DOCSLIB.ORG

Characterization of Polymorphic Microsatellites for the Periwinkle

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Characterization of Polymorphic Microsatellites for the Periwinkle Characterization of polymorphic microsatellites for the periwinkle gastropod, Littorina littorea (Linnaeus, 1758) and their cross- amplification in four congeners McInerney, C. E., Allcock, L., Johnson, M., & Prodöhl, P. (2009). Characterization of polymorphic microsatellites for the periwinkle gastropod, Littorina littorea (Linnaeus, 1758) and their cross-amplification in four congeners. Conservation Genetics, 10(5), 1417-1420. https://doi.org/10.1007/s10592-008-9750-7 Published in: Conservation Genetics Queen's University Belfast - Research Portal: Link to publication record in Queen's University Belfast Research Portal General rights Copyright for the publications made accessible via the Queen's University Belfast Research Portal is retained by the author(s) and / or other copyright owners and it is a condition of accessing these publications that users recognise and abide by the legal requirements associated with these rights. Take down policy The Research Portal is Queen's institutional repository that provides access to Queen's research output. Every effort has been made to ensure that content in the Research Portal does not infringe any person's rights, or applicable UK laws. If you discover content in the Research Portal that you believe breaches copyright or violates any law, please contact [email protected]. Download date:02. Oct. 2021 Conserv Genet DOI 10.1007/s10592-008-9750-7 TECHNICAL NOTE Characterization of polymorphic microsatellites for the periwinkle gastropod, Littorina littorea (Linnaeus, 1758) and their cross-amplification in four congeners Caitrı´ona E. McInerney Æ A. Louise Allcock Æ Mark P. Johnson Æ Paulo A. Prodo¨hl Received: 9 October 2008 / Accepted: 13 November 2008 Ó Springer Science+Business Media B.V. 2008 Abstract Eight polymorphic microsatellite loci are between widely separated areas via ocean currents, poten- described for Littorina littorea (Linnaeus, 1758). Data on tially promoting high levels of gene flow and consequently allelic variation in Irish and Celtic Sea samples are reported. low levels of population structure. An understanding of the The average number of alleles per locus was 11 (range spatiotemporal dynamics and connectivity of populations 4–29), and observed and expected heterozygosities ranged through larval dispersal is fundamental for effective design from 6.9 to 84.3% and from 9.4 to 95.2%, respectively. Loci of marine reserves and their subsequent management (Sala did not deviate from Hardy–Weinberg equilibrium and no et al. 2002). Intertidal molluscs with an almost continuous linkage disequilibrium between loci pairs was detected. distribution, such as L. littorea, are ideal model organisms Microsatellites were not highly conserved in the congeners, for population genetic investigations to further our under- L. fabalis, L. saxatilis, L. compressa and L. obtusata as standing of the relationship between dispersal potential and evidenced by a low rate of cross-amplification. These gene flow in the marine environment. While microsatellite microsatellites should prove useful in population genetic markers are particularly suited to examine geographical studies. patterns and levels of gene flow among populations, to date no such markers are available for L. littorea. Although Keywords Enrichment Á Microsatellite Á Gastropod Á microsatellites have been developed for the congeners, Littorina Á Population genetics Á Littorina littorea L. striata King and Broderip, 1832 (Winnepenninckx and Backeljau 1998), L. subrotundata (Carpenter, 1864); (Tie et al. 2000) and L. saxatilis (Olivi, 1792) (Sokolov et al. The periwinkle Littorina littorea (Linnaeus, 1758) is a key 2002; McInerney pers. comm.), their utilization in L. littorea abundant species in intertidal communities. It is widely is limited due to a lack of conservation of microsatellite distributed in both the eastern and western Atlantic Ocean, flanking