sign in sign up
<<
Home , Acanthoecida, Acarosporales, Acrasidae, Acrospermum, Adelea, Agamococcidiorida

This article isprotected rights by All copyright. reserved. 10.1111/jeu.12691 doi: lead todifferences version between this andthe of Version Rec been and throughtypesetting, proofreadingwhich may thecopyediting, process, pagination This article undergone has for and buthas accepted been not review publication fullpeer Zlatogursky FrederickW.Spiegel Powell Mitchell Gall Kolisko Heiss Dunthorn Paco C AlexeySmirnov AdlSina M. Revisions Classification,to the Nomenclature, and DiversityEukaryotesof al.Adlet Correspondingauthor mail id: Articletype : Original Article VASILYDR. V.ZLATOGURSKY(Orcid ID : 0000 GUIFRÉDR. TORRUELLA (Orcid ID 0000: JONGPROF. SOO PARK(Orcid ID 0000: EDWARDDR. A.D MITCHELL (Orcid ID : 0000 DR. DENIS H. LYNN (Orcid ID : 0000 BENTEPROF. EDVARDSEN (Orcid ID : 0000 D IVANDR. CEPICKA (Orcid ID : 0000 DR. PACO CÁRDENAS (Orcid : ID 0000 CÉDRICDR. BERNEY(Orcid ID 0000: PROF. DAVID BASS (Orcid ID : 0000 SINAPROF. ADL (Orcid ID : 0000 Accepted ArticleR. MICAH DUNTHORN (Orcid ID 0000: ae , Denis , H. Lynn x , , Mona Hoppenrath am árdenas e ac,ai --- , Alexand, , Daniel , J. Ri r,s Classif , Bente , Edvardsen , Christine , Morrow a h,at , David , Bass , Qianqian , Zhang n h , , IvanČepička , Sabine Agatha, i cation of er Kudryavtsever af,ag ap chter

, , GuifréTorruella iCortes , David , G. Mann b,c y , Timothy , James Y. an

, Christopher , E. Lane , Sonja , Rueckert - [email protected] 0001 t aj - - , Yana , Eglit o - 0002 0002 , Jong , Soo Park 0002 , Ludmila , Chistyakova - au,av 0001 i - - , Cedric , Berney h,aa 0003 6324 - - 00 - - . - 0003 - 4322 0002

1554 , Daniel , J. LahrG. 9883 -

- 01 8689 0002 - - - 4045 - 6065) 0003 0002 - - 6253 - - ah - 1376 - 6534 0754) 7792) 7823) - , Ramon , Massana i Molera u - 9907) 6806 , Laure , Guillou - - 6718) -

0358 2688 -

- 5199) ao - 4109)

4758)

z

, LoraShadwick , ,Sergey Karpov -

ak 4807) - ar d

- 506X) , JanPawlowski W. , j , Julius Lukeš, , Matthew , W.Brown 3900) , Noha , Youssef

p ab

, Javier Campo, del , Enrique , Lara v , Vladimír , Hampl ord. Pleasecite article this ord. as h ap e,f , Eunsoo , Kim , Satoshi , Shimano , Conrad , L.Schoch as , Vasily , al q , EdwardA. , D. , , MarthaJ. k,l ac,ad

, Fabien Burki, , Line Le , q , , Micah w , Aaron, A. x , Martin aq g , m , , This article isprotected right by All copyright. d aa z i a n A 34, Hellbrunnerstrasse Salzburg, of University Biosciences, of Department w o v

h USA, 02881 Island, Rhode Kingston, Island, of Rhode University Sciences, Biological of Department Department of Ecology and Evolutionary Biology, University of Michigan, Ann Arbor, MI 48109 USA, USA, MI 48109 Arbor, Ann Michigan, of University Biology, Evolutionary and Ecology of Department Pharmacognosy, Department of Medicinal Chem Medicinal of Department Pharmacognosy, g Department of Zoology, Faculty of Science, Charles University, Vinicna 7, 128 44 Prague, Czechia, Prague, Czechia, 44 7, 128 Vinicna University, Charles Science, of Faculty of Zoology, Department c Sorbonne Université, Université Pierre et Marie Curie Curie Marie et Pierre Université Université, Sorbonne Laboratory of Parasitic Worms and , Zoological Institute RAS, 199034 Sai 199034 RAS, Institute Zoological Protistology, and Worms Parasitic of Laboratory Department Department of Soil Sciences, College of Agriculture and Bioresources, Univers Bioresources, and Agriculture of College Sciences, Soil of Department l Department of Zoology, Faculty of Biology, Saint Petersburg State University, 199034 199034 University, State Petersburg Saint Biology, of Faculty Zoology, Invertebrate of Department e Institute for Genomics, Bi Genomics, Institute for National Institute for Biotechnology Information, National Library of Medicine, National Institutes of of Institutes National Medicine, of Library National Information, Biotechnology for Institute National x t p m

q j Department of Biosciences, University of Oslo, P.O. Box 1066 Blindern, 0316 Oslo, Norway, and Norway, Oslo, 0316 Blindern, 1066 Box P.O. of Oslo, University Biosciences, of Department s

