DOCSLIB.ORG

SOD2 Deficiency in Cardiomyocytes Defines Defective Mitochondrial Bioenergetics As a Cause of Lethal Dilated Cardiomyopathy

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
SOD2 Deficiency in Cardiomyocytes Defines Defective Mitochondrial Bioenergetics As a Cause of Lethal Dilated Cardiomyopathy University of Kentucky UKnowledge Toxicology and Cancer Biology Faculty Publications Toxicology and Cancer Biology 10-2020 SOD2 Deficiency in Cardiomyocytes Defines Defective Mitochondrial Bioenergetics as a Cause of Lethal Dilated Cardiomyopathy Sudha Sharma Louisiana State University Susmita Bhattarai Louisiana State University Hosne Ara Louisiana State University Grace Sun Louisiana State University Daret K. St. Clair University of Kentucky, [email protected] Follow this and additional works at: https://uknowledge.uky.edu/toxicology_facpub Part of the Cardiology Commons, and the Medical Toxicology Commons See next page for additional authors Right click to open a feedback form in a new tab to let us know how this document benefits ou.y Repository Citation Sharma, Sudha; Bhattarai, Susmita; Ara, Hosne; Sun, Grace; St. Clair, Daret K.; Bhuiyan, Md Shenuarin; Kevil, Christopher; Watts, Megan N.; Dominic, Paari; Shimizu, Takahiko; McCarthy, Kevin J.; Sun, Hong; Panchatcharam, Manikandan; and Miriyala, Sumitra, "SOD2 Deficiency in Cardiomyocytes Defines Defective Mitochondrial Bioenergetics as a Cause of Lethal Dilated Cardiomyopathy" (2020). Toxicology and Cancer Biology Faculty Publications. 96. https://uknowledge.uky.edu/toxicology_facpub/96 This Article is brought to you for free and open access by the Toxicology and Cancer Biology at UKnowledge. It has been accepted for inclusion in Toxicology and Cancer Biology Faculty Publications by an authorized administrator of UKnowledge. For more information, please contact [email protected]. SOD2 Deficiency in Cardiomyocytes Defines Defective Mitochondrial Bioenergetics as a Cause of Lethal Dilated Cardiomyopathy Digital Object Identifier (DOI) https://doi.org/10.1016/j.redox.2020.101740 Notes/Citation Information Published in Redox Biology, v. 37, 101740. © 2020 The Authors This is an open access article under the CC BY-NC-ND license (https://creativecommons.org/licenses/by- nc-nd/4.0/). Authors Sudha Sharma, Susmita Bhattarai, Hosne Ara, Grace Sun, Daret K. St. Clair, Md Shenuarin Bhuiyan, Christopher Kevil, Megan N. Watts, Paari Dominic, Takahiko Shimizu, Kevin J. McCarthy, Hong Sun, Manikandan Panchatcharam, and Sumitra Miriyala This article is available at UKnowledge: https://uknowledge.uky.edu/toxicology_facpub/96 Redox Biology 37 (2020) 101740 Contents lists available at ScienceDirect Redox Biology journal homepage: www.elsevier.com/locate/redox SOD2 deficiency in cardiomyocytes defines defective mitochondrial bioenergetics as a cause of lethal dilated cardiomyopathy Sudha Sharma a, Susmita Bhattarai a, Hosne Ara a, Grace Sun a, Daret K. St Clair b, Md Shenuarin Bhuiyan c, Christopher Kevil c, Megan N. Watts d, Paari Dominic d, Takahiko Shimizu e, Kevin J. McCarthy a, Hong Sun a, Manikandan Panchatcharam a,**, Sumitra Miriyala a,* a Department of Cellular Biology and Anatomy, Louisiana State University Health Sciences Center, Shreveport, LA, USA b Department of Toxicology and Cancer Biology, College of Medicine, University of Kentucky, Lexington, KY, USA c Department of Pathology and Translational Pathobiology, Louisiana State University Health Sciences Center, Shreveport, LA, USA d Division of Cardiology, Department of Medicine, Louisiana State University Health Sciences Center, Shreveport, LA, USA e National Center for Geriatrics and Gerontology, 7-430, Morioka, Obu Aichi, Japan ARTICLE INFO ABSTRACT Keywords: Electrophilic aldehyde (4-hydroxynonenal; 4-HNE), formed after lipid peroxidation, is a mediator of mito­ Heart failure chondrial dysfunction and implicated in both the