regions and a high incidence of null alleles and has been the subject of many biological investigations (McInerney pers. comm.). We describe here the develop- (Reid 1996). L. littorea has a planktonic veliger larva with ment of polymorphic microsatellite loci designed to a lengthy duration (4–7 weeks) in the water column L. littorea DNA, and the results of cross-species testing in (Graham 1988). Thus, larvae are most likely transported four co-occurring Northeast Atlantic congeners. Microsatellites were isolated from enriched genomic libraries prepared according to Kijas et al. (1994) using C. E. McInerney Á A. L. Allcock Á M. P. Johnson Á biotinylated oligonucleotides with modifications (details & P. A. Prodo¨hl ( ) available upon request from P. Prodo¨hl). Genomic libraries School of Biological Sciences, Medical Biology Centre, Queen’s University Belfast, 97 Lisburn Road, Belfast BT9 7BL, UK were constructed from the DNA of five individuals. DNA e-mail: [email protected] was isolated from 50 mg of the foot muscle using a modified chloroform phenol extraction (Taggart et al. 1992). Briefly, Present Address: enriched DNA fragments were cloned into pBluescript II A. L. Allcock Á M. P. Johnson Martin Ryan Marine Science Institute, National University of phagemid (Stratagene) and transformed into competent cells Ireland Galway, University Road, Galway, Ireland (XL2-Blue Ultracompetent cells, Stratagene). Some 1,800 123 123 Table 1 Description of microsatellite loci for Littorina littorea with PCR conditions and variability 0 0 Locus / GenBank Cloned repeat motif Primer sequence (5 –3 ) Tm (°C) NA Clone Allele size HO HE Acc. no. length (bp) range (bp) a Llit1/FJ480214 (GAA)8GCAGATAACGACGAAGAGGAACAA F:AGTCTACTCTGTGCCTCCCTCTT 58 10 227 223–250 0.733 0.771 (GA)2G(GA)2ATCTA(GGA)4 R:CAGCTCTAATTGTTGACCTTCCTT a Llit57/FJ480215 (GAA)4AAAGAAAAAGAAGCA(GAA)14 F:GATCCGTGGTCAAGCAGGTCA 56 16 241 233–281 0.586 0.627 R:ATGGCGGGGTAAAAATCGTCAT Llit61/FJ480216 (GACA)2AACA(GACA)5AAAA(GACA)5(GA)4 F:ACCCGGAGTGCGAAAAT 51 6 205 197–217 0.228 0.242 aR:CCTTGACGGGATACTGG Llit16/FJ480217 (GACA)5CACAGGCAGAAA(GACA)2AACAGA F:GACGTTGGGACTATCGGAACA 58 10 244 223–249 0.701 0.705 (GACA)5CTGA(GACA)3 aR:CTGATAGTCCCAATGTCTACACTT a Llit55/FJ480218 (GAA)2GGC(GGA)2AGAA(GA)2TCGAA(GGA)2 F:CACGGGTACAGAAGCTGGTGAG 59 5 260 241–268 0.071 0.093 AGA(GGA)2AGAATAA(GGA)3 R:GCCAAATCAGGACCCCTTCC b a Llit2/FJ480219 (GGAT)6CGATGGATCGATGTTT(GGAT)3 F:GATCCATTGGTCCCGTCTG 57 6 213 195–223 0.613 0.722 GATTAGAT(GGAT)10 R:CTGGCTCAGCTGGACCTCA b a Llit17/FJ480220 (GA)21(GACA)10 F:ATGCATATAAGATCAGAGTAGTC 51 29 209 211–275 0.843 0.952 R:ACATTAAGTCACGCAAAAC a Llit50/FJ480221 (GGA)3GGG(GGA)2GTA(GGA)2GAAGAT F:GCGCTGGCTGCCTACCTGA 56 4 277 255–275 0.069 0.094 GGCACGACAA(GA)2CAGGGAAG(GA)5 R:GATCCACACGCCGCTAAGT GenBank Acc. no., GenBank Accession numbers for the cloned sequences from which the markers were derived Tm°C annealing temperature NA number of alleles HO observed heterozygosity HE expected heterozygosity a Indicates which of the primer pair is IRD labelled b Indicates a touchdown PCR profile was used Conserv Genet Conserv Genet recombinant clones for tri- and tetra-nucleotide microsat- SAGA automated genotyping software (LI-COR Inc., Lin- ellites were screened by southern blot hybridisation with the coln, NE). 32 [P ] endlabelled oligonucleotide probes (AAT)5, (GGA)5, The eight microsatellite loci were screened against 86 (AGC)5, (GAA)5, (GACA)4 and (GGAT)5 following the samples collected from Ballyhornan (Irish Sea, Northern protocol described in Prodo¨hl et al. (1996). A total of 113 Ireland) and League Point (Celtic Sea, Republic of Ire- positive clones were isolated, purified (PurelinkTM HQ mini, land). The number of alleles per locus for the polymorphic Invitrogen), and commercially sequenced (Macrogen Inc., loci ranged from 4 to 29 (average, 11). Expected and Republic of Korea) in both orientations using T3 and T7 observed heterozygosities were calculated in GENETIX universal primers. Sequences contained microsatellites in 4.03 (Belkhir et al. 2004) and ranged from 0.069 to 0.843 94% (N = 106) of cases. Of