Accepted Article71 UMR CNRS, of Sciences, Academy Czech Centre, Biology Parasitology, Institute of Department of Invertebrate Zoology, American Museum of Natural History, New York, NY 10024 10024 NY York, New History, of Natural Museum American Zoology, of Invertebrate Department Centre for Environment, Fisheries and Aquaculture Science (CEFAS), Barrack Road, The Nothe, Nothe, Road, The Barrack (CEFAS), Science Aquaculture and Fisheries Environment, for Centre Core Facility Centre for Culture Collection of , Saint Petersburg St Petersburg Saint Microorganisms, of Collection for Culture Centre Facility Core

Department of Eukaryotic , University of Duisburg of University Microbiology, Eukaryotic of Department ab Department of Organismal Biology, Program in Systematic Biology, Science for Laboratory, Laboratory, Life for Science Biology, Systematic in Program Biology, of Organismal Department b Institut de Ciències del Mar, CSIC, Passeig Marítim de la Barceloneta, 37 Barceloneta, de la Marítim Passeig Mar, CSIC, del Ciències de Institut y

Department of Zoology, Institute of Biosciences, University of Sao Paulo, Matao Travessa 14 Travessa Matao Paulo, of Sao University Biosciences, of Institute of Zoology, Department DZMB Meer, am Senckenberg Dept of Life Sciences, The Natural History Museum, Cromwell Road, London SW7 5BD, and SW7 London Road, Cromwell Museum, History Natural The Sciences, of Life Dept ac r f Department of Ecology, University of Kaiserslautern, Erwin Kaiserslautern, of University Ecology, of Department Faculty of Science, University of South Bohemia, 37005 České Budějovice, Czechia, and Czechia, Budějovice, České 37005 Bohemia, of South University Science, ofFaculty Laboratory of Soil Biodiversity, University of Neuchâtel, Rue Emile Rue Neuchâtel, of University Biodiversity, Soil of Laboratory Biologique de Roscoff, Place Georges Teissier, CS90074, 29688 Roscoff, France, and France, Roscoff, 29688 CS90074, Teissier, Georges Place de Roscoff, Biologique k Department of Biological Sciences, Mississippi State University, MS USA, and MS USA, University, State Mississippi Sciences, Biological of Department Biologique de Roscoff, Place Georges Teissier, Roscoff 29680, France, and 29680, France, Roscoff Teissier, Georges Place de Roscoff, Biologique of Parasitology, Faculty of Science, Charles University, BIOCEV, Průmyslová 595, 252 595, Průmyslová BIOCEV, University, Charles Science, of Faculty Parasitology, of u Depart 44 (AD2M), Groupe Evolution des Protistes et Ecosystèmes Pélagiques, Station Station Pélagiques, Ecosystèmes et Protistes des Evolution Groupe (AD2M), 44 Cidade Universitaria, Sao Paulo, 05508 Paulo, Sao Cidade Universitaria, ment of Biology, Dalhousie University, Halifax, NS, Canada, and NS, Canada, Halifax, University, Dalhousie Biology, of ment Uppsala University, Uppsala 75236, Sweden, and Sweden, 75236, Uppsala University, Uppsala ocomputing & Biotechnology, Mississippi State University, MS USA, and MS USA, State University, Mississippi Biotechnology, & ocomputing Health, Bethesda, MD 20892, Bethesda, Health, 198504 Saint Petersburg, Russia, Russia, and Petersburg, Saint 198504 Weymouth, Dorset DT4 8UB, a 8UB, DT4 Dorset Weymouth, Wilhelmshaven, Germany, and Germany, Wilhelmshaven, Kaiserslautern, Germany, and Germany, Kaiserslautern, and Russia, Petersburg, Saint – 45141 Essen, Germany, and Germany, Essen, 45141 Saskatoon, SK Canada, and Canada, SK Saskatoon,

German Centre for Centre German 42 Vestec, Czechia, and Czechia, 42 Vestec, Uppsala, Sweden, and Sweden, Uppsala, Catalonia, Spain, and Spain, Catalonia, Switzerland, and Switzerland, Czechia, and Czechia, Russia, Russia, and USA, and USA, and and and and istry, Uppsala University, BMC Box 574, SE Box 574, BMC University, Uppsala istry, s reserved.

-

Paris 6, CNRS, UMR 7144 (AD2M), Station Station (AD2M), 7144 UMR CNRS, Paris 6,

Marine Biodiversity Research, D Research, Biodiversity Marine

- USA, and USA, 090 SP, Brazil, and Brazil, SP, 090

-

nd

Schroedinger Street, D Street, Schroedinger -

Essen, Universitätsstrasse 5, D Universitätsstrasse Essen,

- Argand 37005 České Budějovice, Budějovice, České 37005

- - 5020 Salzburg, Austria, Austria, Salzburg, 5020 49 08003 Barcelona, Barcelona, 08003 49 ity of Saskatchewan, ity of Saskatchewan,

