1
DIVERSITY AND ACTIVITIES OF PHAGOTROPHIC
MICRO-EUKARYOTES IN BOILING SPRINGS LAKE, LASSEN VOLCANIC
NATIONAL PARK ______
A Thesis
Presented
to the Faculty of California State University, Chico
______
In Partial Fulfillment
of the Requirements for the Degree
Master of Science
in Biological Science
______
by
William Henry Harrison Reeder IV
Fall 2011 2
DIVERSITY AND ACTIVITIES OF PHAGOTROPHIC
MICRO-EUKARYOTES IN BOILING SPRINGS LAKE, LASSEN VOLCANIC
NATIONAL PARK
A Thesis
by
William Henry Harrison Reeder IV
Fall 2011
APPROVED BY THE DEAN OF GRADUATE STUDIES AND VICE PROVOST FOR RESEARCH:
______Eun K. Park, Ph.D.
APPROVED BY THE GRADUATE ADVISORY COMMITTEE:
______Gordon V. Wolfe, Ph.D., Chair
______Larry F. Hanne, Ph.D.
______Andrea K. White, Ph.D. iii
ACKNOWLEDGMENTS
This thesis would not have come to fruition without the help and guidance of many people. I would initially like to thank Dr. Gordon Wolfe, my advisor, for his attention and assistance through my journey. His insight, support, and direction were indispensible for the completion of this work. Without the opportunity provided to me, I would have never achieved these goals, and learned as much as I have. I want to give a special thanks to Jessica Sanck, whose assistance was mandatory for much of the early work, primarily her work with flagellates and distinct eye for the organisms. I am grateful for the financial support for this project, provided by the National Science Foundation grant MCB-0702069, which has allowed me and many other students gain knowledge and insight into the complexities of our world.
I would like to thank my committee, Dr. Larry Hanne and Dr. Andrea
White, for their advice and expertise with my research, and microbiology as a science. They were always there to answer any questions I had.
Additionally, I am grateful to Rick Giberson. His assistance with preparation, and technical knowledge of electron microscopy was invaluable. Dr.
Russell Shapiro for his help with geological questions and GPS mapping of the lake.
Dr. Kenneth Stedman from Portland State University, and Drs. Mark Wilson and
Patty Siering from Humboldt State University were all instrumental in launching the
iii iv study, and providing a wealth of knowledge. Without their assistance I never would have been able to complete this work.
Friendships and understanding eased the challenges associated with my graduate studies. Without the friendship and understanding of fellow graduate students Akira Iwami, Juan Araujo-Sarinana, Lindsey Wallace and Alena Chin-Curtis,
I would not have been able to maintain sanity through this process, and specifically
Sarah Hoddick for reading my thesis countless times.
Finally, I would like to thank my parents, Susan and William Reeder, for their belief, and support for everything I chose to do. If it wasn’t for them, none of this would have been possible.
iv v
TABLE OF CONTENTS
PAGE
Acknowledgments ...... iii
List of Tables ...... viii
List of Figures ...... ix
Abstract ...... xiii
CHAPTER
I. Introduction ...... 1
Boiling Springs Lake: Microbial Food Webs in Extreme Environments ...... 1 Microbial Food Webs ...... 3 Microbial Eukaryote Diversity In Geothermal and Acidic Environments ...... 4 Geothermal Environments ...... 5 Acid Mine Drainage Sites ...... 8 Coal mining sites ...... 10 Microbial Food Webs in Geothermal and Acidic Environments ...... 11 Geothermal Environments ...... 11 AMD Sites ...... 12 Coal Mining Sites ...... 13 Objectives, Questions, and Gypotheses ...... 14
II. Materials & Methods ...... 15
Study Site and Sampling ...... 15 Media Creation: Enrichments and Isolations ...... 17 Culturing: Food Stocks and Feeding ...... 18 Feeding in Liquid and Solid Media ...... 19
v vi CHAPTER PAGE
Isolation of T. thermacidophilus: Attempts at Monoxenic Cultures ...... 19 pH and Temperature Tolerance ...... 20 Environmental Distribution of T. thermacidophilus Cysts ...... 21 Microscopy: General Observation Techniques ...... 22 Genetics: Extraction and Analysis ...... 22 Clone Libraries ...... 23 DGGE ...... 24 Group-specific Primers ...... 24 Sequencing and Bioinformatics ...... 25 Feeding Observations via TEM and Acridine Orange Staining ...... 26 TEM...... 26 Acridine Orange Staining ...... 28
III. Results ...... 29
Enrichment Cultures 2008 ...... 29 Genetic Characterization of Diversity - DGGE ...... 32 Isolation Efforts ...... 33 Enrichment Cultures 2009 ...... 42 Isolation Efforts ...... 42 Genetic Characterization of Diversity: Clone Libraries ...... 46 Genetic Characterization of Diversity: DGGE ...... 47 Genetic Characterization of Diversity: Group-specific PCR Primers...... 49 Characterization of Grazers ...... 55 Screening for Viral Symbionts...... 58 Summer 2010 Enrichments ...... 63
IV. Discussion ...... 67
Major Findings ...... 67 Vahlkampfiid Amoebae: Key Grazers ...... 68 T. thermacidophilus: Kamchatka and Italy ...... 69 Other Amoebae Associated with BSL’s Geothermal Features .. 71 Lobose Amoebae ...... 72 Kinetoplastid Flagellates ...... 73 Other Potential Members of the Grazing Community ...... 74 Comparison to Other Sites ...... 75 Biogeography of Acidothermophilic Protists ...... 78 vi vii CHAPTER PAGE
Grazing Impact of Protists in Extreme Environments ...... 80
Suggestions for Future Work...... 82 Conclusions ...... 85
Literature Cited ...... 87
vii viii
LIST OF TABLES
TABLE PAGE
1. Primers used for group-specific and universal PCR...... 25
2. DNA samples for DGGE screening...... 33
3. Enrichments following cyst recovery and re-incubation and microscopic examination...... 40
4. Identification of prokaryotes in vahlkampfiid amoebae enrichments following 16S rDNA V3 ampfliciation and DGGE fingerprinting...... 42
5. Transect samples collected 7-18-09...... 43
6. Observations of transect and side-pool samples enrichments used for DGGE Nov. 2009...... 49
7. DGGE-band Sequences from Nov. 2009...... 51
8. Temperature range of activity for BSL grazers ...... 56
9. First and second round MCP/D13L PCR screening of amoebae and flagellate cultures...... 62
10. MCP amplified sequence identities from NCBI BLAST...... 63
11. Summer 2010 sample enrichments and observations...... 65
viii ix
LIST OF FIGURES
FIGURE PAGE
1. Map of Lassen Volcanic National Park, and BSL location within the park. (http://www.us-national-parks.net/images/lass.jpg) ..... 2
2. Google Earth satellite photo (a) and high-resolution GPS map (b)...... 16
3. Morphologies observed in summer 2008 enrichments...... 30
4. Micrographs of vahlkampfiid amoeba...... 30
5. Clearing of sediment in primary enrichments containing amoebae activity after a couple weeks of incubation using sterile wheat berries as a nutrient source ...... 31
6. Other amoebae morphologies observed via culture enrichment, and identified genetically in cultures...... 32
7. DGGE gel screening of initial enrichments (lanes 6-8) stained in ethidium bromide...... 34
8. DGGE gel screening of initial enrichments (Lanes 1-4) stained in ethidium bromide...... 35
9. DGGE gel screening of initial enrichments (Lanes 11-15) stained in ethidium bromide...... 36
10. DGGE gel screening of initial enrichments (Lanes 1,3,4) stained in ethidium bromide...... 37
11. DGGE gel screening of initial enrichments (Lanes 5,6, 7-9) stained in ethidium bromide...... 38
12. Ascomycete Phialphora sp., isolated from amoeboflagellate enrichments...... 39
13. Vahlkampfiid amoebae and Bodo-like flagellates observed in July 2009 transect samples under phase microscopy...... 44
ix x FIGURE PAGE
14. Amoebae observed from summer 2009 TS-2-2 m sample walk-out enrichment...... 44
15. Hartmannella growth on solid media from a soil sample above the southern thermal zone...... 46
16. Clone library PCR products and their RFLP digestions with MspI restriction enzyme...... 48
17. DGGE gel of enrichments from transects and other 2009 samples, with band-associated sequence assignments...... 50
18. DGGE gel showing distances associated with samples and the deterioration of T. thermacidophilus-like sequence in samples with distance from the lake...... 51
19. PCR strategy for universal eukaryotic and Tetramitus-specific primers. SSU = 18S; LSU = 24S; ITS = internal transcribed spacer...... 53
20. Alignment of Tetramitus 18S SSU sequences, showing distance of closely-related vahlkampfiid sequences are referenced by location...... 55
21. Growth vs. pH for the Vahlkampfiid isolated from BSL...... 56
22. Distribution of BSL Vahlkampfiid cysts and corresponding sample - site temperatures...... 59
23. Observations of T. thermacidophilus feeding...... 60
24. TEM micrographs of Acanthamoeba trophophyte ultrastructure...... 61
25. Second round MCP/D13L PCR associated RAGE gel ...... 63
26. Various other morphologies observed from Summer 2010 enrichments...... 66
27. Biogeography of grazers found on transects from Summer 2009...... 80
x xi
ABSTRACT
DIVERSITY AND ACTIVITIES OF PHAGOTROPHIC
MICRO-EUKARYOTES IN BOILING SPRINGS
LAKE, LASSEN VOLCANIC
NATIONAL PARK
by
William Henry Harrison Reeder IV
Master of Science in Biological Science
California State University, Chico
Fall 2011
The biology of extreme environments has focused on diversity and adaptations, largely concentrating on the prokaryotic community. Only recently have investigations targeted eukaryotic diversity in extreme environments, and few studies have examined food web interactions. In this thesis, I studied the protist grazing component of the Boiling Springs Lake (BSL) food web. Boiling Springs Lake is a flooded fumarole that contains a 1.8 ha pool of pH 2.2, 52°C water in California’s
Lassen Volcanic National Park. It is an NSF-funded Microbial Observatory focused on understanding the diversity and interactions of the entire microbial community.
Using a combination of culture and genetic approaches, I found the major predator in BSL to be a unique vahlkampfiid amoeba capable of surviving the
xii xii physical extremes of BSL. It is closely related via rRNA sequence to Tetramitus thermacidophilus, a heterolobose amoeboflagellate recently isolated from volcanic geothermal acidic sites in Europe and Russia, and an uncultured heterolobosean amoebae from the nearby Iron Mountain Mine acid mine drainage site. Transects studies showed the organism is endemic to the lake, and cysts were present at an average of ~500 viable cells mg-1 on the shoreline. The amoeba form is active up to
52 C, is a strict acidophile, and was observed grazing on native ascomycete
Phialophora sp., as well as bacteria such as Micrococcus sp.
Other grazing protists were identified in lakeshore environments, but were unable to grow in the extreme conditions of the lake. These include the lobose amoebae Hartmannella sp. and Acanthamoeba sp., and the kinetoplastid flagellate
Bodo sp. Acanthamoeba and Bodo were acid tolerant, but could not grow at temperatures above 30 C, while Hartmentalla was thermotolerant but could not grow at low pH. Microscopic analysis showed the presence of a variety of other morphotypes that I tentatively identified as ciliates, euglenids, cercozoans, and various flagellates from colder areas around the lake. However, I was not able to culture these, and no genetic identification was obtained.
Additionally, I observed apparent large DNA viruses in Acanthamoeba sp. cultures, which resembled Mimivirus. While still tentative, this is possibly the first observation of a eukaryotic virus from an acidothermal environment.
xiii 1
CHAPTER I
INTRODUCTION
Boiling Springs Lake: Microbial Food Webs in Extreme Environments
Extreme environments can be characterized by extreme pH, temperature, or chemistry, and are microbially-dominated systems, composed of prokaryotes (bacteria and archaea), micro-eukaryotes (protists, fungi and algae), and viruses (Rothschild and Manicinelli 2001). Common extreme habitats include acid mine drainage (AMD) sites (low pH) and natural volcanic geothermal sites
(high T and/or low pH), as well as hypersaline or anoxic sites. Extreme environments have been studied because they resemble conditions in which life potentially originated (Wilson et al. 2004), their potential to work as analogs for astrobiology (Costas et al. 2007), for their potential implications in bioremediation
(Mitman 1999, Johnson and Hallberg 2005), and the possibility to discover novel anti-cancer enzymes (Stierle et al. 2006).
Boiling Springs Lake (BSL) is a flooded fumarole located in Lassen
Volcanic National Park (LVNP) in northern California, 75 km east of Redding, CA
(Fig. 1). BSL is fueled by an outflow plume of degassing liquid, and is an acid-sulfate steam-heated feature (Janik and McLaren 2010). BSL is a NSF-funded Microbial
Observatory, with work being done to characterize the prokaryotic, eukaryotic and
1
2 viral communities and interactions in the environment. The lake has a consistent pH of 2.2, and seasonal temperature variation between 45-52°C.
FIG. 1. Map of Lassen Volcanic National Park, and BSL location within the park (ellipse) (http://www.us-national-parks.net/images/lass.jpg).
Previous genetic screens of the environment have shown algal and fungal diversity. Fungal diversity was suggested to be low, based on 18S rRNA clone libraries that showed all sequences to be either Ascomycota or Basidiomycota
(Wilson et al. 2008). Previous genetic screens have shown no evidence of phagotrophic micro-eukaryotes in the environment (Brown and Wolfe 2006). Work concerning bacterial and archaeal diversity indicated that there is a stable
3 community of diverse novel organisms in the environment (Siering et al. 2006), and evidence of viral interaction, primarily with the crenarchaeote Sulfolobus (Dr. Ken
Stedman, unpublished).
Microbial Food Webs
Microorganisms in the environment provide essential nutrient cycling for global systems, producing organic matter for higher organisms, breaking down organic matter in the environment, and providing nutrients to other organisms.
This cycling of nutrients through different trophic levels is commonly referred to as a food web, which is influenced by the physical characteristics of an environment.
These can limit (‘top-down control’) or encourage the growth of important organisms in the ecosystem, and potentially create organism-specific niches and shape the structure of the microbial community (Jürgens and Güde 1994).
In most ecosystems, protists are the most important predators of bacteria, fungi (Heinbokel 1978, Old et al. 1985), smaller protists (Matin et al.
2006), and other amoebae (Chakraborty et al. 1983, Chakraborty and Old 1986,
Marciano-Cabral 1988, Bradley and Marciano-Cabral 1996, Matin et al. 2006) in soil and aquatic environments (Weekers et al. 1993, Rodríguez-Zaragoza 1994).
Protists receive nutrients from smaller autotrophic and heterotrophic organisms in the ecosystem (Gaedke and Kamjunke 2006). In turn, protists are an important source of re-mineralized nutrients and colloidal and dissolved trace metals in aquatic systems (Sherr and Sherr 2002), and contribute to the “microbial loop”.
Amoebae are of importance due to their grazing effect in soil, freshwater, and
4 marine communities, their potential to act as human pathogens, such as Naegleria fowlerii and Acanthamoeba sp., and their the ability to harbor human bacterial pathogens such as Legionella (Marciano-Cabral 1988). Amoebae have been considered the most important predators on bacteria in the environment, as well as being the most successful thermo tolerant protists.
Microbial Eukaryote Diversity in Geothermal and Acidic Environments
Most work in geothermal, acidic environments has focused exclusively on prokaryotes, as well as their viruses, and examined diversity in response to physical extremes and resource limitation (‘bottom-up control’). Recent studies have indicated that micro-eukaryotes are also present in geothermal and acidic environments and possibly exert control over bacterial and fungal populations.
Classically, these sites are considered areas of relatively low diversity, suggesting there is a direct correlation between the various environmental pressures and complexity of the community, where the members of such communities depend of the organism-specific abilities to withstand the environmental pressures.