pathogenesis and the progression of cardiovascular disease. Manganese superoxide dismutase Manganese superoxide dismutase (MnSOD), a nuclear-encoded antioxidant enzyme, catalyzes the dismutation of Superoxide radicals •- superoxide radicals (O2 ) in mitochondria. To study the role of MnSOD in the myocardium, we generated a cardiomyocyte-specific SOD2 (SOD2Δ) deficient mouse strain. Unlike global SOD2 knockout mice, SOD2Δ mice reached adolescence; however, they die at ~4 months of age due to heart failure. Ultrastructural analysis of SOD2Δ hearts revealed altered mitochondrial architecture, with prominent disruption of the cristae and vacuole Δ formation. Noninvasive echocardiographic measurements in SOD2 mice showed dilated cardiomyopathic fea­ tures such as decreased ejection fraction and fractional shortening along with increased left ventricular internal diameter. An increased incidence of ventricular tachycardia was observed during electrophysiological studies of the heart in SOD2Δ mice. Oxidative phosphorylation (OXPHOS) measurement using a Seahorse XF analyzer in SOD2Δ neonatal cardiomyocytes and adult cardiac mitochondria displayed reduced O2 consumption, particularly + during basal conditions and after the addition of FCCP (H ionophore/uncoupler), compared to that in SOD2fl hearts. Measurement of extracellular acidification (ECAR) to examine glycolysis in these cells showed a pattern precisely opposite that of the oxygen consumption rate (OCR) among SOD2Δ mice compared to their SOD2fl littermates. Analysis of the activity of the electron transport chain complex identified a reduction in Complex I and Complex V activity in SOD2Δ compared to SOD2fl mice. We demonstrated that a deficiency of SOD2 in­ creases reactive oxygen species (ROS), leading to subsequent overproduction of 4-HNE inside mitochondria. Mechanistically, proteins in the mitochondrial respiratory chain complex and TCA cycle (NDUFS2, SDHA, ATP5B, and DLD) were the target of 4-HNE adduction in SOD2Δ hearts. Our findings suggest that the SOD2 mediated 4-HNE signaling nexus may play an important role in cardiomyopathy. 1. Introduction conditions such as hypertension, valvular heart disease, or coronary artery disease [1]. Both genetic and non-genetic factors are associated Dilated cardiomyopathy (DCM), a significant risk factor for heart with this disease, and evidence suggests that various proteins located in failure, is characterized by enlargement of the left ventricle with the mitochondria responsible for energy metabolism and other functions impaired systolic function in the absence of underlying systemic are involved in its initiation and progression [2]. Recently, a SOD2 * Corresponding author. Department of Cellular Biology and Anatomy, LSUHSC-Shreveport, PO Box 33932, Shreveport, LA, 71130-3932, USA. ** Corresponding author. Department of Cellular Biology and Anatomy, LSUHSC-Shreveport, PO Box 33932, Shreveport, LA, 71130-3932, USA.. E-mail addresses: [email protected] (M. Panchatcharam), [email protected] (S. Miriyala). https://doi.org/10.1016/j.redox.2020.101740 Received 16 July 2020; Received in revised form 1 September 2020; Accepted 23 September 2020 Available online 30 September 2020 2213-2317/© 2020 The Authors. Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/). S. Sharma et al. Redox Biology 37 (2020) 101740 homozygous variant was identified as a causative factor for lethal P1=CGAGGGGCATCTAGTGGAGAAG, P2 = TTAGGGCTCAGGTTTGT dilated cardiomyopathy in humans where the homozygous missense CCAGAA, and P4 = AGCTTGGCTGGACGTAA. P1 and P2 were used for variant, c.542 g > t, p. (gly181Val), was observed in the SOD2 gene. This wild type and P1 and P4 for flox genotyping. CRE1 = GCGGTC points to the potential role played by oxidative stress in the etiology and TGGCAGTAAAAACTATC and CRE2 = GTGAAACAGCATTGCTG pathogenesis of dilated cardiomyopathy [3]. TCACTT were used for