DOCSLIB.ORG

"An in Vitro Selection Protocol for Threose Nucleic Acid

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
An In Vitro Selection Protocol for UNIT 9.8 Threose Nucleic Acid (TNA) Using DNA Display Matthew R. Dunn1,3 and John C. Chaput2,3 1School of Life Sciences, Arizona State University, Tempe, Arizona 2Department of Chemistry and Biochemistry, Arizona State University, Tempe, Arizona 3The Biodesign Institute at Arizona State University, Tempe, Arizona ABSTRACT Threose nucleic acid (TNA) is an unnatural genetic polymer composed of repeating threofuranosyl sugars linked by 2 and 3 phosphodiester bonds. TNA is capable of forming antiparallel Watson-Crick duplex structures in a self-pairing mode, and can also cross-pair opposite complementary strands of DNA and RNA. The solution NMR structure of a self-complementary TNA duplex reveals that TNA adopts an A-form helical structure, which explains its ability to exchange genetic information with natural genetic polymers. In a recent advance, a TNA aptamer was evolved from a pool of random sequences using an engineered polymerase that can copy DNA sequences into TNA. This unit details the steps required to evolve functional TNA molecules in the laboratory using a method called DNA display. Using this approach, TNA molecules are physically linked to their encoding double-stranded DNA template. By linking TNA phenotype with DNA genotype, one can select for TNA molecules with a desired function and recover their encoding genetic information by PCR amplification. Each round of selection requires 3 days to complete and multiple rounds of selection and amplification are required to generate functional TNA molecules. Curr. Protoc. Nucleic Acid Chem. 57:9.8.1-9.8.19. C 2014 by John Wiley & Sons, Inc. Keywords: threose nucleic acid (TNA) r oligonucleotide r in vitro selection r DNA display r aptamer INTRODUCTION This unit describes the methodology for selecting protein-binding TNA aptamers using DNA display. This approach utilizes a self-priming, hairpin library to covalently link each TNA molecule to its encoding DNA template strand. The technique itself is general and could be applied to evolve other xenonucleic acid molecules (XNA) as long as the requisite polymerase is available to copy the DNA library into the desired XNA polymer. This approach is particularly useful when an XNA-dependent DNA polymerase is not available to copy the XNA molecules back into DNA for amplification by PCR. The protocols discuss generation of the self-priming hairpin library (see Basic Protocols 1 and 2), transcription of the library into a pool of DNA-displayed TNA molecules (see Basic Protocol 3), separation of protein-binding TNA molecules using capillary electrophoresis (CE)-based selection (see Basic Protocol 4), and amplification of the enriched pool of molecules for a subsequent round of selection (see Basic Protocols 5 and 6). Functional molecules are then identified by DNA sequencing. CE-based selections usually require three to four rounds for functional molecules to dominate the pool with each round requiring 2 to 3 days to complete. Combinatorial Methods in Nucleic Acid Chemistry Current Protocols in Nucleic Acid Chemistry 9.8.1-9.8.19, June 2014 9.8.1 Published online June 2014 in Wiley Online Library (wileyonlinelibrary.com). DOI: 10.1002/0471142700.nc0908s57 Supplement 57 Copyright C 2014 John Wiley & Sons, Inc. BASIC GENERATION OF THE DNA HAIRPIN LIBRARY PROTOCOL 1 The DNA hairpin library is generated by ligating a linear single-stranded DNA library to a synthetic DNA strand that forms a self-complementary hairpin structure (Fig. 9.8.1). The synthetic DNA library is chemically synthesized with fixed-sequence, primer-binding sites flanking each side of the random region. The DNA library can be purchased from a commercial vendor or synthesized in-house using a solid-phase DNA synthesizer (Bradley et al., 2000). The DNA hairpin strand used for primer extension and strand displacement is ligated to the 3 end of the DNA library. This step does not require a DNA splint, since the stem-loop structure is partially complementary to a region of the DNA library. Materials DNA hairpin: 5/Phos/actacgtacccacaacctcggccgtaccacggtacgtagtgacactcgtatgcagtagcc 3 10× T4 DNA ligase buffer Library: 5 TGTCTACACGCAAGCTTACA-N50-GGCTACTGCATACGAGTGTC 3 100,000 U/μL T4 DNA ligase (NEB) 1.5-mL microcentrifuge tube (Eppendorf) 16° and 90°C heating blocks Ligate hairpin to DNA library 1. To a 1.5-mL microcentrifuge tube, add: 40 μL of 100 μM DNA hairpin 100 μLof10× T4 DNA ligase buffer 740 μL of ddH2O. The DNA hairpin requires a 5 phosphate for ligation to the DNA library. The oligonu- cleotide can be chemically phosphorylated during solid-phase oligonucleotide synthesis or enzymatically modified after the synthesis is complete. Enzymatic phosphorylation re- quires incubating the synthetic DNA oligonucleotide with T4 polynucleotide kinase and ATP. It is important to heat denature and anneal the hairpin prior to incubation with the DNA library. 2. Denature and anneal the hairpin by heating tube 5 min on a 90°C heating block and cooling on ice. GGTACGTAGTGACACTCGTATGCAGTAGCC 3Ј CCATGCATCA- P 5Ј 3Ј CTGTGAGCATACGTCATCGG N40 ACATTCGAACGCACATCTGT 5Ј T4 DNA ligase GGTACGTAGTGACACTCGTATGCAGTAGCC 3Ј CCATGCATCACTGTGAGCATACGTCATCGG N40 ACATTCGAACGCACATCTGT 5Ј Figure 9.8.1 Generation of the DNA hairpin library. A 5-phosphorylated hairpin is ligated to the complementary region of the DNA library using T4 DNA ligase. The product of this reaction is the self-priming DNA library used to synthesize the TNA library. 9.8.2 Supplement 57 Current Protocols in Nucleic Acid Chemistry 3. Add the following reagents to the ligation reaction: 20 μL of 100 μMDNALibrary(1 × 1015 unique DNA molecules) 100 μL of T4 DNA ligase. 4. Incubate overnight at 16°C. PURIFICATION OF THE DNA HAIRPIN LIBRARY BASIC The DNA hairpin-library is purified by denaturing polyacrylamide gel electrophoresis PROTOCOL 2 (PAGE), isolated from the gel, and recovered by electroelution and ethanol precipitation. A standard protocol is given here. Materials Acrylamide concentrate (see recipe, also available from National Diagnostics) Acrylamide diluent (see recipe, also available from National Diagnostics) 10× TBE buffer (see recipe) 10% (w/v) ammonium persulfate (APS, EMD Biosciences) N,N,N,N,tetraethylmethylenediamine (TEMED, Pierce) Hairpin template reaction product (see Basic Protocol 1) Urea (Sigma) PAGE running dye (see recipe) 3 M sodium acetate, pH 5.2 (NaOAc, Sigma) Absolute ethanol (Sigma) 70% ethanol, −20°C Gel plates (19.7 × 16– and 19.7 × 18.5–cm) Spacers (1.5-mm thick) Comb (2-well with two marker lanes) 100-mL beaker Magnetic stir bar and stir plate PAGE electrophoresis apparatus 50-mL plastic syringe Power supply 90°C heating block Plastic transfer pipets (pulled capillary) Spatula Plastic wrap UV-active thin-layer chromatography (TLC) plate Handheld UV lamp (254-nm) Black permanent marker Razor blade or scalpel Electroelution apparatus and cassettes Electroelution membranes 1.5-mL microcentrifuge tubes (Eppendorf) Vortex Refrigerated microcentrifuge Spectrophotometer Prepare urea-PAGE gel 1. Prepare the gel plates, spacers, and comb using the manufacturer’s recommended protocol. Combinatorial Purification gels are 1.5-mm thick. Using a comb with one or two wells is recommended. Methods in Nucleic Acid 2. In a 100-mL beaker, combine the following to prepare a 10% urea-PAGE gel: Chemistry 9.8.3 Current Protocols in Nucleic Acid Chemistry Supplement 57 20 mL acrylamide concentrate 25 mL acrylamide diluent 5mLof10× TBE. 3. Stir the mixture using a magnetic stir bar and magnetic stir plate until the solution is homogeneous. 