11, Neuchâtel, 11, Neuchâtel, ate University, ate University,

nt Petersburg, Petersburg, nt

- 67 -

26382 26382 663 663 -

75123 75123

-

This article isprotected right by All copyright. samples. trophic functional environmentalsamples are that effectiveeach for clade. have providedWe a guide to forthe and . provideWe suggested primer sets forDNA sequences from eukaryotes atform least t continue to usfill with surprises. Themain changesin thisrevision are theconfirmation that onlyhave home.their found Sampling soils, deeper marine waters,and thedeepsea will the morphologicalspecies descriptions. Se novelclades,exciting new andgenera, uncovered a massive leveldiversity beyond massivelyincreased the geneticinformation at hand. Consequently, we have discovered clearlyresolved. Aswe hadpredicted, environmental resolution of manynodes in phylogeneticanalyses. For some clades even families being are Microbiol. This revision of classification the of eukaryotes followsthatof A Abstract aj ai ao ak an ae ah au aq am Department of Natural Sciences, National Museums Northern Ireland, 153 Bangor Road, Holywood Holywood Road, Bangor 153 Ireland, Northern Museums National Sciences, Natural of Department Jardin Botanique de Neuchâtel, Chemin du Perthuis du Chemin Neuchâtel, de Botanique Jardin av School of Applied Sciences, Edinburgh Napier University, Edinburgh, EH11 4BN, United , Kingdom, United 4BN, EH11 Edinburgh, University, Napier Edinburgh Sciences, of Applied School af as ag al Department of Oceanography and Kyungpook Institute of Oceanography, School of Earth Syst of Earth School of Oceanography, Institute Kyungpook and of Oceanography Department

Accepted ArticleEvolutiva Biologia de Institut Institut de Systématique, Évolution, Biodiversité, Muséum National d’Histoire Naturelle, Sorbonne Sorbonne Naturelle, d’Histoire National Muséum Biodiversité, Évolution, Systématique, de Institut at B Royal

Science Research Centre, Hosei University, 2 University, Hosei Centre, Research Science Department of Biological Sciences, The University of Alabama, Tuscaloosa, AL 35487 USA 35487 AL Tuscaloosa, Alabama, of University Sciences, The Biological of Department Department of Integrative Biology, University of Guelph, Summerlee Science Complex, Guelph, Guelph, Complex, Science Summerlee of Guelph, University Biology, Integrative of Department ap Department of Genetics and Evolution, University of Geneva 1211, Geneva 4, Switzerland, and Switzerland, 4, Geneva 1211, Geneva of University Evolution, and of Genetics Department Institute of Evolution & Marine Biodiversity, Ocean University of China, Qingdao 266003, China. 266003, Qingdao China, of University Ocean Biodiversity, Marine & of Evolution Institute o Institute Yantai Department of Microbiology and Molecular Genetics, Oklahoma State University, Stillwater, OK OK Stillwater, University, State Oklahoma Genetics, Molecular and Microbiology of Department Department of Zoology, University of British Columbia, 4200 Columbia, British of University of Zoology, Department Department of Organismal Biology, Systematic Biology Program, Uppsala university, Uppsala, Uppsala, university, Uppsala Program, Biology Systematic Biology, of Organismal Department Dep ar and Technology, C/ Poble Nou km 5.5, Sant Carles de La Ràpita, E Ràpita, La de Carles Sant 5.5, Nou km C/ Poble and Technology, Laboratoire Evolution et Systématique, Université Paris Université Systématique, et Evolution Laboratoire artment of Biological Sciences, University of Arkansas, Fayetteville, Arkansas, USA, and USA, Arkansas, Fayetteville, Arkansas, of University Sciences, Biological of artment :

otanic Garden, Edinburgh, EH3 5L EH3 Edinburgh, Garden, otanic 59(5)]and retains emphasis an on . Changes sincehave improved the

ad Sciences, Kyungpook National University, Daegu, Republic of Korea, and Korea, of Republic Daegu, University, National Kyungpook Sciences, Real Jardín Botánico, CSIC, Plaza de Murillo 2, 28014 Madrid, Spain, and Spain, Madrid, 28014 2, Murillo de Plaza CSIC, Botánico, Jardín Real

guildsappendix,an in to facilitate theinterpretation of environmental f Coastal Zone Research, Chinese Academy of Science, Yantai 264003, China, China, Yantai 264003, Science, of Academy Chinese Research, Zone Coastal f Universités, 57 rue Cuvier, CP 39 75005, Paris, Paris, 75005, CP 39 Cuvier, 57 rue Universités, 37 wo domains, theloss of monophylyExavata,in the robustsupport - 49, 08003 Barcelona, Catalonia, Spain, and Spain, Catalonia, Barcelona, 08003 49, British Columbia V6T 1Z4 V6T 1Z4 Columbia British

(CSIC and UK, Ireland, Northern BT18 OEU, Ontario N1G 2W1 Canada, and Canada, 2W1 N1G Ontario - Univeritat Pompeu Fabra) Pompeu Univeritat 74074 USA, and USA, 74074 Sweden, and Sweden, R, United Kingdo R, United veralclades knownenvironmental from samples and and and and - 17 s reserved. -

1 Fujimi, Chiyoda 1 Fujimi, - du -

Canada, and Canada, Sault 58, C 58, Sault samplingin the intervening years has

m and Institute for Agrifood Research Research Agrifood for Institute m and - - , Passeig Marítim de la Barceloneta Barceloneta de la Marítim Passeig , XI, 91405 6270 University Blvd., Vancouver, Vancouver, Blvd., University 6270