genotyping Cre recombinase. The PCR was car­ Mitochondria perform several roles to maintain cellular function. ried out using a thermocycler (PTC-200 MJ Research). + They are producers of ATP, involved in cellular Ca2 homeostasis, and mediate apoptosis. The electron transport chain, comprising five mul­ tiprotein complexes (I–V), is embedded in the inner mitochondrial 2.2. Echocardiography and electrophysiological studies + membrane, and a series of electron transfers and H translocation occurs via the actions of these complexes to generate ATP. In addition, mito­ Mice were anesthetized with isoflurane (0.8%) and the fur from the chondria are a major contributor to the generation of reactive oxygen mid-neckline to the mid-chest level was removed using a hair remover species (ROS) via the respiratory complex under physiological condi­ (Nair). Transthoracic echocardiography was carried out on both SOD2fl tions [4,5]. Mitochondrial abnormalities related to ROS production, and SOD2Δ mice using a 30 MHz probe with Vevo 3100 Ultrasonograph mitochondrial bioenergetics, mitochondrial dynamics, and the mito­ (VisualSonics). The echocardiography procedures were performed in chondrial ability to buffer ions have been linked to heart failure. Given mice while maintaining heart rate, respiratory rate, and body temper­ that mitochondrial bioenergetics and ROS are closely related, it is ature within standard limits. Ventricular dimensions were measured on imperative to address these aspects of mitochondrial dysfunction M-mode images. The formula [(LVID; d - LVID; s) ÷ LVID; d] x 100 was together to understand the mechanism of heart failure [6]. The inner used to calculate percent fractional shortening (%FS). Electrophysio­ mitochondrial membrane is made up of a unique phospholipid called logical studies were performed in mice, as previously described [13]. cardiolipin; mammalian cardiolipin occurs in the form of the dimer Four-month-old SOD2fl and SOD2Δ mice were used for
Load more

Recommended publications
  • Timing of Antioxidant Gene Therapy: Implications for Treating Dry AMD
    Biochemistry and Molecular Biology Timing of Antioxidant Gene Therapy: Implications for Treating Dry AMD Manas R. Biswal,1 Pingyang Han,1 Ping Zhu,2 Zhaoyang Wang,3 Hong Li,1 Cristhian J. Ildefonso,2 and Alfred S. Lewin1 1Department of Molecular Genetics and Microbiology, University of Florida College of Medicine, Gainesville, Florida, United States 2Department of Ophthalmology, University of Florida College of Medicine, Gainesville, Florida, United States 3Department of Ophthalmology, Shanghai Ninth People’s Hospital, Shanghai Jiaotong University School of Medicine, Huangpu District, Shanghai, China Correspondence: Manas R. Biswal, PURPOSE. To investigate whether antioxidant gene therapy protects the structure and function Department of Molecular Genetics of retina in a murine model of RPE atrophy, and to determine whether antioxidant gene and Microbiology, University of Flor- therapy can prevent degeneration once it has begun. ida College of Medicine, 1200 New- ell Drive, Gainesville, FL 32610, USA; METHODS. We induced mitochondrial oxidative stress in RPE by conditional deletion of Sod2, Biswal@ufl.edu. the gene for manganese superoxide dismutase (MnSOD). These mice exhibited localized Submitted: December 9, 2016 atrophy of the RPE and overlying photoreceptors. We restored Sod2 to the RPE of one eye Accepted: January 23, 2017 using adeno-associated virus (AAV) by subretinal injection at an early (6 weeks) and a late Citation: Biswal MR, Han P, Zhu P, et stage (6 months), injecting the other eye with an AAV vector expressing green fluorescent al. Timing of antioxidant gene thera- protein (GFP). Retinal degeneration was monitored over a period of 9 months by py: implications for treating dry AMD. electroretinography (ERG) and spectral-domain optical coherence tomography (SD-OCT).