these, 37 sequences were found and from 0.094 to 0.952, respectively. Testing for Hardy– to contain suitable flanking regions for primer design. PCR Weinberg equilibrium and genotypic disequilibria were primer sets were designed using PrimerSelectTM (Lasergene carried out using exact tests as implemented in GENEPOP 4.0, DNAStar Inc.). Following initial testing, eight PCR 3.4 (Raymond and Rousset 1995). No loci were found to primer sets (Table 1) were found to amplify products in the significantly deviate from Hardy–Weinberg equilibrium correct size range, and were further optimized for automated within each sample. Similarly there was no evidence of genetic screening on a LI-COR 4200 dual-laser automated linkage disequilibrium between loci pairs. The majority of system (LI-COR Inc., Lincoln, NE) using IRD fluorescently the microsatellite repeat motifs were complex (i.e., repe- labelled primers. PCRs were undertaken in 12 ll reaction ated regions interspaced with short unique nucleotides) volumes containing 50 ng DNA, 100 lM of dNTPs, (Table 1). Only one of the eight microsatellites developed 1.5 mM MgCl2,19 Taq DNA polymerase reaction buffer, here consisted of a compound (two adjacent distinct repeat 1 pMol of each primer and 0.5 U of Taq DNA polymerase motifs) microsatellite (Llit17). Sequence information for an (Invitrogen). PCR amplifications were performed using a additional monomorphic locus (Llit52) was deposited in MWG Primus PCR thermal cycler and cycling conditions GenBank (Accession number FJ480222). were as follows: an initial denaturation (94°C for 5 min), We investigated the cross-species amplification of followed by 25 cycles of 1 min at 94°C, annealing for 1 min L. littorea microsatellite primer sets in four congeners: at locus-specific temperature (Table 1) and 1 min at 72°C. L. fabalis (Turton 1825), L. obtusata (Linnaeus 1758), L. Following amplification, 6 ll of stop solution (95% compressa Jeffreys, 1865 and L. saxatilis (Olivi 1972). formamide, 10 mM NaOH, 10 mM EDTA, 0.01% para- Results (presented in Table 2) are in agreement with rosaniline) were added to PCR products. PCRs were known phylogenetic relationships among Littorina (Reid denatured (94°C for 5 min) and 0.3 ll was loaded and 1996).
Load more

Recommended publications
  • WMSDB - Worldwide Mollusc Species Data Base
    WMSDB - Worldwide Mollusc Species Data Base Family: TURBINIDAE Author: Claudio Galli - [email protected] (updated 07/set/2015) Class: GASTROPODA --- Clade: VETIGASTROPODA-TROCHOIDEA ------ Family: TURBINIDAE Rafinesque, 1815 (Sea) - Alphabetic order - when first name is in bold the species has images Taxa=681, Genus=26, Subgenus=17, Species=203, Subspecies=23, Synonyms=411, Images=168 abyssorum , Bolma henica abyssorum M.M. Schepman, 1908 aculeata , Guildfordia aculeata S. Kosuge, 1979 aculeatus , Turbo aculeatus T. Allan, 1818 - syn of: Epitonium muricatum (A. Risso, 1826) acutangulus, Turbo acutangulus C. Linnaeus, 1758 acutus , Turbo acutus E. Donovan, 1804 - syn of: Turbonilla acuta (E. Donovan, 1804) aegyptius , Turbo aegyptius J.F. Gmelin, 1791 - syn of: Rubritrochus declivis (P. Forsskål in C. Niebuhr, 1775) aereus , Turbo aereus J. Adams, 1797 - syn of: Rissoa parva (E.M. Da Costa, 1778) aethiops , Turbo aethiops J.F. Gmelin, 1791 - syn of: Diloma aethiops (J.F. Gmelin, 1791) agonistes , Turbo agonistes W.H. Dall & W.H. Ochsner, 1928 - syn of: Turbo scitulus (W.H. Dall, 1919) albidus , Turbo albidus F. Kanmacher, 1798 - syn of: Graphis albida (F. Kanmacher, 1798) albocinctus , Turbo albocinctus J.H.F. Link, 1807 - syn of: Littorina saxatilis (A.G. Olivi, 1792) albofasciatus , Turbo albofasciatus L. Bozzetti, 1994 albofasciatus , Marmarostoma albofasciatus L. Bozzetti, 1994 - syn of: Turbo albofasciatus L. Bozzetti, 1994 albulus , Turbo albulus O. Fabricius, 1780 - syn of: Menestho albula (O. Fabricius, 1780) albus , Turbo albus J. Adams, 1797 - syn of: Rissoa parva (E.M. Da Costa, 1778) albus, Turbo albus T. Pennant, 1777 amabilis , Turbo amabilis H. Ozaki, 1954 - syn of: Bolma guttata (A. Adams, 1863) americanum , Lithopoma americanum (J.F.