Previously, acidophiles have been defined by the inability to survive at circumneutral pH (Gross and Robbins 2000), though it has been redefined as an organism that uses the low pH as a clear fitness strategy (Weisse and Stadler 2006).
Acid-tolerant organisms are those that are able to survive in acidic conditions, as well as neutral conditions, while a neutrophil grows best under neutral conditions and cannot survive an acidic environment (Moser and Weisse 2011).
5 Analogies in community structure can be drawn from two basic environments: acid mine drainage (AMD) sites: which include coal and metal mining tailings, pits, and leachate drainage; and volcanic sites: which can be either geothermal or acidic-geothermal sites, and are fueled by subterranean volcanic activity.
Various grazing protists have been identified in extreme environments, with flagellates and amoebae considered to be the most common (Mitman 1999,
Aguilera et al. 2007a). Acid mine drainage (AMD) has been studied for biological activity and possible bioremediation application. There is interest in the impact of protist activity, as it has potential to raise the pH naturally (Mitman 1999), and reduce further acidification by iron-oxidizing bacteria (McGinness and Johnson
1992, Johnson and Hallberg 2005). Recent studies have highlighted the eukaryotic composition of acidic and thermal sites, illustrating a common organismal composition (Baker et al. 2004, Aguilera et al. 2007a, Aguilera et al. 2010).
Geothermal Environments Geothermal environments can be natural (volcanic) and, in one instance, man-made (Iron Mountain Mine). The volcanic sites are primarily located in the
‘ring of fire’, a volcanically active region of the planet, and can be defined as vapor- dominated (acidic) or water-dominated (alkaline). These sites are host to microbial communities, in which only organisms capable of enduring the high temperatures can survive. Prokaryotes have a higher threshold for temperature tolerance, with some eubacteria having a temperature optimum up to 142 C (Rothschild and
6 Manicinelli 2001), while eukaryotes, such as protists, algae and fungi, have a upper life limit of ~60 C (Rothschild and Manicinelli 2001).
Free-living amoebae found in geothermal sites are of interest due to their potential to harbor, as well as, act as human pathogens (Sheehan et al. 2003). This has prompted inquiry in environments that can support their growth to understand the diversity and biogeography of these organisms. While interest has focused on presence, activities and potential ecological impact is left largely unexplored.
Marine Benthic Geothermal Sites
Marine thermal environments are an example of the most extreme environments found on earth. Recent studies showed that some of these environments are host to complex microbial ecosystems, including fungal diversity dominated by evolutionarily diverse yeast (Bass et al. 2007), and a multitude of prokaryotic organisms. Research has shown some of these environments contain various grazing amoebae. Heterolobosean amoebae, Marinamoeba thermophila, was discovered growing up to 50 C, (de Jonckheere et al. 2009), and an extremely thermophilic, lobose amoeba Echinamoeba thermarum, is capable of growing up to
54 C (Baumgartner et al. 2003). Marine anaerobic environments have
(Baumgartner et al. 2009) amoebae in anaerobic sediments (Smirnov and Fenchel
1996).
Volcanic Geothermal Sites
Volcanic geothermal sites can be associated with acidic, alkaline, or neutral pH. Sites that have been the focus of research include Yellowstone National
7 Park, USA (YNP), New Zealand (NZ), Japan, Iceland, Kampchatka, Indonesia, and
Costa Rica (CR).
YNP, despite long-standing research efforts, has been little studied for microbial eukaryotes other than algae and fungi. The only published work on potential grazers is that of (Sheehan et al. 2003), who used genus-specific PCR primers to show the presence of the amoeboflagellate Naegleria sp. in several thermoacidic sites, which harbored the pathogen Legionella. Vahlkampfia lobospinosa was also identified in genetic screens, suggesting that heterolobose amoebae may dominate the grazing community. Fungal analysis has been aimed at interactions and adaptations as in mycorrhizal interactions with plant root systems
(Appoloni et al. 2008).
There have been numerous studies of micro-eukaryotic diversity in NZ geothermal systems. A majority has focused on algal diversity along pH and temperature gradients (Brock and Brock 1970) and various other low, pH sites, though the studies focused on prokaryotic diversity (Donachie et al. 2002). Other studies have focus on global, long-term biogeography and geological isolation of micro-eukaryotic algae in similar environments (Toplin et al. 2008). Reports of pathogenic Acanthamoeba sp. and Naegleria fowlerii were reported in thermal waters of New Zealand, though the sites were primarily alkaline (Brown et al.
1983b). Further eukaryotic research showed that 64% of the clones in a geothermal site were eukaryotic, identifying sequences of Klebsormidium, Navicula and Euglena
(Donachie et al. 2002).
8 Community diversity was analyzed in Icelandic geothermal hot springs, where pH 2-7 environments were sampled. Phylogenetic analysis of the diversity using the 18S rRNA gene suggested a composition of phyla’s bacillariophyta, chlorophyta, rhodophyta, euglenophyta, as well as detecting ciliates and amoebae.
These environments harbored microecosystems that appeared to be organized as phototrophic microbial mats, with filamentous cyanobacteria as a major component
(Aguilera et al. 2010).
A thermophillic, acidophillic heterolobosean amoebae, T. thermacidophilus was isolated and studied from two geothermal acidic environments, Pisciarelli Solfatara, Italy and Kamchatka, Russia (Baumgartner et al.
2009). T. thermacidophilus was co-isolated with the thermo-acidophilic bacterium
Alicyclobacillus as prey. Temperature and pH tolerance were detailed, though further community structure and interactions were not.
Acid Mine Drainage Sites
Acid Mine Drainage (AMD) is a global problem associated with the acidification of waters following mining activity. These sites typically impact surrounding ecosystems and are characterized with the deposit of acid-mobilized toxic heavy metals and acidic waters, generally with a pH < 3. Microbiological studies of AMD have shown further biotic acidification of pyrite (FeS2) by specialized bacteria, Leptospirillium ferrooxidans and Thiobacillus ferrooxidans.
AMD includes lakes, rivers, and streams that can have access to sunlight (Rio Tinto,
East German Mining Lakes), or be void of sunlight (IMM). These sites are typically
9 host to mesophilic organisms due to the cold-moderate temperatures, allowing for decreased pressures, and increased diversity, comparatively. Sites with access to sunlight frequently have a portion of the primary production performed by photosynthetic algae and euglenids (McGinness and Johnson 1992), while the lack of sunlight (e.g. Iron Mountain Mine) results in primary production performed chemolithoautotrophically. Phagotrophic eukaryotes characterized from these sites usually include ciliates, flagellates, and amoebae. Most eukaryotic research in these sites focuses on diversity, and primary production, while the grazing impact is largely left unstudied.
The Rio Tinto, a river in Spain’s Iberian Pyrite belt, is perhaps the oldest and the best-studied AMD site in the world. The Rio Tinto has exceptional eukaryotic diversity, with groups such as alveolates, cercozoa, and choanozoa present throughout sites sampled (Gadanho and Sampaio 2006, Aguilera et al.
2007b). A second study suggested that the eukaryotic microorganisms are the primary source of biomass in the system, claiming that over 65% of the total biomass is eukaryotic (Aguilera et al. 2007b). The Rio Tinto studies identified a larger variety of protists morphologically, including a member of Euglenphyta,
Acanthamoeba sp., Naegleria, heliozoan Actinophrys sp., flagellates Bodo sp.,
Cercomonas sp., Ochroomonas sp., ciliates Oxytrichia sp. and Colpidium sp., and a rotifer, Rotari sp. A third study of Rio Tinto focusing on seasonal variation of eukaryotic diversity via light and SEM microscopy reported the presence of flagellate Labyrinthula, and indicate a seasonal succession of the phagotrophic
10 protists about a month after an increase in bacterial particles (Aguilera et al.
2007b).
Iron Mountain Mine (IMM), an AMD site in Northern California, is host to the world’s most acidic water, with pH as low as -3 (Baker et al. 2009). It has been the site of pioneering studies in metagenomics and proteomics due to its highly limited prokaryote community (Baker et al. 2004, Baker et al. 2009). Despite this,
IMM also harbors many microeukaryotes, including fungi (Baker et al. 2004), and a previously undescribed "acidophilic protist clade" (APC) (Baker et al. 2004). In addition to fungal and novel sequences, three heterolobose amoebae were genetically identified in the Vahlkampfiidae family; Naegleria gruberi, Singhamoeba horticola, and Plaesiobystra hypersalinica, though their activities were never monitored (Baker et al. 2004).
Coal Mining Sites
Acid Mine Lakes (AML) were formed from previous human mining activity. The most extensively studied AML sites are located in east Germany, and are characterized by low pH (2.3-3.5), and low temperatures (<12-20 C)(Packroff
2000, Bell and Weithoff 2008). Initially, studies of protist diversity focused on live and fixed observations of ciliates, with little work focusing on flagellates, rhizopods, and heliozoa (Packrof and Woelfl 2000). Further studies observed the heliozoan
Actinophrys sol, the top-predator in the lower pH lakes (Bell et al. 2006), and illustrated that in lakes with pH <2.9, were dominated by heliozoans, while pH >2.9 were dominated by ciliates (Packroff 2000), where heliozoans were not observed in
11 any pH 3.4-3.8 lakes (Bell et al. 2006). Rotifers were also noted to be active predators in the system, with distinct species domination correlating to pH (Deneke
2000). This work showed that larger species of rotifers replaced smaller organisms as the pH rose above 3. When observing seasonal recruitment of different predatory protists in a pH 2.6 lake, they showed probable temporal succession of organisms with potential grazing activity (Bell and Weithoff 2008). In spring conditions of 12 C, the rotifer Cephalodella was dominant, while an increase of temperature to 20 C resulted in a small increase in rhizopods and heliozoans. A final incubation at 20 C simulated mid-summer conditions and resulted in an increase in heliozoan recruitment. The chyrsophyte Ochromonas sp., a mixotrophic alga, is also recognized to be an important predator of bacteria in the acidic systems
(Schmidtke et al. 2006).
Microbial Food Webs in Geothermal and Acidic Environments
In contrast to microbial eukaryotic diversity, much less is known about ecological interactions, especially food webs and trophic structures in extreme environments. Interactions between these organisms in environments lacking the presence of higher-organisms is important due to the absence of predation, and organic material in a system (Gaedke and Kamjunke 2006).
Geothermal Environments
Geothermal sites such as Pisciarelli Solfatara in Naples, Italy and
Kamchatka, Russia have been found to harbor a unique, thermo-acidophilic
12 heterolobosean amoeboflagellate, Tetramitus thermacidophilus, which grazed on a native thermo-acidophillic bacterium, Alicyclobacillus and other organisms tested
(Baumgartner et al. 2009). T. thermacidophilus was found to withstand temperatures from 28 C to 52 C, and had an optimum temperature of 44 C. T. thermacidophilus was unable to survive neutral conditions, and had a pH range of
1.2 to 6, with an optimum of pH 3, signifying the organisms is acidophilic.
AMD Sites
The Eukaryotic component of trophic structures, and their impact on the food web in AMD sites has been focused on primary production of algae (Gyure et al.
1987). Little is known concerning the impact of phagotrophic grazing, though it is suggested that excretions in the environment might increase the pH, and the grazing might induce a top-down control over pyrite-oxidizing bacteria and archaea. The potential diversity of the food web in IMM was analyzed (Robbins et al. 2000). The report showed that bacteria were diverse and present at all acidic sites, despite pH, observing an increase in eukaryotic diversity as the pH rose. Fungi inhabited all sites characterized with a pH > 1.0. Holotrichous ciliates and bdelloid rotifers were seen in sites where the pH > 1.5, rhizopods and heliozoans observed at pH > 2.0.
The study suggested heliozoans are the top predator in the environment. While this initial characterization of the food web suggests the possibility of interactions, specific feeding and interactions were not observed.
13 Coal Mining Sites
The best-studied extreme food webs come from the East German mining lakes. Trophic structures have been compared between neutral and acidic sites
(Lake 111) of similar temperature in East Germany (Gaedke and Kamjunke 2006) by comparing relative biomass of prokaryotes, microeukaryotes, and metazoans with different metabolic capabilities. The study found that acidic environments have a food web restricted to two trophic levels, compared to the four levels found in neutral lakes, illustrating a decrease in organismal diversity with an increase in environmental extremes. In addition to defining the entire food web, another study went on to determine preferential grazing based on prey size, finding that 0.5 µm, the smallest size tested, resulted in the fastest rate of grazing (Schmidtke et al.
2006).
Further analysis of AMD grazing communities and potential impact has noted direct correlation to pyrite oxidizing bacteria and grazing activity. A study focusing on the AMD of a coal biotreatment plant reported the isolation and characterization of a ciliate, an amoeba, and three flagellates in the acidic waters.
The efforts characterized the grazing effect of these organisms on Iron-oxidizing bacteria Thiobacillus ferrooxidans and Leptospirillum ferrooxidans, as well as acidophilic heterotrophic bacteria (Johnson and Rang 1993) . An unidentified bi- flagellated protist isolated from pyrite mine AMD was characterized for its phagotrophic abilities (McGinness and Johnson 1992). The study illustrated preferential feeding among co-isolated acidophilic bacteria, highlighting predation
14 of iron-oxidizing bacteria T. ferrooxidans, and heterotrophic acidophile Acidiphilium cryptum, while excluding T. ferrooxidans as prey.
Objectives, Questions, and Hypotheses
The objectives of this study were:
1. To isolate and identify members of the eukaryotic grazing community using culturing and genetic techniques.
2. To determine the distribution of these grazers and their relationship to environmental variables (pH, T).
3. To understand the potential impact of the protest grazing community on native bacterial, fungal and algal communities.
Questions I addressed included:
1. Is there a unique, endemic grazing community?
2. Does diversity decrease with proximity to the lake?
3. What are the T and pH limitations of these organisms?
I hypothesized that there is an endemic, specialized grazing community with low diversity, whose members will be well adapted to the extreme pH and temperature of the lake. This community would be low in diversity, and I predicted that organisms from the surrounding forest cannot survive the extremes of the lake environment.
15
CHAPTER II
MATERIALS & METHODS
Study Site and Sampling
BSL is a 1.8 ha pool of geothermal water lying along a geologic fault (Fig.
2). The lake's temperature varies seasonally and spatially, and is thought to be fueled primarily through a 'hot zone ' at the south end of the lake, where gases and bubbling water can reach temperatures of 90 C or more. The lake is surrounded by an abundance of other volcanic geological features such as mud pots, steam vents, and springs, while seasonal side-pools surrounding the lake vary in temperature and pH.
Sampling was restricted to the summer and fall of years spanning 2008-
2010 due to winter weather and road closures associated with snow. BSL’s water temperature and pH during most sample periods was nearly constant at 50-52 C, and pH 2.2. I took samples from lake water at site ‘A’, near the outflow channel.
Samples included the suspended clay sediments, which I determined to average 73 mg L-1 (n = 5), and consisted of kaolinite (Dr. Ken Stedman, Portland State Univ., personal communication). Water samples were usually collected in sterile 2-4L bottles and transported immediately to the lab, where they were stored at 4 C.
Other samples were taken from the lake shore (dried acidic clay), various
15
16 A
B
FIG. 2. Google Earth satellite photo (a) and high-resolution GPS map of BSL shoreline and various geological features around the lake (b); Photo reprinted with permission, courtesy of Russell Shapiro).
17 geothermal features surrounding the lake, and in transects from the shore to the forest. I stored these samples in 50 mL Falcon tubes at room temperature until processed in the lab, which usually occurred within a few days.
Media Creation: Enrichments and Isolations
Filtered BSL Lake water was used for most culturing experiments. BSL water was collected on site and transported back to the lab, where it was vacuum filtered through 0.22 µm Millipore 47 mm glass-fiber filters to remove contaminating organisms and sediments. The filtered water was stored at 4 C, and aliquoted for subsequent cultures. Iron precipitation due to autoclaving BSL filtrate required heating the water to 90 C for 10 minutes.