    [Show full text]
  • Review on Parkinson's Disease, a Neurodegenerative Disorder And
    ISSN: 2349-8889 International Journal for Research in Applied Sciences and Biotechnology Volume-8, Issue-4 (July 2021) www.ijrasb.com https://doi.org/10.31033/ijrasb.8.4.11 Review on Parkinson’s Disease, a Neurodegenerative Disorder and The Role of Ceruloplasmin Protein in It Ajay Chaudhary1, Noopur Khare2, Yamini Dixit3 and Abhimanyu Kumar Jha4 1Department of Biotechnology, Faculty of Life Sciences, Institute of Applied Medicines and Research, Ghaziabad, Uttar Pradesh, INDIA 2Shri Ramswaroop Memorial University, Barbanki, Uttar Pradesh, INDIA 3Department of Biotechnology, Faculty of Life Sciences, Institute of Applied Medicines and Research, Ghaziabad, Uttar Pradesh, INDIA 4Department of Biotechnology, Faculty of Life Sciences, Institute of Applied Medicines and Research, Ghaziabad, Uttar Pradesh, INDIA 3Corresponding Author: [email protected] ABSTRACT neurodegenerative disease [Gitler et al., 2017]. Increasing Parkinson’s disease (PD), a neurodegenerative Age is the one of the most common risk factor associated disease is becoming major health concern mainly for elder with neurodegenerative disease, especially in case of people of age over 60 years. The main cause of PD is Alzheimer’s and Parkinson’s disease [Przedborski et al., permanent loss/death of dopaminergic nerve cells present in 2003]. In this study, main focus will be the cause of PD brain part called substantia nigra, which is responsible for and ceruloplasmin role in it. dopamine synthesis. MAO-B, monoamine oxidase B, regulates dopamine metabolism and increased activity of Parkinson’s disease MAO-B causes dopamine degradation which in turn Parkinson’s disease (PD) is the second most promotes the accumulation of glutamate and oxidative stress occurring disease after Alzheimer’s disease in elder with free radical liberation.
    [Show full text]
  • Biddau, M. and Sheiner, L. (2019) Targeting the Apicoplast in Malaria. Biochemical Society Transactions, 47(4), Pp. 973-983. (Doi: 10.1042/BST20170563)
    \ Biddau, M. and Sheiner, L. (2019) Targeting the apicoplast in malaria. Biochemical Society Transactions, 47(4), pp. 973-983. (doi: 10.1042/BST20170563) The material cannot be used for any other purpose without further permission of the publisher and is for private use only. There may be differences between this version and the published version. You are advised to consult the publisher’s version if you wish to cite from it. http://eprints.gla.ac.uk/191922/ Deposited on 07 August 2019 Enlighten – Research publications by members of the University of Glasgow http://eprints.gla.ac.uk 1 Targeting the apicoplast in malaria 2 3 Marco Biddau1* and Lilach Sheiner1* 4 5 1 Wellcome Centre for Integrative Parasitology, University of Glasgow, 120 University Place 6 Glasgow, United Kingdom. 7 8 *corresponding authors: [email protected]; [email protected] 9 10 Abbreviations aaRS aminoacyl-tRNA synthetase ABCF1 ATP-binding cassette protein F1 ACT Artemisinin-based combination therapy ATG Autophagy-related protein ATrxs Apicoplast thioredoxins Clp Caseinolytic protease DMT2 Divalent metal transporter 2 EF-G Elongator factor G EF-Tu Elongator factor thermo unstable FASII Fatty acid synthesis type II GGPP Geranylgeranyl pyrophosphate IPP Isopentenyl pyrophosphate ISC Iron-Sulfur cluster biosynthesis MMV Medicines for Malaria Venture 11 12 Abstract 13 Malaria continues to be one of the leading causes of human mortality in the world, and 14 the therapies available are insufficient for eradication. Malaria is caused by the 15 apicomplexan parasite Plasmodium. Apicomplexan parasites, including the 16 Plasmodium spp., are descendants of photosynthetic algae, and therefore they possess 17 an essential plastid organelle, named the apicoplast.