France, and France, H dlet al., 2012 [

- -

ku, Tokyo, 102 Tokyo, ku, 2000 Neuchâtel, Switzerland, Switzerland, Neuchâtel, 2000

- Orsay, France, and France, Orsay, 43540 Spain Spain 43540

J.Euk. - 8160, Japan, Japan, 8160,

, and

, and , em

This article isprotected right by All copyright. under the “International CodeNomenclature of foralgae, andfungi, ”, and oneunder or the other of the two Codesof Nomenclature (algaeand some otherprotists nomenclature forprotists in general.Historically, task the Nomenclature representa family,and families an into order. phylogenetic reconstructions. became This possible, as there hasbeen some stability thisat level in the molecular clades toprovide a point of reference in theclassification hierarchy forthe non environmentalsamples. Second,we informa assignments for most taxa.will This prove in useful interpreting communities from There are two novelincomponents this revision. First,we have provided trophic monophyletic lineages. common morphological suchfeatures, assynapomorph formaldiagnoses. They providedare primarilythe studentfor and general users identifyto emended in publication.this Thedescriptions provided intended not are tosubstitute for byor the submitting author(e.g. Mann Adl in et al., 2019), and isterm introduced in this classification,it isidentified with ‘‘Adl2019’’al. et as theauthority, e orrank composition changes, and it isonly authority the for thename that changes when classificationduring the 20 past years. Clade names inthis systemnotdo change when their provedutits This systemof hierarchical nameless ranks, thatignores endingsof clade names,has monophyletic lineages,and para are representedby the genusonly. Nested clades represent as best as we know, lowerrank, higher the ranks were eliminated as superfluous. In scheme,this monotypict andterm its appropriate authorship.In cases where rankswere created to includesingle a where its authority) thatcorrectly assembled genera orhigher groups togetherinto aclade,except indentedparagraphs. The nomenclaturalpriority is given oldestto the name (andits hierarchicalsy background elsewhere,and we refer the readerto the introductions of both Adlet al., 2005and 2012 for Systematics revision.this new This data clarified phylogenetic relationshipsand new the information isincorporated in continentsand soils in generalare poorly sampled, and the deeper ocean ishard to reach. de2012; Vargas et al., 2015). significant,While it stillremains a muchbetter sense of theundescribed biodiversity environmentin our (Pawlowskiet al., sequenceinformation of phylogenetic relevance environmentalfrom samples. now have We Protistologists(Adlet al., 2012). Since then, therebeenhas a massive incr TH Acceptedcladeach description isadjusted (Cantino,1998; Pleijel and Rouse, 2003). anewWhere Article IS

revision of theclassification of eukaryotes updates thatof the InternationalSociety of compositionwas substantiallymodified. In these cases,we have usedanewer

ilityin providingname stabilityas we reconstructeda new phylogenetic information

. assembWe stemwithout formalrank designations. Thehierarchy isrepresented by . committee This of the Society has had the responsibilityarbitrating of

, and toAdl et2007 al. fora discussion. Briefly, we adopteda led the classificationled the according to the principles outlined

It shouldIt beobvious that genera grouped intoclade a then -

orpolyphyletic are groups soindicated. llysuggesta rank and classes in most s reserved. ies and apomorphies,within

was simpleras most groups fell a partialestimation asseveral theyare to citedasbe

easeDNA in - specialist. axa This article isprotected right by All copyright. Specifically,isit their refusal useto monophylya guidingas principle, but argueto to retain Acceptedprokaryotes,but the section does not s pass (Ruggieroet al. 2015). Thiseffort mayreasonablebe their in classification of the proposedAnother classification ofprokaryotes and eukaryoteswas published recently nomenclaturalpriority and a nominaambigua, nomina perplexa,nomina dubia,nomina nuda invalid names,we specify can thatthose not selected in classificationthis wereconsidered partout of respect each for othe and classified.elaborate The rules arise disputesfrom and mistakes made past,in the in nomenclature that guide and regulatehow living organisms are named, names changed, one individual.TheLinnaean sys isa It commonlyagreed pointofreference. canIt hardlyre be teaching, curation,organizing data, archiving, and communicating withcommon a language. isand it generated throughdiscussions of availab the contrastIn to a ,a classification systembelongs to a community of users, changestoday given the rateat which newinformation isbecoming available. the offloor the congress at four codes takes yearsas it has toproceed throughcommittees and approvedthen by vote on slowofprocess voting toconserve or namesreject through the traditionof botanical the fallsSocietyon committees representing communities ofprofessionals. The eventuallyconsidered forchange in theclassification. Thetask of refereeingand classifying as a (Adlet al., 2012), this mustbe donewith care,respecting nomenclatural priority, published prematurelyand pretend to re names reflectsa me their monophylystanddid not the testof (time)statistical analysis. proliferation The of these noare longer Articleaccumulated, thus with increasing an formalizedclassificationin the immediately.An overwhelmingnumber of spentnames have nodeshave theirutility in phylogenetic analysisand discussion, but notdo need beto clades,branches, or robust nodes requires p Aclassification isunlike a phylogenetic treein a publication,where thediscovery newof spiritof codes of nomenclature. name discussto and arbitrate published phylogenetic hypotheses,proposals fornew names and past the (Adlet al., 2007; Lahr et al., 2012). hasIt beenthe responsibility this of committee governed bythe Zoolog botanical the Code (Sheikhet al. 2018) for generaare that unarguablyin perpetuates anomalies, assuch the recent re describedparallel in b under nowinclude mixture aof taxaboth from Codes. Several taxa,such as , are rearrangementof the classificationalong monophyletic lineages during the90 Code,while proposed others to ad Codesboth are incompatible, some have proposedto provide parallel classifications in each Codes.both TheSociety was representedon the relevantcommittees. Notwithstanding that under the “International CodeZoological of Nom proposalor a phylogenetic hypothesis first,toverified be by the community, and only changes.Underlying these discussions are principles ofnomenclatural priority in the –