I created primary enrichments using a sterile wheat berry as a nutrient source in 10 mL of BSL filtrate along with ~100 mg of sample material in 40 mL tissue flasks. These cultures had too much suspended sediment to efficiently view protist growth and morphologies, and required subsequent liquid cultures to reduce obscuring sediments. For these secondary cultures, I used a 0.02% peptone/yeast extract final concentration in 10 mL BSL filtrate as a nutrient source. Transfer of organisms from the primary to secondary enrichments was performed by pipetting
100 µL of the primary enrichment into the secondary enrichment flask.
Solid BSL filtrate media used Gelrite, agar, or agarose (concentrations varied) as solidifying agents. Nutrients were added as 0.02% peptone/yeast extract in most cases for isolation of bacteria and fungi, though growth using myco agar and
18 PDA were also used. Variable concentrations of cysteine were used with filtered
BSL during autoclaving to prevent precipitation of iron, though it appeared toxic to the amoebae.
Culturing: Food Stocks and Feeding Creation of Live Food Stocks
The presence of nutrients in cultures enriching for unwanted fungal contamination which could inhibit PCR amplification of desired sequences, and the need for known prey organisms for studying the predator-specific activities prompted me to isolate bacterial and fungal prey, and grow them in high enough numbers to keep the predator organisms alive. Feeder cultures of bacteria and fungi were initially colony-isolated from BSL filtrate low nutrient (0.02% peptone/yeast extract) 2% agar plates. After re-streaking for isolation, I grew the organisms in liquid broth in order to supply liquid cultures with prey-cells.
Micrococcus sp., was grown in TSB at 37°C in a 1 liter Erlenmeyer flask on a shaker.
Phialophora sp. was grown identically, using potato dextrose broth (PDB).
Additional BSL-native bacterial strains were provided by Dr. Patricia Siering and Dr.
Mark Wilson (Humboldt State University) using the recipe provided, the cells were grown in 500 mL volumes at the temperatures previously described. I harvested cells by repeated centrifugation to serially pellet cells at 12,000 RPM for 10 minutes.
I washed the cells three times in 1X phosphate buffered saline (PBS) before re- suspension in ~ 10 mL DI water. I stored the cells at 4°C for use in liquid cultures and as lawns on solid media.
19 Feeding in Liquid and Solid Media
I used the cells in two ways: for feeding as a suspension in liquid cultures, and as lawns on agar, commonly referred to as the walk-out method previously described (Neff 1958) for amoebae isolation. Liquid cultures used 10 µL concentrated feeder cells per 10 mL liquid cultures. I created plates by heating BSL filtrate to 90 C for 10 minutes, and then mixing with a solidifying agent. I autoclaved the solidifying agents in 100 mL DI water, and added to the BSL filtrate for a final agar or agarose concentration of 2%. Gelrite required CaCl2 at a concentration of 0.02% for a final Gelrite concentration of 4%. I then deposited a lawn of 500 µL concentrated prey cells on the surface of the agar, and allowed it to dry overnight. Once dried, small amounts of soil, or inoculum were placed on the lawn. The plates were parafilmed to reduce evaporation, and stored face up at 37°C until a plaque appeared around the soil sample. The plaque was checked for amoebae by suspending a loop of material in DI water on a deep-well slide and observed under 400X phase microscopy. If amoebae were present, they were re- cultured onto a separate plate with a lawn of feeder cells via sterile loop transfer, and subsequently into liquid cultures of BSL filtrate or DI water and a suspension of feeder cells.
Isolation of T. thermacidophilus: Attempts at Monoxenic Culture Creation
I attempted to isolate T. thermacidophilus on solid media in different aerobic environments. Using the previously described walk-out method, I incubated
20 T. thermacidophilus inoculated plates of agar, agarose, and Gelrite in anaerobic and microaerophillic environments aerobically (using Becton-Dickson anaerobic and microaerobic “Campy” gas generating pouches), and incubated them at 37 C.
I then attempted to rid T. thermacidophilus cultures of the consistent acid, thermal-tolerant fungal contamination by filtration and serial dilutions. I attempted filtration-isolation of T. thermacidophilus cysts by vacuum filtering fungi- contaminated T. thermacidophilus cultures through 8 µm glass-fiber 45 mm filters, using the cyst-laden filters as an innoculum for subsequent cultures, which were incubated in 0.02% peptone/yeast extract BSL filtrate, or on lawns of prey cells. I then attempted isolation by dilution to extinction. This was performed by serially diluting active T. thermacidophilus cultures in BSL filtrate containing 0.02% peptone/yeast extract. Three 4-fold serial dilutions were attempted, with ratios of
10:1, 20:1, and 100:1 in 24 well plates containing a Micrococcus sp., prey suspension.
Wells were monitored on an inverted scope for the presence of amoebae, and the lowest concentration with positive T. thermacidophilus growth was used for subsequent work.
pH and Temperature Tolerance
To understand the environmental tolerance of the organisms, I tested
Acanthamoeba sp., Bodo sp., Hartmannella sp., and T. thermacidophilus for their ability to survive at a range of temperatures, as well as for the ability to survive neutral and pH 2 environments and in the case of T. thermacidophilus, pH tolerance and subsequent doubling times. Temperature tolerance was noted by the ability to
21 grow in a temperature-gradient incubator in a variety of temperatures.
Temperature was controlled through the nine-tube gradient by a heat source at one end, and a water-circulating cold-water bath at the opposing end. Temperatures of the sample tubes, ranging high to low, were measured as 50, 40, 34, 29, 24, 22, 20 and 16 C. Growth was determined by positive or negative activity over the next week.
In order to test the pH tolerance of T. thermacidophilus, I created a basal salts medium (0.2% KH2PO4, 0.1% NaCl, 0.2% NH4Cl, 0.05% MgSO4, 0.0025% FeSO4,
0.0025% MnSO4, 0.01% CaCl2) buffered with H2SO4 and NaOH for a pH gradient ranging from 1-8. Cells were incubated at 42 C in 20 mL scintillation vials and counted in triplicate every 24 hours for 96 hours. I calculated doubling time at the specific pH values for the 96 hours and graphed the results.
Environmental Distribution of T. thermacidophilus Cysts
In-vitro environmental counting was performed by inoculating 24 well plates containing 2 mL BSL filtrate with 0.02% peptone/yeast extract with an amount of suspended sample. The wells were observed for positive or negative growth via inverted scope after 14 days. Mg sediment/volume of sample water was determined by dry vs. wet weight, and mg µL-1 into each well was subsequently calculated. I then calculated the amount of viable cysts mg-1 sediment present in the site sampled indicated by the presence or absence of amoebae growth. I used this
22 method to calculate the amount of viable cysts at six locations on the west side of the lake. Temperatures were documented from each site.
Microscopy: General Observation Techniques
I used a variety of microscopy techniques to observe growth of organisms in cultures. Phase microscopy was primarily used for counting, imaging, and basic observations of cultures and enrichments. To do this, I would place 10 µL of a liquid culture in a deep well slide. I used an inverted microscope with Hoffman modulation contrast to observe grown in 12 and 24 well plates, as well as periodically in flask-cultures.
Due to their slow locomotion, I counted all amoebae without fixation, but the quick-moving Bodo sp., required fixation with Lugol’s iodine. This was performed by pipetting 20 µL culture into a PCR tube, and using a stock solution of
Lugol’s iodine, I added enough drop-wise to convert the culture to a light-yellow color, and invert the tube a few times to mix.
Genetics: Extraction and Analysis
Whole genomic DNA was extracted by centrifuging 1 mL liquid culture
10,000 RPM for 1 minute and re-suspending in 1 mL 1X pH 7.4 PO4 buffer and vortexing to re-suspend material. Samples were then transferred to 2-mL bead- beating tubes. I added 300 µL SDS lysis buffer, 1-mm glass bead-beads, and 300 µL
CHCl3. Tubes were bead-beaten twice for 1 minute, with 1 minute rest on ice, and
23 then spun for 5 minutes at maximum speed to pellet cell debris. The aqueous layer was added to a new tube containing 100 µL 3M sodium acetate, pH 5.6 in 1.5 mL microcentrifuge tubes, vortexed, and spun for 5 minutes. The supernatant was added at a 1:1 ratio of isopropanol and incubated for 15 minutes to precipitate nucleic acids. The tubes were spun for 5 minutes, and the supernatant was removed. The nucleic acids were washed once with 70% EtOH, spun at maximum speed for 5 minutes and the supernatant was removed. The tubes were then spun under vacuum at 35 C to remove the remaining EtOH, and re-suspended in 40 µL TE buffer.
Clone Libraries
I attempted to construct clone libraries using Lucigen Corporation’s GC
Cloning and Amplification Kit with pSMART GC Vectors as per manufacturer’s instructions. DNA was extracted from transect and other samples, and PCR amplified using 82F, 1520R primers at 52 C for 35 cycles. Positive amplification was verified on RAGE gels. Samples resulting in amplification were cleaned of inhibitors using AMPure (Agencourt Biosciences), and re-ran with T4 kinase phosphorylated primers at 37 C for 10 minutes. Ligation with puc19 plasmid was followed by transformation of chemically competent E. cloni cells, and plated on LB- ampicillin plates and incubated at 37 C. Clones were screened with MspI restriction enzyme.
24 DGGE
I extracted whole-genome DNA from samples and ran the nucleic acids on
4% agarose gels to confirm DNA extraction. I then PCR amplified the V8 region of the ITS using the 1427GC/1616R primers for DGGE. Using a 30-55% gradient gel, the samples were run at 50 V for 960 minutes at 58 C. The gels were stained with ethidium bromide for 15 minutes, and destained for 30 minutes. Gels were photographed under UV light, and bands excised on a UV light table. Excised bands were placed in PCR tubes and stored at 4 C until they could be re-amplified and sequenced.
Group-specific Primers
Group specific primers were obtained from various sources (Table 1), and used for screening DNA extracted from enrichments for specific organisms. The primers and targeted organisms are listed (Table 1), and PCR was performed as per appropriate melting temperature by manufacturers suggestion. Reactions were usually run for 35 cycles. T. thermacidophilus primers were designed using sequences obtained by aligning Tetramitus sp., ITS sequences found in the NCBI database, and finding a homologous region at the beginning of the ITS rRNA gene.
Samples showing bands from gel electrophoresis indicating PCR amplification of a product the appropriate size were sequenced and analyzed using NCBI BLAST.
25 TABLE 1. Primers used for group-specific and universal PCR.
Primer Sequence (5' - 3') Target Source
Universal Euk 82F GAAACTGCGAATGGCTC 18S SSU rRNA Brown & Wolfe, 2006 1427F TCTGTGATGCCCTTAGATGTTCTGGG V8 SSU rRNA Brown & Wolfe, 2006 20F GTAGTCATATGCTTGTCTC 18S SSU rRNA Brown & Wolfe, 2006 1616R GCGGTGTGTACAAAGGGCAGGG V8 SSU rRNA Brown & Wolfe, 2006 516R AACCAGACTGCCCTCC V3 SSU rRNA Brown & Wolfe, 2006 LSU-R1 TTAGTTTCTTTTCCTCCGCTTAGT LSU rRNA
Specific Euk Tetramitus ITS-R CACTCACAAGCAAGTACCCTTGCTACTCG Tetramitus This study Naeglaria F192 GTGCTGAAACCTAGCTATTGTAACTCAGT Naegleria Naeglaria R344 CACTAGAAAAAGCAAACCTGAAAGG Naeglaria Cerco 18S 1256R GCACCACCACCCAYAGAATCAAGAAAGAWCTT Cercozoans C JITS-F GTCTTCGTAGGTGAACCTGC Vahlkampfiid De Jonckheere & amoebae Brown, 2005 JITS-R CCGCTTACTGATATGCTTAA Vahlkampfiid De Jonckheere & amoebae Brown, 2005 Kineto 14F CTGCCAGTAGTCATATGCTTGTTTCAAG Kinetoplastids Kineto 2026R GATCCTTCTGCAGGTTCACCTACAGCT Kinetoplastids JDP1 GGCCCAGATCGTTTACCGTGAA Acanthamoeba Booton, 2005 JDP2 TCTCACAAGCTGCTAGGGGAGTCA Acanthamoeba Booton, 2005
Virus Mimivirus L396F TTAATCATCTTCCAAAAAATTTAATTC Mimivirus Dare et al., 2008 helicast Mimivirus L396R ATGGCGAACAATATTAAAACTAAAA Mimivirus Dare et al., 2009 helicast Mimivirus R596F ATGTCGTTATCAAAACAAGTAGTTCC Mimivirus thiol oxidoreductase Mimivirus R596R CTAATTTTCAATATAGTGCGTAGATTCTA Mimivirus thiol oxidoreductase Mimivirus CP D13L- ATGGCAGGTGGTTTACTCCAATTA Mimivirus Aaza et al., 2009 F Capsid Protein Mimivirus CP D13L- ATTACTGTACGCTAATCCG Mimivirus Aaza et al., 2009 R Capsid Protein MCP-F GGTGGTCARCYATTGA Major Capsid Larsen et al., 2008 Protein MCP-R TGIARYTGYTCRAYIAGGTA Major Capsid Larsen et al., 2008 Protein
26 Sequencing and Bioinformatics
Samples were sent to University of Washington High-Throughput
Sequencing Center for Sanger sequencing. The returned sequences were analyzed using BLAST against the NCBI database. The top results based on percent similarity and lowest E value were considered positive identification. I created contigs of the
T. thermacidophilus 18S SSU rRNA gene using the DNA star software suite that resulted in a fragment of 1954 bases of the 18S SSU rRNA sequence. I used
ClustalW2 software to align the sequences, and Jal View to cut the sequences to nucleotides 63-2408 for maximum alignment. The sequences were analyzed using
MEGA 5.01 software to create a pairwise distance matrix and Maximum likelihood phylogenic tree using default parameters.
Feeding Observations via TEM and Acridine Orange Staining
In order to determine if T. thermacidophilus was capable of feeding on
BSL-native bacterial and fungal food sources I used transmission electron microscopy (TEM) and acridine orange (AO) staining to observe internalized cellular structures and determine what organisms were ingested.
TEM
I created TEM samples from T. thermacidophilus, Acanthamoeba sp., and
Bodo sp., cultures for examination of ultrastructure, detection of possible viral infection and analysis of engulfed prey. To do this I spun 10 mL of the cultures for
40 minutes at low speed and transferred the bottom 0.5-1 mL to a 2 mL microfuge
27 tube. I then fixed the samples with Karnovskey’s fixative at a ratio of 1:1 two times for 20 seconds at 650 W under 20 mm Hg vacuum with a 30 second resting period. I proceeded to spin one minute at 10,000 RPM, and decanted. I then added 0.5 mL cacodylate buffer and microwaved for 30 seconds at 150 W without vacuum. I spun the samples for one minute at 10,000 rpm, and decanted the buffer, adding 100 µL
1% OsO4 and microwaved the samples at 450 W three times (40 seconds on, 1 minute off). For the dehydration step, I microwaved without vacuum at 150 W,
80 C, for 1 minute intervals for each step, which required serial removal and addition of 50%, 70%, 90% and two 100% ethanol steps. The resin infiltration was done three times. For this I would fill the samples with 300 µL Epon resin, and microwave in 20 mm Hg at 350 watts/80 C for 1 ,2, and 3 minute durations per step. For the final step I centrifuged the samples for 10 minutes at 10,000 rpm with the spin-bucket rotor into the final shells and incubated overnight at 50 C overnight.
The shells were cut, and the plugs were removed and ultra-thin sections cut and placed on copper grids, which were stained with uranyl acetate and Lead citrate by floating the grids sample-side down on a drop of uranyl acetate for 10 minutes, and then washed by dipping the grid in DI water 160 times. I then counter-stained and washed with lead citrate the same way. Initially scanning was performed at CSU
Chico, and grids with good samples were noted, and taken to Portland State
University and UC Davis for further analysis and imaging.