    [Show full text]
  • Role of Rim101p in the Ph Response in Candida Albicans Michael Weyler
    Role of Rim101p in the pH response in Candida albicans Michael Weyler To cite this version: Michael Weyler. Role of Rim101p in the pH response in Candida albicans. Biomolecules [q-bio.BM]. Université Paris Sud - Paris XI, 2007. English. tel-00165802 HAL Id: tel-00165802 https://tel.archives-ouvertes.fr/tel-00165802 Submitted on 27 Jul 2007 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. UNIVERSITE PARISXI UFR SCIENTIFIQUE D’ORSAY THESE présentée par Michael Weyler pour obtenir le grade de DOCTEUR EN SCIENCES DE L’UNIVERSITE PARISXI-ORSAY LE RÔLE DE RIM101p DANS LA RÉPONSE AU pH CHEZ CANDIDA ALBICANS Soutenance prévue le 6 juillet 2007 devant le jury composé de: Pr. Dr. H. Delacroix Président Dr. J-M. Camadro Rapporteur Pr. Dr. F. M. Klis Rapporteur Dr. G. Janbon Examinateur Dr. M. Lavie-Richard Examinateur Pr. Dr. C. Gaillardin Examinateur Remerciements Tout d’abord je voudrais remercier vivement mon directeur de thèse, Prof. Claude Gaillardin, pour m’avoir permis d’effectuer ce travail au sein de son laboratoire, pour ses conseils et sa disponibilité malgré son calendrier bien remplis. Je lui remercie également pour m’avoir laissé beaucoup de liberté dans mon travail, et pour la possibilité de participer aux différents congrès au cours de ma formation de thèse.
    [Show full text]
  • Mitochondrial Genetics
    Mitochondrial genetics Patrick Francis Chinnery and Gavin Hudson* Institute of Genetic Medicine, International Centre for Life, Newcastle University, Central Parkway, Newcastle upon Tyne NE1 3BZ, UK Introduction: In the last 10 years the field of mitochondrial genetics has widened, shifting the focus from rare sporadic, metabolic disease to the effects of mitochondrial DNA (mtDNA) variation in a growing spectrum of human disease. The aim of this review is to guide the reader through some key concepts regarding mitochondria before introducing both classic and emerging mitochondrial disorders. Sources of data: In this article, a review of the current mitochondrial genetics literature was conducted using PubMed (http://www.ncbi.nlm.nih.gov/pubmed/). In addition, this review makes use of a growing number of publically available databases including MITOMAP, a human mitochondrial genome database (www.mitomap.org), the Human DNA polymerase Gamma Mutation Database (http://tools.niehs.nih.gov/polg/) and PhyloTree.org (www.phylotree.org), a repository of global mtDNA variation. Areas of agreement: The disruption in cellular energy, resulting from defects in mtDNA or defects in the nuclear-encoded genes responsible for mitochondrial maintenance, manifests in a growing number of human diseases. Areas of controversy: The exact mechanisms which govern the inheritance of mtDNA are hotly debated. Growing points: Although still in the early stages, the development of in vitro genetic manipulation could see an end to the inheritance of the most severe mtDNA disease. Keywords: mitochondria/genetics/mitochondrial DNA/mitochondrial disease/ mtDNA Accepted: April 16, 2013 Mitochondria *Correspondence address. The mitochondrion is a highly specialized organelle, present in almost all Institute of Genetic Medicine, International eukaryotic cells and principally charged with the production of cellular Centre for Life, Newcastle energy through oxidative phosphorylation (OXPHOS).
    [Show full text]
  • Arsenic Hexoxide Has Differential Effects on Cell Proliferation And
    www.nature.com/scientificreports OPEN Arsenic hexoxide has diferential efects on cell proliferation and genome‑wide gene expression in human primary mammary epithelial and MCF7 cells Donguk Kim1,7, Na Yeon Park2,7, Keunsoo Kang3, Stuart K. Calderwood4, Dong‑Hyung Cho2, Ill Ju Bae5* & Heeyoun Bunch1,6* Arsenic is reportedly a biphasic inorganic compound for its toxicity and anticancer efects in humans. Recent studies have shown that certain arsenic compounds including arsenic hexoxide (AS4O6; hereafter, AS6) induce programmed cell death and cell cycle arrest in human cancer cells and murine cancer models. However, the mechanisms by which AS6 suppresses cancer cells are incompletely understood. In this study, we report the mechanisms of AS6 through transcriptome analyses. In particular, the cytotoxicity and global gene expression regulation by AS6 were compared in human normal and cancer breast epithelial cells. Using RNA‑sequencing and bioinformatics analyses, diferentially expressed genes in signifcantly afected biological pathways in these cell types were validated by real‑time quantitative polymerase chain reaction and immunoblotting assays. Our data show markedly diferential efects of AS6 on cytotoxicity and gene expression in human mammary epithelial normal cells (HUMEC) and Michigan Cancer Foundation 7 (MCF7), a human mammary epithelial cancer cell line. AS6 selectively arrests cell growth and induces cell death in MCF7 cells without afecting the growth of HUMEC in a dose‑dependent manner. AS6 alters the transcription of a large number of genes in MCF7 cells, but much fewer genes in HUMEC. Importantly, we found that the cell proliferation, cell cycle, and DNA repair pathways are signifcantly suppressed whereas cellular stress response and apoptotic pathways increase in AS6‑treated MCF7 cells.
