DOCSLIB.ORG

WDR11, a WD Protein That Interacts with Transcription Factor EMX1, Is Mutated in Idiopathic Hypogonadotropic Hypogonadism and Kallmann Syndrome

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
WDR11, a WD Protein That Interacts with Transcription Factor EMX1, Is Mutated in Idiopathic Hypogonadotropic Hypogonadism and Kallmann Syndrome View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector ARTICLE WDR11, a WD Protein that Interacts with Transcription Factor EMX1, Is Mutated in Idiopathic Hypogonadotropic Hypogonadism and Kallmann Syndrome Hyung-Goo Kim,1,4,15,* Jang-Won Ahn,2 Ingo Kurth,3,16 Reinhard Ullmann,4 Hyun-Taek Kim,5 Anita Kulharya,6 Kyung-Soo Ha,7 Yasuhide Itokawa,8 Irene Meliciani,9 Wolfgang Wenzel,9 Deresa Lee,2 Georg Rosenberger,3 Metin Ozata,10 David P. Bick,11 Richard J. Sherins,12 Takahiro Nagase,8 Mustafa Tekin,13,17 Soo-Hyun Kim,14 Cheol-Hee Kim,5 Hans-Hilger Ropers,4 James F. Gusella,15 Vera Kalscheuer,4 Cheol Yong Choi,2 and Lawrence C. Layman1,* By defining the chromosomal breakpoint of a balanced t(10;12) translocation from a subject with Kallmann syndrome and scanning genes in its vicinity in unrelated hypogonadal subjects, we have identified WDR11 as a gene involved in human puberty. We found six patients with a total of five different heterozygous WDR11 missense mutations, including three alterations (A435T, R448Q, and H690Q) in WD domains important for b propeller formation and protein-protein interaction. In addition, we discovered that WDR11 interacts with EMX1, a homeodomain transcription factor involved in the development of olfactory neurons, and that missense alterations reduce or abolish this interaction. Our findings suggest that impaired pubertal development in these patients results from a deficiency of productive WDR11 protein interaction. Introduction have used a variety of strategies to find IHH- and/or KS- causing mutations in a number of genes. Such strategies Human puberty is a dynamic process that initiates have included linkage analysis, deletion mapping, and complex interactions of the hypothalamic-pituitary- candidate gene analysis. The discovery of a rare family gonadal axis, the purpose of which is to produce sex with males displaying both X-linked KS and ichthyosis steroids for reproductive maturity and gametes for fertility. led to the identification of KAL1 (MIM 308700) by posi- Any disruption of the development or regulation of this tional cloning,2,3 and characterization of deletions4 system, for which the hypothalamus serves as the master and a balanced translocation5 involving chromosome 8 regulator through its pulsatile release of gonadotropin- facilitated the cloning of FGFR1 (KAL2, MIM 136350), releasing hormone (GnRH), can produce deleterious associated with both IHH and KS.6 Positional cloning in consequences for successful reproduction.1 Patients with consanguineous autosomal-recessive IHH families revealed idiopathic hypogonadotropic hypogonadism (IHH, MIM KISS1R (MIM 604161) encoding GPR54,7,8 TAC39 (MIM 146110) show clinical signs and symptoms of GnRH defi- 162330), and TACR39 (MIM 162332) and candidate-gene ciency: delayed puberty due to low sex steroid production approaches identified mutations in GNRHR10,11 (MIM along with low levels of serum gonadotropins. Patients 138850), NELF12 (MIM 608137), CHD7(KAL5)13 (MIM with Kallmann syndrome (KS, MIM 308700, 147950, 608892), FGF8 (KAL6)14 (MIM 600483), and GNRH115,16 244200, 610628, 612370, 612702) have IHH but also (MIM 152760); analogous mouse phenotypes pointed to display an impaired sense of smell, thought to be due to PROKR2 (KAL3)17 (MIM 607123), and PROK2 (KAL4)17 the developmental failure of the migration of GnRH (MIM 607002), as well as KISS1R.8 Despite these significant neurons along the olfactory axonal projections. advances in the past two decades, however, the genetic IHH/KS is one of the most common causes of hypogo- etiology remains unknown for about two-thirds of all nadism and is genetically heterogeneous. Researchers IHH and KS patients. 