4. Add 400 μL of 10% APS and 20 μL TEMED to the solution and stir for 30 sec. 5. Carefully pour the acrylamide solution into the prepared gel plates, ensuring that there are no leaks or air bubbles present between the plates. 6. Insert the comb at the top of the gel and dislodge any air bubbles by tapping on the glass. 7. Allow the solution to polymerize between the glass plates (typically 30 min). Pre-run urea-PAGE gel 8. Carefully remove the comb and bottom spacer from the gel plates making sure not to damage the gel. 9. Rinse the gel with tap water to remove excess acrylamide or urea that may form on the outside of the glass plates. 10. Place the gel plates into the gel electrophoresis apparatus and secure the plates as suggested by the manufacturer. 11. Fill the bottom reservoir of the gel apparatus with 1× TBE buffer. Displace air bubbles that form in the bottom spacer region using a syringe containing 1× TBE buffer. 12. Fill the top reservoir of the electrophoresis apparatus with 1× TBE buffer until the solution is 1 cm above the gel. 13. Rinse the top well with 1× TBE buffer to remove any residual polyacrylamide. 14. Connect the apparatus to the power supply and pre-run the gel for 30 min at a constant power of 20 W. The ideal wattage for the gel will heat the glass plates so they are warm to the touch. Temperatures greater than 70°C can cause the glass to break. 15. While the gel is pre-running, prepare the DNA sample by adding 50% (w/v) urea and denature the sample by heating for 5 min at 90°C. Load and run the urea-PAGE gel 16. Once the gel has finished pre-running, disconnect the gel apparatus from the power supply and rinse the wells with 1× TBE to remove any residual urea. Rinsing the wells prior to sample loading helps to visualize the sample as it is being loaded into the wells. The sample can also be mixed with dye to aid in visualization. 17. Load the sample into the well using a pulled plastic transfer pipet or micropipet equipped with gel loading tips. 18. Load 5 μL PAGE running dye into a small well on the side of the gel. An In Vitro 19. Reconnect the gel apparatus to the power supply and run the gel for 1.5 hr at a Selection Protocol constant power of 20 W.
Load more

Recommended publications
  • (12) Patent Application Publication (10) Pub. No.: US 2013/0203610 A1 Meller Et Al
    US 20130203610A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2013/0203610 A1 Meller et al. (43) Pub. Date: Aug. 8, 2013 (54) TOOLS AND METHOD FOR NANOPORES Related U.S. Application Data UNZIPPING-DEPENDENT NUCLECACID (60) Provisional application No. 61/318,872, filed on Mar. SEQUENCING 30, 2010. (75) Inventors: Amit Meller, Brookline, MA (US); Alon Publication Classification Singer, Brighton, MA (US) (51) Int. Cl. (73) Assignee: TRUSTEES OF BOSTON CI2O I/68 (2006.01) UNIVERSITY, Boston, MA (US) (52) U.S. Cl. CPC .................................... CI2O I/6874 (2013.01) (21) Appl. No.: 13/638,455 USPC ................................................. 506/6:506/16 (57) ABSTRACT (22) PCT Filed: Mar. 30, 2011 Provided herein is a library that comprises a plurality of molecular beacons (MBs), each MB having a detectable (86). PCT No.: PCT/US2O11AO3O430 label, a detectable label blocker and a modifier group. The S371 (c)(1), library is used in conjunction with nanopore unzipping-de (2), (4) Date: Apr. 17, 2013 pendent sequencing of nucleic acids. Patent Application Publication Aug. 8, 2013 Sheet 1 of 18 US 2013/020361.0 A1 . N s Patent Application Publication Aug. 8, 2013 Sheet 2 of 18 US 2013/020361.0 A1 I’9IAI ::::::::::: Dº3.modoueN Patent Application Publication Aug. 8, 2013 Sheet 3 of 18 US 2013/020361.0 A1 Z’9IAI ~~~~~~~~~);........ Patent Application Publication Aug. 8, 2013 Sheet 4 of 18 US 2013/020361.0 A1 s :·.{-zzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzz iii. 9 iii.338 lii &S Patent Application Publication Aug. 8, 2013 Sheet 5 of 18 US 2013/020361.0 A1 s r Patent Application Publication Aug.