ornever were thodologicalerror practiced by some. isThat to formalize names icalCode. Issuessuch as these have been th redeclared oth Codeswith names. different This situationcreated and - – organize classificationssingle -

yearintervals. is,That how r’s work.r’s Instead providing of a long list of rejectedand in commonuse. Many theseof names were ephemeral, as temthatwe have inheritedhas detailed codes of opta modern unified code ofnomenclature. Since the

frequencyover past the decades, four mostof which nomina rejicienda roposingnew names. Newly cladesnamed and - s reserved. description of dictyostellid the amoebae with enclature”),and fewwere described under le evidence,pragmatic for purposes of tandardsof modern biology.

.

ever,too slow pace for the of - handedly.As we before argued - imagined or re , or did, nothave o roughlydiscussed in

veryformal and - s doneat will by

, , manyclades This article isprotected right by All copyright. 7) 6) 5) 4) 3) 2) 1) 20 Classification. itsreduces usefulness. names thatdo not have nomenclaturalpriority and poorlydescribe thetaxa included, further monophyletic cladesare alreadyestablished “ancestral(paraphyletic) taxa whenseemed it beneficial doto so” instead, evenwhere

Accepted Articleare05) revisedas follows: clade, ,In the the Opisthokonta,Breviatea, and nowa form robust additionalclades do that not group intoa thirdDomain. Eukaryotesnow twoform Domains calledAmorphea andDiaphoretickes, with several outsideof the two principaldomains, but notdo clustertogether into a thirddomain. as informal the Excavates when referringto the “Discoba, Metamonada, Malawimonada”, eukaryotes, of remain uncertain. haveWe dropped thesupergoup in of favour Malawimonada. Their mutualrelationships, as well as their relatio TheExcavata comprise threeclades: Metamonada, the Discoba the and the placeholdername Protalveolata islongerno required. Nodes atthe base of withinDiaphoretickes. the supporta for clade comprising theCentroplasthelida and Haptophyta as the Haptista Thenew robust support forCryptista the clade is accompaniedby a similarlyrobust origin mustnot be ruled isarare minorityopinion. Yet, thepossibility moreof than one withoutaffecting its defining criteria. Questioning thesingle origin ofa plastid within the likelihood.inclusion The of Cryptista the in Archa the areWe notcommitted to their inclusion within Archaeplastida the but notedo its phylogenies with weaksupport,but thereisnow stronger support forthis association. insideArchaeplastida. the position This has always occ Diaphoretickes remains problematic. someIn but not all analyses, theclade appears Palpitomonas Diaphoretickes.clade The comprisingthe cryp TheArchaeplastida, Sar, and several other clades remain amonophyletic clade under amoeboid andphagotrophic. cellbiosynthetic and metabolicpathways. Genera at the base of each clade are extracellulardigestion of substrateswith osmotrophicabsorption of n in exoskeleton,cyst/spore wall,cellor wall filamentousof growth andhyphae; the (/). Theyshare several characters, including synthesis of extracellularchitin There are two sister clades in Opisthokonta,the and the CRuMs(Brown al., 2018). et addition,a sisterclade tothe Amorphea comprising several generarecently described as together basal the sisterlineages. In the Holozoa, the and other the group Holozoaand Nucletmycea(/Holomycota) are robustclades with improvedresolution of Incertaesedis asnoted earlier (Adl al.,et 2012),called . the Opisthokonta,Within the asthe Metazoa (Porifera, , , , ). In Thesuper

iswell recognized and robust, although placement of its node within the

in eukaryotes. TheExcavates, and several clades

theAlveolata betterare resolvedwith additionalgenera. The - groupsutilized since 2005(Simpson and Roger 2004, Adl et al., - out until out the

arerobustly positioned. . . Theirinsistence usingon a hodge s reserved. tomonads, kathablepharids,and eplastida would expandthat group