1Section of Reproductive Endocrinology, Infertility, and Genetics, Department of Obstetrics and Gynecology; Reproductive Medicine and Developmental Neurobiology Programs in the Institute of Molecular Medicine and Genetics; and Neuroscience Program, Medical College of Georgia, 1120 15th Street, Augusta, Georgia 30912, USA; 2Department of Biological Science, Sungkyunkwan University, Suwon 440-746, Korea; 3Institut fu¨r Humangenetik, Univer- sita¨tsklinikum Hamburg-Eppendorf, Martinistrasse 52, Hamburg 20246, Germany; 4Department of Human Molecular Genetics, Max Planck Institute for Molecular Genetics, Ihnestrasse 63-73, Berlin 14195, Germany; 5Department of Biology and Graduate School of Analytical Science and Technolgy, Chung- nam National University, Daejeon 305-764, Korea; 6Departments of Pediatrics and Pathology, Medical College of Georgia, 1120 15th Street, Augusta, Georgia 30912, USA; 7Medical College of Georgia Cancer Center, Augusta, Georgia, 30912 USA; 8Department of Human Genome Research, Kazusa DNA Research Institute, 2-6-7 Kazusa-Kamatari, Kisarazu, Chiba 292-0818, Japan; 9Forschungszentrum Karlsruhe, Institute for Nanotechnology, PO Box 3640, Karlsruhe, 76021 Germany; 10Gulhane Military Medical Academy, Haydarpasa Training Hospital, Department of Endocrinology, Istanbul, 34660 Turkey; 11Division of Medical Genetics, Departments of Pediatrics and Obstetrics and Gynecology, Medical College of Wisconsin, Milwaukee, Wisconsin 53226, USA; 12Director of Andrology, Columbia Fertility Associates, Washington, DC 20037, USA; 13Dr. John T. Macdonald Foundation Department of Human Genetics, Miller School of Medicine, University of Miami, Miami, Florida 33156, USA; 14Division of Basic Medical Sciences, St. George’s Medical School, University of London, London SW17 0RE United Kingdom; 15Center for Human Genetic Research, Massachusetts General Hospital and Depart- ment of Genetics, Harvard Medical School, Boston, Massachusetts 02114, USA; 16Jena University Hospital, Institute of Human Genetics, Jena 07743 Germany; 17Division of Pediatric Genetics, Ankara University School of Medicine, Ankara 06610, Turkey *Correspondence: [email protected] (H.-G.K.), [email protected] (L.C.L.) DOI 10.1016/j.ajhg.2010.08.018. Ó2010 by The American Society of Human Genetics. All rights reserved. The American Journal of Human Genetics 87, 465–479, October 8, 2010 465 A t (10; 12) (q26.12; q13.11) Figure 1. Balanced Chromosome Translocation and FISH Mapping of the Chromosome 10 Break- point (A) Ideogram and composite chromosomes illus- 12q13.11 trating the balanced t(10;12)(q26.12;q13.11)dn (revised in this paper from the original karyotypic assessment, t(10;12)(q26.3;q13.1)dn) in the KS 12 der(12) patient. 10q26.12 (B) FISH mapping with BAC clone RP11-254K03, labeled with SpectrumGreen to metaphase spreads 12 der(12) 10 der(10) of the KS patient, resulted in hybridization to the normal chromosome 10, as well as the der(10) and der(12) chromosomes, indicating that the transloca- tion breakpoint of chromosome 10 is located within 10 der(10) the sequence of this BAC clone. B 300–1100 ng/dl), and low or normal serum gonado- tropins. In females, IHH was defined as primary amenorrhea, nearly always with absent breast development at R17 years of age and low estradiol (<30 pg/ml).18,28 All patients had normal pituitary function, including normal thyroid-stimulating hormone, thyroxin, cortisol, and prolactin. No pitu- itary tumor was present by radiographic imaging. Complete IHH or KS is a more severe phenotype defined as the complete lack of puberty with absent breast development (Tanner 1) in females and testis size %3 ml bilaterally in males. Incomplete IHH or KS was defined as partial breast development in females and testis size R 4 ml bilaterally in males.18 Olfaction was either tested with the University of Pennyslvania Smell Identification Test when avail- To identify chromosomal rearrangements in IHH and KS able or documented by history. Lymphoblastoid cell lines were as a basis for disease gene identification, we previously kar- generated from patients, and DNA, RNA, and/or protein was 18 yotyped 76 patients and found one male KS patient with extracted by standard methods as described previously. All chromosome translocation reported as: 46,XY, t(10;12) patients signed an informed consent approved by the Human (q26.3;q13.1)dn (Figure 1A).18 The chromosome 10q26 Assurance Committee of the Medical College of Georgia. region has been associated previously with abnormal male genital development resulting from interstitial or Tissue Culture and Lymphoblastoid Cell Lines terminal deletions as well as a balanced translocation. Epstein-Barr-virus-immortalized lymphoblastoid cell lines used in Abnormal development has included cryptorchidism,19,20 this study were established from peripheral blood lymphocytes of individuals. Once established, these cell lines were cultured small testes,21 sperm defects and infertility,22 micropenis in RPMI 1640 (Mediatech) supplemented with 10% FCS, 2 mM and hypogonadism,23 hypogenitalism,24 and sparse sexual 25 L-glutamine, and 0.017 mg/ml benzylpenicillin (CLS) and grown hair. All of these phenotypic features overlap with char- at 37 C with 5% CO2. acteristics of IHH and KS. Importantly, a trisomy involving 10q26 has been reported in a KS patient with an unbal- 26 SNP Oligonucleotide Microarray Analysis anced chromosome translocation, suggesting the pres- The Affymetrix Human Mapping 500K Array Set (Affymetrix, ence of a new KS gene, which can involve dysregulation Santa Clara, CA) is comprised of two arrays, each capable of geno- as a result of either reduced or increased dosage, in this crit- typing on average 250,000 SNPs (approximately 262,000 for the ical region. Therefore, we postulated that a single disease Nsp arrays and
Load more

Recommended publications
  • SEC23IP (NM 007190) Human Recombinant Protein – TP309056
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for TP309056 SEC23IP (NM_007190) Human Recombinant Protein Product data: Product Type: Recombinant Proteins Description: Recombinant protein of human SEC23 interacting protein (SEC23IP) Species: Human Expression Host: HEK293T Tag: C-Myc/DDK Predicted MW: 110.9 kDa Concentration: >50 ug/mL as determined by microplate BCA method Purity: > 80% as determined by SDS-PAGE and Coomassie blue staining Buffer: 25 mM Tris.HCl, pH 7.3, 100 mM glycine, 10% glycerol Preparation: Recombinant protein was captured through anti-DDK affinity column followed by conventional chromatography steps. Storage: Store at -80°C. Stability: Stable for 12 months from the date of receipt of the product under proper storage and handling conditions. Avoid repeated freeze-thaw cycles. RefSeq: NP_009121 Locus ID: 11196 UniProt ID: Q9Y6Y8 RefSeq Size: 7306 Cytogenetics: 10q26.11-q26.12 RefSeq ORF: 3000 Synonyms: iPLA1beta; MSTP053; P125; P125A Summary: This gene encodes a member of the phosphatidic acid preferring-phospholipase A1 family. The encoded protein is localized to endoplasmic reticulum exit sites and plays a critical role in ER-Golgi transport as part of the multimeric coat protein II complex. An orthologous gene in frogs is required for normal neural crest cell development, suggesting that this gene may play a role in Waardenburg syndrome neural crest defects. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Feb 2011] This product is to be used for laboratory only.
