University of Kentucky UKnowledge Toxicology and Cancer Biology Faculty Publications Toxicology and Cancer Biology 10-2020 SOD2 Deficiency in Cardiomyocytes Defines Defective Mitochondrial Bioenergetics as a Cause of Lethal Dilated Cardiomyopathy Sudha Sharma Louisiana State University Susmita Bhattarai Louisiana State University Hosne Ara Louisiana State University Grace Sun Louisiana State University Daret K. St. Clair University of Kentucky, [email protected] Follow this and additional works at: https://uknowledge.uky.edu/toxicology_facpub Part of the Cardiology Commons, and the Medical Toxicology Commons See next page for additional authors Right click to open a feedback form in a new tab to let us know how this document benefits ou.y Repository Citation Sharma, Sudha; Bhattarai, Susmita; Ara, Hosne; Sun, Grace; St. Clair, Daret K.; Bhuiyan, Md Shenuarin; Kevil, Christopher; Watts, Megan N.; Dominic, Paari; Shimizu, Takahiko; McCarthy, Kevin J.; Sun, Hong; Panchatcharam, Manikandan; and Miriyala, Sumitra, "SOD2 Deficiency in Cardiomyocytes Defines Defective Mitochondrial Bioenergetics as a Cause of Lethal Dilated Cardiomyopathy" (2020). Toxicology and Cancer Biology Faculty Publications. 96. https://uknowledge.uky.edu/toxicology_facpub/96 This Article is brought to you for free and open access by the Toxicology and Cancer Biology at UKnowledge. It has been accepted for inclusion in Toxicology and Cancer Biology Faculty Publications by an authorized administrator of UKnowledge. For more information, please contact [email protected]. SOD2 Deficiency in Cardiomyocytes Defines Defective Mitochondrial Bioenergetics as a Cause of Lethal Dilated Cardiomyopathy Digital Object Identifier (DOI) https://doi.org/10.1016/j.redox.2020.101740 Notes/Citation Information Published in Redox Biology, v. 37, 101740. © 2020 The Authors This is an open access article under the CC BY-NC-ND license (https://creativecommons.org/licenses/by- nc-nd/4.0/). Authors Sudha Sharma, Susmita Bhattarai, Hosne Ara, Grace Sun, Daret K. St. Clair, Md Shenuarin Bhuiyan, Christopher Kevil, Megan N. Watts, Paari Dominic, Takahiko Shimizu, Kevin J. McCarthy, Hong Sun, Manikandan Panchatcharam, and Sumitra Miriyala This article is available at UKnowledge: https://uknowledge.uky.edu/toxicology_facpub/96 Redox Biology 37 (2020) 101740 Contents lists available at ScienceDirect Redox Biology journal homepage: www.elsevier.com/locate/redox SOD2 deficiency in cardiomyocytes defines defective mitochondrial bioenergetics as a cause of lethal dilated cardiomyopathy Sudha Sharma a, Susmita Bhattarai a, Hosne Ara a, Grace Sun a, Daret K. St Clair b, Md Shenuarin Bhuiyan c, Christopher Kevil c, Megan N. Watts d, Paari Dominic d, Takahiko Shimizu e, Kevin J. McCarthy a, Hong Sun a, Manikandan Panchatcharam a,**, Sumitra Miriyala a,* a Department of Cellular Biology and Anatomy, Louisiana State University Health Sciences Center, Shreveport, LA, USA b Department of Toxicology and Cancer Biology, College of Medicine, University of Kentucky, Lexington, KY, USA c Department of Pathology and Translational Pathobiology, Louisiana State University Health Sciences Center, Shreveport, LA, USA d Division of Cardiology, Department of Medicine, Louisiana State University Health Sciences Center, Shreveport, LA, USA e National Center for Geriatrics and Gerontology, 7-430, Morioka, Obu Aichi, Japan ARTICLE INFO ABSTRACT Keywords: Electrophilic aldehyde (4-hydroxynonenal; 4-HNE), formed after lipid peroxidation, is a mediator of mito­ Heart failure chondrial dysfunction and implicated in both the pathogenesis and the progression of cardiovascular disease. Manganese superoxide dismutase Manganese superoxide dismutase (MnSOD), a nuclear-encoded antioxidant enzyme, catalyzes the dismutation of Superoxide radicals •- superoxide radicals (O2 ) in mitochondria. To study the role of MnSOD in the myocardium, we generated a cardiomyocyte-specific SOD2 (SOD2Δ) deficient mouse strain. Unlike global SOD2 knockout mice, SOD2Δ mice reached adolescence; however, they die at ~4 months of age due to heart failure. Ultrastructural analysis of SOD2Δ hearts revealed altered mitochondrial architecture, with prominent disruption of the cristae and vacuole Δ formation. Noninvasive echocardiographic measurements in SOD2 mice showed dilated cardiomyopathic fea­ tures such as decreased ejection fraction and fractional shortening along with increased left ventricular internal diameter. An increased incidence of ventricular tachycardia was observed during electrophysiological studies of the heart in SOD2Δ mice. Oxidative phosphorylation (OXPHOS) measurement using a Seahorse XF analyzer in SOD2Δ neonatal cardiomyocytes and adult cardiac mitochondria displayed