    [Show full text]
  • Oxidative Stress and Immune System Dysfunction in Autism Spectrum Disorders
    International Journal of Molecular Sciences Review Oxidative Stress and Immune System Dysfunction in Autism Spectrum Disorders Luca Pangrazzi *, Luigi Balasco and Yuri Bozzi Center for Mind/Brain Sciences (CIMeC), University of Trento, 38068 Rovereto, Italy; [email protected] (L.B.); [email protected] (Y.B.) * Correspondence: [email protected] Received: 10 April 2020; Accepted: 4 May 2020; Published: 6 May 2020 Abstract: Autism Spectrum Disorders (ASDs) represent a group of neurodevelopmental disorders associated with social and behavioral impairments. Although dysfunctions in several signaling pathways have been associated with ASDs, very few molecules have been identified as potentially effective drug targets in the clinic. Classically, research in the ASD field has focused on the characterization of pathways involved in neural development and synaptic plasticity, which support the pathogenesis of this group of diseases. More recently, immune system dysfunctions have been observed in ASD. In addition, high levels of reactive oxygen species (ROS), which cause oxidative stress, are present in ASD patients. In this review, we will describe the major alterations in the expression of genes coding for enzymes involved in the ROS scavenging system, in both ASD patients and ASD mouse models. In addition, we will discuss, in the context of the most recent literature, the possibility that oxidative stress, inflammation and immune system dysfunction may be connected to, and altogether support, the pathogenesis and/or severity of ASD. Finally, we will discuss the possibility of novel treatments aimed at counteracting the interplay between ROS and inflammation in people with ASD. Keywords: ROS; inflammation; ASD; autism; immune system 1.
    [Show full text]
  • SOD2 Acetylation and Deacetylation: Another Tale of Jekyll and Hyde in Cancer
    COMMENTARY COMMENTARY SOD2 acetylation and deacetylation: Another tale of Jekyll and Hyde in cancer Anita B. Hjelmelanda,b and Rakesh P. Patela,c,1 Subsets of highly invasive, therapy-resistant tumor tumor-suppressive and -promoting functions have been cells contribute to the development of metastasis and described (13). At physiologic levels, SOD2 is antitu- treatment failures. Recent evidence suggests that these morigenic; lower dismutase activity leads to stabiliza- tumor cell subsets are enriched for cancer stem cells tion of HIF1α and underlies cancer cell adaptation to (CSCs) (1–3). Similar to nonneoplastic stem cells, CSCs hypoxia (14). However, SOD2 expression is elevated express specific markers and transcription factors and in many cancers, and sites of metastasis have higher can self-renew or differentiate. For example, breast SOD2 levels compared to primary tumors (15–18). If CSCs are identified as positive for CD44, ALDH1 activ- SOD2 is an antioxidant, why does its overexpression ity, and/or expressing SOX2, OCT4, or Nanog (4). Com- not confer greater protection, but instead result in a pared to bulk tumor cells, CSCs are often more resistant flipping of its function to a procancer role? Insights to cell death, including that induced by chemo- or ra- into this conundrum are provided by He et al. (10). diotherapy. Furthermore, CSCs are metabolically plastic They show that CSC gene expression signatures were with different redox states associated with epithelial- or greater in SOD2-overexpressing MCF7 cells (breast mesenchymal-like breast CSCs (5). Hypoxia is an impor- cancer-derived epithelial cells) compared to paren- tant inducer of CSC phenotypes, and hypoxia-inducible tal controls.