    [Show full text]
  • Genetic Variant in 3' Untranslated Region of the Mouse Pycard Gene
    bioRxiv preprint doi: https://doi.org/10.1101/2021.03.26.437184; this version posted March 26, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. 1 2 3 Title: 4 Genetic Variant in 3’ Untranslated Region of the Mouse Pycard Gene Regulates Inflammasome 5 Activity 6 Running Title: 7 3’UTR SNP in Pycard regulates inflammasome activity 8 Authors: 9 Brian Ritchey1*, Qimin Hai1*, Juying Han1, John Barnard2, Jonathan D. Smith1,3 10 1Department of Cardiovascular & Metabolic Sciences, Lerner Research Institute, Cleveland Clinic, 11 Cleveland, OH 44195 12 2Department of Quantitative Health Sciences, Lerner Research Institute, Cleveland Clinic, Cleveland, OH 13 44195 14 3Department of Molecular Medicine, Cleveland Clinic Lerner College of Medicine of Case Western 15 Reserve University, Cleveland, OH 44195 16 *, These authors contributed equally to this study. 17 Address correspondence to Jonathan D. Smith: email [email protected]; ORCID ID 0000-0002-0415-386X; 18 mailing address: Cleveland Clinic, Box NC-10, 9500 Euclid Avenue, Cleveland, OH 44195, USA. 19 1 bioRxiv preprint doi: https://doi.org/10.1101/2021.03.26.437184; this version posted March 26, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. 20 Abstract 21 Quantitative trait locus mapping for interleukin-1 release after inflammasome priming and activation 22 was performed on bone marrow-derived macrophages (BMDM) from an AKRxDBA/2 strain intercross.
    [Show full text]
  • TITLE PAGE Oxidative Stress and Response to Thymidylate Synthase
    Downloaded from molpharm.aspetjournals.org at ASPET Journals on October 2, 2021 -Targeted -Targeted 1 , University of of , University SC K.W.B., South Columbia, (U.O., Carolina, This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted.
    [Show full text]
  • SEC23IP (NM 007190) Human Tagged ORF Clone – RG209056
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RG209056 SEC23IP (NM_007190) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: SEC23IP (NM_007190) Human Tagged ORF Clone Tag: TurboGFP Symbol: SEC23IP Synonyms: iPLA1beta; MSTP053; P125; P125A Vector: pCMV6-AC-GFP (PS100010) E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 4 SEC23IP (NM_007190) Human Tagged ORF Clone – RG209056 ORF Nucleotide >RG209056 representing NM_007190 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCCGAGAGAAAACCTAACGGTGGCAGCGGCGGCGCCTCCACTTCCTCATCGGGCACTAACTTACTTT TCTCCTCCTCGGCCACGGAGTTCAGCTTCAATGTGCCCTTCATCCCAGTCACCCAGGCCTCCGCTTCTCC GGCCTCCCTGCTCTTACCGGGAGAGGATTCCACAGATGTTGGTGAGGAGGACAGCTTCCTTGGTCAGACT TCTATTCACACATCTGCCCCACAGACATTTAGTTACTTCTCTCAGGTATCAAGCAGCAGTGATCCTTTTG GGAATATTGGACAGTCACCATTAACAACTGCAGCAACCTCAGTTGGACAATCAGGATTCCCCAAGCCCCT GACTGCTCTCCCTTTTACAACTGGATCCCAAGATGTCTCGAATGCATTTTCACCATCCATTTCGAAGGCT CAACCTGGTGCTCCACCTTCCTCACTGATGGGAATAAATTCTTATCTGCCTTCTCAGCCAAGTAGTCTCC CTCCTTCATATTTTGGGAACCAACCCCAAGGAATTCCCCAACCAGGATACAATCCATATCGCCATACCCC TGGCAGCAGCAGGGCTAATCCTTACATTGCACCACCCCAGCTGCAGCAGTGCCAAACACCAGGCCCTCCT
    [Show full text]
  • Supplementary Table 1
