DOCSLIB.ORG

Molecular Consequences of SOD2 Expression in Epigenetically Silenced Pancreatic Carcinoma Cell Lines

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Molecular Consequences of SOD2 Expression in Epigenetically Silenced Pancreatic Carcinoma Cell Lines British Journal of Cancer (2007) 97, 1116 – 1123 & 2007 Cancer Research UK All rights reserved 0007 – 0920/07 $30.00 www.bjcancer.com Molecular consequences of SOD2 expression in epigenetically silenced pancreatic carcinoma cell lines *,1 2 3 *,1 EM Hurt , SB Thomas , B Peng and WL Farrar 1 Cancer Stem Cell Section, Laboratory of Cancer Prevention, Center for Cancer Research, National Cancer Institute at Frederick, National Institutesof 2 Health, Frederick, MD 21702, USA; Basic Research Program, SAIC-Frederick Inc., National Cancer Institute at Frederick, Frederick, MD 21702, USA; 3 School of Dental Science, University of Melbourne, Melbourne, Victoria, Australia Manganese superoxide dismutase (SOD2) is an enzyme that catalyses the dismutation of superoxide in the mitochondria, leading to reduced levels of reactive oxygen species. Reduced expression levels of SOD2 have been shown to result in increased DNA damage and sod2 heterozygous mice have increased incidences of cancer. It has also been shown that SOD2 expression is lost in pancreatic cell lines, with reintroduction of SOD2 resulting in decreased rate of proliferation. The mechanism of decreased SOD2 expression in pancreatic carcinoma has not been previously determined. We demonstrate, through sodium bisulphite sequencing, that the sod2 locus is methylated in some pancreatic cell lines leading to a corresponding decrease in SOD2 expression. Methylation can be reversed by treatment with zebularine, a methyltransferase inhibitor, resulting in restored SOD2 expression. Furthermore, we demonstrate that sensitivity of pancreatic carcinoma cell lines to 2-methoxyestradiol correlates with SOD2 expression and SOD2 modulation can alter the sensitivity of these cells. Using both genomics and proteomics, we also identify molecular consequences of SOD2 expression in MIA-PaCa2 cells, including dephosphorylation of VEGFR2 and the identification of both SOD2-regulated genes and transcription factors with altered binding activity in response to SOD2 expression. British Journal of Cancer (2007) 97, 1116–1123. doi:10.1038/sj.bjc.6604000 www.bjcancer.com Published online 25 September 2007 & 2007 Cancer Research UK Molecular Diagnostics Keywords: superoxide dismutase 2; pancreatic neoplasms; proteomics; genomics; epigenetic process Free radicals are, arguably, considered among the most potent, stand as guardians for ROS have been implicated in the possible ubiquitous, endogenous mutagens generated by normal physiolo- progression or initiation of some cancers. Considered among the gical processes (Hussain et al, 2003). Among various molecular earliest pre-neoplastic changes in prostate cancer is the epigenetic forms of free radicals, reactive oxygen species (ROS) have been the silencing by promoter CpG hypermethylation of the glutathione most diligently studied. Generated by all cells as a by-product of S-transferase p gene (Lin et al, 2001; Nelson et al, 2001). Thus, oxidative metabolism and inflammatory processes, ROS are speculating that a reduction in the ability to manage ROS leads to indicted in inducing cellular aging (Melov, 2000), cancer, and a further mutation and advancement of the neoplastic process. variety of other pathophysiological conditions. Alterations in Among the enzymes produced by cells that manage ROS, macromolecular functions are understandable in view that ROS manganese superoxide dismutase (SOD2), the form of SOD found may target DNA, proteins, RNA, and lipids. Due to the deleterious in mitochondria, has received considerable attention with regard potential of free radicals, mechanisms have evolved to protect cells to cancer (Liu et