    [Show full text]
  • Peroxiredoxin 1 (Prx1) Is a Dual Function Enzyme by Possessing Cys
    BIOCHEMICAL JOURNAL ACCEPTED MANUSCRIPT Peroxiredoxin 1 (Prx1) is a dual-function enzyme by possessing Cys-independent catalase-like activity Cen-Cen Sun, Wei-Ren Dong, Tong Shao, Jiang-Yuan Li, Jing Zhao, Li Nie, Li-Xin Xiang, Guan Zhu, Jian-Zhong Shao Peroxiredoxin (Prx) was previously known as a Cys-dependent thioredoxin. However, we unexpected observed that Prx1 from the green spotted puffer fish Tetraodon nigroviridis (TnPrx1) was able to reduce H2O2 in a manner independent on the Cys peroxidation and reductants. This study aimed to validate the novel function for Prx1, delineate the biochemical features and explore its antioxidant role in cells. We have confirmed that Prx1 from the puffer fish and humans truly possesses a catalase-like activity that is independent of Cys residues and reductants, but dependent on iron. We have identified that the GVL motif was essential to the catalase-like (CAT) activity of Prx1, but not to the Cys-dependent thioredoxin peroxidase (POX) activity, and generated mutants lacking POX and/or CAT activities for individual functional validation. We discovered that the TnPrx1 POX and CAT activities possessed different kinetic features in reducing H2O2. The overexpression of wild-type TnPrx1 and mutants differentially regulated the intracellular levels of reactive oxygen species (ROS) and the phosphorylation of p38 in HEK-293T cells treated with H2O2. Prx1 is a dual function enzyme by acting as POX and CAT with varied affinities towards ROS. This study extends our knowledge on Prx1 and provides new opportunities to further study the biological roles of this family of antioxidants. Cite as Biochemical Journal (2017) DOI: 10.1042/BCJ20160851 Copyright 2017 The Author(s).
    [Show full text]
  • A Strategy to Address Dissociation-Induced Compositional and Transcriptional Bias for Single-Cell Analysis of the Human Mammary Gland
    bioRxiv preprint doi: https://doi.org/10.1101/2021.02.11.430721; this version posted February 11, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. A strategy to address dissociation-induced compositional and transcriptional bias for single-cell analysis of the human mammary gland Lisa K. Engelbrecht1,9,*,‡, Alecia-Jane Twigger1,2,*, Hilary M. Ganz1, Christian J. Gabka4, Andreas R. Bausch5,8, Heiko Lickert6,7,8, Michael Sterr6, Ines Kunze6, Walid T. Khaled2,3 & Christina H. Scheel1,10,‡ Affiliations 1 Institute of Stem Cell Research, Helmholtz Center for Health and Environmental Research Munich, Neuherberg 85764, Germany 2 Department of Pharmacology, University of Cambridge, Cambridge CB2 1PD, UK 3 Cancer Research UK Cambridge Cancer Center, Cambridge CB2 0RE, UK 4 Nymphenburg Clinic for Plastic and Aesthetic Surgery, Munich 80637, Germany 5 Chair of Biophysics E27, Technical University Munich, 85747 Garching, Germany 6 Institute of Diabetes and Regeneration Research, Helmholtz Center for Health and Environmental Research Munich, Neuherberg 85764, Germany 7 German Center for Diabetes Research (DZD), 85764 Neuherberg, Germany 8 Technical University of Munich, 80333 Munich, Germany. 9 Present address: Chair of Biophysics E27, Technical University Munich, 85747 Garching, Germany 10 Present address: Department of Dermatology, St. Josef Hospital, Ruhr-University Bochum, 44791 Bochum, Germany * These authors contributed equally to this work. ‡ Corresponding author. Correspondence to: [email protected] or [email protected] 1 bioRxiv preprint doi: https://doi.org/10.1101/2021.02.11.430721; this version posted February 11, 2021.