    [Show full text]
  • Rachor, E., Bönsch, R., Boos, K., Gosselck, F., Grotjahn, M., Günther, C
    Rachor, E., Bönsch, R., Boos, K., Gosselck, F., Grotjahn, M., Günther, C.-P., Gusky, M., Gutow, L., Heiber, W., Jantschik, P., Krieg, H.J., Krone, R., Nehmer, P., Reichert, K., Reiss, H., Schröder, A., Witt, J. & Zettler, M.L. (2013): Rote Liste und Artenlisten der bodenlebenden wirbellosen Meerestiere. – In: Becker, N.; Haupt, H.; Hofbauer, N.; Ludwig, G. & Nehring, S. (Red.): Rote Liste gefährdeter Tiere, Pflanzen und Pilze Deutschlands, Band 2: Meeresorganismen. – Münster (Landwirtschaftsverlag). – Na- turschutz und Biologische Vielfalt 70 (2): S. 81-176. Die Rote Liste gefährdeter Tiere, Pflanzen und Pilze Deutschlands, Band 2: Meeres- organismen (ISBN 978-3-7843-5330-2) ist zu beziehen über BfN-Schriftenvertrieb – Leserservice – im Landwirtschaftsverlag GmbH 48084 Münster Tel.: 02501/801-300 Fax: 02501/801-351 http://www.buchweltshop.de/bundesamt-fuer-naturschutz.html bzw. direkt über: http://www.buchweltshop.de/nabiv-heft-70-2-rote-liste-gefahrdeter-tiere-pflanzen-und- pilze-deutschlands-bd-2-meeresorganismen.html Preis: 39,95 € Naturschutz und Biologische Vielfalt 70 (2) 2013 81 –176 Bundesamtfür Naturschutz Rote Liste und Artenlisten der bodenlebenden wirbellosen Meerestiere 4. Fassung, Stand Dezember 2007, einzelne Aktualisierungenbis 2012 EIKE RACHOR,REGINE BÖNSCH,KARIN BOOS, FRITZ GOSSELCK, MICHAEL GROTJAHN, CARMEN- PIA GÜNTHER, MANUELA GUSKY, LARS GUTOW, WILFRIED HEIBER, PETRA JANTSCHIK, HANS- JOACHIM KRIEG,ROLAND KRONE, PETRA NEHMER,KATHARINA REICHERT, HENNING REISS, ALEXANDER SCHRÖDER, JAN WITT und MICHAEL LOTHAR ZETTLER unter Mitarbeit von MAREIKE GÜTH Zusammenfassung Inden hier vorgelegten Listen für amMeeresbodenlebende wirbellose Tiere (Makrozoo- benthos) aus neun Tierstämmen wurden 1.244 Arten bewertet. Eszeigt sich, dass die Verhältnis- se in den deutschen Meeresgebietender Nord-und Ostsee (inkl.
    [Show full text]
  • Endringer I Norsk Marin Bunnfauna 1997-2010 Endringer I Norsk Marin Bunnfauna 1997-2010
    UTREDNING DN-utredning 8-2011 Endringer i norsk marin bunnfauna 1997-2010 Endringer i norsk marin bunnfauna 1997-2010 DN-utredning 8-2011 EKSTRAKT: ABSTRACT: I denne utredningen viser Torleiv Bratte- In this report Torleiv Brattegard shows that Utgiver: gard at av de vel 1600 bunnlevende marine of the about 1600 benthic marine species Direktoratet for naturforvaltning artene som tidligere ble definert som syd- that were defined as southern species in lige arter for Norge, det vil si at de hadde Norway in 1997, having their northern Dato: Juni 2011 sin nordgrense ved norskekysten, har 565 distribution limit somewhere on the Nor- arter forflyttet seg lenger nord i tidsperio- wegian coast, 565 species have moved Antall sider: 112 den 1997 - 2010. I gjennomsnitt har disse further north along the coast, on average artene forflyttet seg 75-100 mil på de siste 750-1000 kilometers during the period from Emneord: Marine bunnlevende 13 årene og hele 300 av disse artene er fun- 1997 - 2010. About 300 of these southern organismer, benthos, kartlegging, net så langt nord som den vestlige delen av species have been found in the western part klimaendringer, nye arter, utbredelse Barentshavet og/eller ved Svalbard. of the Barents Sea and/or at Svalbard. Keywords: Marine benthic organisms, Godt over 100 nye arter har kommet fra More than 100 new species from more mapping, distribution, climatic change, mer tempererte områder og har etablert temperate waters have been established new species seg i norske farvann fra 1997 og fram til i in Norwegian waters from 1997 until today. dag. Minst to tredeler av disse artene har At least two thirds of these have entered Bestilling: sannsynligvis kommet via nordvestkysten our seas from Scotland and Shetland, and Direktoratet for naturforvaltning, av Skottland eller Shetland.