    [Show full text]
  • Alternative Biochemistries for Alien Life: Basic Concepts and Requirements for the Design of a Robust Biocontainment System in Genetic Isolation
    G C A T T A C G G C A T genes Review Alternative Biochemistries for Alien Life: Basic Concepts and Requirements for the Design of a Robust Biocontainment System in Genetic Isolation Christian Diwo 1 and Nediljko Budisa 1,2,* 1 Institut für Chemie, Technische Universität Berlin Müller-Breslau-Straße 10, 10623 Berlin, Germany; [email protected] 2 Department of Chemistry, University of Manitoba, 144 Dysart Rd, 360 Parker Building, Winnipeg, MB R3T 2N2, Canada * Correspondence: [email protected] or [email protected]; Tel.: +49-30-314-28821 or +1-204-474-9178 Received: 27 November 2018; Accepted: 21 December 2018; Published: 28 December 2018 Abstract: The universal genetic code, which is the foundation of cellular organization for almost all organisms, has fostered the exchange of genetic information from very different paths of evolution. The result of this communication network of potentially beneficial traits can be observed as modern biodiversity. Today, the genetic modification techniques of synthetic biology allow for the design of specialized organisms and their employment as tools, creating an artificial biodiversity based on the same universal genetic code. As there is no natural barrier towards the proliferation of genetic information which confers an advantage for a certain species, the naturally evolved genetic pool could be irreversibly altered if modified genetic information is exchanged. We argue that an alien genetic code which is incompatible with nature is likely to assure the inhibition of all mechanisms of genetic information transfer in an open environment. The two conceivable routes to synthetic life are either de novo cellular design or the successive alienation of a complex biological organism through laboratory evolution.
    [Show full text]
  • Threose Nucleic Acid
    2/23/11! Something else…! •" Neither the chicken nor the egg came first! Alternative Ideas! •" Transitional forms that were later discarded! Or was it the “egkin”?! Some experiments with peptide nucleic acid! Threose Nucleic Acid (TNA)! (PNA).! PNA: Peptide backbone with bases! •" Threose is one of two sugars with a four- sided ring! Can act as template for polymerization of RNA! •" Fewer issues with incorrect linkages, From activated nucleotides! selection of correct handedness! (Böhler, et al., Nature, 376, 578! •" Replace ribose sugar in RNA with threose! & comments by Piccirilli, pg. 548 17 Aug. 1995! •" Can base pair with RNA! •" Could have preceded RNA! PNA could be simpler to form under prebiotic conditions! Main point is that a simpler thing (not necessarily PNA) ! could have preceded RNA! 1! 2/23/11! Focus on Energy! Membranes! G. Wächtershäuser! Inorganic - organic connection! •" Membranes provide enclosure! FeS2 ! (Iron pyrite)! –"Also fundamental for metabolism! Attracts negatively charged molecules ! •" Membranes never arise from scratch! Surface catalysis provides energy via formation from! –"Always passed down and added to! FeS + H2S! –"All derived from ancestral cell! •" T. Cavalier-Smith proposes membranes! Scene is hot sulfur vents on sea floor! –"Plus nucleic acid formed “ob-cell”! Some successes in simulations! Amino acids formed peptide bonds! –"Merger of 2 ob-cells formed first cell! Thioester World! H O 1." Need precursor to RNA world! H H S H O Thioester! S C. de Duve! C C O 2. !Need energy conversion! In Vital Dust! O !Protometabolism! Thiol + Carboxyl! Background:! H O H H O H O Ester! O Thiols involved in metabolism, particularly in ancient ! C C pathways! O O Hydroxyl + Carboxyl! Also can catalyze ester formation by group transfer! Reactions! e.g.
