
British Journal of Cancer (2007) 97, 1116 – 1123 & 2007 Cancer Research UK All rights reserved 0007 – 0920/07 $30.00 www.bjcancer.com Molecular consequences of SOD2 expression in epigenetically silenced pancreatic carcinoma cell lines *,1 2 3 *,1 EM Hurt , SB Thomas , B Peng and WL Farrar 1 Cancer Stem Cell Section, Laboratory of Cancer Prevention, Center for Cancer Research, National Cancer Institute at Frederick, National Institutesof 2 Health, Frederick, MD 21702, USA; Basic Research Program, SAIC-Frederick Inc., National Cancer Institute at Frederick, Frederick, MD 21702, USA; 3 School of Dental Science, University of Melbourne, Melbourne, Victoria, Australia Manganese superoxide dismutase (SOD2) is an enzyme that catalyses the dismutation of superoxide in the mitochondria, leading to reduced levels of reactive oxygen species. Reduced expression levels of SOD2 have been shown to result in increased DNA damage and sod2 heterozygous mice have increased incidences of cancer. It has also been shown that SOD2 expression is lost in pancreatic cell lines, with reintroduction of SOD2 resulting in decreased rate of proliferation. The mechanism of decreased SOD2 expression in pancreatic carcinoma has not been previously determined. We demonstrate, through sodium bisulphite sequencing, that the sod2 locus is methylated in some pancreatic cell lines leading to a corresponding decrease in SOD2 expression. Methylation can be reversed by treatment with zebularine, a methyltransferase inhibitor, resulting in restored SOD2 expression. Furthermore, we demonstrate that sensitivity of pancreatic carcinoma cell lines to 2-methoxyestradiol correlates with SOD2 expression and SOD2 modulation can alter the sensitivity of these cells. Using both genomics and proteomics, we also identify molecular consequences of SOD2 expression in MIA-PaCa2 cells, including dephosphorylation of VEGFR2 and the identification of both SOD2-regulated genes and transcription factors with altered binding activity in response to SOD2 expression. British Journal of Cancer (2007) 97, 1116–1123. doi:10.1038/sj.bjc.6604000 www.bjcancer.com Published online 25 September 2007 & 2007 Cancer Research UK Molecular Diagnostics Keywords: superoxide dismutase 2; pancreatic neoplasms; proteomics; genomics; epigenetic process Free radicals are, arguably, considered among the most potent, stand as guardians for ROS have been implicated in the possible ubiquitous, endogenous mutagens generated by normal physiolo- progression or initiation of some cancers. Considered among the gical processes (Hussain et al, 2003). Among various molecular earliest pre-neoplastic changes in prostate cancer is the epigenetic forms of free radicals, reactive oxygen species (ROS) have been the silencing by promoter CpG hypermethylation of the glutathione most diligently studied. Generated by all cells as a by-product of S-transferase p gene (Lin et al, 2001; Nelson et al, 2001). Thus, oxidative metabolism and inflammatory processes, ROS are speculating that a reduction in the ability to manage ROS leads to indicted in inducing cellular aging (Melov, 2000), cancer, and a further mutation and advancement of the neoplastic process. variety of other pathophysiological conditions. Alterations in Among the enzymes produced by cells that manage ROS, macromolecular functions are understandable in view that ROS manganese superoxide dismutase (SOD2), the form of SOD found may target DNA, proteins, RNA, and lipids. Due to the deleterious in mitochondria, has received considerable attention with regard potential of free radicals, mechanisms have evolved to protect cells to cancer (Liu et al, 2004). The main function of SOD2 is to convert from ROS, including antioxidant scavengers, enzymes, and repair superoxide anion into hydrogen peroxide (H2O2), which is mechanisms. subsequently converted to water by catalases. Decreased expres- Cancer, in particular, arises from a combination of potential sion of SOD2 has been noted, initially, in pancreatic carcinoma genetic mutations, and possibly epigenetic changes, altering the cells lines (Cullen et al, 2003). More recently, reduced expression cells’ normal proliferative and apoptotic programming. Within the of SOD2 has been seen in multiple myeloma cells (Hodge et al, last few years, changes in expression patterns of enzymes that 2005b), androgen-independent prostate cancer (Best et al, 2005; Venkataraman et al, 2005), and invasive breast carcinoma (Soini et al, 2001). Overexpression of SOD2 in deficient cell lines has *Correspondence: EM Hurt, Laboratory of Cancer Prevention, National reduced the proliferation of pancreatic carcinoma cells (Weydert Cancer Institute at Frederick, 1050 Boyles Street, Building 560, Room et al, 2003; Ough et al, 2004), multiple myeloma cells (Hodge et al, 21-81, Frederick, MD 21702, USA; E-mail: [email protected] or 2005b), glioma cells (Zhong et al, 1997), squamous oral carcinoma WL Farrar, Laboratory of Cancer Prevention, National Cancer Institute at cells (Liu et al, 1997), and prostate carcinoma cells (Li et al, 1998b; Frederick, 1050 Boyles Street, Building 560, Room 21-78, Frederick, MD Zhong et al, 2004; Venkataraman et al, 2005). Transgenic 21702, USA; E-mail: [email protected] overexpression of SOD2 also results in increased resistance to Received 2 April 2007; revised 14 August 2007; accepted 29 August chemical carcinogenesis as compared to wild-type mice (Zhao 2007; published online 25 September 2007 et al, 2001). While homozygous sod2 knockout mice die within SOD2 in pancreatic carcinoma cell lines EM Hurt et al 1117 weeks, heterozygous þ /À mice have accelerated tumour of expected size was cloned into pCR4-TOPO TA cloning vector development, particularly lymphomas (Van Remmen et al, 2003). (Invitrogen, Carlsbad, CA, USA). Ten individual clones for each cell Taken together, these data have raised the compelling issue that, in line were sequenced. addition to the effects of SOD2 as a guardian against ROS, SOD2 may phenotypically act as a tumour suppressor (Cullen et al, Construction of SOD2 expression and shRNA retroviruses 2003). While the phenotypic effects of diminished and/or over- Adenoviral SOD2 construct (kind gift of JJ Cullen, University of expressed SOD2 have been reported for various tumour cell lines, Iowa) was EcoRI digested and sod2 cDNA was cloned into the the explanation for reduced expression has only recently emerged. retroviral vector pLZRS-BMN-eGFP containing an IRES and eGFP Polymorphisms of the sod2 promoter have been suggested as one cDNA. For overexpression experiments, the control was the empty possible mechanism for reduced expression of SOD2 in certain cell eGFP vector. The oligos used for shRNA knockdown of sod2 are as lines (Xu et al, 1999). More recently, we have found that the sod2 follows: 50-GATCCCGGGGTTGGCTTGGTTTCAATATTCAAGAGA promoter is methylated in some multiple myeloma cells and TATTGAAACCAAGCCAACCCCTTTTTA-30 and 50-AGCTTAAAA diminished expression can be reversed by the methyltransferase AGGGGTTGGCTTGGTTTCAATATCTCTTGAATATTGAAACCAA inhibitor zebularine (Hodge et al, 2005a), suggesting that GCCAACCCCGG-30. The oligos were annealed and cloned into the repression of SOD2 may occur at the level of epigenetic regulation. BglII/HindIII sites of pRetroSuper (Brummelkamp et al, 2002). In addition to understanding the relative mechanisms of SOD2 expression levels in cancer cells, little is known about the Generation of stable cell lines with altered SOD2 consequences of reduced SOD2 on the signal transduction and expression levels transcriptional processes that control cancer cell viability and growth. Some data have emerged suggesting that levels of SOD2 A bicistronic retrovirus carrying sod2 cDNA and eGFP or an empty have effects on AP-1 and NF-kB activities, in which overexpression vector (control) was used to create the overexpression cell lines. experiments diminish the activities of these two important For knockdown of SOD2, the shSOD2-pRetroSuper or empty transcription factors (Kiningham and St Clair, 1997; Li et al, pRetroSuper was used to infect pancreatic cell lines. In both 1998a). instances, the Phoenix Amphotropic cells (kind gift of Gary Nolan, Here, using a series of pancreatic carcinoma cell lines, we show Stanford University) were transfected using FuGENE 6 (Roche that the relative expression patterns of SOD2 are inversely related Diagnostics, Indianapolis, IN, USA), according to manufacturer’s to the methylation density status of the sod2 promoter. Hyper- instructions. Two days following transfection, 3 ml of viral methylation of CpG sites was rapidly reversed by the methyl- supernatant was used to infect 1–3 Â 106 pancreatic cells. For transferase inhibitor zebularine, restoring SOD2 levels. The overexpression of SOD2, cells were flow sorted for high GFP epigenetic silencing of sod2 revealed a particular Achille’s heel of expression, whereas for shSOD2 and control cells were selected pancreatic carcinoma cells with low SOD2, making the cells with 1 mgmlÀ1 puromycin 48 h post infection. Expression of SOD2 particularly susceptible to the apoptotic effects of 2-methoxy- was determined by western blot (anti-SOD2, ab16954; Abcam, estradiol (2ME2), an oxidative burst agent. Cambridge, MA, USA). To examine the more global consequences of SOD2 expression on the cellular processes of pancreatic carcinoma, we have Determination of superoxide dismutase activity in cell employed a gestalt approach of examining how SOD2 affects vital lines processes of signal-transduction proteins, transcription
Details
-
File Typepdf
-
Upload Time-
-
Content LanguagesEnglish
-
Upload UserAnonymous/Not logged-in
-
File Pages8 Page
-
File Size-