al, 2004). The main function of SOD2 is to convert from ROS, including antioxidant scavengers, enzymes, and repair superoxide anion into hydrogen peroxide (H2O2), which is mechanisms. subsequently converted to water by catalases. Decreased expres- Cancer, in particular, arises from a combination of potential sion of SOD2 has been noted, initially, in pancreatic carcinoma genetic mutations, and possibly epigenetic changes, altering the cells lines (Cullen et al, 2003). More recently, reduced expression cells’ normal proliferative and apoptotic programming. Within the of SOD2 has been seen in multiple myeloma cells (Hodge et al, last few years, changes in expression patterns of enzymes that 2005b), androgen-independent prostate cancer (Best et al, 2005; Venkataraman et al, 2005), and invasive breast carcinoma (Soini et al, 2001). Overexpression of SOD2 in deficient cell lines has *Correspondence: EM Hurt, Laboratory of Cancer Prevention, National reduced the proliferation of pancreatic carcinoma cells (Weydert Cancer Institute at Frederick, 1050 Boyles Street, Building 560, Room et al, 2003; Ough et al, 2004), multiple myeloma cells (Hodge et al, 21-81, Frederick, MD 21702, USA; E-mail: [email protected] or 2005b), glioma cells (Zhong et al, 1997), squamous oral carcinoma WL Farrar, Laboratory of Cancer Prevention, National Cancer Institute at cells (Liu et al, 1997), and prostate carcinoma cells (Li et al, 1998b; Frederick, 1050 Boyles Street, Building 560, Room 21-78, Frederick, MD Zhong et al, 2004; Venkataraman et al, 2005). Transgenic 21702, USA; E-mail: [email protected] overexpression of SOD2 also results in increased resistance to Received 2 April 2007; revised 14 August 2007; accepted 29 August chemical carcinogenesis as compared to wild-type mice (Zhao 2007; published online 25 September 2007 et al, 2001). While homozygous sod2 knockout mice die within SOD2 in pancreatic carcinoma cell lines EM Hurt et al 1117 weeks, heterozygous þ /À mice have accelerated tumour of expected size was cloned into pCR4-TOPO TA cloning vector development, particularly lymphomas (Van Remmen et al, 2003). (Invitrogen, Carlsbad, CA, USA). Ten individual clones for each cell Taken together, these data have raised the compelling issue that, in line were sequenced. addition to the effects of SOD2 as a guardian against ROS, SOD2 may phenotypically act as a tumour suppressor (Cullen et al, Construction of SOD2 expression and shRNA retroviruses 2003). While the phenotypic effects of diminished and/or over- Adenoviral SOD2 construct (kind gift of JJ Cullen, University of expressed SOD2 have been reported for various tumour cell lines, Iowa) was EcoRI digested and sod2 cDNA was cloned into the the explanation for reduced expression has only recently emerged. retroviral vector pLZRS-BMN-eGFP containing an IRES and eGFP Polymorphisms of the sod2 promoter have been suggested as one cDNA. For overexpression experiments, the control was the empty possible mechanism for reduced expression of SOD2 in certain cell eGFP vector. The oligos used for shRNA knockdown of sod2 are as lines (Xu et al, 1999). More recently, we have found that the sod2 follows: 50-GATCCCGGGGTTGGCTTGGTTTCAATATTCAAGAGA promoter is methylated in some multiple myeloma cells and TATTGAAACCAAGCCAACCCCTTTTTA-30 and 50-AGCTTAAAA diminished expression can be reversed by the methyltransferase AGGGGTTGGCTTGGTTTCAATATCTCTTGAATATTGAAACCAA inhibitor zebularine (Hodge et al, 2005a), suggesting that GCCAACCCCGG-30. The oligos were annealed and cloned into the repression of SOD2 may occur at the level of epigenetic regulation. BglII/HindIII sites of pRetroSuper (Brummelkamp et al, 2002). In addition to understanding the relative mechanisms of SOD2 expression levels in cancer cells, little is known about the Generation of stable cell lines with altered SOD2 consequences of reduced SOD2 on the signal transduction and expression levels