    [Show full text]
  • Sequencing a Gene Under Strong Selection Aspartate Aminotransferase in North Atlantic Littorina
    Sequencing a Gene under Strong Selection Aspartate Aminotransferase in North Atlantic Littorina Felix Mittermayer Degree project for Master of Science (Two Years) in Biology Degree course in Marine Ecology 45 hec Spring and Autumn 2013 Department of Biological and Environmental Sciences University of Gothenburg Examiner: Kerstin Johannesson Department of Biological and Environmental Sciences University of Gothenburg Supervisor: Marina Panova and Mårten Duvetorp Department of Biological and Environmental Sciences University of Gothenburg ABSTRACT 3 INTRODUCTION 4 NATURAL SELECTION, LOCAL ADAPTION AND ALLOZYME VARIATION 4 SPECIES OF LITTORINA IN NORTH ATLANTIC 4 ASPARTATE AMINOTRANSFERASE ALLOZYME VARIATIONS IN L. SAXATILIS 6 AIM 7 MATERIAL AND METHODS 8 SAMPLING, SAMPLE PREPARATION AND PHENOTYPING 8 DNA AMPLIFICATION AND SEQUENCING 8 DATA ANALYSIS 10 RESULTS 10 DISCUSSION 11 FUTURE WORK 13 REFERENCES 14 FIGURES AND TABLES 17 2 Abstract Natural selection is one of the driving forces of evolution, to understand it we must gain inside into the molecular mechanics that create genetics variation. Allozymes are variants of an enzyme coded for by different alleles, they are generally considered to be under neutral or weak selection. Aspartate aminotransferase (Aat, EC 2.6.1.1) in the rough periwinkle, Littorina saxatilis (Olivi, 1792), has however shown to be under a very stringed selection regime, Aat is an essential part of the anaerobe energy production is molluscs. The two variants of Aat are found over a vertical gradient, Aat100 is predominant (0.7-0.8) in the surf zone while Aat120 is mainly found (0.8-0.9) in the splash zone. After an extinction event of L.
    [Show full text]
  • Rocky Shore Snails As Material for Projects (With a Key for Their Identification)
    Field Studies, 10, (2003) 601 - 634 ROCKY SHORE SNAILS AS MATERIAL FOR PROJECTS (WITH A KEY FOR THEIR IDENTIFICATION) J. H. CROTHERS Egypt Cottage, Fair Cross, Washford, Watchet, Somerset TA23 0LY ABSTRACT Rocky sea shores are amongst the best habitats in which to carry out biological field projects. In that habitat, marine snails (prosobranchs) offer the most opportunities for individual investigations, being easy to find, to identify, to count and to measure and beng sufficiently robust to survive the experience. A key is provided for the identification of the larger species and suggestions are made for investigations to exploit selected features of individual species. INTRODUCTION Rocky sea shores offer one of the best habitats for individual or group investigations. Not only is there de facto public access (once you have got there) but also the physical factors that dominate the environment - tides (inundation versus desiccation), waves, heat, cold, light, dark, salinity etc. - change significantly over a few metres in distance. As a bonus, most of the fauna and flora lives out on the open rock surface and patterns of distribution may be clearly visible to the naked eye. Finally, they are amongst the most ‘natural’ of habitats in the British Isles; unless there has been an oil spill, rocky sea shores are unlikely to have been greatly affected by covert human activity. Some 270 species of marine snail (Phylum Mollusca, Class Gastropoda; Sub-Class Prosobranchia) live in the seas around the British Isles (Graham, 1988) and their empty shells may be found on many beaches. Most of these species are small (less than 3 mm long) or live beneath the tidemarks.