28 Acridine Orange Staining
Acridine orange (AO) was used to stain fixed T. thermacidophilus and
Bodo sp., cells for microscopic analysis. I prepared a 0.1% AO stock solution in
DMSO and stored it at 4 C. Cells were washed two times in 1X PBS buffer to prevent acid interaction with AO, then re-suspended in DI water at half volume. The cells were fixed with a final concentration of 1% methanol, and incubated with a final concentration of 0.01% AO for 10 minutes. It was observed at 600X magnification under blue light.
29
CHAPTER III
RESULTS
Enrichment Cultures 2008
Liquid Cultures: Microscopy
I set up initial enrichments in Summer 2008 from BSL water, sediments, and surrounding geothermal features. Samples were incubated with filtered BSL water, and all were provided 1-2 sterile wheat berries per ca. 50 mL as a nutrient source. Within a few days of incubation at 27-50 C, I observed a number of micro- eukaryotes, including numerous amoebae, fungi, diatoms, and small flagellates in all samples (Fig. 3). Other morphologies observed in cooler side pools and geothermal features included algae, ciliates, and in one instance, from samples incubated at below room temperature, euglenids. Subsequent culturing showed fewer cell morphologies over time, suggesting microbial succession.
Besides fungi, the most frequent protist morphologies observed were
Bodo-like flagellates and limax amoebae originally documented in a deep-well slide using 400X phase contrast microscope (Fig. 3a,e, Fig. 4). The latter resembled vahlfampfiids (Schizopyrenidea), heterolobose amoebae with pseudopodia produced in sudden bulges. These amoebae have a flagellate life cycle stage
(amoeboflagellates), and form cysts when environmental conditions are
29
30
FIG. 3. Morphologies observed in summer 2008 enrichments. With 400X phase contrast microscopy. (A ) Bodo sp. flagellate, (B) Pinnularia-like diatom; (C-D) unidentified flagellates; (E-F) vahlkampfiid amoeboflagellates. Scale bars = 10 µm.
FIG. 4. Micrographs of vahlkampfiid amoeba. (A,B) in limax form, (C) in the flagellate stage, (D) in cyst form. Scale bars: 10 µm.
31 unfavorable. These include the genera Naegleria, Tetramitus, and Vahlkampfia among others (de Jonckheere and Brown 2005, Opperdoes et al. 2011). These typically co-occurred with a filamentous fungus and were especially numerous in culture flasks where macroscopic clearing of the sediment was observed (Fig. 5, bottom flask). Other amoebae had fine pseudopodia, were large-limax naked amoebae, or were nucleariid-like (Fig. 6).
FIG. 5. Clearing of sediment in primary enrichments containing amoebae activity after a couple weeks of incubation using sterile wheat berries as a nutrient source.
32
FIG. 6. Other amoebae morphologies observed via culture enrichment, and identified genetically in cultures. (A) Acanthamoeaba-like; (B) Hartmanella-like; (C) Nucleariid-like. Micrographs using 400X phase microscopy suspended in water and observed in a deep-well slide. Scale bars = 10 µm.
Genetic Characterization of Diversity - DGGE
To determine diversity and complexity of my enrichment cultures and transects, and to help guide isolation efforts, I extracted DNA from enrichment and environmental samples (Table 2) and used DGGE fingerprinting with the
1427GC/1616 primer pair (Table 1), which amplifies the V8 region of the 18S rDNA.
A total of 35 bands were excised, reamplified, and sequenced. Several phototrophic eukaryotes were observed: one sample incubated at 54°C showed a number of bands corresponding to Cyanidiales (Fig. 7) and another showed chlorophyte
Chlamydomonas acidophila (Fig. 8), but most bands were similar to either fungi, nuclearid, lobose or heterolobose amoebae, or flagellates (Figs. 7a, b, c). Although these short sequences had little phylogenetic resolution, several were similar to
Acanthamoeba, which had not been observed in culture at this time. A second DGGE gel also revealed diatoms with the 1427GC-1616 primers (Fig. 10), while a set of
33 TABLE 2. DNA samples for DGGE screening. ENV = environmental sample. DNA samples for DGGE screening. ENV = environmental sample.
Tube Sample Extract. date Sample Incubation T ( C) 1 ENRICHMENT 12/3/2008 LWD# EF 34 2 ENRICHMENT 12/3/2008 BI-EF 34 3 ENRICHMENT 12/3/2008 LWD#2-TC 4 ENRICHMENT 12/3/2008 LWD#3 TC 5 ENRICHMENT 12/3/2008 LWD#3 2L 6 ENRICHMENT 10/7/2008 BI-1.5(54C) 54 7 ENRICHMENT 10/7/2008 LBI-2.5 8 ENRICHMENT 10/7/2008 L-WD#-1 9 ENRICHMENT 10/7/2008 L-WD#2 10 ENRICHMENT 2/16/2009 BR001 11 ENRICHMENT 2/16/2009 BR003 12 ENRICHMENT 2/16/2009 BR022 25 13 ENRICHMENT 2/16/2009 BR0035 25 14 ENRICHMENT 2/16/2009 BR002a 15 ENRICHMENT 2/16/2009 BR002a -D 16 ENRICHMENT 2/25/2009 BR002a-2 34 17 ENRICHMENT 2/25/2009 BR002a-1 34 18 ENRICHMENT 2/25/2009 BR005 light table 19 ENRICHMENT 2/25/2009 BR005a light table 20 ENRICHMENT 2/25/2009 BSL-2-diatom-2 light table 21 ENRICHMENT 2/25/2009 BSL-2-diatom light table 22 ENRICHMENT 2/25/2009 BSL-004 light table 23 ENRICHMENT 2/25/2009 BR002 light table 24 ENV 7-5-09 10/7/2008 Side A 25 ENV 7-5-09 10/7/2008 Sediment 26 ENV 7-5-09 10/7/2008 West Green Pool 27 ENV 7-5-09 10/7/2008 Sample 007 28 ENV 7-5-09 10/7/2008 Sediment control
amplifications with 20-516GC primers to amplify the V3 region revealed mostly fungi, but also a possible cercozoan (Fig. 11).
Isolation Efforts
In order to isolate vahlkampfiid amoebae, I first tried to find suitable prey sources, as attempts to use standard lab bacteria such as E. coli as a food source
34 showed greatly decreased growth. I plated enrichments onto low-nutrient (0.01% peptone/yeast extract) filtered-BSL water agar to isolate potential prey. This resulted in the isolation of a white-pink pigmented ascomycete with large irregular conidia, initially labeled ‘White Dot (WD)’ and later identified as Phialophora sp., a known acidophilic fungus (Fig. 12).
FIG. 7. DGGE gel screening of initial enrichments (Lanes 6-8) stained in ethidium bromide. Bands were excised and subsequent sequence assignments are labeled. Samples are listed in Table 2.
35
FIG. 8. DGGE gel screening of initial enrichments (Lanes 1-4) stained in ethidium bromide. Bands were excised and subsequent sequence assignments are labeled. Samples are listed in Table 2.
36
FIG. 9. DGGE gel screening of initial enrichments (Lanes 11-15)stained in ethidium bromide. Bands were excised and subsequent sequence assignments are labeled. Samples are listed in Table 2.
37
FIG. 10. DGGE gel screening of initial enrichments (Lanes 1,3,4) stained in ethidium bromide. Bands were excised and subsequent sequence assignments are labeled. Samples are listed in Table 2.
38
FIG. 11. DGGE gel screening of initial enrichments (Lanes 5,6, 7-9) stained in ethidium bromide. Bands were excised and subsequent sequence assignments are labeled. Samples are listed in Table 2.
39 In April 2009, I attempted to isolate amoeboflagellate cysts and to characterize potential prey by DGGE. In order to isolate amoeboflagellate cysts, actively feeding cultures were starved, or placed in a 50°C water bath overnight to induce encystment, and then cysts were washed in 1X PBS and recovered by filtering through 8 µm pore filters to allow passing of fungal conidia, smaller micro- eukaryotes, and bacteria, while retaining amoeboflagellate cysts. These were then re-incubated with prey in liquid media, as well as direct placement of the filter on a lawn of feeder cells. While I was able to use this method to enrich for amoeboflagellate cultures void of other protists (Table 3), fungal contamination
FIG. 12. Ascomycete Phialphora sp., isolated from amoeboflagellate enrichments. (A) Growth on 0.01% peptone/yeast extract-filtered BSL water agar (A-left) and Myco Agar (A-right). (B) 400X phase contrast microscopy of conidia. Scale bar = 10 µm.
40 TABLE 3. Enrichments following cyst recovery and re-incubation, and microscopic examination.
Date Food Source Inoc. Source Observations 4-17-09 4/13/2009 BR009(2/6/09) LWD#3 (BR004) Many large vahlkampfiid amoebae 4/10/2009 SB-2 Y-WD Vahlkampfiid amoeba, Flagellates and cysts.
4/10/2009 BR009 (WD) Y-WD One vahlkampfiid amoebae observed,
4/10/2009 SB-1 Y-WD Many vahlkampfiid amoebae,
4/13/2009 SB-1 LWD#3 (BR004) Amoebas, bacteria and small euks? Amoeba seem to be eating the euks. 4/15/2009 BR009 WD#3L (BR004) Large vahlkampfiid amoebae
4/15/2009 SB-3 LWD#3 (BR004) Highly active vahlkampfiid amoebae
4/15/2009 SB-1 LWD#3 (BR004) Many vahlkampfiid amoebae, lots of food, Contamination 4/15/2009 SB-2 LWD#3 (BR004) Many vahlkampfiid amoebae.
remained. I observed both amoebae and flagellate activity on plates within a few days, though no clearing ever occurred. Attempts to use the ‘walk-out’ method for isolation failed, as activity was only observed directly around the inoculation point, suggesting an inability to migrate on the agar surface. Further attempts at isolating the vahlkampfiid amoebae on plates using lawns of either prey under aerobic, anaerobic and microaerophillic conditions, and with media solidified with agarose, agar, or Gelrite, all failed to give growth at both 27°C and 37°C (not shown).
To determine the genetic identification of the amoebae, and examine the communities within cultures, the potential prokaryotic prey in the cultures, I extracted DNA and amplified both prokaryote (16S rRNA) using the 341/534 primer pair (V3 region) and eukaryote (18S rRNA) with 1427/1616 primer pair (V8 region), which were analyzed by DGGE. Bands were excised, re-amplified, and
41 sequenced to give low-resolution identities. Prokaryotes identified included possible Acidphilium, proteobacteria, and several firmicutes known to be present in
BSL and other AMD/geothermal sites, including Alicyclobacillus/Sulfobacillus (Table
4). Because these bacteria were co-detected in amoeboflagellate cultures, we determined that they are probably the naturally occurring prey in the system, along with fungi. The eukaryotic primers provided sequences indicating the presence of cercomonads in a culture grown at 34°C, as well as several fungal sequences identified as ascomycetes and basidiomycetes. The fungal V8 region was too low in resolution to give generic information, but fungi detected by rRNA-ITS PCR included the ascomycetes Aspergillus and Penicillium spp.
Enrichment Cultures 2009
In July 2009, I collected additional samples for enrichments. These include transects from the lake’s edge to the forest, to examine diversity across a gradient of temperature and acidity, as well as samples from cooler acidic side- pools, and from non-acidic thermal soils above the southern slope of the lake. I collected four transect samples (Table 5) but focused work on TS-1, with samples taken 0, 3, 9, 34, and 45 meters from the lake. Samples were incubated at 40°C with wheat berries, and growth was monitored with microscopy. After incubation, samples from the lake’s edge and nearby sediments showed amoeboflagellates, flagellates (Fig. 13a, b),, and cysts (Fig. 4d) while samples incubated at cooler temperatures also showed
Bodo-like flagellates (Fig. 13c,d).
42 TABLE 4. Identification of prokaryotes in vahlkampfiid amoebae enrichments following 16S rDNA V3 ampfliciation and DGGE fingerprinting. YNP = Yellowstone National Park; AMD = acid mine drainage site.
Sample culture food source Closest BLAST hits 7a F-2 SB-1 Uncultured bacterium clone RH2-P2 (YNP) 10c F-5 SB-2 Uncultured -proteobacterium clone D01_SGPL01 10b F-5 SB-2 Uncultured bacterium clone LAN9 1a LWD# EF Uncultured Firmicutes bacterium clone F12_3B_FF 2a L-WD#2 Uncultured AMD bacterium clone DBS-Clone1 5b BR002a Uncultured - proteobacterium clone HCM3MC80_10B_FF 8a F-3 BR009 Acidiphilium sp. SX-F 16S 8b F-3 BR009 Acetobacteraceae AKB-2008-TA7 14a F-9 SB-1 Uncultured bacterium clone RH2-P2 (YNP) 14b F-9 SB-1 Uncultured low G+C Gram+ bacterium clone NEC02064 (YNP) Gram-positive iron-oxidizing acidophile CH2 (AMD) 14c Uncultured bacterium clone BFA_001 5a BR002a Acidiphilium sp. DKAP1.1 (AMD) 6a F-1 SB-3 Gram-positive heterotrophic acidophile Y004 Alicyclobacillus tolerans Sulfobacillus
Isolation Efforts
Previous attempts to isolate the vahlkampfiid amoeba by placing liquid cultures onto small lawns of bacteria and fungi spread on solid media had failed, therefore I attempted to perform plate isolations directly from soil samples. In
October of 2009 I used condensed, washed Micrococcus cells spread on pH 2 water agar to isolate two different amoebae directly from soil and sediment samples. For the first attempt at isolating amoebae via the walk-out method, I used sediment from sample TS-2-2m (Transect 2, taken 2 meters from the lake shore and incubated the plates at 34°C and 40°C. This resulted in plaques surrounding the
43
TABLE 5. Transect samples collected 7-18-09. Figure 23 shows locations.
Site Transect Distance (m) Description Site A TS-1 0 Taken within 5 cm of lake shore. Wet sediment TS-1 3 small dry inflow channel sample, dry sediment TS-1 9 source of small inflow channel, intersection of red/white TS-1 15 dry red soil TS-1 34 On burn next to sulfur deposit TS-1 45 Past trail panic grass sample West site TS-2 0 wet sediment from peninsula between A two submerged mud pots TS-2 5 dry west green pool sample TS-2 12 before red barrier next to small dry pots TS-2 20 red soil before tree growth Site D TS-3 0 Near water site A - crusty dry soil TS-3 6 Near canyon - crusty dirt TS-3 14 Near end of canyon TS-3 21 Forrest soil East Lake TS-4 0 Near water wet sediment TS-4 5 Near pot TS-4 11 On hill near plants, red soil
44
FIG. 13. Vahlkampfiid amoebae and Bodo-like flagellates observed in July 2009 transect samples under phase microscopy. (A-B) vahlkampfiid amoebae in active limax form at 400X magnification. (C-D) Bodo-like flagellates fixed with Lugal’s iodine at 600X magnification. Size bars = 10 µm.
inoculation site on the 34°C plate. When I transferred a loop of material from within the plaque and mixed it in DI water on a deep-well slide I observed large amoebae with filose pseudopodia and large, irregular cysts (Fig. 14), similar to Acanthamoeba sp. I then loop-transferred more plaque material to a new lawn prepared the same way and observed two plaques that appeared overgrown with fungi. Though the contaminating fungi was present in the first transfer, it eventually disappeared with
45 subsequent re-plating immediately after plaques were observed. I suspected the fungus was utilizing Acanthamoeba excretion as nutrients, which would explain the fungal growth limiting within the plaque.
FIG. 14. Amoebae observed from summer 2009 TS-2-2 m sample walk-out enrichment. Acanthamoeba-like cell (A), and cysts (B), at 400X phase microscopy. Size bars = 10 µm.
I then inoculated soil from an area not previously sampled, from the steeply sloped south side of the lake high above the thermal zone, where the soil was warm, but the temperature was never monitored. This resulted in plaques surrounding the inoculation point after five days of incubation at 34°C (Fig. 15a).
