Characterization of polymorphic microsatellites for the periwinkle gastropod, Littorina littorea (Linnaeus, 1758) and their cross- amplification in four congeners McInerney, C. E., Allcock, L., Johnson, M., & Prodöhl, P. (2009). Characterization of polymorphic microsatellites for the periwinkle gastropod, Littorina littorea (Linnaeus, 1758) and their cross-amplification in four congeners. Conservation Genetics, 10(5), 1417-1420. https://doi.org/10.1007/s10592-008-9750-7 Published in: Conservation Genetics Queen's University Belfast - Research Portal: Link to publication record in Queen's University Belfast Research Portal General rights Copyright for the publications made accessible via the Queen's University Belfast Research Portal is retained by the author(s) and / or other copyright owners and it is a condition of accessing these publications that users recognise and abide by the legal requirements associated with these rights. Take down policy The Research Portal is Queen's institutional repository that provides access to Queen's research output. Every effort has been made to ensure that content in the Research Portal does not infringe any person's rights, or applicable UK laws. If you discover content in the Research Portal that you believe breaches copyright or violates any law, please contact [email protected]. Download date:02. Oct. 2021 Conserv Genet DOI 10.1007/s10592-008-9750-7 TECHNICAL NOTE Characterization of polymorphic microsatellites for the periwinkle gastropod, Littorina littorea (Linnaeus, 1758) and their cross-amplification in four congeners Caitrı´ona E. McInerney Æ A. Louise Allcock Æ Mark P. Johnson Æ Paulo A. Prodo¨hl Received: 9 October 2008 / Accepted: 13 November 2008 Ó Springer Science+Business Media B.V. 2008 Abstract Eight polymorphic microsatellite loci are between widely separated areas via ocean currents, poten- described for Littorina littorea (Linnaeus, 1758). Data on tially promoting high levels of gene flow and consequently allelic variation in Irish and Celtic Sea samples are reported. low levels of population structure. An understanding of the The average number of alleles per locus was 11 (range spatiotemporal dynamics and connectivity of populations 4–29), and observed and expected heterozygosities ranged through larval dispersal is fundamental for effective design from 6.9 to 84.3% and from 9.4 to 95.2%, respectively. Loci of marine reserves and their subsequent management (Sala did not deviate from Hardy–Weinberg equilibrium and no et al. 2002). Intertidal molluscs with an almost continuous linkage disequilibrium between loci pairs was detected. distribution, such as L. littorea, are ideal model organisms Microsatellites were not highly conserved in the congeners, for population genetic investigations to further our under- L. fabalis, L. saxatilis, L. compressa and L. obtusata as standing of the relationship between dispersal potential and evidenced by a low rate of cross-amplification. These gene flow in the marine environment. While microsatellite microsatellites should prove useful in population genetic markers are particularly suited to examine geographical studies. patterns and levels of gene flow among populations, to date no such markers are available for L. littorea. Although Keywords Enrichment Á Microsatellite Á Gastropod Á microsatellites have been developed for the congeners, Littorina Á Population genetics Á Littorina littorea L. striata King and Broderip, 1832 (Winnepenninckx and Backeljau 1998), L. subrotundata (Carpenter, 1864); (Tie et al. 2000) and L. saxatilis (Olivi, 1792) (Sokolov et al. The periwinkle Littorina littorea (Linnaeus, 1758) is a key 2002; McInerney pers. comm.), their utilization in L. littorea abundant species in intertidal communities. It is widely is limited due to a lack of conservation of microsatellite distributed in both the eastern and western Atlantic Ocean, flanking regions and a high incidence of null alleles and has been the subject of many biological investigations (McInerney pers. comm.). We describe here the develop- (Reid 1996). L. littorea has a planktonic veliger larva with ment of polymorphic microsatellite loci designed to a lengthy duration (4–7 weeks) in the water column L. littorea DNA, and the results of cross-species testing in (Graham 1988). Thus, larvae are most likely transported four co-occurring Northeast Atlantic congeners. Microsatellites were isolated from enriched genomic libraries prepared according to Kijas et al. (1994) using C. E. McInerney Á A. L. Allcock Á M. P. Johnson Á biotinylated oligonucleotides with modifications (details & P. A. Prodo¨hl ( ) available upon request from P. Prodo¨hl). Genomic libraries School of Biological Sciences, Medical Biology Centre, Queen’s University Belfast, 97 Lisburn Road, Belfast BT9 7BL, UK were constructed from the DNA of five individuals. DNA e-mail: [email protected] was isolated from 50 mg of the foot muscle using a modified chloroform phenol extraction (Taggart et al. 1992). Briefly, Present Address: enriched DNA fragments were cloned into pBluescript II A. L. Allcock Á M. P. Johnson Martin Ryan