transcriptional processes that control cancer cell viability and growth. Some data have emerged suggesting that levels of SOD2 A bicistronic retrovirus carrying sod2 cDNA and eGFP or an empty have effects on AP-1 and NF-kB activities, in which overexpression vector (control) was used to create the overexpression cell lines. experiments diminish the activities of these two important For knockdown of SOD2, the shSOD2-pRetroSuper or empty transcription factors (Kiningham and St Clair, 1997; Li et al, pRetroSuper was used to infect pancreatic cell lines. In both 1998a). instances, the Phoenix Amphotropic cells (kind gift of Gary Nolan, Here, using a series of pancreatic carcinoma cell lines, we show Stanford University) were transfected using FuGENE 6 (Roche that the relative expression patterns of SOD2 are inversely related Diagnostics, Indianapolis, IN, USA), according to manufacturer’s to the methylation density status of the sod2 promoter. Hyper- instructions. Two days following transfection, 3 ml of viral methylation of CpG sites was rapidly reversed by the methyl- supernatant was used to infect 1–3 Â 106 pancreatic cells. For transferase inhibitor zebularine, restoring SOD2 levels. The overexpression of SOD2, cells were flow sorted for high GFP epigenetic silencing of sod2 revealed a particular Achille’s heel of expression, whereas for shSOD2 and control cells were selected pancreatic carcinoma cells with low SOD2, making the cells with 1 mgmlÀ1 puromycin 48 h post infection. Expression of SOD2 particularly susceptible to the apoptotic effects of 2-methoxy- was determined by western blot (anti-SOD2, ab16954; Abcam, estradiol (2ME2), an oxidative burst agent. Cambridge, MA, USA). To examine the more global consequences of SOD2 expression on the cellular processes of pancreatic carcinoma, we have Determination of superoxide dismutase activity in cell employed a gestalt approach of examining how SOD2 affects vital lines processes of signal-transduction proteins, transcription
Load more

Recommended publications
  • Timing of Antioxidant Gene Therapy: Implications for Treating Dry AMD
    Biochemistry and Molecular Biology Timing of Antioxidant Gene Therapy: Implications for Treating Dry AMD Manas R. Biswal,1 Pingyang Han,1 Ping Zhu,2 Zhaoyang Wang,3 Hong Li,1 Cristhian J. Ildefonso,2 and Alfred S. Lewin1 1Department of Molecular Genetics and Microbiology, University of Florida College of Medicine, Gainesville, Florida, United States 2Department of Ophthalmology, University of Florida College of Medicine, Gainesville, Florida, United States 3Department of Ophthalmology, Shanghai Ninth People’s Hospital, Shanghai Jiaotong University School of Medicine, Huangpu District, Shanghai, China Correspondence: Manas R. Biswal, PURPOSE. To investigate whether antioxidant gene therapy protects the structure and function Department of Molecular Genetics of retina in a murine model of RPE atrophy, and to determine whether antioxidant gene and Microbiology, University of Flor- therapy can prevent degeneration once it has begun. ida College of Medicine, 1200 New- ell Drive, Gainesville, FL 32610, USA; METHODS. We induced mitochondrial oxidative stress in RPE by conditional deletion of Sod2, Biswal@ufl.edu. the gene for manganese superoxide dismutase (MnSOD). These mice exhibited localized Submitted: December 9, 2016 atrophy of the RPE and overlying photoreceptors. We restored Sod2 to the RPE of one eye Accepted: January 23, 2017 using adeno-associated virus (AAV) by subretinal injection at an early (6 weeks) and a late Citation: Biswal MR, Han P, Zhu P, et stage (6 months), injecting the other eye with an AAV vector expressing green fluorescent al. Timing of antioxidant gene thera- protein (GFP). Retinal degeneration was monitored over a period of 9 months by py: implications for treating dry AMD. electroretinography (ERG) and spectral-domain optical coherence tomography (SD-OCT).