    [Show full text]
  • Association of Genetic Polymorphisms in SOD2, SOD3, GPX3, and GSTT1
    Association of genetic polymorphisms in SOD2, SOD3, GPX3, and GSTT1 with hypertriglyceridemia and low HDL-C level in subjects with high risk of coronary artery disease Nisa Decharatchakul1,2, Chatri Settasatian2,3, Nongnuch Settasatian2,4, Nantarat Komanasin2,4, Upa Kukongviriyapan2,5, Phongsak Intharaphet2,6 and Vichai Senthong2,6,7 1 Biomedical Sciences Program, Graduate School, Khon Kaen University, Khon Kaen, Thailand 2 Cardiovascular Research Group, Khon Kaen University, Khon Kaen, Thailand 3 Department of Pathology, Faculty of Medicine, Khon Kaen University, Khon Kaen, Thailand 4 School of Medical Technology, Faculty of Associated Medical Sciences, Khon Kaen University, Khon Kaen, Thailand 5 Department of Physiology, Faculty of Medicine, Khon Kaen University, Khon Kaen, Thailand 6 Queen Sirikit Heart Center of the Northeast, Khon Kaen University, Khon Kaen, Thailand 7 Department of Internal Medicine, Faculty of Medicine, Khon Kaen University, Khon Kaen, Thailand ABSTRACT Background. Oxidative stress modulates insulin resistant-related atherogenic dys- lipidemia: hypertriglyceridemia (HTG) and low high-density lipoprotein cholesterol (HDL-C) level. Gene polymorphisms in superoxide dismutase (SOD2 and SOD3), glutathione peroxidase-3 (GPX3), and glutathione S-transferase theta-1 (GSTT1) may enable oxidative stress-related lipid abnormalities and severity of coronary atherosclerosis. The present study investigated the associations of antioxidant-related gene polymorphisms with atherogenic dyslipidemia and atherosclerotic severity in subjects with high risk of coronary artery disease (CAD). Submitted 13 April 2019 Methods. Study population comprises of 396 subjects with high risk of CAD. Gene Accepted 4 July 2019 Published 1 August 2019 polymorphisms: SOD2 rs4880, SOD3 rs2536512 and rs2855262, GPX rs3828599, and GSTT1 (deletion) were evaluated the associations with HTG, low HDL-C, high Corresponding author Chatri Settasatian, [email protected], TG/HDL-C ratio, and severity of coronary atherosclerosis.
    [Show full text]
  • Superoxide Dismutase 2 Overexpression Attenuates Effects of Ischemia Reperfusion-Induced Mitochondrial Dysfunction
    Superoxide Dismutase 2 Overexpression Attenuates Effects of Ischemia Reperfusion-Induced Mitochondrial Dysfunction A Thesis Presented in partial fulfillment for the requirements for the degree of Masters of Science in the College of Graduate Studies of Northeast Ohio Medical University Paul Lin B.S Integrated Pharmaceutical Medicine Northeast Ohio Medical University 2017 Thesis Committee: Dr. Yeong-Renn Chen (Advisor) Dr. Denise Inman Dr. William Chilian Copyright by Paul Lin 2017 Abstract Myocardial ischemia reperfusion (IR) injury has been shown to cause mitochondrial dysfunction. The electron transport chain (ETC) is a major source of superoxide and other superoxide derived reactive oxygen species during ischemia and reperfusion. Previous studies suggest that the downregulation of ETC, Krebs cycle, and antioxidant enzymes in the mitochondria occur as a result of increased oxidative stress. SOD2 is one of the primary antioxidants in the mitochondrial matrix. It is capable of scavenging superoxide into hydrogen peroxide. To test the therapeutic potential of increased superoxide scavenging in murine models, we subjected cardiac specific human SOD2 overexpressing (SOD2TG) murine hearts to 30 minutes of ischemia and 45 minutes of reperfusion using the Langendorff isolated heart system. SOD2TG hearts were relatively protected from impairment of electron transport activity in complex I-IV as well as downregulation of Krebs cycle enzyme activities. However, SOD2 overexpressing hearts had selectively decreased basal respiratory enzyme kinetics without indication of impairment of respiratory coupling and hydrogen peroxide scavenging. ii Acknowledgements I would like to thank my advisor, Dr. Yeong-Renn Chen for guiding me through my academic career at Northeast Ohio Medical University. I am also grateful for Chwen- Lih Chen and Dr.
    [Show full text]