This sample produced long limax amoebae resembling Hartmanella sp., (Fig. 15b), which were later genotyped as Hartmannella vermiformis.
46
FIG. 15. Hartmannella growth on solid media from a soil sample above the southern thermal zone. (A): plaque resulting after migration over the agar surface on a lawn of Micrococcus.; (B) limax amoebae and cysts (marked by arrow) at 400X phase suspended in water on a deep-well slide. Scale bar = 10 µm.
Both new amoebae cultures were later transferred to liquid culture with a suspension of Micrococcus cells in BSL-filtrate. Acanthamoeba proliferated, while
Hartmannella failed to grow until placed in DI water, suggesting Hartmannella is intolerant of the acidic conditions of the lake.
Genetic Characterization of Diversity: Clone Libraries
In fall 2009 I attempted to create clone libraries from enrichment cultures to phenotypically identify the vahlkampfid amoebae. PCR amplification using the 82F/1520R primers for 18S rRNA on 16 samples of DNA extracted from two transects as well as several side pool samples yielded eight positive samples, which were used to construct separate libraries. Cloning efficiency was very low,
47 and only 24 colonies were observed for all eight libraries, with ten unique RFLP patterns observed when digested by MspI (Fig. 16). After sequencing clones with both forward and reverse primers used for cloning, 29 sequences were retrieved and blasted against the NCBI database. All sequences were identified as algae or fungi, including the chlorophyte Coccomyxa pringsheimii, and the ascomycete
Penicillium purpurogenum. Additionally, several fungal clones corresponding to prior libraries from BSL sediments (Wilson et al., 2008) and acidophilic bacterial sequences were identified.
Genetic Characterization of Diversity: DGGE
The failure to retrieve non-fungal sequences from clone libraries prompted me to repeat the DGGE analysis on enrichments from the TS1 transect samples, as well as various side pools (Table 6). I used DGGE fingerprinting with the
1427/1616 primer pair, which amplifies the V8 region of the 18S rDNA. Thirty- eight distinct bands were chosen to re-amplify and sequence (Fig. 17). Fungi included Aspergillus, Penicillium, Ochrochonis, Acidomyces, and other ascomycetes, while algae included Cyanidiales and chlorophytes. Several heterolobosea were also detected. In particular, the gel showed a band in the transect samples that were strongest at the near-lake region, but faded towards the forest (Fig. 18), and which had high similarity to a newly deposited sequence for the heterolobosean
Tetramitus thermacidophilus, a valkampfiid taxon identified from similar acidic geothermal sites in Russia and Italy and just published in fall 2009 (Baumgartner et
48 al. 2009). This organism, along with the fungi Acidomyces and Ochrochonis, was most abundant near the lake shore on the NW side (Table 7).
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 Gel Lane Clone 3 uncertain 5 C 7 B 9 uncertain 1 11 B 13 D 15 E 17 F 19 G
3 H 5 uncertain 7 I 9 J 2 11 A 13 uncertain 15 uncertain 17 uncertain 20 A
3 B 5 uncertain 7 B 9 B 3 11 uncertain 13 B 15 B 17 uncertain 19 B
FIG. 16. Clone library PCR products and their RFLP digestions with MspI restriction enzyme. RFLP lanes are indicated by gel, and common RFLP patterns are designated by letter assignment.
49 TABLE 6. Observations of transect and side-pool sample enrichments used for DGGE Nov. 2009.
Lane Sample Date T ( C) Observed Contents A TS-1-0 m 8/28/2009 37 vahlkampfiid amoebae, flagellates B TS-1-3 m 8/28/2009 37 vahlkampfiid amoebae, flagellates C TS-1-9 m 9/2/2009 37 Low vahlkampfiid amoebae activity, flagellates, brown fungus D TS-1-34 m 9/2/2009 37 Low vahlkampfiid amoebae activity, flagellates, brown fungus E TS-1-46 m 9/2/2009 37 Highly active large vahlkampfiid amoebae F W-T-A 2 9/9/2009 37 vahlkampfiid amoebae and flagellates G W-T-B 2 9/9/2009 37 vahlkampfiid amoebae H W-T-C 2 9/9/2009 37 vahlkampfiid amoebae and flagellates I Extraction (JS4) 7/20/2009 45 vahlkampfiid amoebae at 51 C J Heat Sample 8/5/2009 40 vahlkampfiid amoebae JS(4) K A- Green 6/16/2009 37 Various flagellates L C- Red Fil. 6/23/2009 37 Various flagellates M 3- Blue 6/8/2009 13 Various flagellates N 3- Blue 6/8/2009 37 Various flagellates O 4- Red Fil. 6/15/2009 37 Various flagellates P 4- Pink 6/15/2009 40 Various flagellates Q A-004 7/21/2009 22 Various flagellates
Genetic Characterization of Diversity: Group-specific PCR Primers
Cultures from transects and enrichments were also screened with group-specific primers for SSU and ITS rRNA. Targeted organisms included ciliates, kinetoplastids, cercozoans, and heteroloboseans (Table 1). The ciliate primers consistently failed
50 to amplify, while the others gave strong bands in some samples (not shown).
However, of those, only kinetoplastids were successfully sequenced to
FIG. 17. DGGE gel of enrichments from transects and other 2009 samples, with band-associated sequence assignments. Table 7 shows lane assignments and enrichment specifics.
51
FIG. 18. DGGE gel showing distances associated with samples and the deterioration of T. thermacidophilus-like sequence in samples with distance from the lake. Samples are Transect 1 (TS-1) and West Transect (WTA), location illustrated in Figure 23.
52 TABLE 7. DGGE-band Sequences from Nov. 2009. C = coverage; I = identity.
Sample Lane Band PCR BP C% I% E BLAST Ident TS-1-0m A1 2 +++ 179 95 2E-73 Acidomyce srichmondensis TS-1-3m B1 2 +++ 197 92 4E-65 Tetramitus thermacidophilus C1 3 +++ 199 93 9E-67 T. thermacidophilus (IMM) Trebouxiophyceae sp, TS-1-9 C2 3 +++ 185 97 1E-69 Coccomyxa D1 2 +++ 203 93 1E-66 T. thermacidophilus (IMM) D2 3 +++ 207 96 3E-77 Heterolobosea sp. D3 1 + 210 82 5E-47 Heterolobosea sp. Trebouxiophyceae sp, D4 3 ++ 182 95 1E-74 Coccomyxa TS-1- D5 2 - 184 nothing 34m D6 2 ++ 184 97 3E-71 Penicilliumpittii E1 2 + 205 74 1E-09 Lecanoromycetidae E2 1 ++ 185 97 9E-72 Ochroconis gallopava E3 0 - 183 nothing E4 1 ++ 180 87 96 2E-68 uncultured Sordariales clone TS-1- E5 3 +++ 180 97 93 5E-69 uncultured eukaryote isolate 46m E6 4 +++ 180 87 93 2E-62 Lopezaria versicolor F0 1 ++ 173 90 98 3E-71 Acidomyces richmondensis WTA-2 F1 0 - 385 43 95 1E-63 Penicillium pittii I1 2 ++ 186 87 90 9E-57 uncultured ascomycete (IMM) A-Green I2 1 ++ 187 84 94 2E-63 Ochroconis gallopava K1 2 ++ 185 86 95 2E-67 Acidomyces richmondensis K2 1 ++ 189 85 94 1E-65 Aspergillus zonatus 3-blue K3 4 ++ 187 96 95 3E-76 Ochroconis gallopava L1 0 + 186 87 98 1E-74 uncultured fung/euk L2 1 + 178 89 90 2E-57 Phoma herbarum L3 1 + 191 84 97 9E-72 uncultured fung/euk 3-blue L4 3 + 192 85 97 7E-73 Acidomyces richmondensis M1 0 ++ 185 87 91 5E-59 Penicillium pittii M2 1 ++ 179 88 95 1E-65 uncultured fung/euk M3 1 - 379 31 70 1E-07 Warcupiella spinulosa 4-red-fil M4 4 ++ 192 85 96 4E-70 Penicillium pittii N1 4 + 187 84 81 5E-34 Aspergillus sp. 4-pink N2 1 + 188 86 86 2E-44 uncultured fung/euk N3 2 - 277 32 75 4E-05 Trichocomaceae N4 4 ++ 189 97 92 1E-69 Galdieria partita/ sulphuraria N5 1 + 186 85 87 5E-49 Galdieria partita/ sulphuraria N6 2 + 195 69 94 2E-53 uncultured fung/euk A-004 N7 2 ++ 185 96 92 3E-68 Trebouxiophyceae sp, coccomyxa
53 the target group (Bodo spp.), while cercozoan and heterolobosean JITS primers consistently amplified only fungal sequences. Subsequent discussion with Dr. David
Bass (London Natural History Museum) suggested the cercozoan primers were not stringent at the annealing temperature used (60°C), and raising the stringency resulted in no amplification. However, the JITS primers were supposedly specific for vahlkampfiids. Upon further examination, these primers also matched ascomycete sequences, so forward and reverse primers were designed based on the
DGGE sequence identity (Table 1) to specifically target the genus Tetramitus at the beginning of the ITS sequence (Gordon Wolfe, personal communication). These primers, labeled TET-1F and TET-R1, were designed to overlap, and for contiguous sequences to be constructed. A universal LSU-R primer located near the start of the
Large Subunit (LSU) sequence was used to amplify the ITS-1 region (Fig. 19). This primer pair resulted a 200 bp product that gave strong sequence homology to
FIG. 19. PCR strategy for universal eukaryotic and Tetramitus-specific primers. SSU = 18S; LSU = 24S; ITS = internal transcribed spacer.
the T. thermacidophilus ITS and 18S SSU rRNA sequences. Other universal eukaryotic primers located in the SSU rRNA sequence, 20F, 1427F, 1520R, 637R,
54 1200R and 82F were used with TET-R1 T. thermacidophilus specific reverse primer located at the beginning of the ITS-1 sequence in order to amplify varying length segments of the 18S rRNA for construction of a full-length SSU rRNA contiguous sequence that was 770 bases in length. When BLASTed against the NCBI database, the closest sequence matches included T. thermacidophilus (Baumgartner et al.
2009) and an uncultured sequence from Iron Mountain Mine in nearby Redding, CA
(Baker et al. 2009) (Fig. 20).
The lobose amoebae isolated directly from soil samples onto solid media were genotyped using material from within the plaques on the plate. The first was identified as Hartmennella vermiformis with the two primer pairs 1427/1616 and
1427/LSU-R1. Another was genotyped using only the 1427F/1616R primers and was identified as Acanthamoeba sp. Using universal primers targeting the V8 region of the SSU rRNA, I identified Acanthamoeba sp., with 97% sequence homology from the DGGE genetic fingerprint and alignment performed via NCBI BLAST database.
Higher resolution identification was performed using Acanthamoeba-specific primers JDP (Table 1) (Edagawa et al. 2009), resulting in amplification of a 500 base fragment, which enhanced identifying resolution, confirming Acanthamoeba sp.
55
FIG. 20. Alignment of Tetramitus 18S SSU sequences, showing distance of closely- related vahlkampfiid sequences are referenced by location.
Characterization of Grazers
Growth: pH and T Range
To determine optimal growth conditions, I monitored liquid cultures of T. thermacidophilus in a gradient incubator under a variety of pH values ranging from
1-7 (Fig. 21) and temperatures ranging from 25-52°C (Table 8). Results suggest that
T. thermacidophilus is unable to grow in pH <2 or >6, with an optimum of pH 3.6
(Fig. 21). My isolate had a temperature range of 25-52°C, with an optimum of 40°C
(Table 8). Under optimal pH and T, the isolate grew with a doubling time of about 9 hours (Fig. 21).
56 1 0.9 0.8 0.7 0.6 0.5
0.4 Doubling TimeDoubling (d) 0.3 0.2 0.1 0 0 1 2 3 4 5 6 7 8 9 pH
FIG. 21. Growth vs. pH for the Vahlkampfiid isolated from BSL. (n=3)
TABLE 8. Temperature range of growth for BSL grazers.
Organism Temp Range (°C) T. thermacidophilus BSL 25-52 Acanthamoeba sp. 4-37 Hartmannella veriformis 22-40 Bodo sp, 4-35
Acanthamoeba was able to grow in both pH 2 BSL filtrate and neutral conditions. Acanthamoeba growth initially occurred from 23°C to 37°C with the lowest temperature tested in the gradient being 23°C. Later cultures were observed
57 to have vegetative cells at 4°C, suggesting temperature tolerance from 4°C to 37°C
(Table 8).
Attempts to transfer Hartmanella to BSL-filtrate liquid culture failed. The cells would grow on Micrococcus in DI water, but not pH 2 BSL filtrate, suggesting an inability for Hartmannella to proliferate in BSL’s acidic environment. Hartmannella was capable of surviving temperatures ranging from 20-40°C (Table 8), which suggests they might be able to survive in warm, neutral geological features.
Tetramitus Cyst Abundance and Biogeography
In summer 2010, I collected samples along transects from the lake to the forest, as well as six shoreline locations around the lake to examine the distribution of Tetramitus cysts. I found that an average of 500 cells mL-1 along the west side of the lake, increasing between the north and south side of the lake (Fig. 22).
Strangely, zero cysts were found at the north side outflow, a result obtained from two separate samples.
Feeding Observations
T. thermaciophilus was observed ingesting fungal conidia at 37 C growing on nutrient agar, which was solidified on slides (Fig. 23a). The unique Phialophora sp. fungal conidia and Micrococcus sp. cells were observed inside T. thermacidophilus cells, via phase, acridine-orange stained epifluorescence microscopy (Fig. 23b) and TEM respectively, in liquid cultures (Fig. 23c, d).
Scanning showed a large number of Acanthamoeba cysts, their distinct cell walls with vacuoles inside, nucleus, which stained darker than the cytoplasm, the distinct
58 pseudopodia of vegetative cells (Fig. 24a) and a cyst with the distinctive cell wall
(Fig. 24b). A vegetative cell was observed attempting to ingest a smaller cyst (Fig.
24c), suggesting the potential for cannibalistic feeding.
Screening for Viral Symbionts
Mimivirus, the largest virus discovered to date, is known to infect
Acanthamoeba cells. I first tried to PCR amplify conserved viral genes, screening T. thermacidophilus, Hartmannella sp., Acanthamoeba cultures in addition to mixed flagellate enrichments. I used four previously described primer sets targeting different, relatively conserved regions of the Nucleocytoplasmic Large DNA Virus
(NCLDV) viral genome. The first two primer pairs, L396 targeting the Mimivirus helicase, and R596 targeting Mimivirus thiol oxidoreductase (Dare et al. 2008) produced no bands after PCR amplification. The third pair, CP D13L, which targets the capsid protein (Azza et al. 2009), produced bands in all three mixed flagellate cultures, while the fourth primer pair, MCP, which also targets the major capsid protein (Larsen et al. 2008), gave positive bands in a Hartmannella sp. sample, as well as in the Acanthamoeba sp. sample and all mixed-flagellate cultures (Table 9,
Fig. 25). I repeated PCR that gave positive bands using touchdown PCR with an annealing temperature gradient from 60-50 C. The D13L resulted in faint bands for
JS 15 and JS 17 mixed flagellate cultures, while the MCP results gave bands consistent with the previous PCR, though Hartmannella showed multiple bands.
59
900 800 700 cysts/mL 600 500 400 300 200 100 0
FIG. 22. Distribution of BSL Vahlkampfiid cysts and corresponding sample-site temperatures. (Photo reprinted with permission, courtesy of Russel Shapiro)
60
FIG. 23. Observations of T. thermacidophilus feeding: (A) phase contrast of cells ingesting Phialophera conidia on agar Scale bars= 10 µm, (B) acridine orange staining of bacteria in food vacuoles Scale bars= 10 µm (C, D): TEM images of cells fed Philaphora conidia (C) and Micrococcus sp. (D) Scale bars = 1 µm.