    [Show full text]
  • Review on Parkinson's Disease, a Neurodegenerative Disorder And
    ISSN: 2349-8889 International Journal for Research in Applied Sciences and Biotechnology Volume-8, Issue-4 (July 2021) www.ijrasb.com https://doi.org/10.31033/ijrasb.8.4.11 Review on Parkinson’s Disease, a Neurodegenerative Disorder and The Role of Ceruloplasmin Protein in It Ajay Chaudhary1, Noopur Khare2, Yamini Dixit3 and Abhimanyu Kumar Jha4 1Department of Biotechnology, Faculty of Life Sciences, Institute of Applied Medicines and Research, Ghaziabad, Uttar Pradesh, INDIA 2Shri Ramswaroop Memorial University, Barbanki, Uttar Pradesh, INDIA 3Department of Biotechnology, Faculty of Life Sciences, Institute of Applied Medicines and Research, Ghaziabad, Uttar Pradesh, INDIA 4Department of Biotechnology, Faculty of Life Sciences, Institute of Applied Medicines and Research, Ghaziabad, Uttar Pradesh, INDIA 3Corresponding Author: [email protected] ABSTRACT neurodegenerative disease [Gitler et al., 2017]. Increasing Parkinson’s disease (PD), a neurodegenerative Age is the one of the most common risk factor associated disease is becoming major health concern mainly for elder with neurodegenerative disease, especially in case of people of age over 60 years. The main cause of PD is Alzheimer’s and Parkinson’s disease [Przedborski et al., permanent loss/death of dopaminergic nerve cells present in 2003]. In this study, main focus will be the cause of PD brain part called substantia nigra, which is responsible for and ceruloplasmin role in it. dopamine synthesis. MAO-B, monoamine oxidase B, regulates dopamine metabolism and increased activity of Parkinson’s disease MAO-B causes dopamine degradation which in turn Parkinson’s disease (PD) is the second most promotes the accumulation of glutamate and oxidative stress occurring disease after Alzheimer’s disease in elder with free radical liberation.
    [Show full text]
  • Biddau, M. and Sheiner, L. (2019) Targeting the Apicoplast in Malaria. Biochemical Society Transactions, 47(4), Pp. 973-983. (Doi: 10.1042/BST20170563)
    \ Biddau, M. and Sheiner, L. (2019) Targeting the apicoplast in malaria. Biochemical Society Transactions, 47(4), pp. 973-983. (doi: 10.1042/BST20170563) The material cannot be used for any other purpose without further permission of the publisher and is for private use only. There may be differences between this version and the published version. You are advised to consult the publisher’s version if you wish to cite from it. http://eprints.gla.ac.uk/191922/ Deposited on 07 August 2019 Enlighten – Research publications by members of the University of Glasgow http://eprints.gla.ac.uk 1 Targeting the apicoplast in malaria 2 3 Marco Biddau1* and Lilach Sheiner1* 4 5 1 Wellcome Centre for Integrative Parasitology, University of Glasgow, 120 University Place 6 Glasgow, United Kingdom. 7 8 *corresponding authors: [email protected]; [email protected] 9 10 Abbreviations aaRS aminoacyl-tRNA synthetase ABCF1 ATP-binding cassette protein F1 ACT Artemisinin-based combination therapy ATG Autophagy-related protein ATrxs Apicoplast thioredoxins Clp Caseinolytic protease DMT2 Divalent metal transporter 2 EF-G Elongator factor G EF-Tu Elongator factor thermo unstable FASII Fatty acid synthesis type II GGPP Geranylgeranyl pyrophosphate IPP Isopentenyl pyrophosphate ISC Iron-Sulfur cluster biosynthesis MMV Medicines for Malaria Venture 11 12 Abstract 13 Malaria continues to be one of the leading causes of human mortality in the world, and 14 the therapies available are insufficient for eradication. Malaria is caused by the 15 apicomplexan parasite Plasmodium. Apicomplexan parasites, including the 16 Plasmodium spp., are descendants of photosynthetic algae, and therefore they possess 17 an essential plastid organelle, named the apicoplast.