    Supplementary Table 1. 492 genes are unique to 0 h post-heat timepoint. The name, p-value, fold change, location and family of each gene are indicated. Genes were filtered for an absolute value log2 ration 1.5 and a significance value of p ≤ 0.05. Symbol p-value Log Gene Name Location Family Ratio ABCA13 1.87E-02 3.292 ATP-binding cassette, sub-family unknown transporter A (ABC1), member 13 ABCB1 1.93E-02 −1.819 ATP-binding cassette, sub-family Plasma transporter B (MDR/TAP), member 1 Membrane ABCC3 2.83E-02 2.016 ATP-binding cassette, sub-family Plasma transporter C (CFTR/MRP), member 3 Membrane ABHD6 7.79E-03 −2.717 abhydrolase domain containing 6 Cytoplasm enzyme ACAT1 4.10E-02 3.009 acetyl-CoA acetyltransferase 1 Cytoplasm enzyme ACBD4 2.66E-03 1.722 acyl-CoA binding domain unknown other containing 4 ACSL5 1.86E-02 −2.876 acyl-CoA synthetase long-chain Cytoplasm enzyme family member 5 ADAM23 3.33E-02 −3.008 ADAM metallopeptidase domain Plasma peptidase 23 Membrane ADAM29 5.58E-03 3.463 ADAM metallopeptidase domain Plasma peptidase 29 Membrane ADAMTS17 2.67E-04 3.051 ADAM metallopeptidase with Extracellular other thrombospondin type 1 motif, 17 Space ADCYAP1R1 1.20E-02 1.848 adenylate cyclase activating Plasma G-protein polypeptide 1 (pituitary) receptor Membrane coupled type I receptor ADH6 (includes 4.02E-02 −1.845 alcohol dehydrogenase 6 (class Cytoplasm enzyme EG:130) V) AHSA2 1.54E-04 −1.6 AHA1, activator of heat shock unknown other 90kDa protein ATPase homolog 2 (yeast) AK5 3.32E-02 1.658 adenylate kinase 5 Cytoplasm kinase AK7
    [Show full text]
  • SCAP/SREBP Pathway Is Required for the Full Steroidogenic Response To
    SCAP/SREBP pathway is required for the full PNAS PLUS steroidogenic response to cyclic AMP Masami Shimizu-Alberginea,b,c, Brian Van Yserloob,c, Martin G. Golkowskia, Shao-En Onga, Joseph A. Beavoa,1,2, and Karin E. Bornfeldtb,c,d,1,2 aSchool of Medicine, Department of Pharmacology, University of Washington, Seattle, WA 98195; bSchool of Medicine, Department of Medicine, Division of Metabolism, Endocrinology and Nutrition, University of Washington, Seattle, WA 98109; cUniversity of Washington Diabetes Institute, School of Medicine, University of Washington, Seattle, WA 98109; and dSchool of Medicine, Department of Pathology, University of Washington Diabetes Institute, University of Washington, Seattle, WA 98109 Contributed by Joseph A. Beavo, July 19, 2016 (sent for review May 14, 2016; reviewed by Marco Conti, Donald Maurice, and Timothy Osborne) Luteinizing hormone (LH) stimulates steroidogenesis largely through Cellular cholesterol levels are controlled in part by several a surge in cyclic AMP (cAMP). Steroidogenic rates are also critically transcription factors, including sterol-regulatory element-binding dependent on the availability of cholesterol at mitochondrial sites of proteins (SREBPs) 2 and 1a, that promote cholesterol bio- synthesis. This cholesterol is provided by cellular uptake of lipoproteins, synthetic gene expression when cellular cholesterol levels are too mobilization of intracellular lipid, and de novo synthesis. Whether low to meet demand (9, 10). The activities of the SREBPs are and how these pathways are coordinated by cAMP are poorly un- precisely controlled by an escort protein, SREBP cleavage-acti- derstood. Recent phosphoproteomic analyses of cAMP-dependent vating protein (SCAP), and the insulin-inducible gene product phosphorylation sites in MA10 Leydig cells suggested that cAMP (Insig) (11–13).