61
FIG. 24. TEM micrographs of Acanthamoeba trophophyte ultrastructure (A), Cyst (B) cannibalistic feeding on cyst (C) and possible Mimivirus viral bodies (D) Scale bars labeled on image.
However, when sequenced, only one amplicon was found to have sequence homology with any virus: the MCP primer pair in a Hartmannella culture (Table 10).
62 TABLE 9. First and second round MCP/D13L PCR screening of amoebae and mixed flagellate cultures. Showing samples showing bands for possible Mimivirus from both rounds of identical PCR.
Prior Band PCR Tube Culture Contents Primer Lane PCR 1 1 Hartmannella_29C Hartmannella 29°C 2 2 1a Hartmannella 29°C 1:10 3 3 1b Hartmannella 29°C 1:100 4 4 2 Hartmannella_24C Hartmannella 24°C 5 5 2a Hartmannella 24°C 1:10 6 6 2b Hartmannella 24°C 1:100 7 7 3 Acanthamoeba Acanthamoeba 8 D13L 8 6 JS 14 Mixed flagellates 9 +++ 9 7 JS 15 Mixed flagellates 10 +++ + 10 8 JS 17 Mixed flagellates 11 +++ + 11 Postv E.hux CTRL 1:1 12 12 Postv E.hux CTRL 1:10 13 13 Postv E.hux CTRL 1:100 14 14 Neg CTRL 15 15 1 Hartmannella_29C Hartmannella 29°C 17 + 16 1a Hartmannella 29°C 1:10 18 17 1b Hartmannella 29°C 1:100 19 18 2 Hartmannella_24C Hartmannella 24°C 20 ++ + 19 2a Hartmannella 24°C 1:10 21 20 2b Hartmannella 24°C 1:100 22 21 3 Acanthamoeba Acanthamoeba 23 ++ ++ MCP 22 6 JS 14 JS 14 24 +++ ++ 23 7 JS 15 JS 15 25 +++ ++ 24 8 JS 17 JS 17 26 +++ ++ 25 Postv E.hux CTRL 1:1 27 26 Postv E.hux CTRL 1:10 28 27 Postv E.hux CTRL 1:100 29 28 Neg CTRL 30 29 D13L - A004 D13L 31 30 MCP - A004 MCP 32 ++
63
FIG. 25. Second round MCP/D13L PCR associated RAGE gel. (Lane assignment in Table 7). Red square targets amplified bands.
In addition to molecular detection, I also examined Acanthamoeba cultures with TEM for Mimivirus-like structures. Possible viral particles were observed in one vegetative cell, and appeared to be ~500 nm, which is consistent with previous descriptions of the virus, though not definitive evidence of their presence (Fig. 24d). Personal communication with Dr. Kenneth Stedman suggested that the bodies were not viral particles (Portland State University).
Summer 2010 Enrichments
In the summer of 2010, I made an effort to characterize the different grazer morphotypes present in specific side pools and downstream features early in the summer, to look for increased microeukaryotic diversity. I created enrichments,
64 incubating them at temperatures ranging from 14-45 C in BSL-filtrate containing a sterile wheat berry (Table 11). Most results were consistent with previous
TABLE 10. MCP amplified sequence identities from NCBI BLAST. Table 9 shows PCR samples, and figure 21 the resulting gel.
Primer Sample Culture Contents Nearest Sequence Identity MCP-R Hartmannella_24C Liquid Hartmannella (24°C) Grapevine fanleaf virus isolate B5a coat protein gene MCP-F Hartmannella_29C Liquid Hartmannella (29°C) Yersinia pestis, other bacteria MCP-F JS_14_6-8 Mixed Flagellate (14°C) Salmo salar microsatellite, zebrafish MCP-R JS_14_6-8 Mixed Flagellate (14°C) Soliobacter MCP-F JS_14_6-9 Mixed Flagellate (14°C) Soliobacter MCP-F JS_15_6-8 Mixed Flagellate (14°C) Soliobacter MCP-R JS_15_6-8 Mixed Flagellate (14°C) Soliobacter MCP-F JS_15_6-9 Mixed Flagellate (14°C) Soliobacter MCP-F Acanthamoeba Liquid Acanthamoeba (34°C) Microsatellites MCP-F JS_17_6-9 Mixed Flagellate (14°C) Human, Aspergillus, Geobacillus MCP-F TSM_gradient_24C Liquid Hartmannella (24°C) Vitus vinfera MCP-R TSM_gradient_29C Liquid Hartmannella (29°C) Solibacter
observations, showing a variety of unidentified flagellates, testate and naked amoebae, Bodo, euglenids (Table 11, Fig. 26), vahlkampfiid amoebae and diatoms.
The 47 C acidic outflow downstream of the lake showed a new morphology after incubation at 45 C, a large ~10 µm circular cell with filamentous bodies radiating from the main body (Fig. 26e, f). In addition to these cells, I observed ciliates in the same cultures (Fig. 26g), though the presence of all unique morphotypes disappeared after a few days.
65
TABLE 11. Summer 2010 sample enrichments and observations.
Source T (°C) Observations A- Green Pool 13 Bodo sp., vahlkampfiid amoebae, other flagellates 27 Bodo sp., and vahlkampfiid amoebae 37 Bodo sp., and vahlkampfiid amoebae and cysts B1- Little Green 13 Bodo sp., possible Hartmannella; large flagellates Pool Water 27 Bodo sp., and vahlkampfiid cysts 37 Bodo sp., and vahlkampfiid cysts B2- Little Green 27 Bodo sp., and misc. flagellates Pool Sediment 37 Bodo sp., diatoms, misc. flagellates
C- Diatom Pool 13 Nothing observed 27 Bodo sp., diatoms 37 Bodo sp., misc. flagellates; diatoms, possible testate amoebae D- Mud Pot 13 Bodo sp., diatoms, misc. flagellates, vahlkampfiid cysts 27 Bodo sp., and misc. flagellates 37 Bodo sp., diatoms, and vahlkampfiid cysts E1- BSL Water 13 Bodo sp. and vahlkampfiid cysts 27 Bodo sp. and misc. flagellates 37 Bodo sp. and misc. flagellates 45 Nothing observed E2- BSL Sediment 27 A lot of sediment, flagellates present 37 A lot of sediment, flagellates present 45 vahlfampfiid amoebae; possible cercozoans F- In Outflow 27 Nothing observed 37 Bodo sp. and vahlkampfiid cysts 45 Ciliates, possible cercozoans
G- At Outflow 27 A lot of sediment, flagellates present 37 Nothing observed 45 Nothing observed H- Bridge 13 Bodo sp. and misc. large flagellates 27 Bodo sp. and vahlkampfiid amoebae and cysts 37 Bodo sp. and misc. flagellates
66
FIG. 26. Various other morphologies observed from Summer 2010 enrichments. (A) Testate amoebae; (B,C) Unknown naked, limax amoebae; (D) Unknown euglenid; (E,F) Possible cercozoans; (G) Unknown ciliate; (H,I,J) Unknown flagellates. Size bars = 10 µm.
67
CHAPTER IV
DISCUSSION
Major Findings
The initial goals of this study were to determine who the important predators in the lake are, to what degree they are specialized for growth in the environment, and which grazers, if any, might exert a top-down control on the microbial community.
Classic food webs incorporate phagotrophic protists as the most important predators of bacteria and fungi in microbial ecosystems, channeling microbial production at the base of the food web to higher trophic levels. Protists, in turn, are the primary source of food for copepods and other zooplankters in marine systems (Sherr and Sherr 2002). The physical environment can determine the complexity of the food web, and even limit it to a microbial-only system, in which phagotrophic protists are not the subject of grazing, and limit protist activities via bottom-up control (Gaedke and Kamjunke 2006). The physical environment can determine the trophic structures involved in an ecosystem via size of the environment, pH, temperature, and metals present in a system, raising questions concerning the interactions in systems void of higher trophic structure, and community organization.
67
68 Vahlkampfiid Amoebae: Key Grazers in Acidothermal Environments?
The results found in this study suggest that T. thermacidophilus is the primary grazing organism in the BSL system capable of withstanding the temperatures and pH of the lake and surrounding systems. While I was unable to identify any competing organisms capable of summer-time survival, the seasonal and spatial variability of the physical environment probably allows for other organisms that are not as specialized to proliferate and compete as grazers in niches characterized by more moderate conditions.
The close geographical distance between IMM and BSL and the distances associated with the sites where T. thermacidophilus was previously discovered prompted inquiry to sequence variation between the SSU sequences. When aligned with the closest homologous sequences from the NCBI database, we found the BSL strain grouped closely with the sequence from IMM, while the previously described
T. thermacidophilus sequences grouped together (Fig. 20).
While I did find an endemic organism present in most areas of the lake capable of surviving the extreme conditions, I was unable to determine any preferential feeding due to an inability to grow T. thermacidophilus on solid-surface media, and continuous contamination by fungi. Due to this problem I was unable to accurately test a multitude of isolated native prey organisms, though I was able to determine that T. thermacidophilus ingests bacteria Micrococcus and fungi
Philaphora sp. (Fig. 23).
69 I was able to determine T. thermacidophilus’ temperature and pH tolerance, which suggests an ability to survive and multiply in the lake environment, perhaps prolifically in the colder winter months where the temperature drops to the
40s. The colder, acidic side pools surrounding the lake appeared to be dominated by B. saltans, other unidentified flagellates, and various other morphotypes (Fig.
25). Suggesting that as the environmental pressures restrict diversity, moderate temperatures allow for the diversity of competing organisms to proliferate and compete for food.
Prior work has suggested that Vahlkampfiidae be divided between four genera; Tetramitus, Vahlkampfia, Neovahlkampfia and Paravahlkampfia. Genus identification based on morphology is unreliable in the family Vahlkampfiidae, so genetic analysis is required. The internal transcribed spacer (ITS) sequence is shorter than 18S small subunit (SSU) rRNA, under less evolutionary constraint, providing higher resolution for genetic divergence (Brown and de Jonckheere
1999). In Naegleria, it is proposed that a difference of as few as two base pairs is indicative of different strains (de Jonckheere 2004).
T. thermacidophilus: Kamchatka and Italy
Geothermal acidic sites, Pisciarelli Solfatara in Naples, Italy and
Kamchakta, Russia were found harboring a unique, thermo-acidophilic heterolobosean amoeboflagellate, designated Tetramitus thermacidophilus, which grazed on a native thermo-acidophillic bacterium, Alicyclobacillus (Baumgartner et al. 2009). Our isolated heterolobosean sequences and characteristic closely
70 matched this previously described amoeboflagellate T. thermacidophilus
(Baumgartner et al. 2009). The BSL strain 18S SSU and ITS sequences were highly similar to T. thermacidophilus and the uncultured heterolobosean from IMM via the genbank NCBI BLAST tool. Further sequence alignment analysis showed higher sequence homology to the uncultured heterolobosean from IMM, while the two strains previously identified grouped together (Fig. 20). The strain isolated from
BSL also appeared to have slightly different physiological tolerances than the isolates from Naples and Kamchatka. While the BSL strain had a pH optimum of 3.6 and a range of >1 to 6, the isolate previously described had a pH optimum of 3.0 and a range of 1.2 to 6 (Fig. 21). Temperature tolerance appeared identical, where both isolates grow from 28 C to 52 C, with a temperature optimum of ~40°C
(Baumgartner et al. 2009) reported isolation of the Naples/Kamchatka T. thermacidophilus strains on a co-isolated lawn of Alicyclobacillus sp., on solid Gelrite media. The BSL strain was unable to grow on a lawn of any cells we provided under a variety of conditions. Later communication with de Jonckheere suggested that his work with the organism resulted in a failure to culture on solid-media. T. thermacidophilus may be restricted to aquatic environments.
The ubiquity of amoebae, primarily heteroloboseans, in extreme environments is notable due to the frequency of genetic and morphological detection. The organisms found in these environments probably possess an inherent ability to survive the physical extremes. Also relevant is the concept of food-web structure. Perhaps a phagotrophic grazing organism is necessary for
71 nutrient cycling and community complexity control. (Baker et al. 2003) suggests that some species of vahlkampfiids contain habitat-specific genes, allowing them to be pre-adapted to thermal environments, though it has been suggested that the strict acidophilic lifestyle was probably recently adopted from a common ancestor
(Baumgartner et al. 2009). The Baas-Becking hypothesis, suggest that there is wide geographical distribution of these organisms, though the precise mechanisms of global dispersal are not understood. The fact that others and I have detected closely related 18S SSU rRNA sequences from environments of similar physical characteristics, separated by large geographical distance imply that the organism is everywhere, or easily transported to the ‘islands’ with the conditions it requires for proliferation, though mechanisms are not understood.
Other Amoebae Associated with BSL’s Geothermal Features
Common soil-dwelling lobose amoeba Acanthamoeba sp., isolated from surrounding acidic soils, is unable to tolerate the temperatures of the lake. Its ability to survive the acidic environment suggests it impacts the food web in colder environments and non-thermal, acidic soils. Acanthamoeba has the potential to harbor Mimivirus, the largest virus discovered, as well as pathogen-associated bacteria (Scola et al. 2003). While I never found direct evidence of viruses via TEM analysis or genetic screening, several of my results promote the possibility (Fig. 24d,
Tables 9, 10), such as viral sequences being found in amoeba cultures, and TEM information.
72 Previous studies have shown that Acanthamoeba has been genetically detected in Yellowstone geothermal features (Sheehan et al. 2005), and
Acanthamoeba endosymbionts were detected in highly acidic IMM (Baker et al.
2003), though tolerance has remained unstudied.
Lobose Amoebae
Hartmannella has been found in other acidic sites such as Berkeley Pit
Mine, and is known to be thermo-tolerant, occupying hospital warm water systems
(Rohr et al. 1998). Though due to the BSL native Hartmannella's inability to multiply at the low pH of BSL, we suspect an endemic strain is not present in the
BSL system (Mitman 1999).
Acanthamoeba sp., has previously been detected in aquatic geothermal systems, in hospital thermal water systems, though it has been largely studied for potential pathogenesis (Brown et al. 1983a). Found in the acidic IMM,
Acanthamoeba was observed hosting intracellular endosymbionts in the low pH environment, providing a neutral environment for the bacterium (Baker et al.
2003). While the BSL isolate was only able to tolerate temperatures up to 35 C, it has been reported that cultures grown for extended periods of time show a decrease in physiological abilities to tolerate variances in temperatures as well as a decrease in possible food intake (Pumidonming et al. 2010). Acanthamoeba might behave as a vector for human infection in similar environments, as well as increase bacterial diversity in these extreme environments. Known to harbor Legionella in thermal and acidic environments (Sheehan et al. 2005), it is also the host for Mimivirus, and
73 other large DNA viruses (Scola et al. 2003, La Scola et al. 2010). Whether the BSL isolate harbors Mimivirus-like viruses is still not clear, but if it does, this would be the first instance of a eukaryotic virus from a thermoacidic environment, or any extreme environment.
Kinetoplastid Flagellates
In the early summer after the cold 2010 winter, I observed several other morphotypes (Fig. 26), but was unable to accurately identify them. The overall lake temperatures were observed to have decreased (Fig. 22), suggesting the lower temperatures allowed for proliferation of potential competing organisms in the lake environment. My results are congruent with the hypothesis; as environmental restrictions decrease, competition intensifies. While I was unable to identify all organisms genetically, I was able to document an increase in morphological diversity associated with lower temperatures. I was also able to quantitatively identify an increase in grazing protist diversity where conditions were tolerable.
Samples taken from numerous side pools on the west side of the lake typically had lower temperatures and acidic pH, which allowed for increasing community complexity. Samples were enriched via methods described for T. thermacidophilus, at 27 C and 37°C, usually producing large amounts of T. thermacidophilus growth, which were repressed by growth in a flask on a shaker, but resumed after shaking ceased. Additionally, a variety of Bodo-like flagellates appeared to be active at the lower temperatures (Fig. 13).