    [Show full text]
  • Darwinian Evolution of an Alternative Genetic System Provides Support for TNA As an RNA Progenitor Hanyang Yu†,Suzhang† and John C
    ARTICLES PUBLISHED ONLINE: 10 JANUARY 2012 | DOI: 10.1038/NCHEM.1241 Darwinian evolution of an alternative genetic system provides support for TNA as an RNA progenitor Hanyang Yu†,SuZhang† and John C. Chaput* The pre-RNA world hypothesis postulates that RNA was preceded in the evolution of life by a simpler genetic material, but it is not known if such systems can fold into structures capable of eliciting a desired function. Presumably, whatever chemistry gave rise to RNA would have produced other RNA analogues, some of which may have preceded or competed directly with RNA. Threose nucleic acid (TNA), a potentially natural derivative of RNA, has received considerable interest as a possible RNA progenitor due to its chemical simplicity and ability to exchange genetic information with itself and RNA. Here, we have applied Darwinian evolution methods to evolve, in vitro, a TNA receptor that binds to an arbitrary target with high affinity and specificity. This demonstration shows that TNA has the ability to fold into tertiary structures with sophisticated chemical functions, which provides evidence that TNA could have served as an ancestral genetic system during an early stage of life. he question of why nature chose ribofuranosyl nucleic acids as like DNA and RNA, can fold into structures with complicated func- the molecular basis of life’s genetic material has prompted a tions—a prerequisite for any RNA progenitor in a hypothetical Tsystematic analysis of nucleic acid structure with regard to pre-RNA world. the chemical etiology of RNA1. Results from these studies reveal that several potentially natural RNA alternatives are capable of Results and discussion Watson–Crick base pairing, demonstrating the capacity for these The discovery by Eschenmoser and colleagues that TNA can molecules to store genetic information.
    [Show full text]
  • 12.12.2017 1 CHAPTER 1 OLIGONUCLEOTIDES Part 2
    12.12.2017 Canonical nucleobase pairing and alternative base pairs CHAPTER 1 OLIGONUCLEOTIDES Part 2 – noncanonical nucleobases Natural and non-natural base pairs that function in polymerase reactions Self-assembly of whole genes and DNA nanostructures The technology tested by assembly of the kanamycin-resistance gene and growing the bacteria in the environment containing kanamycin after assembly and conversion of that gene. S. Benner et al., Beilstein J. Org. Chem. 2014, 10, 2348–2360. doi:10.3762/bjoc.10.245 1 12.12.2017 AEGIS – Artificially Expanded Genetic Information System AEGIS – Artificially Expanded Genetic Information System ZP CG S. Benner et al., Beilstein J. Org. Chem. 2014, 10, 2348–2360. doi:10.3762/bjoc.10.245 S. Benner et al., J. Am. Chem. Soc., 2011 , 133 (38), pp 15105–15112 AEGIS – Permanent orthogonal nucleobases surviving PCR ACGTZP-DNA crystal structures Electron density presented to the minor groove recognition site by polymerases „ minor groove scanning hypothesis” Error rate 0,2% per a PCR cycle – both removal and incorporation of Z and P the artificial genetic system capable to evolve. Pol: Deep Vent – 2 Z/P, Taq/Phu – 3-4 Z/P 18-mers: 2+2 Z:P pairs B-DNA dZTP ( deprotonated ) at higher pH pairs slightly with G 6 consecutive Z:P A-DNA loss of some Z, but also gain of some new Z mutants. 0,1 nm wider, but otherwise alike G:C pairs S. Benner et al., J. Am. Chem. Soc., 2011 , 133 (38), pp 15105–15112 S. Benner et al., J. Am. Chem. Soc., 2015, 137, pp 6947–6955 2 12.12.2017 Unnatural aminoacid incorporation using a noncanonical base pair (A) The coupled transcription–translation system using the nonstandard codon– anticodon interaction for the site-specific incorporation of 3-chlorotyrosine into the Ras protein.