    [Show full text]
  • ID AKI Vs Control Fold Change P Value Symbol Entrez Gene Name *In
    ID AKI vs control P value Symbol Entrez Gene Name *In case of multiple probesets per gene, one with the highest fold change was selected. Fold Change 208083_s_at 7.88 0.000932 ITGB6 integrin, beta 6 202376_at 6.12 0.000518 SERPINA3 serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3 1553575_at 5.62 0.0033 MT-ND6 NADH dehydrogenase, subunit 6 (complex I) 212768_s_at 5.50 0.000896 OLFM4 olfactomedin 4 206157_at 5.26 0.00177 PTX3 pentraxin 3, long 212531_at 4.26 0.00405 LCN2 lipocalin 2 215646_s_at 4.13 0.00408 VCAN versican 202018_s_at 4.12 0.0318 LTF lactotransferrin 203021_at 4.05 0.0129 SLPI secretory leukocyte peptidase inhibitor 222486_s_at 4.03 0.000329 ADAMTS1 ADAM metallopeptidase with thrombospondin type 1 motif, 1 1552439_s_at 3.82 0.000714 MEGF11 multiple EGF-like-domains 11 210602_s_at 3.74 0.000408 CDH6 cadherin 6, type 2, K-cadherin (fetal kidney) 229947_at 3.62 0.00843 PI15 peptidase inhibitor 15 204006_s_at 3.39 0.00241 FCGR3A Fc fragment of IgG, low affinity IIIa, receptor (CD16a) 202238_s_at 3.29 0.00492 NNMT nicotinamide N-methyltransferase 202917_s_at 3.20 0.00369 S100A8 S100 calcium binding protein A8 215223_s_at 3.17 0.000516 SOD2 superoxide dismutase 2, mitochondrial 204627_s_at 3.04 0.00619 ITGB3 integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61) 223217_s_at 2.99 0.00397 NFKBIZ nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, zeta 231067_s_at 2.97 0.00681 AKAP12 A kinase (PRKA) anchor protein 12 224917_at 2.94 0.00256 VMP1/ mir-21likely ortholog
    [Show full text]
  • UNIVERSITY of CALIFORNIA Los Angeles a Sterile Alpha Motif
    UNIVERSITY OF CALIFORNIA Los Angeles A Sterile Alpha Motif Domain Network Involved in Kidney Development A dissertation submitted in partial satisfaction of the requirements for the degree Doctor of Philosophy in Biochemistry and Molecular Biology by Catherine Nicole Leettola 2015 ABSTRACT OF THE DISSERTATION A Sterile Alpha Motif Domain Network Involved in Kidney Development by Catherine Nicole Leettola Doctor of Philosophy in Biochemistry and Molecular Biology University of California, Los Angeles, 2015 Professor James U. Bowie, Chair Cystic kidney diseases including polycystic kidney disease (PKD) and nephronophthisis (NPHP) are the most common genetic disorders leading to end-stage renal failure in humans. Animal models and human cases of PKD and NPHP have implicated the sterile alpha motif (SAM) domain containing proteins bicaudal C homolog 1 (BICC1) and ankyrin repeat and SAM- domain containing protein 6 (ANKS6) as being involved in these conditions and important for renal development. SAM domains are known protein-protein interaction domains that are capable of binding each other to form polymers and heterodimers. Using a negGFP native gel assay, we have identified the SAM domain of the previously uncharacterized protein ankyrin repeat and SAM-domain containing protein 3 (ANKS3) as a direct binding partner of the BICC1 and ANKS6 SAM domains. We found the ANKS3 SAM domain to polymerize with moderate affinity and determined the ANKS6 SAM domain can bind to a single end of this polymer. Crystal structures of the ANKS3 SAM domain polymer and the ANKS3 SAM-ANKS6 SAM ii heterodimer are presented to reveal typical ML-EH SAM domain interaction interfaces with a pronounced charge complementarity.