Marine Science Institute, National University of phagemid (Stratagene) and transformed into competent cells Ireland Galway, University Road, Galway, Ireland (XL2-Blue Ultracompetent cells, Stratagene). Some 1,800 123 123 Table 1 Description of microsatellite loci for Littorina littorea with PCR conditions and variability 0 0 Locus / GenBank Cloned repeat motif Primer sequence (5 –3 ) Tm (°C) NA Clone Allele size HO HE Acc. no. length (bp) range (bp) a Llit1/FJ480214 (GAA)8GCAGATAACGACGAAGAGGAACAA F:AGTCTACTCTGTGCCTCCCTCTT 58 10 227 223–250 0.733 0.771 (GA)2G(GA)2ATCTA(GGA)4 R:CAGCTCTAATTGTTGACCTTCCTT a Llit57/FJ480215 (GAA)4AAAGAAAAAGAAGCA(GAA)14 F:GATCCGTGGTCAAGCAGGTCA 56 16 241 233–281 0.586 0.627 R:ATGGCGGGGTAAAAATCGTCAT Llit61/FJ480216 (GACA)2AACA(GACA)5AAAA(GACA)5(GA)4 F:ACCCGGAGTGCGAAAAT 51 6 205 197–217 0.228 0.242 aR:CCTTGACGGGATACTGG Llit16/FJ480217 (GACA)5CACAGGCAGAAA(GACA)2AACAGA F:GACGTTGGGACTATCGGAACA 58 10 244 223–249 0.701 0.705 (GACA)5CTGA(GACA)3 aR:CTGATAGTCCCAATGTCTACACTT a Llit55/FJ480218 (GAA)2GGC(GGA)2AGAA(GA)2TCGAA(GGA)2 F:CACGGGTACAGAAGCTGGTGAG 59 5 260 241–268 0.071 0.093 AGA(GGA)2AGAATAA(GGA)3 R:GCCAAATCAGGACCCCTTCC b a Llit2/FJ480219 (GGAT)6CGATGGATCGATGTTT(GGAT)3 F:GATCCATTGGTCCCGTCTG 57 6 213 195–223 0.613 0.722 GATTAGAT(GGAT)10 R:CTGGCTCAGCTGGACCTCA b a Llit17/FJ480220 (GA)21(GACA)10 F:ATGCATATAAGATCAGAGTAGTC 51 29 209 211–275 0.843 0.952 R:ACATTAAGTCACGCAAAAC a Llit50/FJ480221 (GGA)3GGG(GGA)2GTA(GGA)2GAAGAT F:GCGCTGGCTGCCTACCTGA 56 4 277 255–275 0.069 0.094 GGCACGACAA(GA)2CAGGGAAG(GA)5 R:GATCCACACGCCGCTAAGT GenBank Acc. no., GenBank Accession numbers for the cloned sequences from which the markers were derived Tm°C annealing temperature NA number of alleles HO observed heterozygosity HE expected heterozygosity a Indicates which of the primer pair is IRD labelled b Indicates a touchdown PCR profile was used Conserv Genet Conserv Genet recombinant clones for tri- and tetra-nucleotide microsat- SAGA automated genotyping software (LI-COR Inc., Lin- ellites were screened by southern blot hybridisation with the coln, NE). 32 [P ] endlabelled oligonucleotide probes (AAT)5, (GGA)5, The eight microsatellite loci were screened against 86 (AGC)5, (GAA)5, (GACA)4 and (GGAT)5 following the samples collected from Ballyhornan (Irish Sea, Northern protocol described in Prodo¨hl et al. (1996). A total of 113 Ireland) and League Point (Celtic Sea, Republic of Ire- positive clones were isolated, purified (PurelinkTM HQ mini, land). The number of alleles per locus for the polymorphic Invitrogen), and commercially sequenced (Macrogen Inc., loci ranged from 4 to 29 (average, 11). Expected and Republic of Korea) in both orientations using T3 and T7 observed heterozygosities were calculated in GENETIX universal primers. Sequences contained microsatellites in 4.03 (Belkhir et al. 2004) and ranged from 0.069 to 0.843 94% (N = 106) of cases. Of these, 37 sequences were found and from 0.094 to 0.952, respectively. Testing for Hardy– to contain suitable flanking regions for primer design. PCR Weinberg equilibrium and genotypic disequilibria were primer sets were designed using PrimerSelectTM (Lasergene carried out using exact tests as implemented in GENEPOP 4.0, DNAStar Inc.). Following initial testing, eight PCR 3.4 (Raymond and Rousset 1995). No loci were found to primer sets (Table 1) were found to amplify products in the significantly deviate from Hardy–Weinberg equilibrium correct size range, and were further optimized for automated within each sample. Similarly there was no evidence of genetic screening on a LI-COR 4200 dual-laser automated linkage disequilibrium between loci pairs. The majority of system (LI-COR Inc., Lincoln, NE) using IRD fluorescently the microsatellite repeat motifs were complex (i.e., repe- labelled primers. PCRs were undertaken in 12 ll reaction ated regions interspaced with short unique nucleotides) volumes containing 50 ng DNA, 100 lM of dNTPs, (Table 1). Only one of the eight microsatellites developed 1.5 mM MgCl2,19 Taq DNA polymerase reaction buffer, here consisted of a compound (two adjacent distinct repeat 1 pMol of each primer and 0.5 U of Taq DNA polymerase motifs) microsatellite (Llit17). Sequence information for an (Invitrogen). PCR amplifications were performed using a additional monomorphic locus (Llit52) was deposited in MWG Primus PCR thermal cycler and cycling conditions GenBank (Accession number FJ480222). were as follows: an initial denaturation (94°C for 5 min), We investigated the cross-species amplification of followed by 25 cycles of 1 min at 94°C, annealing for 1 min L. littorea microsatellite primer sets in four congeners: at locus-specific temperature (Table 1) and 1 min at 72°C. L. fabalis (Turton 1825), L. obtusata (Linnaeus 1758), L. Following amplification, 6 ll of stop solution (95% compressa Jeffreys, 1865 and L. saxatilis (Olivi 1972). formamide, 10 mM NaOH, 10 mM EDTA, 0.01% para- Results (presented in Table 2) are in agreement with rosaniline) were added to PCR products. PCRs were known phylogenetic relationships among Littorina (Reid denatured (94°C for 5 min) and 0.3 ll was loaded and 1996).