    [Show full text]
  • DNA Before Proteins? Recent Discoveries in Nucleic Acid Catalysis Strengthen the Case
    Portland State University PDXScholar Chemistry Faculty Publications and Presentations Chemistry 1-2009 DNA Before Proteins? Recent Discoveries in Nucleic Acid Catalysis Strengthen the Case Aaron Steven Burton Portland State University Niles Lehman Portland State University Follow this and additional works at: https://pdxscholar.library.pdx.edu/chem_fac Part of the Biology Commons, and the Genetics Commons Let us know how access to this document benefits ou.y Citation Details Burton, A.S.; Lehman, N. (2009). DNA before proteins? Recent discoveries in nucleic acid catalysis strengthen the case. Astrobiology 9:125-130. This Article is brought to you for free and open access. It has been accepted for inclusion in Chemistry Faculty Publications and Presentations by an authorized administrator of PDXScholar. Please contact us if we can make this document more accessible: [email protected]. ASTROBIOLOGY Volume 9, Number 1, 2009 © Mary Ann Liebert, Inc. DOI: 10.1089/ast.2008.0240 Hypothesis Paper DNA Before Proteins? Recent Discoveries in Nucleic Acid Catalysis Strengthen the Case Aaron S. Burton and Niles Lehman Abstract An RNA-DNA World could arise from an all-RNA system with the development of as few as three ribozymes— a DNA-dependent RNA polymerase, an RNA-dependent DNA polymerase, and a catalyst for the production of DNA nucleotides. A significant objection to DNA preceding proteins is that RNA has not been shown to cat- alyze the production of DNA. However, RNA- and DNAzymes have been recently discovered that catalyze chemical reactions capable of forming deoxyribose, such as mixed aldol condensation of 5’-glyceryl- and 3’- glycoaldehyde-terminated DNA strands.
    [Show full text]
  • Evaluating TNA Stability Under Simulated Physiological Conditions
    Bioorganic & Medicinal Chemistry Letters 26 (2016) 2418–2421 Contents lists available at ScienceDirect Bioorganic & Medicinal Chemistry Letters journal homepage: www.elsevier.com/locate/bmcl Evaluating TNA stability under simulated physiological conditions Michelle C. Culbertson a, Kartik W. Temburnikar a, Sujay P. Sau a,c, Jen-Yu Liao a,c, Saikat Bala a,c, ⇑ John C. Chaput a,b,c, a Biodesign Institute, Arizona State University, Tempe, AZ 85287-5301, USA b Department of Chemistry and Biochemistry, Arizona State University, Tempe, AZ 85287-5301, USA c Department of Pharmaceutical Sciences, University of California, Irvine, CA 92697-3958, USA article info abstract Article history: Chemically modified oligonucleotides are routinely used as diagnostic and therapeutic agents due to their Received 12 March 2016 enhanced biological stability relative to natural DNA and RNA. Here, we examine the biological stability Revised 30 March 2016 of a-L-threofuranosyl nucleic acid (TNA), an artificial genetic polymer composed of repeating units of Accepted 31 March 2016 0 0 a-L-threofuranosyl sugars linked by 2 ,3 -phosphodiester bonds. We show that TNA remains undigested Available online 1 April 2016 after 7 days of incubation in the presence of either 50% human serum or human liver microsomes and is stable against snake venom phosphordiesterase (a highly active 30 exonuclease). We further show that Keywords: TNA will protect internal DNA residues from nuclease digestion and shield complementary RNA strands Threose nucleic acid from RNA degrading enzymes. Together, these results demonstrate that TNA is an RNA analogue with Biological stability RNA analogue high biological stability. Ó 2016 Elsevier Ltd. All rights reserved.