74 Using kinetoplastid group-specific primers (Table 1), I PCR-amplified the
18S SSU rRNA sequence with 1:5, 1:10 and 1:15 concentrations of DNA extract which resulted in strong bands about 770 bases in length in six out of seven samples amplified. The resulting sequences returned with high sequence homology for Bodo saltans when BLAST against the NCBI database. Bodo sp. has been described in a previous study of eukaryotic diversity of LVNP's thermal features (Brown and Wolfe
2006). I suspect that due to the lack of high temperature tolerance, and apparent low pH tolerance, this organism was found to be ubiquitous in the parks acidic features, and is possibly transported to thermal environments where it cannot survive, but remains genetically detectable. I found that it is viable in low temperature, low pH environments. Coupled with previous data (Brown, 2006), I suggest that it is everywhere, but can only proliferate when the environment is tolerable.
Bodo sp. is known to inhabit colder acidic AMD sites around the globe, such as the Rio Tinto in Spain (Aguilera et al. 2007b), and the Berkeley Pit Mine in
Montana (Mitman 1999). Because of the ubiquity of Bodo sp. throughout LVNP, as well as other similar environments in the world, it is possible that Bodo sp. is innately capable of withstanding acidic environments.
Other Potential Members of the Grazing Community
Primary cultures incubated at a variety of temperatures resulted in high eukaryotic morphological diversity in the immediate incubation period post-
75 inoculation, though diversity decreased in time resulting in selection for T. thermacidophilus and Bodo sp. Among the morphotypes observed, I suspect the majority of them were ciliates, cercozoans, and euglenids. Initial DGGE screens showed sequences related to Nuclearia, a cercomonad, and Bodomorpha using 20-
516 GC primers. These were not observed frequently in culture, and subsequently never genetically detected again.
Probable ciliates were observed with phase-contrast microscopy in cultures enriched from the side pools, and in the downstream-acidic outflow, though their relative numbers in cultures were low. Potential cercozoan morphologies were observed in some cultures incubated at high temperatures (Fig. 26e, f), but were never detected genetically. Additional PCR screening for possible cercozoans resulted in no amplification (Dr. David Bass, London Natural History Museum, personal communication).
Euglenid-like cells were rarely observed in samples taken from (various) locations around the lake (Fig. 26d). They disappeared within days in primary cultures, and appeared to only survive at low temperatures.
Comparison to Other Sites
Geothermal Environments
Geothermal, terrestrial and marine environments are host to unique, primarily microbial communities in which the primary grazers have been shown to be amoebae and ciliates. Previous studies have revealed heterolobose amoebae capable of growing in temperatures up to 50 C (de Jonckheere et al. 2009), and an
76 extremely thermophilic, neutral lobose amoebae Echinamoeba thermarum, capable of growing in temperatures up to 54 C (Baumgartner et al. 2003). Marine anaerobic environments have presented ciliates capable of growing up to 52°C in thermal vents (Baumgartner et al. 2002, Baumgartner et al. 2009), a vahlkampfiid amoebae in anaerobic sediments (Smirnov and Fenchel 1996), and unique heterolobosean capable of 50 C growth in volcanic thermal waters (de Jonckheere et al. 2011). I have detected amoebae, and analyzed their ability to survive in the environment, though I was unable to analyze the potential impact of ciliates other than their presence, and ability for brief growth in 45°C, pH 2 conditions. I suspect that my culturing methods might have enhanced the ability for T. thermacidophilus to out-compete the other organisms in culture, as well as survive elevated temperatures.
Genus-specific primers used in Yellowstone National Park thermal-acidic sites showed the presence of potential-pathogens Naegleria and Legionella in several sites. Vahlkampfia lobospinosa was also identified in genetic screens, suggesting a diverse grazing community (Sheehan et al. 2003) with multiple components.
AMD Sites: IMM and Rio Tinto
I found that the BSL T. thermacidophilus 18S SSU sequence was highly similar to an uncultured heterolobosean from the thermal-acidic AMD site Iron
Mountain Mine in nearby Redding, California. While there was no culturing
77 performed in the study of IMM, the environment where the sequence was derived was similar, having a pH of 3 and 5 at sampling sites and a temperature of 72 C.
The work performed at IMM suggested that the fungal community plays an important role in the system, claiming that the eukaryotic composition of IMM was found to be 68% fungal(Baker et al. 2009). We suspect the community found at
BSL is similar, considering the highly acidophilic fungi, Acidomyces richmondensis originally isolated from IMM, was also genetically detected at BSL (Table 7, Fig. 17).
It is also apparent that the BSL community is largely fungal due to the complexity of fungal sequences retrieved from our fingerprinting methods (Table 7, Fig. 7-11), and frequency of fungal contamination in cultures. Because of the amount of genetic similarities, I suspect highly similar eukaryotic community structure between the two environments, without the algal component.
The Rio Tinto studies identified a larger variety of protists morpho- logically; including a member of Euglenophyta, Acanthamoeba sp., Naegleria, the heliozoan Actinophrys sp., flagellates Bodo sp., Cercomonas sp., Ochroomonas sp., ciliates Oxytrichia sp. and Colpidium sp. and a rotifer, Rotari sp. (Amaral Zettler et al. 2002). The high diversity in possible phagotrophic organisms is probably directly related to the lower temperature of the environment, and coincides with the increase in morphotypes and genotypes identified in the colder regions around BSL
(Figs. 3, 22). A later study of Rio Tinto studying seasonal variation of eukaryotic diversity via light and SEM microscopy reported the presence of the flagellate
Labyrinthula, and indicated a seasonal succession of the phagotrophic protists about
78 a month after an increase in bacterial particles (Aguilera et al. 2007b). Seasonal succession probably occurs with the protist population in BSL, due to lower temperatures observed to be associated with winter-time snowfall. The high summer temperatures of BSL border on the limits of known eukaryotic activity, though the significant drop in temperature during the winter probably allows for blooms of protist activity, possibly in accordance with blooms of potential prey.
Biogeography of Acidothermophilic Protists
Microbial dispersal is of importance when considering concepts of speciation and the roles organism holds in a specific environmental niche. The commonly accepted Bass-Becking hypothesis: "Everything is Everywhere" which depicts a global microbial community in which microbes are present everywhere and the environment selects for those capable of filling a specific environmental niche (De Wit and Bouvier 2006). This suggests the main difference between macro and microbial ecology is that geographical barriers do not exist for microorganisms, allowing them to proliferate when they encounter a favorable environmental niche
(Finlay 2002). While dispersal over large distance is possible, it has also been suggested that the environmental selection of extreme environments are analogous with 'island' dynamics (Staley 1999, Finlay 2002). My results agree with this hypothesis, illustrating the ubiquity of T. thermacidophilus sequences in previous studies of similar environments, and their restriction to the near-lake environment with other amoebae Acanthamoeba sp. located in acidic clays surrounding the lake,
79 and Hartmannella sp. found in warn, neutral soils (Fig 27). The presence of Bodo sp., in the colder side pools of BSL, and similar sequences and morphologies found in similar environments support the claim.
In the case of Naegleria sp., strains on the poles share the same gene pool, via high sequence homology of isolates from both arctic environments (de
Jonckheere 2006). The geographical and physical barriers between these poles might be homologous to those between the environments in which T. thermacidophilus has been identified (Fig. 20). This suggests that microbial genes are freely distributed between similar environments, which allow for proliferation of organisms capable of withstanding the specific environmental stresses, but leaves open the question, how are the genes transported?
Dispersal of microorganisms over large distances has been observed, primarily in dust-born systems traversing continents (Kellogg and Griffin 2006).
Previously thought to be unable to survive the elevated solar UV-radiation, desiccation, and lack of nutrients, recent studies suggest spore-forming bacteria and fungi are resistant to such environmental extremes (Kellogg and Griffin 2006). It has been suggested that amoebae with the ability to encyst in stressful situations should be able to survive the extremes, which might account for their universal dispersal across the planet, with similar organisms found in similar environments that are separated by large distances (Rodríguez-Zaragoza 1994). While the method
80
FIG. 27. Biogeography of grazers found on transects from Summer 2009 (Photo reprinted with permission, courtesy of Russel Shapiro)
of dispersal is unknown, and was not addressed in this study, it’s an important consideration when analyzing the genetic divergence relative to the geographical distances.
Grazing Impact of Protists in Extreme Environments
These findings further the concept that protists are ubiquitous in geothermal and acidic environments where the temperature and pH are not too
81 extreme, possibly enacting top-down predation on prokaryotic and fungal communities.
I was unable to show direct evidence of top-down control via T. thermaciodphilus in the environment, though I was able to show that T. thermacidophilus was easily culturable in high numbers at most sites sampled (Fig.
22), with an average abundance of ~500 viable cells g-1. In addition to this, I was able to determine that T. thermacidophilus is able to withstand the environmental pressures of T and pH within the lake environment (Table 8, Fig. 21). Direct fungal counts have not been performed in BSL, though bacterial counts have been performed. (Siering and Wilson) reported ~106 bacteria mL-1 suspended in BSL water, and 108 bacteria g-1 in the sediments, signifying substantially more potential bacterial prey abundance than predator abundance. It is not clear whether grazing is exerting top-down control, or if bottom-up control is enacted due to the carbon, temperature, and pH limitations.
This is the first attempt to investigate food web interactions of acidothermal environment. The only prior work was for East German coal mining lakes, which are less acidic and much cooler, allowing a greater diversity of protists and even a few metazoa. Those studies found that the food web was restricted to two trophic levels by measuring relative biomass of autotrophs and heterotrophs in the system. The consumers appeared to have larger concentrations than in analog neutral lakes, which they attributed to a lack of a tertiary consumer population. Due to the similar bacterial populations in terms of numbers in neutral and acidic sites,
82 they suggested that the bacterial population underwent top-down control, which they suggest could promote the growth of certain bacterial species (Gaedke and
Kamjunke 2006).
It has been considered that the ability to survive low pH environments might allow for an increase in ability to survive elevated temperatures. This hypothesis was tested, and disproved, suggesting that the combined stress of pH and temperature constricts the niche of acidophilic protists (Moser and Weisse
2011).
Suggestions for Future Work
Culturing and Environmental DNA Extraction
A major downfall in my study was the inability to culture all organisms, while this was not a surprising downfall. I observed more morphologies than I was able to actually identify, genetically or morphologically. While I am fairly confident that the primary grazing organism present at the highest numbers is the native heterolobosean T. thermacidophilus based on the frequency in culture, and the ubiquity of the cysts, there are other organisms present. I cannot be certain of the entire grazing population, and how it varies over time. My culture-based genetic methods could have eclipsed other organisms that were not cultivatable, but present in the lake. Due to the effects of the suspended clay in all samples, direct environmental DNA extraction proved difficult, as the DNA might have bonded to the positively charged clay particles, inhibiting extraction. Some studies have
83 suggested using milk, or BSA to increase DNA yields in high-clay samples (Yankson and Steck 2009).
It is clear that future approaches need to combine molecular and culture- based methods. Thus far, in taxonomic and identification techniques for eukaryotic, especially protist genetic identification is performed via analysis of ‘barcoding’ genes (McManus and Katz 2009). Most previous information concerning morphology, phenotypic variation and distribution was based on formal morphological descriptions, but with the rise in genetic analysis technologies, higher variance has been uncovered (McManus and Katz 2009). Identification via fingerprinting techniques, such as clone libraries, DGGE, and RFLP methodologies usually examines rRNA and mitochondrial genes. While this has been beneficial in creating vast database libraries of various genes found in the environment, specific environmental studies might show artifacts because they detect all genes in a system (Epstein and López-García 2008). The presence of genes in the environment does not confirm the activity of an organism in a specific environment, as the genes might have been amplified from live, dead, of allochthonous species. In addition to amplifying organisms unrelated to the specific ecosystem, primer bias and fast evolving lineages, especially in systems with harsh stressors, can result in an incorrect genetic fingerprint of systems (Epstein and López-García 2008).
Promising routes to overcome these shortcomings include whole genome sequencing, which is expected to be increasingly easier and cost-efficient in the future, though this does not address the problems associated with measuring the
84 true abundance and function in a system. Fingerprinting techniques, such as clone libraries, are unable to quantitatively describe the abundance in a system, though frequency of certain genes can suggest importance (Epstein and López-García
2008). The next step required for adequate understanding of these ecosystems and the important players requires a ‘marriage’ of molecular and morphological identification. This comes from the inability to astutely claim the organism observed in the microscope, and the genes in a library are the same organism. Work using Fluorescence In-Situ Hybridization (FISH) allowed for organism-specific oligonucleotides to fluoresce when bound to nucleic acids in the targeted cell
(McManus and Katz 2009). Coupling organism-identifying genes with traditional microscopy would allow for combined molecular and morphological identification, increasing quantitative analysis of organismal function in specific environments.
One study took it a step further, coupling FISH with Scanning Electron Microscopy
(SEM) via a novel process for analyzing specific cells (Stoeck et al. 2003). The addition of the SEM step opens new pathways for conducting proper morphological studies of organisms only known by an environmental 18S rRNA signature.
T. thermacidophilus Feeding Assays
In order to understand the impact of T. thermacidophilus on the bacterial population of the lake, analysis of prey-preference and predation rates between bacterial and fungal isolates should have been performed. While I obtained several isolates from Dr. Patricia Siering at HSU, my inability to grow T. thermacidophilus on solid media prevented me from being able to accurately determine any prey-
85 preferences. The main problem with doing liquid-based prey-preference or predation rates appeared to be the inability to determine what T. thermacidophilus was consuming. It was apparent that residual Micrococcus was present in the subsequent cultures. While I was able to determine ingestion of both bacteria and fungi via TEM, I did not have the resolution to determine variation between bacteria ingested. A possible method for testing prey-preference in liquid cultures might be to filter-wash cysts to rid them of contaminating bacteria, though fungal contamination will remain.
Conclusions
1. The lake environment is inhabited by the unique, endemic heterolobose amoeba, closely related to T. thermacidophilus.
2. The colder, near lake, acidic side pools appear to be largely dominated by
B. saltans.
3. The summer-exposed acidic clays around the lake harbor Acanthamoeba, which has been detected genetically in previous studies, and potentially harbors
Mimivirus-like large DNA virus. Hartmannella was observed in forest soils around the lake, and could tolerate elevated temperatures, but was acidophobic.