    [Show full text]
  • Role of Rim101p in the Ph Response in Candida Albicans Michael Weyler
    Role of Rim101p in the pH response in Candida albicans Michael Weyler To cite this version: Michael Weyler. Role of Rim101p in the pH response in Candida albicans. Biomolecules [q-bio.BM]. Université Paris Sud - Paris XI, 2007. English. tel-00165802 HAL Id: tel-00165802 https://tel.archives-ouvertes.fr/tel-00165802 Submitted on 27 Jul 2007 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. UNIVERSITE PARISXI UFR SCIENTIFIQUE D’ORSAY THESE présentée par Michael Weyler pour obtenir le grade de DOCTEUR EN SCIENCES DE L’UNIVERSITE PARISXI-ORSAY LE RÔLE DE RIM101p DANS LA RÉPONSE AU pH CHEZ CANDIDA ALBICANS Soutenance prévue le 6 juillet 2007 devant le jury composé de: Pr. Dr. H. Delacroix Président Dr. J-M. Camadro Rapporteur Pr. Dr. F. M. Klis Rapporteur Dr. G. Janbon Examinateur Dr. M. Lavie-Richard Examinateur Pr. Dr. C. Gaillardin Examinateur Remerciements Tout d’abord je voudrais remercier vivement mon directeur de thèse, Prof. Claude Gaillardin, pour m’avoir permis d’effectuer ce travail au sein de son laboratoire, pour ses conseils et sa disponibilité malgré son calendrier bien remplis. Je lui remercie également pour m’avoir laissé beaucoup de liberté dans mon travail, et pour la possibilité de participer aux différents congrès au cours de ma formation de thèse.
    [Show full text]
  • Mitochondrial Genetics
    Mitochondrial genetics Patrick Francis Chinnery and Gavin Hudson* Institute of Genetic Medicine, International Centre for Life, Newcastle University, Central Parkway, Newcastle upon Tyne NE1 3BZ, UK Introduction: In the last 10 years the field of mitochondrial genetics has widened, shifting the focus from rare sporadic, metabolic disease to the effects of mitochondrial DNA (mtDNA) variation in a growing spectrum of human disease. The aim of this review is to guide the reader through some key concepts regarding mitochondria before introducing both classic and emerging mitochondrial disorders. Sources of data: In this article, a review of the current mitochondrial genetics literature was conducted using PubMed (http://www.ncbi.nlm.nih.gov/pubmed/). In addition, this review makes use of a growing number of publically available databases including MITOMAP, a human mitochondrial genome database (www.mitomap.org), the Human DNA polymerase Gamma Mutation Database (http://tools.niehs.nih.gov/polg/) and PhyloTree.org (www.phylotree.org), a repository of global mtDNA variation. Areas of agreement: The disruption in cellular energy, resulting from defects in mtDNA or defects in the nuclear-encoded genes responsible for mitochondrial maintenance, manifests in a growing number of human diseases. Areas of controversy: The exact mechanisms which govern the inheritance of mtDNA are hotly debated. Growing points: Although still in the early stages, the development of in vitro genetic manipulation could see an end to the inheritance of the most severe mtDNA disease. Keywords: mitochondria/genetics/mitochondrial DNA/mitochondrial disease/ mtDNA Accepted: April 16, 2013 Mitochondria *Correspondence address. The mitochondrion is a highly specialized organelle, present in almost all Institute of Genetic Medicine, International eukaryotic cells and principally charged with the production of cellular Centre for Life, Newcastle energy through oxidative phosphorylation (OXPHOS).
    [Show full text]
  • Arsenic Hexoxide Has Differential Effects on Cell Proliferation And
    www.nature.com/scientificreports OPEN Arsenic hexoxide has diferential efects on cell proliferation and genome‑wide gene expression in human primary mammary epithelial and MCF7 cells Donguk Kim1,7, Na Yeon Park2,7, Keunsoo Kang3, Stuart K. Calderwood4, Dong‑Hyung Cho2, Ill Ju Bae5* & Heeyoun Bunch1,6* Arsenic is reportedly a biphasic inorganic compound for its toxicity and anticancer efects in humans. Recent studies have shown that certain arsenic compounds including arsenic hexoxide (AS4O6; hereafter, AS6) induce programmed cell death and cell cycle arrest in human cancer cells and murine cancer models. However, the mechanisms by which AS6 suppresses cancer cells are incompletely understood. In this study, we report the mechanisms of AS6 through transcriptome analyses. In particular, the cytotoxicity and global gene expression regulation by AS6 were compared in human normal and cancer breast epithelial cells. Using RNA‑sequencing and bioinformatics analyses, diferentially expressed genes in signifcantly afected biological pathways in these cell types were validated by real‑time quantitative polymerase chain reaction and immunoblotting assays. Our data show markedly diferential efects of AS6 on cytotoxicity and gene expression in human mammary epithelial normal cells (HUMEC) and Michigan Cancer Foundation 7 (MCF7), a human mammary epithelial cancer cell line. AS6 selectively arrests cell growth and induces cell death in MCF7 cells without afecting the growth of HUMEC in a dose‑dependent manner. AS6 alters the transcription of a large number of genes in MCF7 cells, but much fewer genes in HUMEC. Importantly, we found that the cell proliferation, cell cycle, and DNA repair pathways are signifcantly suppressed whereas cellular stress response and apoptotic pathways increase in AS6‑treated MCF7 cells.