    [Show full text]
  • Atlas De La Faune Marine Invertébrée Du Golfe Normano-Breton. Volume
    350 0 010 340 020 030 330 Atlas de la faune 040 320 marine invertébrée du golfe Normano-Breton 050 030 310 330 Volume 7 060 300 060 070 290 300 080 280 090 090 270 270 260 100 250 120 110 240 240 120 150 230 210 130 180 220 Bibliographie, glossaire & index 140 210 150 200 160 190 180 170 Collection Philippe Dautzenberg Philippe Dautzenberg (1849- 1935) est un conchyliologiste belge qui a constitué une collection de 4,5 millions de spécimens de mollusques à coquille de plusieurs régions du monde. Cette collection est conservée au Muséum des sciences naturelles à Bruxelles. Le petit meuble à tiroirs illustré ici est une modeste partie de cette très vaste collection ; il appartient au Muséum national d’Histoire naturelle et est conservé à la Station marine de Dinard. Il regroupe des bivalves et gastéropodes du golfe Normano-Breton essentiellement prélevés au début du XXe siècle et soigneusement référencés. Atlas de la faune marine invertébrée du golfe Normano-Breton Volume 7 Bibliographie, Glossaire & Index Patrick Le Mao, Laurent Godet, Jérôme Fournier, Nicolas Desroy, Franck Gentil, Éric Thiébaut Cartographie : Laurent Pourinet Avec la contribution de : Louis Cabioch, Christian Retière, Paul Chambers © Éditions de la Station biologique de Roscoff ISBN : 9782951802995 Mise en page : Nicole Guyard Dépôt légal : 4ème trimestre 2019 Achevé d’imprimé sur les presses de l’Imprimerie de Bretagne 29600 Morlaix L’édition de cet ouvrage a bénéficié du soutien financier des DREAL Bretagne et Normandie Les auteurs Patrick LE MAO Chercheur à l’Ifremer
    [Show full text]
  • Marine Shell-Bearing Gastropoda of Murman (Barents Sea): an Annotated Check-List
    Ruthenica, 2014, vol. 24, No. 2: 75-121. © Ruthenica, 2014 Published online November 24, 2014. http: www.ruthenica.com Marine shell-bearing Gastropoda of Murman (Barents Sea): an annotated check-list Ivan O. NEKHAEV Murmansk Marine Biological Institute, Russian Academy of Sciences, Vladimirskaya str. 17, Murmansk 183010, Russia; [email protected] ABSTRACT. Annotated check-list of shell-bearing were placed close to Kola Peninsula [Derjugin, 1924]. Gastropoda of Murman Coast (Barents Sea Coast of Some samples of bottom fauna including Mollusca Kola Peninsula) is presented. Based on original materi- were collected along the Murman Coast by both al collected in 1996-2013 and literature data 148 species Helgoland expedition in 1898 and Poseidon expedi- are recorded for the region. Nine species: Skenea rugu- tion in 1913 [Thiele, 1928]. losa (G.O. Sars, 1878), Aclis sarsi Dautzenberg et Fis- Biological station in Dalnie Zelentsy village was cher, 1912, Admete clivicola Høisæter, 2010, Nassarius established after shutting of the research station in incrassatus (Strøm, 1768), Raphitoma leufroyi Ekaterinenskaya Bay in 1933. The first account of (Michaud, 1828), Taranis moerchi (Malm, 1861), Ondi- the fauna of the biological station vicinity (Yarnish- na divisa (J. Adams, 1797), Menestho albula (Fabri- naya, Dalne-Zelenetskaya and Porchnikha bays) was cius, 1780), Bogasonia volutoides Warén, 1989 were published by Ushakov [1948]. The general direction absent in previous reviews of Russian molluscan fau- na. Three species with unclear taxonomical position are of molluscan research during this period was com- listed: Skenea cf. trochoides, Omalogyra cf. atomus prehensive study of population ecology, life history, and Chrysallida sp. A majority of species found in breeding and in some cases embryonic develop- Murman waters have a boreal distribution and are typi- ment of common species [Kuznetsov, 1946; 1948a; cal for northern European fauna.