4. Colder environments show the presence of multiple other microeukaryotic morphotypes.
86
LITERATURE CITED
87
LITERATURE CITED
Aguilera, A., V. Souza-Egipsy, F. Gómez, and R. Amils. 2007a. Development and structure of eukaryotic biofilms in an extreme acidic environment, Río Tinto (SW, Spain). Microbial Ecology 53:294. Aguilera, A., V. Souza-Egipsy, E. González-Toril, O. Rendueles, and R. Amils. 2010. Eukaryotic microbial diversity of phototrophic microbial mats in two Icelandic geothermal hot springs. International Microbiology 13:21-32. Aguilera, A., E. Zettler, F. Gómez, L. Amaral-Zettler, N. Rodríguiez, and R. Amils. 2007b. Distribution and seasonal variability in the benthic eukaryotic community of Río Tinto (SW, Spain), an acidic, high metal extreme environment. Systematic and Applied Microbiology 30:531-546. Amaral Zettler, L. A., F. Gómez, E. Zettler, B. G. Keenan, R. Amils, and M. L. Sogin. 2002. Eukaryotic diversity in Spain's river of fire. Nature 417:137. Appoloni, S., Y. Lekberg, M. Tercek, C. Zabinski, and D. Redecker. 2008. Molecular community analysis of arbuscular mycorrhizal fungi in roots of geothermal soils in Yellowstone National Park (USA). Microbial Ecology 56:649-659. Azza, S., C. Cambillau, D. Raoult, and M. Suzan-Monti. 2009. Revised Mimivirus major capsid protein sequence reveals intron-containing gene structure and extra domain. BMC Molecular Biology 10:39-47. Baker, B. J., P. Hugenholtz, S. C. Dawson, and J. F. Banfield. 2003. Extremely acidophilic protists from acid mine drainage host Rickettsiales-lineage endosymbionts that have intervening sequences in their 16S rRNA genes. Applied and Environmental Microbiology 69:5512-5518. Baker, B. J., M. A. Lutz, S. C. Dawson, P. Bond, and J. Banfield. 2004. Metabolically active eukaryotic communities in extremely acidic mine drainage. Applied and Environmental Microbiology 70:6264-6271. Baker, B. J., G. W. Tyson, L. Goosherst, and J. F. Banfield. 2009. Insights into the diversity of eukaryotes in acid mine drainage biofilm communities. Applied and Environmental Microbiology 75:2192-2199. Bass, D., A. Howe, N. Brown, H. Barton, M. Demidova, H. Michelle, L. Li, H. Sanders, S. C. Watkinson, S. Willcock, and T. A. Richards. 2007. Yeast forms dominate fungal diversity in the deep oceans. Proceedings of the Royal Society B: Biological Sciences 274:3069-3077. Baumgartner, M., S. Eberhardt, J. F. de Jonckheere, and K. O. Stetter. 2009. Tetramitus thermacidophilus n. sp., an amoeboflagellate from acidic hot springs. Journal of Eukaryotic Microbiology 56:201-206. Baumgartner, M., K. O. Stetter, and W. Foissner. 2002. Morphological, small subunit rRNA, and physiological characterization of Trimyema minutum (Kahl, 1931), an anaerobic ciliate from submarine hydrothermal vents growing from 28 oC to 52 oC. Journal of Eukaryotic Microbiology 49:227-238. Baumgartner, M., A. Yapi, R. Gröbner-Ferreira, and K. O. Stetter. 2003. Cultivation and properties of Echinamoeba thermarum n. sp., an extremely thermophilic amoeba thriving in hot springs. Extremophiles 7:267-274. 87
88 Bell, E. M. and G. Weithoff. 2008. Recruitment of heliozoa, rhizopods and rotifers from the sediments of an extremely acidic lake during spring and early summer. Lakes & Reservoirs: Research & Management 13:105-115. Bell, E. M., G. Weithoff, and U. Gaedke. 2006. Temporal dynamics and growth of Actinophrys sol (Sarcodina: Heliozoa), the top predator in an extremely acidic lake. Freshwater Biology 51:1149-1161. "Boiling Springs Lake." 40"26'05.70" N and 121"23'52.15" W. Google Earth. July 21, 2010. September 13, 2011. Booton, G. C., G. S. Visvesvara, et al. (2005). "Identification and distribution of Acanthamoeba species genotypes associated with nonkeratitis infections." J. Clin. Microbiol. 43(4): 1689-1693. Bradley, S. G. and F. Marciano-Cabral. 1996. Diversity of free-living ‘naked’ amoeboid organisms. Journal of Industrial Microbiology and Biotechnology 17:314-321. Brock, T. D. and M. L. Brock. 1970. The algae of Waimangu cauldron (New Zealand): distribution in relation to pH. Journal of Phycology 6:371-375. Brown, P. B. and G. V. Wolfe. 2006. Protist genetic diversity in the acidic hydrothermal environments of Lassen Volcanic National Park, USA. Journal of Eukaryotic Microbiology 53:420-431. Brown, S. and J. F. de Jonckheere. 1999. A reevaluation of the amoeba genus Vahlkampfia based on SSU rDNA sequences. European Journal of Protistology 35:49-54. Brown, T. J., R. T. M. Cursons, E. A. Keys, M. Marks, and M. Miles. 1983a. The occurrence and distribution of pathogenic free-living amoebae in thermal areas of the North Island of New Zealand. New Zealand Journal of Marine and Freshwater Research 17:59-69. Brown, T. J., R. T. M. Cursons, E. A. Keys, M. Marks, and M. Miles. 1983b. The occurrence and distribution of pathogenic free-living amoebae in thermal areas of the North Island of New Zealand. New Zealand Journal of Marine and Freshwater Research 17:59-69. Chakraborty, S., K. Old, and J. Warcup. 1983. Amoebae from a take-all suppressive soil which feed on Gaeumannomyces graminis tritici and other soil fungi. Soil Biology and Biochemistry 15:17-24. Chakraborty, S. and K. M. Old. 1986. Ultrastructure and description of a fungus-feeding amoeba, Trichamoeba mycophaga n. sp. (Amoebidae, Amoebea), from Australia. Journal of Eukaryotic Microbiology 33:564-569. Costas, E., A. Flores-Moya, N. Perdigones, E. Maneiro, J. L. Blanco, M. E. Garcia, and V. Lopez-Rodas. 2007. How eukaryotic algae can adapt to the Spain's Rio Tinto: a neo- Darwinian proposal for rapid adaptation to an extremely hostile ecosystem. New Phytologist 175:334-339. Dare, R. K., M. Chittaganpitch, and D. D. Erdman. 2008. Screening pneumonia patients for Mimivirus. Emerging Infectious Diseases 14:465-467. de Jonckheere, J. F. 2004. Molecular definition and the ubiquity of species in the genus Naegleria. Protist 155:89-103. de Jonckheere, J. F. 2006. Isolation and molecular identification of free-living amoebae of the genus Naegleria from Arctic and sub-Antarctic regions. European Journal of Protistology 42:115-123. de Jonckheere, J. F., M. Baumgartner, F. R. Oppordoes, and K. O. Stetter. 2009. Marinamoeba thermophila, a new marine heterolobosean amoeba growing at 50 oC. European Journal of Protistology 45:231-236.
89 de Jonckheere, J. F. and S. Brown. 2005. The identification of Vahlkampfiid amoebae by ITS sequencing. Protist 156:89-96. de Jonckheere, J. F., M. J., and F. R. Opperdoes. 2011. A new thermophilic heterolobosean amoeba, Fumarolamoeba ceborucoi, gen. nov., sp. nov., isolated near a fumarole at a volcano in Mexico. Acta Protozoologica 50:41-48. De Wit, R. and T. Bouvier. 2006. ‘Everything is everywhere, but, the environment selects’; what did Baas Becking and Beijerinck really say? Environmental Microbiology 8:755-758. Deneke, R. 2000. Review of rotifers and crustaceans in highly acidic environments of pH values ≤3. Hydrobiologia 433:167-172. Donachie, S. P., B. W. Christenson, D. D. Kunkel, A. Malahoff, and M. Alam. 2002. Microbial community in acidic hydrothermal waters of volcanically active White Island, New Zealand. Extremophiles 6:419-425. Edagawa, A., A. Kimura, T. Kawabuchi-Kurata, Y. Kusuhara, and P. Karanis. 2009. Isolation and genotyping of potentially pathogenic Acanthamoeba and Naegleria species from tap-water sources in Osaka, Japan. Parasitology Research 105:1109- 1117. Epstein, S. and P. López-García. 2008. “Missing” protists: a molecular prospective. Biodiversity and Conservation 17:261-276. Finlay, B. J. 2002. Global dispersal of free-living microbial eukaryotic species. Science 296:1061-1063. Gadanho, M. and J. P. Sampaio. 2006. Microeukaryotic diversity in the extreme environments of the Iberian Pyrite Belt: a comparison between universal and fungi- specific primer sets, temperature gradient gel electrophoresis and cloning. FEMS Microbiology Ecology 57:139-148. Gaedke, U. and N. Kamjunke. 2006. Structural and functional properties of low- and high- diversity planktonic food webs. Journal of Plankton Research 28:707-718. Gross, S. and E. I. Robbins. 2000. Acidophilic and acid-tolerant fungi and yeasts. Hydrobiologia 433:91-109. Gyure, R. A., A. Konopka, A. Brooks, and W. Doemel. 1987. Algal and Bacterial Activities in Acidic (pH 3) Strip Mine Lakes. Applied and Environmental Microbiology 53:2069- 2076. Heinbokel, J. F. 1978. Studies on the functional role of tintinnids in the southern California bight. I. Grazing and growth rates in laboratory cultures. Marine Biology 47:177- 189. Janik, C. J. and M. K. McLaren. 2010. Seismicity and fluid geochemistry at Lassen Volcanic National Park, California: Evidence for two circulation cells in the hydrothermal system. Journal of Volcanology and Geothermal Research 189:257-277. Johnson, D. B. and K. B. Hallberg. 2005. Acid mine drainage remediation options: a review. Science of The Total Environment 338:3-14. Johnson, D. B. and L. Rang. 1993. Effects of acidophilic protozoa on populations of metal- mobilizing bacteria during the leaching of pyritic coal. Journal of General Microbiology 139:1417-1423. Jürgens, K. and H. Güde. 1994. The potential importance of grazing-resistant bacteria in planktonic systems. Marine Ecology Progress Series 112:169-188. Kellogg, C. A. and D. W. Griffin. 2006. Aerobiology and the global transport of desert dust. Trends in Ecology & Evolution 21:638-644.
90 La Scola, B., A. Campocasso, R. N’Dong, G. Fournous, L. Barrassi, C. Flaudrops, and D. Raoult. 2010. Tentative characterization of new environmental giant viruses by MALDI-TOF mass spectrometry. Intervirology 53:344-353. Larsen, J. B., A. Larsen, G. Bratbak, and R. A. Sandaa. 2008. Phylogenetic analysis of members of the Phycodnaviridae virus family, using amplified fragments of the major capsid protein gene. Applied and Environmental Microbiology 74:3048- 3057. Marciano-Cabral, F. 1988. Biology of Naegleria spp. Microbiology and Molecular Biology Reviews 52:114-133. Matin, A., S. Jeong, J. Faull, A. Rivas, and N. Khan. 2006. Evaluation of prokaryotic and eukaryotic cells as food source for Balamuthia mandrillaris. Archives of Microbiology 186:261-271. McGinness, S. and D. B. Johnson. 1992. Grazing of acidophilic bacteria by a flagellated protozoan. Microbial Ecology 23:75-86. McManus, G. B. and L. A. Katz. 2009. Molecular and morphological methods for identifying plankton: what makes a successful marriage? Journal of Plankton Research 31:1119-1129. Mitman, G. G. 1999. A Final Report: Biological Survey of the Berkeley Pit Lake System. 8958, U.S. EPA National Risk Management Lab. Moser, M. and T. Weisse. 2011. Combined stress effect of pH and temperature narrows the niche width of flagellates in acid mining lakes. Journal of Plankton Research 33:1023-1032. Neff, R. J. 1958. Mechanisms of purifying amoebae by migration on agar surfaces. Journal of Protozoology 5:226-231. Old, K. M., S. Chakraborty, and R. Gibbs. 1985. Fine structure of a new mycophagous amoeba and its feeding on Cochliobolus sativus. Soil Biology and Biochemistry 17:645-655. Opperdoes, F. R., J. F. De Jonckheere, and A. G. M. Tielens. 2011. Naegleria gruberi metabolism. International Journal for Parasitology 41:915-924. Packrof, G. and S. Woelfl. 2000. A review on the occurrence and taxonomy of heterotrophic protists in extreme acidic environments of pH values <3. Hydrobiologia 433:153-156. Packroff, G. 2000. Protozooplankton in acidic mining lakes with special respect to ciliates. Hydrobiologia 433:157-166. Pumidonming, W., M. Koehsler, and J. Walochnik. 2010. Acanthamoeba strains show reduced temperature tolerance after long-term axenic culture. Parasitology Research 106:553-559. Robbins, E. I., T. M. Rodgers, C. N. Alpers, and D. K. Nordstrom. 2000. Ecogeochemistry of the subsurface food web at pH 0-2.5 in Iron Mountain, California, U.S.A. Hydrobiologia 433:15-23. Rodríguez-Zaragoza, S. 1994. Ecology of free-living amoebae. Critical Reviews in Microbiology 20:225-241. Rohr, U., S. Weber, R. Michel, F. Selenka, and M. Wilhelm. 1998. Comparison of free-living amoebae in hot water systems of hospitals with isolates from moist sanitary areas by identifying genera and determining temperature tolerance. Applied and Environmental Microbiology 64:1822-1824. Rothschild, L. J. and R. L. Manicinelli. 2001. Life in extreme environments. Nature 409:1092-1101.
91 Schmidtke, A., E. M. Bell, and G. Weithoff. 2006. Potential grazing impact of the mixotrophic flagellate Ochromonas sp. (Chrysophyceae) on bacteria in an extremely acidic lake. Journal of Plankton Research 28:991-1001. Scola, B. L., S. Audic, C. Robert, L. Jungang, X. de Lamballerie, M. Drancourt, R. Birtles, J.- M. Claverie, and D. Raoult. 2003. A giant virus in amoebae. Science 299:2033. Sheehan, K. B., J. A. Fagg, M. J. Ferris, and J. M. Henson. 2005. Thermophilic amoebae and Legionella in hot springs in Yellowstone and Grand Teton National Parks. Pages 317-324 in W. P. Inskeep and T. R. McDermott, editors. Geothermal Biology and Geochemistry in Yellowstone National Park. Montana State University Publications, Bozeman. Sheehan, K. B., M. J. Ferris, and J. M. Henson. 2003. Detection of Naegleria sp. in a thermal, acidic stream in Yellowstone National Park. Journal of Eukaryotic Microbiology 50:263-265. Sherr, E. B. and B. F. Sherr. 2002. Significance of predation by protists in aquatic microbial food webs. Antonie van Leeuwenhoek 81:293-308. Siering, P. L., J. M. Clarke, and M. S. Wilson. 2006. Geochemical and biological diversity of acidic, hot springs in Lassen Volcanic National Park. Geomicrobiology Journal 23:129-141. Smirnov, A. V. and T. Fenchel. 1996. Vahlkampfia anaerobica n. sp. and Vanella peregrinia n. sp. (Rhizopoda) - anaerobic amoebae from a marine sediment. Archiv für Protistenkunde 147:189-198. Staley, J. T. 1999. Bacterial biodiversity: a time for place. ASM News 65:681-687. Stierle, A. A., D. B. Stierle, and K. Kelly. 2006. Berkelic acid, a novel spiroketal with selective anticancer activity from an acid mine waste fungal extremophile. The Journal of Organic Chemistry 71:5357-5360. Stoeck, T., W. H. Fowle, and S. S. Epstein. 2003. Methodology of protistan discovery: from rRNA detection to quality scanning electron microscope images. Applied and Environmental Microbiology 69:6856-6863. Toplin, J. A., T. B. Norris, C. R. Lehr, T. R. McDermott, and R. W. Castenholz. 2008. Biogeographic and phylogenetic diversity of thermoacidophilic Cyanidiales in Yellowstone National Park, Japan, and New Zealand. Applied and Environmental Microbiology 74:2822-2833. Weekers, P. H. H., P. L. E. Bodelier, J. P. H. Wijen, and G. D. Vogels. 1993. Effects of grazing by the free-living soil amoebae Acanthamoeba castellanii, Acanthamoeba polyphaga, and Hartmannella vermiformis on various bacteria. Applied and Environmental Microbiology 59:2317-2319. Weisse, T. and P. Stadler. 2006. Effect of pH on growth, cell volume, and acid production of freshwater ciliates, and implications for distribution. Limnology and Oceanography 51:1708–1715. Wilson, M., P. Siering, C. White, M. Hauser, and A. Bartles. 2008. Novel archaea and bacteria dominate stable microbial communities in North America’s largest hot spring. Microbial Ecology 56:292-305. Wilson, M. S., A. T. Carter, and P. L. Siering. 2004. Molecular analysis of microbial communities in a 55˚C pH 1.7 lake in Lassen Volcanic National Park.in 104th General Meeting of the American Society for Microbiology, New Orleans, LA.
92 Yankson, K. K. and T. R. Steck. 2009. Strategy for extracting DNA from clay soil and detecting a specific target sequence via selective enrichment and real-time (quantitative) PCR amplification. Applied and Environmental Microbiology 75:6017-6021.