    [Show full text]
  • Oxidative Stress and Immune System Dysfunction in Autism Spectrum Disorders
    International Journal of Molecular Sciences Review Oxidative Stress and Immune System Dysfunction in Autism Spectrum Disorders Luca Pangrazzi *, Luigi Balasco and Yuri Bozzi Center for Mind/Brain Sciences (CIMeC), University of Trento, 38068 Rovereto, Italy; [email protected] (L.B.); [email protected] (Y.B.) * Correspondence: [email protected] Received: 10 April 2020; Accepted: 4 May 2020; Published: 6 May 2020 Abstract: Autism Spectrum Disorders (ASDs) represent a group of neurodevelopmental disorders associated with social and behavioral impairments. Although dysfunctions in several signaling pathways have been associated with ASDs, very few molecules have been identified as potentially effective drug targets in the clinic. Classically, research in the ASD field has focused on the characterization of pathways involved in neural development and synaptic plasticity, which support the pathogenesis of this group of diseases. More recently, immune system dysfunctions have been observed in ASD. In addition, high levels of reactive oxygen species (ROS), which cause oxidative stress, are present in ASD patients. In this review, we will describe the major alterations in the expression of genes coding for enzymes involved in the ROS scavenging system, in both ASD patients and ASD mouse models. In addition, we will discuss, in the context of the most recent literature, the possibility that oxidative stress, inflammation and immune system dysfunction may be connected to, and altogether support, the pathogenesis and/or severity of ASD. Finally, we will discuss the possibility of novel treatments aimed at counteracting the interplay between ROS and inflammation in people with ASD. Keywords: ROS; inflammation; ASD; autism; immune system 1.
    [Show full text]
  • SOD2 Acetylation and Deacetylation: Another Tale of Jekyll and Hyde in Cancer
    COMMENTARY COMMENTARY SOD2 acetylation and deacetylation: Another tale of Jekyll and Hyde in cancer Anita B. Hjelmelanda,b and Rakesh P. Patela,c,1 Subsets of highly invasive, therapy-resistant tumor tumor-suppressive and -promoting functions have been cells contribute to the development of metastasis and described (13). At physiologic levels, SOD2 is antitu- treatment failures. Recent evidence suggests that these morigenic; lower dismutase activity leads to stabiliza- tumor cell subsets are enriched for cancer stem cells tion of HIF1α and underlies cancer cell adaptation to (CSCs) (1–3). Similar to nonneoplastic stem cells, CSCs hypoxia (14). However, SOD2 expression is elevated express specific markers and transcription factors and in many cancers, and sites of metastasis have higher can self-renew or differentiate. For example, breast SOD2 levels compared to primary tumors (15–18). If CSCs are identified as positive for CD44, ALDH1 activ- SOD2 is an antioxidant, why does its overexpression ity, and/or expressing SOX2, OCT4, or Nanog (4). Com- not confer greater protection, but instead result in a pared to bulk tumor cells, CSCs are often more resistant flipping of its function to a procancer role? Insights to cell death, including that induced by chemo- or ra- into this conundrum are provided by He et al. (10). diotherapy. Furthermore, CSCs are metabolically plastic They show that CSC gene expression signatures were with different redox states associated with epithelial- or greater in SOD2-overexpressing MCF7 cells (breast mesenchymal-like breast CSCs (5). Hypoxia is an impor- cancer-derived epithelial cells) compared to paren- tant inducer of CSC phenotypes, and hypoxia-inducible tal controls.