    [Show full text]
  • Periwinkles (Gastropoda, Littorinidae) As a Model for Studying Patterns and Dynamics of Marine Biodiversity by Thierry BACKELJAU, Antonio M
    BULLETIN DE L’INSTITUT ROYAL DES SCIENCES NATURELLES DE BELGIQUE, BIOLOGIE, 71-SUPPL.: 43-65, 2001 BULLETIN VAN HET KONINKLIJK BELGISCH INSTITUUT VOOR NATUURWETENSCHAPPEN, BIOLOGIE, 71-SUPPL.: 43-65, 2001 Periwinkles (Gastropoda, Littorinidae) as a model for studying patterns and dynamics of marine biodiversity by Thierry BACKELJAU, Antonio M. FRIAS MARTINS, Elizabeth GOSLING, John GRAHAME, Peter MILL, Carlos BRITO, Andrea CLARKE, Roberto MEDEIROS, Maureen SMALL, Craig WILDING, Iain WILSON, Birgitta WINNEPENNINCKX, Richard CLARKE, & Hans DE WOLF A b str a c t intraspecifique, ils ne représentent pas suffisamment la diversité non-moléculaire pertinente du point de vue d’évolution. This paper presents a summary synthesis of an international EC- Mots-clés: Gastropoda, Littorinidae, biodiversité marine, généti­ funded research program in which periwinkles are used as a model que de populations, taxonomie, systématique moléculaire. group to study patterns and dynamics in marine biodiversity. In the first part of the paper, a number of techniques and markers to assess biodiversity in periwinkles are illustrated and evaluated, while Introduction protocols for DNA-extraction, Single-Strand Conformation Polymorphisms (SSCP) and PCR-amplification of a number of nu­ clear and mitochondrial DNA markers are provided. The second Biodiversity can be defined as “The variability among living part of the paper presents a brief overview of the application of organisms from all sources, including inter alia terrestrial, these techniques in the analysis of genetic diversity in two periwin­ marine and other aquatic ecosystems and the ecological com­ kle taxa with contrasting developmental modes, viz. Littorina plexes of which they are part; this includes diversity within striata and the L.
    [Show full text]
  • Proteomic Similarity of the Littorinid Snails in the Evolutionary Context
    Proteomic similarity of the Littorinid snails in the evolutionary context Arina L. Maltseva1,*, Marina A. Varfolomeeva1,*, Arseniy A. Lobov1,2, Polina Tikanova1, Marina Panova1,3, Natalia A. Mikhailova1,4 and Andrei I. Granovitch1 1 Department of Invertebrate Zoology, St. Petersburg State University, St. Petersburg, Russia 2 Laboratory of Regenerative Biomedicine, Institute of Cytology Russian Academy of Sciences, St. Petersburg, Russia 3 Department of Marine Sciences, Tjärnö, University of Gothenburg, Sweden 4 Centre of Cell Technologies, Institute of Cytology Russian Academy of Sciences, St. Petersburg, Russia * These authors contributed equally to this work. ABSTRACT Background: The introduction of DNA-based molecular markers made a revolution in biological systematics. However, in cases of very recent divergence events, the neutral divergence may be too slow, and the analysis of adaptive part of the genome is more informative to reconstruct the recent evolutionary history of young species. The advantage of proteomics is its ability to reflect the biochemical machinery of life. It may help both to identify rapidly evolving genes and to interpret their functions. Methods: Here we applied a comparative gel-based proteomic analysis to several species from the gastropod family Littorinidae. Proteomes were clustered to assess differences related to species, geographic location, sex and body part, using data on presence/absence of proteins in samples and data on protein occurrence frequency in samples of different species. Cluster support was assessed using multiscale bootstrap resampling and the stability of clustering—using cluster-wise index of cluster stability. Taxon-specific protein markers were derived using IndVal method. Proteomic trees were compared to consensus phylogenetic tree (based on neutral genetic markers) using estimates of the Robinson–Foulds distance, the Submitted 15 August 2019 – Accepted 10 January 2020 Fowlkes Mallows index and cophenetic correlation.
    [Show full text]
  • Review Article Ecological Speciation and the Intertidal Snail Littorina Saxatilis
    Hindawi Publishing Corporation Advances in Ecology Volume 2014, Article ID 239251, 9 pages http://dx.doi.org/10.1155/2014/239251 Review Article Ecological Speciation and the Intertidal Snail Littorina saxatilis Juan Galindo1 and John W. Grahame2 1 Departamento de Bioqu´ımica, Xenetica´ e Inmunolox´ıa, Facultade de Biolox´ıa,UniversidadedeVigo, Campus de Vigo, 36310 Vigo, Spain 2 School of Biology, University of Leeds, Leeds LS2 9JT, UK Correspondence should be addressed to John W. Grahame; [email protected] Received 3 April 2014; Revised 18 June 2014; Accepted 19 June 2014; Published 22 July 2014 Academic Editor: Sveinn Are Hanssen Copyright © 2014 J. Galindo and J. W. Grahame. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. In recent decades biologists studying speciation have come to consider that the process does not necessarily require the presence of a geographical barrier. Rather, it now seems to be possible for reproductive barriers to evolve within what was hitherto a single “species.” The intertidal snail Littorina saxatilis has been the focus of a considerable amount of work in this context, and it is now thought of as a good case study of “ecological speciation.” We review some of this work and briefly consider prospects for future developments. 1. Introduction and salt marshes [8]. There are few published data on longevity. Hughes [9] gives a maximum of about four years. In recent decades, there has been a considerable shift in our Littorina saxatilis is also highly polymorphic, and this view of speciation—ecology has come in [1].