    [Show full text]
  • Diagnostic Yield and Novel Candidate Genes by Exome Sequencing in 152 Consanguineous Families with Neurodevelopmental Disorders
    Research JAMA Psychiatry | Original Investigation Diagnostic Yield and Novel Candidate Genes by Exome Sequencing in 152 Consanguineous Families With Neurodevelopmental Disorders Miriam S. Reuter, MD; Hasan Tawamie, MA; Rebecca Buchert, MA; Ola Hosny Gebril, MD; Tawfiq Froukh, PhD; Christian Thiel, MD; Steffen Uebe, PhD; Arif B. Ekici, PhD; Mandy Krumbiegel, PhD; Christiane Zweier, MD; Juliane Hoyer, MD; Karolin Eberlein, MD; Judith Bauer, MD; Ute Scheller, MD; Tim M. Strom, MD; Sabine Hoffjan, MD; Ehab R. Abdelraouf, MD; Nagwa A. Meguid, MD, PhD; Ahmad Abboud, MD; Mohammed Ayman Al Khateeb, MD; Mahmoud Fakher, MD; Saber Hamdan, MD; Amina Ismael, MD; Safia Muhammad, MD; Ebtessam Abdallah, MD, PhD; Heinrich Sticht, PhD; Dagmar Wieczorek, MD; André Reis, MD; Rami Abou Jamra, MD Supplemental content IMPORTANCE Autosomal recessive inherited neurodevelopmental disorders are highly heterogeneous, and many, possibly most, of the disease genes are still unknown. OBJECTIVES To promote the identification of disease genes through confirmation of previously described genes and presentation of novel candidates and provide an overview of the diagnostic yield of exome sequencing in consanguineous families. DESIGN, SETTING, AND PARTICIPANTS Autozygosity mapping in families and exome sequencing of index patients were performed in 152 consanguineous families (the parents descended from a same ancestor) with at least 1 offspring with intellectual disability (ID). The study was conducted from July 1, 2008, to June 30, 2015, and data analysis was conducted from July 1, 2015, to August 31, 2016. RESULTS Of the 152 consanguineous families enrolled, 1 child (in 45 families [29.6%]) or multiple children (107 families [70.4%]) had ID; additional features were present in 140 of the families (92.1%).
    [Show full text]
  • Renoprotective Effect of Combined Inhibition of Angiotensin-Converting Enzyme and Histone Deacetylase
    BASIC RESEARCH www.jasn.org Renoprotective Effect of Combined Inhibition of Angiotensin-Converting Enzyme and Histone Deacetylase † ‡ Yifei Zhong,* Edward Y. Chen, § Ruijie Liu,*¶ Peter Y. Chuang,* Sandeep K. Mallipattu,* ‡ ‡ † | ‡ Christopher M. Tan, § Neil R. Clark, § Yueyi Deng, Paul E. Klotman, Avi Ma’ayan, § and ‡ John Cijiang He* ¶ *Department of Medicine, Mount Sinai School of Medicine, New York, New York; †Department of Nephrology, Longhua Hospital, Shanghai University of Traditional Chinese Medicine, Shanghai, China; ‡Department of Pharmacology and Systems Therapeutics and §Systems Biology Center New York, Mount Sinai School of Medicine, New York, New York; |Baylor College of Medicine, Houston, Texas; and ¶Renal Section, James J. Peters Veterans Affairs Medical Center, New York, New York ABSTRACT The Connectivity Map database contains microarray signatures of gene expression derived from approximately 6000 experiments that examined the effects of approximately 1300 single drugs on several human cancer cell lines. We used these data to prioritize pairs of drugs expected to reverse the changes in gene expression observed in the kidneys of a mouse model of HIV-associated nephropathy (Tg26 mice). We predicted that the combination of an angiotensin-converting enzyme (ACE) inhibitor and a histone deacetylase inhibitor would maximally reverse the disease-associated expression of genes in the kidneys of these mice. Testing the combination of these inhibitors in Tg26 mice revealed an additive renoprotective effect, as suggested by reduction of proteinuria, improvement of renal function, and attenuation of kidney injury. Furthermore, we observed the predicted treatment-associated changes in the expression of selected genes and pathway components. In summary, these data suggest that the combination of an ACE inhibitor and a histone deacetylase inhibitor could have therapeutic potential for various kidney diseases.