    [Show full text]
  • Theranostics Molecular Beacons of Xeno-Nucleic Acid for Detecting
    Theranostics 2013, Vol. 3, Issue 6 395 Ivyspring International Publisher Theranostics 2013; 3(6):395-408. doi: 10.7150/thno.5935 Review Molecular Beacons of Xeno-Nucleic Acid for Detecting Nucleic Acid Qi Wang2, Lei Chen1, Yitao Long1, He Tian1 and Junchen Wu1, 1. Key Lab for Advanced Materials and Institute of Fine Chemicals, East China University of Science and Technology, China. 2. College of Public Health, Nantong University, China. Corresponding author: Junchen Wu, Meilong 130, Shanghai 200237, China. Telephone: (+86) 21-6425-3674, fax: (+86) 21-6425-2258, E-mail: [email protected]. © Ivyspring International Publisher. This is an open-access article distributed under the terms of the Creative Commons License (http://creativecommons.org/ licenses/by-nc-nd/3.0/). Reproduction is permitted for personal, noncommercial use, provided that the article is in whole, unmodified, and properly cited. Received: 2013.01.23; Accepted: 2013.04.10; Published: 2013.05.05 Abstract Molecular beacons (MBs) of DNA and RNA have aroused increasing interest because they allow a continuous readout, excellent spatial and temporal resolution to observe in real time. This kind of dual-labeled oligonucleotide probes can differentiate between bound and unbound DNA/RNA in homogenous hybridization with a high signal-to-background ratio in living cells. This review briefly summarizes the different unnatural sugar backbones of oligonucleotides combined with fluoro- phores that have been employed to sense DNA/RNA. With different probes, we epitomize the fundamental understanding of driving forces and these recognition processes. Moreover, we will introduce a few novel and attractive emerging applications and discuss their advantages and dis- advantages.
    [Show full text]
  • Modeling Prebiotic Catalysis with Nucleic Acid-Like Polymers and Its Implications for the Proposed RNA World*
    Pure Appl. Chem., Vol. 76, No. 12, pp. 2085–2099, 2004. © 2004 IUPAC Modeling prebiotic catalysis with nucleic acid-like polymers and its implications for the proposed RNA world* S. G. Srivatsan‡ Department of Chemistry, Indian Institute of Technology-Kanpur, Kanpur-208016 (UP), India Abstract: The theory that RNA molecules played a pivotal role in the early evolution of life is now widely accepted. Studies related to this hypothetical “RNA world” include three major areas: the formation of precursors for the first RNA molecules, the polymerization process, and the potential of RNA to catalyze chemical and biochemical reactions. Several chemical and biochemical studies performed under simulated prebiotic conditions support the role of RNA as both genetic as well as catalytic material. However, owing to the lack of credible mechanism for de novo nucleic acid synthesis and the hydrolytic instability of RNA mole- cules, there has been some serious discussion of whether biopolymers that closely resembled nucleic acid preceded the “RNA world”. In this context, an overview of prebiotic chemistry, the role of mineral surface, and the significance of studies related to RNA-like polymers in the origin of life are presented here. INTRODUCTION Though life that exists today and in the geological record is based on DNA genomes and protein en- zymes, there is convincing evidence that hypothesizes the origin of life based on RNA [1]. This hypo- thetical primordial era is referred to as the “RNA world” [2]. The “RNA world” hypothesis assumes that all modern organisms are descendants of a prebiotic self-replicating moiety, which utilized RNA as both genetic as well as catalytic material.
    [Show full text]
  • Amplification of RNA by an RNA Polymerase Ribozyme David P
    XVIIIth Intl Conf on Origin of Life 2017 (LPI Contrib. No. 1967) 4024.pdf July 16-21, 2017 at UC San Diego, CA, USA Amplification of RNA by an RNA Polymerase Ribozyme David P. Horning1 and Gerald F. Joyce1 1Jack H. Skirball Center for Chemical Biology and Proteomics, The Salk Institute, La Jolla, CA 92037 * [email protected] Introduction: In all extant life, genetic information is stored in nucleic acids that are repli- cated by polymerase proteins. In the hypothesized RNA world, prior to the evolution of genet- ically-encoded proteins, ancestral organisms contained RNA genes that were replicated by an RNA polymerase ribozyme [1,2]. In an effort toward reconstructing RNA-based life in the labor- atory, in vitro evolution was used to improve dramatically the activity and generality of an RNA polymerase ribozyme by selecting variants that can synthesize functional RNA molecules from an RNA template [3]. The improved polymerase ribozyme (fig. 1A) is able to synthesize a varie- ty of complex structured RNAs, including aptamers, ribozymes, and, in low yield, even tRNA. The polymerase can also transcribe, with more modest activity, template RNA into nucleic acid analogs, including threose nucleic acid (TNA). Furthermore, the polymerase can replicate nucle- ic acids, amplifying short RNA templates by more than 10,000-fold in an RNA-catalyzed form of the polymerase chain reaction (riboPCR, fig. 1B). Thus the two prerequisites of Darwinian life — the replication of genetic information and its conversion into functional molecules — can now be accomplished with RNA in the complete absence of proteins. Currently, polymerases are un- dergoing in vitro evolution to synthesize complete functional ribozymes within minutes, with the aim of achieving fully autonomous RNA replication of the polymerase itself and other ribozymes of similar complexity.