    [Show full text]
  • SOD2 Deficiency in Cardiomyocytes Defines Defective Mitochondrial Bioenergetics As a Cause of Lethal Dilated Cardiomyopathy
    University of Kentucky UKnowledge Toxicology and Cancer Biology Faculty Publications Toxicology and Cancer Biology 10-2020 SOD2 Deficiency in Cardiomyocytes Defines Defective Mitochondrial Bioenergetics as a Cause of Lethal Dilated Cardiomyopathy Sudha Sharma Louisiana State University Susmita Bhattarai Louisiana State University Hosne Ara Louisiana State University Grace Sun Louisiana State University Daret K. St. Clair University of Kentucky, [email protected] Follow this and additional works at: https://uknowledge.uky.edu/toxicology_facpub Part of the Cardiology Commons, and the Medical Toxicology Commons See next page for additional authors Right click to open a feedback form in a new tab to let us know how this document benefits ou.y Repository Citation Sharma, Sudha; Bhattarai, Susmita; Ara, Hosne; Sun, Grace; St. Clair, Daret K.; Bhuiyan, Md Shenuarin; Kevil, Christopher; Watts, Megan N.; Dominic, Paari; Shimizu, Takahiko; McCarthy, Kevin J.; Sun, Hong; Panchatcharam, Manikandan; and Miriyala, Sumitra, "SOD2 Deficiency in Cardiomyocytes Defines Defective Mitochondrial Bioenergetics as a Cause of Lethal Dilated Cardiomyopathy" (2020). Toxicology and Cancer Biology Faculty Publications. 96. https://uknowledge.uky.edu/toxicology_facpub/96 This Article is brought to you for free and open access by the Toxicology and Cancer Biology at UKnowledge. It has been accepted for inclusion in Toxicology and Cancer Biology Faculty Publications by an authorized administrator of UKnowledge. For more information, please contact [email protected]. SOD2 Deficiency in Cardiomyocytes Defines Defective Mitochondrial Bioenergetics as a Cause of Lethal Dilated Cardiomyopathy Digital Object Identifier (DOI) https://doi.org/10.1016/j.redox.2020.101740 Notes/Citation Information Published in Redox Biology, v. 37, 101740.
    [Show full text]
  • Peroxiredoxin 1 (Prx1) Is a Dual Function Enzyme by Possessing Cys
    BIOCHEMICAL JOURNAL ACCEPTED MANUSCRIPT Peroxiredoxin 1 (Prx1) is a dual-function enzyme by possessing Cys-independent catalase-like activity Cen-Cen Sun, Wei-Ren Dong, Tong Shao, Jiang-Yuan Li, Jing Zhao, Li Nie, Li-Xin Xiang, Guan Zhu, Jian-Zhong Shao Peroxiredoxin (Prx) was previously known as a Cys-dependent thioredoxin. However, we unexpected observed that Prx1 from the green spotted puffer fish Tetraodon nigroviridis (TnPrx1) was able to reduce H2O2 in a manner independent on the Cys peroxidation and reductants. This study aimed to validate the novel function for Prx1, delineate the biochemical features and explore its antioxidant role in cells. We have confirmed that Prx1 from the puffer fish and humans truly possesses a catalase-like activity that is independent of Cys residues and reductants, but dependent on iron. We have identified that the GVL motif was essential to the catalase-like (CAT) activity of Prx1, but not to the Cys-dependent thioredoxin peroxidase (POX) activity, and generated mutants lacking POX and/or CAT activities for individual functional validation. We discovered that the TnPrx1 POX and CAT activities possessed different kinetic features in reducing H2O2. The overexpression of wild-type TnPrx1 and mutants differentially regulated the intracellular levels of reactive oxygen species (ROS) and the phosphorylation of p38 in HEK-293T cells treated with H2O2. Prx1 is a dual function enzyme by acting as POX and CAT with varied affinities towards ROS. This study extends our knowledge on Prx1 and provides new opportunities to further study the biological roles of this family of antioxidants. Cite as Biochemical Journal (2017) DOI: 10.1042/BCJ20160851 Copyright 2017 The Author(s).