    [Show full text]
  • Diagnosis of Metastatic Melanoma and Monitoring
    (19) TZZ ZZ_Z_T (11) EP 2 080 140 B1 (12) EUROPEAN PATENT SPECIFICATION (45) Date of publication and mention (51) Int Cl.: of the grant of the patent: G06F 19/00 (2011.01) 24.04.2013 Bulletin 2013/17 (86) International application number: (21) Application number: 07871360.9 PCT/US2007/083555 (22) Date of filing: 03.11.2007 (87) International publication number: WO 2008/100352 (21.08.2008 Gazette 2008/34) (54) DIAGNOSIS OF METASTATIC MELANOMA AND MONITORING INDICATORS OF IMMUNOSUPPRESSION THROUGH BLOOD LEUKOCYTE MICROARRAY ANALYSIS DIAGNOSE VON METASTASIERENDEM MELANOM UND ÜBERWACHUNG VON IMMUNSUPPRESSIONSINDIKATOREN MITTTELS LEUKOZYTEN-MIKROARRAY DIAGNOSTIC DE MELANOME METASTATIQUE ET SURVEILLANCE D’INDICATEURS D’IMMUNOSUPPRESSION PAR ANALYSE DE MICRORESEAUX DE LEUCOCYTES SANGUINS (84) Designated Contracting States: • PAVEY SANDRA ET AL: "Microarray expression AT BE BG CH CY CZ DE DK EE ES FI FR GB GR profiling in melanoma reveals a BRAF mutation HU IE IS IT LI LT LU LV MC MT NL PL PT RO SE signature", ONCOGENE, vol. 23, no. 23, 20 May SI SK TR 2004 (2004-05-20), pages 4060-4067, XP002644753, ISSN: 0950-9232 (30) Priority: 03.11.2006 US 856406 P • ZHOU YOUWEN ET AL: "Osteopontin expression correlates with melanoma invasion", JOURNAL (43) Date of publication of application: OF INVESTIGATIVE DERMATOLOGY, vol. 124, 22.07.2009 Bulletin 2009/30 no. 5, May 2005 (2005-05), pages 1044-1052, XP002644754, ISSN: 0022-202X (60) Divisional application: • BITTNER M ET AL: "MOLECULAR 12152482.1 / 2 506 172 CLASSIFICATION OF CUTANEOUS MALIGNANT 12196231.0 / 2 579 174 MELANOMA BY GENE EXPRESSION 12196232.8 / 2 570 951 PROFILING", NATURE, NATURE PUBLISHING GROUP, LONDON, GB, vol.
    [Show full text]
  • Gene Identification in Hereditary Spastic Paraplegias and Characterization of Spastic Paraplegia Type 58 (SPG58)
    Gene identification in Hereditary Spastic Paraplegias and characterization of spastic paraplegia type 58 (SPG58) Dissertation zur Erlangung des Grades eines Doktors der Naturwissenschaften der Mathematisch-Naturwissenschaftlichen Fakultät und der Medizinischen Fakultät der Eberhard-Karls-Universität Tübingen vorgelegt von Andrés Caballero García de Oteyza aus Madrid, Spanien Oktober - 2016 Tag der mündlichen Prüfung: 14 Oktober 2016 Dekan der Math.-Nat. Fakultät: Prof. Dr. W. Rosenstiel Dekan der Medizinischen Fakultät: Prof. Dr. I. B. Autenrieth 1. Berichterstatter: Prof. Dr. Ludger Schöls 2. Berichterstatter: Prof. Dr. Doron Rapaport Prüfungskommission: Prof. Dr. Peter Heutink Prof. Dr. Thomas Gasser Prof. Dr. Ludger Schöls Dr. Michela Deleidi 2 I hereby declare that I have produced the work entitled: “Gene Identification in Hereditary Spastic Paraplegias and Characterization of spastic paraplegia type 58 (SPG58)”, submitted for the award of a doctorate, on my own (without external help), have used only the sources and aids indicated and have marked passages included from other works, whether verbatim or in content, as such. I swear upon oath that these statements are true and that I have not concealed anything. I am aware that making a false declaration under oath is punishable by a term of imprisonment of up to three years or by a fine. Tübingen, October 21st 2016 Andrés Caballero García de Oteyza Date Signature 3 Acknowledgements I would like to start thanking Dr. Rebecca Schüle for having given me the opportunity to start such an exciting project together. I also thank her because she believed in me even though I had little experience when I started. She has guided and taught me patiently as much as I have asked for.
    [Show full text]