    [Show full text]
  • Evolution of Functional Nucleic Acids in the Presence of Nonheritable Backbone Heterogeneity
    Evolution of functional nucleic acids in the presence of nonheritable backbone heterogeneity Simon G. Trevinoa, Na Zhanga, Mark P. Elenkoa, Andrej Luptákb, and Jack W. Szostaka,1 aHoward Hughes Medical Institute, Center for Computational and Integrative Biology, and Department of Molecular Biology, Simches Research Center, Massachusetts General Hospital, Boston, MA 02144; and bDepartments of Pharmaceutical Sciences, Chemistry and Molecular Biology and Biochemistry, University of California, Irvine, CA 92697 Edited by Dinshaw J. Patel, Memorial Sloan-Kettering Cancer Center, New York, NY, and approved July 11, 2011 (received for review May 4, 2011) Multiple lines of evidence support the hypothesis that the early manner, from mixtures of chemically diverse monomer building evolution of life was dominated by RNA, which can both transfer blocks. information from generation to generation through replication Any genetic polymer capable of Darwinian evolution must directed by base-pairing, and carry out biochemical activities by be able to replicate and must be able to encode useful functions. folding into functional structures. To understand how life emerged Of these two properties, replication is probably more tolerant of from prebiotic chemistry we must therefore explain the steps that structural heterogeneity in the sugar-phosphate backbone of a led to the emergence of the RNA world, and in particular, the synth- nucleic acid, because the key to information transfer during esis of RNA. The generation of pools of highly pure ribonucleotides replication is the complementarity of the nucleobases, which on the early Earth seems unlikely, but the presence of alternative act as molecular recognition modules that are largely indepen- nucleotides would support the assembly of nucleic acid polymers dent of the backbone structure (8, 9).
    [Show full text]
  • Front Matter Template
    Copyright by Matthew Levy 2003 Design and Evolution of Functional Nucleic Acids by Matthew Levy, B.S., M.S. Dissertation Presented to the Faculty of the Graduate School of The University of Texas at Austin in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy The University of Texas at Austin May, 2003 For Harry, my mother and my father. Dad, now I, too, have advanced graduate degrees. Acknowledgements I would like to thank Andy and all of the members of the Ellington lab, past and present. In particular, I’d like to thank Michael Robertson, who not only first helped show me how to do science in Stanley Miller’s lab, but helped me learn molecular biology in Andy’s lab. I would also like to thank Amos Yan, Jay “Buddy” Hesselberth, Scott Knudsen, Colin “Bunny” Cox, Jeff Tabor and Kristin Thompson for all of their help and fruitful scientific conversations. In addition, I’d like to thank Dr. Kenneth A. Johnson for his assistance with kinetics. Also, a special thanks to Stanley L. Miller for first teaching me how to do research in his lab and sparking my interest in origins research. Finally, I’d like to thank all of my friends in Texas, San Diego and New York, as well as my family, especially my mother Judy, father Walter, brother Alex, stepmother Gene, stepsisters Kate and Kristie (Matt and Emma, too) and stepfather Harvey, for all of their love and support over the years. v Design and Evolution of Functional Nucleic Acids Publication No._____________ Matthew Levy, Ph.
    [Show full text]