    [Show full text]
  • A Strategy to Address Dissociation-Induced Compositional and Transcriptional Bias for Single-Cell Analysis of the Human Mammary Gland
    bioRxiv preprint doi: https://doi.org/10.1101/2021.02.11.430721; this version posted February 11, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. A strategy to address dissociation-induced compositional and transcriptional bias for single-cell analysis of the human mammary gland Lisa K. Engelbrecht1,9,*,‡, Alecia-Jane Twigger1,2,*, Hilary M. Ganz1, Christian J. Gabka4, Andreas R. Bausch5,8, Heiko Lickert6,7,8, Michael Sterr6, Ines Kunze6, Walid T. Khaled2,3 & Christina H. Scheel1,10,‡ Affiliations 1 Institute of Stem Cell Research, Helmholtz Center for Health and Environmental Research Munich, Neuherberg 85764, Germany 2 Department of Pharmacology, University of Cambridge, Cambridge CB2 1PD, UK 3 Cancer Research UK Cambridge Cancer Center, Cambridge CB2 0RE, UK 4 Nymphenburg Clinic for Plastic and Aesthetic Surgery, Munich 80637, Germany 5 Chair of Biophysics E27, Technical University Munich, 85747 Garching, Germany 6 Institute of Diabetes and Regeneration Research, Helmholtz Center for Health and Environmental Research Munich, Neuherberg 85764, Germany 7 German Center for Diabetes Research (DZD), 85764 Neuherberg, Germany 8 Technical University of Munich, 80333 Munich, Germany. 9 Present address: Chair of Biophysics E27, Technical University Munich, 85747 Garching, Germany 10 Present address: Department of Dermatology, St. Josef Hospital, Ruhr-University Bochum, 44791 Bochum, Germany * These authors contributed equally to this work. ‡ Corresponding author. Correspondence to: [email protected] or [email protected] 1 bioRxiv preprint doi: https://doi.org/10.1101/2021.02.11.430721; this version posted February 11, 2021.
    [Show full text]
  • Association of Genetic Polymorphisms in SOD2, SOD3, GPX3, and GSTT1
    Association of genetic polymorphisms in SOD2, SOD3, GPX3, and GSTT1 with hypertriglyceridemia and low HDL-C level in subjects with high risk of coronary artery disease Nisa Decharatchakul1,2, Chatri Settasatian2,3, Nongnuch Settasatian2,4, Nantarat Komanasin2,4, Upa Kukongviriyapan2,5, Phongsak Intharaphet2,6 and Vichai Senthong2,6,7 1 Biomedical Sciences Program, Graduate School, Khon Kaen University, Khon Kaen, Thailand 2 Cardiovascular Research Group, Khon Kaen University, Khon Kaen, Thailand 3 Department of Pathology, Faculty of Medicine, Khon Kaen University, Khon Kaen, Thailand 4 School of Medical Technology, Faculty of Associated Medical Sciences, Khon Kaen University, Khon Kaen, Thailand 5 Department of Physiology, Faculty of Medicine, Khon Kaen University, Khon Kaen, Thailand 6 Queen Sirikit Heart Center of the Northeast, Khon Kaen University, Khon Kaen, Thailand 7 Department of Internal Medicine, Faculty of Medicine, Khon Kaen University, Khon Kaen, Thailand ABSTRACT Background. Oxidative stress modulates insulin resistant-related atherogenic dys- lipidemia: hypertriglyceridemia (HTG) and low high-density lipoprotein cholesterol (HDL-C) level. Gene polymorphisms in superoxide dismutase (SOD2 and SOD3), glutathione peroxidase-3 (GPX3), and glutathione S-transferase theta-1 (GSTT1) may enable oxidative stress-related lipid abnormalities and severity of coronary atherosclerosis. The present study investigated the associations of antioxidant-related gene polymorphisms with atherogenic dyslipidemia and atherosclerotic severity in subjects with high risk of coronary artery disease (CAD). Submitted 13 April 2019 Methods. Study population comprises of 396 subjects with high risk of CAD. Gene Accepted 4 July 2019 Published 1 August 2019 polymorphisms: SOD2 rs4880, SOD3 rs2536512 and rs2855262, GPX rs3828599, and GSTT1 (deletion) were evaluated the associations with HTG, low HDL-C, high Corresponding author Chatri Settasatian, [email protected], TG/HDL-C ratio, and severity of coronary atherosclerosis.
    [Show full text]