    [Show full text]
  • The Ecology of Marine Tidal Race Environments and the Impact of Tidal Energy Development
    The ecology of marine tidal race environments and the impact of tidal energy development Melanie Broadhurst A thesis submitted for the degree of Doctor of Philosophy from the Division of Biology, Department of Life Sciences, Imperial College London 2 Abstract Marine tidal race environments undergo extreme hydrodynamic regimes and are favoured locations for offshore marine renewable tidal energy developments. Few ecological studies have been conducted within these complex environments, and therefore, ecological impacts from tidal energy developments remain unknown. This thesis aimed to investigate the ecological aspects of marine tidal race environments in two themes, using a combination of field-based sampling techniques. I first examined the natural ecological variation of a marine tidal race environment at the spatial and temporal scale. These studies were based on the benthic and intertidal communities within the Alderney Race tidal environment, Alderney. My results suggest that both communities vary in species diversity and composition, at different spatial gradients and timescales. Species showed opportunistic or resilient life history characteristics, highlighting the overall influence of the strong hydrodynamic conditions present. I then explored the ecology of a marine tidal race environment within a renewable tidal energy development site. These studies were based within the European Marine Energy Centre’s tidal energy development site, Orkney. Here, I investigated ecological variation in terms of fish interaction and benthic assemblage structure with a deployed tidal energy device, and, the structure of intertidal communities within the overall development site. Interestingly, my results indicated species-specific interactions with the deployed tidal energy device, which was related to species’ refuge or feeding behaviour.
    [Show full text]
  • Littorinidae
    WMSDB - Worldwide Mollusc Species Data Base Family: LITTORINIDAE Author: Claudio Galli - [email protected] (updated 07/set/2015) Class: GASTROPODA --- Clade: CAENOGASTROPODA-HYPSOGASTROPODA-LITTORINIMORPHA-LITTORINOIDEA ------ Family: LITTORINIDAE Children, 1834 (Sea) - Alphabetic order - when first name is in bold the species has images Taxa=959, Genus=31, Subgenus=11, Species=239, Subspecies=16, Synonyms=661, Images=178 aberrans , Littoraria aberrans (R.A. Philippi, 1846) abjecta, Echinolittorina abjecta A. Adams, 1852 - syn of: Echinolittorina atrata (A. Adams, 1852) abyssicola, Lacuna abyssicola J.C. Melvill & R. Standen, 1912 abyssorum , Lacuna abyssorum É.A.A. Locard, 1896 - syn of: Benthonella tenella (J.G. Jeffreys, 1869) acuminata , Littorina acuminata A.A. Gould, 1849 - syn of: Littoraria undulata (J.E. Gray, 1839) acuta , Austrolittorina acuta R.A. Philippi, 1847 - syn of: Austrolittorina unifasciata (J.E. Gray, 1826) acutispira , Afrolittorina acutispira (E.A. Smith, 1892) acutispira , Nodilittorina acutispira E.A. Smith, 1892 - syn of: Afrolittorina acutispira (E.A. Smith, 1892) adonis , Palustorina adonis M. Yokoyama, 1927 - syn of: Littoraria sinensis (R.A. Philippi, 1847) adonis , Littorina adonis M. Yokoyama, 1927 - syn of: Littoraria sinensis (R.A. Philippi, 1847) aestualis , Laevilitorina aestualis H. Strebel, 1908 - syn of: Laevilitorina caliginosa (A.A. Gould, 1849) affinis , Tectarius affinis D'Orbigny, 1839 - syn of: Tectarius striatus (P.P. King, 1832) affinis , Littorina affinis D'Orbigny, 1840 - syn of: Tectarius striatus (P.P. King, 1832) africana , Afrolittorina africana (C.F.F. von Krauss in R.A. Philippi, 1847) africana , Nodilittorina africana C.F.F. von Krauss in R.A. Philippi, 1847 - syn of: Afrolittorina africana (C.F.F. von Krauss in R.A.
    [Show full text]