urred timefrom to intime some

nshipsto otherclades Nucletmycea

and genera, fall utrients;and other

- podge of

This article isprotected right by All copyright. Acceptedspace. sample,solution chemistryand site physical parameters con stratified throughthe profile, and across thediameter of each ped. a soil orWhether aquatic example isheterogeneous horizontallythesub at issufficiently described. Stating marine,terrestrial, or soil is grosslyinadequate. Th species orto verify the typespecimen. Therefore, isimportantit theenvironment and habitat appropriatesa Tocompare environmentalDNA sets,data adequate meta ecosystem. speciesOften lacksufficient description of the collection siteor feedinghabit. preferences are required f understanding cell functionand interpreting phylogenetic trees, descriptions of site and food additionIn todescriptions of morphology thataccompany specimen, which iscritical for to trophic functional and groups, centre(MTOC), basal body, kinetosome, kinetid, and mastigont. In this revisionthey pertain granuloreticulopodia, reticulopodia,axopodia, centriole, centrosome, microtubularorganizing 2012they were related to thecytoskeleton and motility: ,zoosporic fungi,protozoa, , , cyst, spore, and . In correct misuseof terminology in publications. In 2005, were:these eukaryote, prokaryote, Clarificationof terms fortrophic functional groups. diversity,, and ecology. communityhub to centralize, standardize andpromote global knowledge on eukaryotic flag taxonomyissue communitymembers to directlyinteract with and informthe taxonomic framework,and to to representative images,etc.). willIt operationalbe by 2019and will allow registered Articlenode/taxonisassociated with co representation of theUniEuk taxonomyin the ofform a publicly navigable tree,where each datasetsand metadata. EukMap(eukmap.unieuk.org) isan editable, user metabarcodingdatasets, centralise and metadata.EukBank isa public repository of (primarily V4 18SrDNA) high lineage basis)taxonomically curated sequences, sequencealignments, phylogenetic trees, availableINSDC in databases. EukRef is fullyo pipeline to generate homogenous,high EukRef(eukref.org; del Campoet al. 2018) uses a standardized, open diversity,evolution andecologyvia three main modules (E (http://www.ebi.ac.uk/ena).project The will our capture collective knowledgeeukaryoticon frameworkinto ENA the (European NucleotideArchive) EMBLat and preservation willensuredbybe a direc GenBank (ncbi.nlm.nih.gov),and ENA (ebi.ac.uk/ena)databases. Thesystem's broad use DatabaseCollaboration (INSDC)repositories, which includes DDBJ (ddbj.nig.ac.jp), one taxonomic frameworktoall genetic da taxonomyat least, for, microbial eukaryotes. Aspecific ofaim theUniEuk isproject to apply driven,community developedby UniEuk (unieuk.org; Berney et al. 2017), the This classification willserve aprimary as starting reference forthe taxonomic framework

mples for comparison. Thesame issueexists when tryingto re - based andexpert s requiring revision.Asa whole, UniEuk the system will represent a oran ecological interpretation of the role in the communityand

ntextualdata (taxonomic, and ecological information, links a pleato improve samplesite descriptions.

d atENA, with standardizedprotocols submitting for - driveninternational initiative maintain to universal a - qualitycurationof sequences (primarily18SrDNA) tain the InternationalNucleotide Sequence timplementation of UniEuk the taxonomic s reserved. perational;outputs include (on a lineage - millimetreto regional scales. isIt also

Severalterms lobopodia,lamellipodia, filopodia,

ukRef,EukBank, and EukMap). - Societysupported, consensus dataisnecessary selectto tribute defineto the niche - EBI wereclarified to - sourcebioinformatics - friendly

- - isolatea throughput e soil for - - by -

- This article isprotected right by All copyright. Acceptedswallowing( the mechanismof ingestion. weThus, have the ortube in the spore. isbestIt to distinguish betweencell wall the material digestto and phagocytosecytoplasm, and somespecies even penetrate inside ingestto cytoplasm along them, o the hyphae(chitinous cellwall). One mechanismis to slurp the filamentslike noodles andingest There are two distinct mechanisms to feedalgalon filaments(cellulosic ) or fungal Mixotrophy Schwann,1824; 1839; Schleiden has 1839) been used since to refer to a eukaryotic cell. (Ehrenberg 1838)has been the word used to referto a prokaryotic cell,while cell(Dutrochet, ingestunicellular protists by phagotrop Gr.), eatto for andfood nourishment,sounds more awkwardin English.For species that reviewerswill be prey,their and incompletean description. Use it devouring( byphagocytosis”. A popular term bacterivore has the unintended implication ofvoraciously phagotrophyas a grazerpredator; or isit best to specify “ by fil example a foragin bacteria,or on soilparticle surfaces). ingest surfacesfrom covered with potential itemsfood example(for anamoeba aon lawn of categories, the grazersan goodidea tospecify what size preyare ingested. Theremaining consumers into fall two current generated,and the structure of the feeding apparatus (Fenchel,1986), and it isa theynotdo onfeed filters).size The of accumulatethe particles describe the functional groups.Some acquire suspended particles in solution the and ArticleSpecieseat that other species arecalled woodor (microchip) fragments. cellsfrom and tissues, decomposing organic matter, granules, or debris, strictare havealternative no form acquiring of energy,are verydecomposingat poor substrates, and pinocytosis,by diffusion, and byvarious membrane transport mechanisms.Some species obtain allthe other element air, the as well as some oxygen throughthe cell membrane. For example plantsobtain theircarbon for Probablyfungi. all eukaryotes are capable o (https://github.com/UMNFuN/FUNGuild)todetermine substrate utilizationsaprotrophic for organicmatter. incredible One resourceisFunGuild (Nguyenet al., 2016, generallycalled Speciesrelease that enzymes extracellularly digestsubstratesto in habitat,their are are two partsto describing the habit:feeding what iseaten, and how isit eaten. isequally important to care forhow we des especiallythings, and species their groupingsinto nodesand stems phylogeneticon trees,it Becausewe about care nomenclature andthe exact meaningof words, and of names of g theory,g typically handle onepreyat a time,and isit mathematically distinct(for osmotroph theris penetrateto throughthe cell wall. Those thatpuncture through voracitas

devoratis refersto photos saprotrophic morediscriminating

ingestingone bacterium). Species ingestbacteria either byfiltration, or by L s L.)or by penetrating ( .