reduced O2 consumption, particularly + during basal conditions and after the addition of FCCP (H ionophore/uncoupler), compared to that in SOD2fl hearts. Measurement of extracellular acidification (ECAR) to examine glycolysis in these cells showed a pattern precisely opposite that of the oxygen consumption rate (OCR) among SOD2Δ mice compared to their SOD2fl littermates. Analysis of the activity of the electron transport chain complex identified a reduction in Complex I and Complex V activity in SOD2Δ compared to SOD2fl mice. We demonstrated that a deficiency of SOD2 in­ creases reactive oxygen species (ROS), leading to subsequent overproduction of 4-HNE inside mitochondria. Mechanistically, proteins in the mitochondrial respiratory chain complex and TCA cycle (NDUFS2, SDHA, ATP5B, and DLD) were the target of 4-HNE adduction in SOD2Δ hearts. Our findings suggest that the SOD2 mediated 4-HNE signaling nexus may play an important role in cardiomyopathy. 1. Introduction conditions such as hypertension, valvular heart disease, or coronary artery disease [1]. Both genetic and non-genetic factors are associated Dilated cardiomyopathy (DCM), a significant risk factor for heart with this disease, and evidence suggests that various proteins located in failure, is characterized by enlargement of the left ventricle with the mitochondria responsible for energy metabolism and other functions impaired systolic function in the absence of underlying systemic are involved in its initiation and progression [2]. Recently, a SOD2 * Corresponding author. Department of Cellular Biology and Anatomy, LSUHSC-Shreveport, PO Box 33932, Shreveport, LA, 71130-3932, USA. ** Corresponding author. Department of Cellular Biology and Anatomy, LSUHSC-Shreveport, PO Box 33932, Shreveport, LA, 71130-3932, USA.. E-mail addresses: [email protected] (M. Panchatcharam), [email protected] (S. Miriyala). https://doi.org/10.1016/j.redox.2020.101740 Received 16 July 2020; Received in revised form 1 September 2020; Accepted 23 September 2020 Available online 30 September 2020 2213-2317/© 2020 The Authors. Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/). S. Sharma et al. Redox Biology 37 (2020) 101740 homozygous variant was identified as a causative factor for lethal P1=CGAGGGGCATCTAGTGGAGAAG, P2 = TTAGGGCTCAGGTTTGT dilated cardiomyopathy in humans where the homozygous missense CCAGAA, and P4 = AGCTTGGCTGGACGTAA. P1 and P2 were used for variant, c.542 g > t, p. (gly181Val), was observed in the SOD2 gene. This wild type and P1 and P4 for flox genotyping. CRE1 = GCGGTC points to the potential role played by oxidative stress in the etiology and TGGCAGTAAAAACTATC and CRE2 = GTGAAACAGCATTGCTG pathogenesis of dilated cardiomyopathy [3]. TCACTT were used for genotyping Cre recombinase. The PCR was car­ Mitochondria perform several roles to maintain cellular function. ried out using a thermocycler (PTC-200 MJ Research). + They are producers of ATP, involved in cellular Ca2 homeostasis, and mediate apoptosis. The electron transport chain, comprising five mul­ tiprotein complexes (I–V), is embedded in the inner mitochondrial 2.2. Echocardiography and electrophysiological studies + membrane, and a series of electron transfers and H translocation occurs via the actions of these complexes to generate ATP. In addition, mito­ Mice were anesthetized with isoflurane (0.8%) and the fur from the chondria are a major contributor to the generation of reactive oxygen mid-neckline to the mid-chest level was removed using a hair remover species (ROS) via the respiratory complex under physiological condi­ (Nair). Transthoracic echocardiography was carried out on both SOD2fl tions [4,5]. Mitochondrial abnormalities related to ROS production, and SOD2Δ mice using a 30 MHz probe with Vevo 3100 Ultrasonograph mitochondrial bioenergetics, mitochondrial dynamics, and the mito­ (VisualSonics). The echocardiography procedures were performed in chondrial ability to buffer ions have been linked to heart failure. Given mice while maintaining heart rate, respiratory rate, and body temper­ that mitochondrial bioenergetics and ROS are closely related, it is ature within standard limits. Ventricular dimensions were measured on imperative to address these aspects of mitochondrial dysfunction M-mode images. The formula [(LVID; d - LVID; s) ÷ LVID; d] x 100 was together to understand the mechanism of heart failure [6]. The inner used to calculate percent fractional shortening (%FS). Electrophysio­ mitochondrial membrane is made up of a unique phospholipid called logical studies were performed in mice, as previously described [13]. cardiolipin; mammalian cardiolipin occurs in the form of the dimer Four-month-old SOD2fl and SOD2Δ mice were used for