) which isa false descriptionof how many bacteria eatersacquire relyingon dissolved nutrients. by d predators. s theyneed. Osmotrophy occurs throughthe ciliary by pit,

filtration yntheticspecies thatalso ingest byfood . ,or

–

lys howeverthey rely osmotrophyon through the roots to . contrast,In the moreappropriate term otrophic

Predators into anoral regionor (not filter hy,the correct isterm Grazers particles outfiltered of liquid the dependon the consumers cribesampling sitesand feedinghabits. There penetrando f osmotrophy, f the acquisition of soluble nutrients mycotrophy s reserved. ,and contribute tothe decomposition of ,like a cow in a field of grasses,browse and ,

pursuescarce prey according optimalto b ut beut aware thatsome readersand , and , Detritus L.).

or

thereare a variety of termsto

phycotrophy cytotrophy

eatersingestparticles derived tration”,or “bacteria . Bacterium . , by , either – trophy( -

feeders

trophe

, from from

as

This article isprotected right by All copyright. Accepted 60102 mol 1.53.574.2017and RFBR 16 programof National the LibraryMedicine, of National Institutes of Health; ASby RSF Researchof Ministry the Economy of and Knowledge; CLS by intramural the research postdoctoralprogramme of the Governmento and OPVVV16_019/0000759; MP by NSF DEB NSF1541510and NIH 1.05/1.1.00/02.0109BI byANR HAPAR (ANR program throughthe SponGES project (679849)*; forLi NE/H009426/1 andNE/H000887/1; MWB by NSF1456054; FB by a Fellowship Science from Researchsupport was provided as follows:SMA by NSERC 249889 Clamp,both ciliatologists. were We saddened and hurtby alphabeticallyand are to consideredbe third authors. contributedequally and are beto considered second authors;subsequent authors are listed After Acknowledg the genuslevel. Articlemoredetail about the trophic functionalassignments across protists, by noting exceptions at literaturethatwe consideredimportant to understand thechanges. Appendix 2 provides important sourcesof variation between studies.Appendix environmentalsamples, notingthat the choice of primersand depth of sequencing are as genera thathave notbeen studiedenough placeto the in classific phylogenetic tree. The revisedclassification ofeukaryotes ispresented in Table 2,and designationsto help orient student the estimate of the known numberof andgenera, providing informal p haveWe summarizedthe higherlevel classification of eukaryotes in Table 1,with an multicellular,with various gradesof host specificity, isand it a poor substitute forcytotrophy. include famousexamples ofeukaryovory (Saint poorlyAnother webs,ishardlyit correct to refer carnivoresto in food webswhere thereis meat.no functional groups.Although equivalentare above In microbial websfood there are also consumers consumers, of typically predation,by that incertae fe Laboratoryfe and VR/2017 the firstauthor, D. C.EBass, Lane, J.Lukeš, C. L. Schoch, and A. Smirnovhave -

a sedis - ments dk;UniEuk and EukRefby the Gordonand Betty Moore Foundation.

craftedterm one encounters, albeit rarely,iseukaryovory. Although there are

Eukarya. Table 4provides recommended primers analyzing for DNA from , , as intracellularor extracellular parasites, on hosts thatare protis

- gr - - OCEV AI124092; 14 ound orin aquaticsystems to carnivores (meateaters), or other -

CE02 2°consumers - ; 04

SKby RSF 16

- the untimely the loss of twocolleagues, dear D.HLynn, and J. - - 0007);VH MK JL byERDF; MEYS with ERC77159 01454NY by 04563; ELby CAM: 2017 andusers - Exupéry,1943), eukaryotes eating eukaryotes PCby EU , 3°consumers - 14 f Catalonia's f Secretariat for Universitiesand s reserved. NSF DEB1557102; VZ byRFBR 16 - - 1455611; DJR byDJRBeatriu de 1455611; Pinósthe 10302; along hierarchy, the or nodes a on

- BEby Horizon2020research andinnovation - T1/AMB

MKby CSF GA18

RCNTaxMArc 268286/GMR;

1 providesadditional supporting ,and so onexist in microbial food - 5210; JL5210; by ERC CZ LL1601 ationare listed in Table 3 hylumand class - 2007; DB2007; by NERC - 28103S;

- 34

CELby 2 CZ t s -

or LG can

This article isprotected right by All copyright. Dunthorn,M. Geisen, S. OliverGlöckner, F. Mahé, F. Quast,Kaye,C. J.Z. Simpson, A. G. WegenerParfrey, L. Adl, Audic,S. S. Bass, D. Caron, D.A. Cochrane, G. Czech,L. network M.D.&Bass, 2015. Expansion of the“reticulosphere”: diversity novel of branchingand classificationof eukaryotes. Rueckert,J., S.,Shadwick, L., Schoch, C., Smirnov, A.,&Spiegel, F. 2012. TheW. revised H.,D.McManus, Mitchell, H., A.E. D., Mozley Burki,W., F., Dunthorn, M.,Hampl,V., Heiss, A., Hoppenrath, M., Lara, E., Le L.,Gall, Lynn, Taxonomyof Protists. Standridge,S.E.,Smirnov, A.V. &Spiegel, F.W. 2007. Diversity, Nomenclature and Lodge,J., Lynn, D.H., Mann, D.G., Meisterfeld, R., Mendoza, L.,Moestrup, Mozley Ø., D.,Bass, Bowser, S.S., Brugerolle,Farmer, G., M.A.,Karp with emphasison the taxonomyprotists. of Smirnov,A.V., Spiegel, &F.W. Taylor,F. J.R. 2005. R.M.,Mendoza, L.,Moestrup, Ø.,Mozley Kugrens,P.,Krug, Lane,J., C.E., Lewis, L.A., Lodge, J., Lynn, D.H., Mann, D.G., McCourt, Bowser,J.R., S.S., Brugerolle, Fensome, G., R.A., Fredericq, S., J informationit contains. Medium * art. discussionshigheron level andranking structure; Angela Mele (Philadelphia) coverfor the University)State fordiscussions ciliaon Karnkowska (University of with Warsaw) Euglenophyta; Bourland William (Biology, Boise Copenhagen,Denmark) forthe literature and functionalassignments; Anna Germany)and Per Juel Hansen(Marine BiologicalS (Alfred Wegener Institut, Helmholz Occidentale,Concarneau, France) dinoflagellate for primers and barcoding; Urban Tillmann (CSIC),Barcelona, Spain) and Nicolas Chomérat( AlbertReñé (Dept.Biologia Marina iOceanografia, InstitutCiènciesde delMar, CMIMA Shauna Murray(Climate Change Cluster,University of TechnologySydney, Australia), Nationald’Histoire Naturelle,Sorbonne Universit Holomycota; Isabelle Florent(Institut Systématique,de Évolution, Biodiversité, Muséum RadcliffeInstitute forAdvanced Study, Harvard University, Cambridge, MA) with the Holozoa;David Hibbett S. (Biology Department, Clark Biologia Evolutiva,CSIC Marseille,France) forhelp withsponges; the and IñakiRuiz addition,we specifically Alexanderthank Ereskovsky (CNRS, S thankWe numerous colleagues who were consulted AcceptedThisdocument reflects onlyauthors’ the view and the Executive AgencySmall for and Article

Adl,M.S., Simpson, A.G.B., Farmer, M.A., Andersen, R.A., Anderson, O.R.,Barta, LITERATURECITED Berney,C.,Ciuprina, A, S.Bender, Brodie, J.Edgcomb, V. Kim, E. Rajan, J Berney,C., Geisen,S., Van Nitsche,J., Wichelen, F., Vanormelingen, P., Bon M.,Adl,S. Simpson, A. Lane, G., C. E., Lukeš, J., Bass, D.,Bowser, S. S.,Brown, M. Adl,M.S., Leander, B.S., Simpson, Archibald, J.M., Anderson, O.R.,Barta, J.R., - - formingamoebae helps todefine Variosea (Amoebozoa). sizedEnterpris SystematicBiol.,

es(EASME) isnot responsible any for use thatmay made ofbe the - UniversitatPompeu Fabra, Barcelona, Catalonia, Spain) with the J.Eukaryot. Microbiol.,

- ZentrumPolar für

tes 56 - Standridge,S.E., Nerad, T.A.,Shearer, C.A., (4):684 ; Alastair ; Simpson (Dalhousie University) for J.fEuk. Microbiol., s reserved. - Stanridge,S. E., Parfrey és, Paris,és, France) with ; - 689. IFREMER,ODE/UL/LER Bretagne

59: ection, Dept.ection, of Biology, University of - adhoc Thenew classification of eukaryotes

undMeeresforschung, Bremerhaven, University, MAWorcester, USA, and 429

ov,S., Kolisko, M., Lane, C.E., - - 493.

Trillo (ICREA throughoutthis process. In

52 tation marined’Endoume,

(5): 399(5): ames, Karpov,T.Y., S., , L. , Pawlowski,W., - , 451. - 166

Institutde

: 271 : . – 295. kowski, kowski, -

This article isprotected right by All copyright. amoebae. Lahr, A., D. J., &Brown, M.2017. Between W. a pod andahard test: the de M.,Kosakyan, A.,Alcântara, M.,D. Roger, A. J., Shadwick,L. L.,Smirnov, A., Kudryavstev, nov.). digitatum and distribution. phylogenetic curat Simpson,A.G.B., Berney, C.,de Vargas, C.,Brown, M.,Keeling, &P. Parfrey, L.W. EukRef: 224. Corliss,J.O. & Patterson, D.J. Biopress ltd. pl.1 Ungarn.Königlich Akademie der Wissenschaften zu Berlin,Abhandlungen, v. Infusorienund über ein neues Infusorien intimedes animaux et des végétaux, Paris, éd. Baillière. DOI:10.1126/science.1261605. 1261605. Velayoudon,2015. D. Follows,M., Stemmann,L., Sunagawa, S., Weissenbach,J, P., Karsenti, Wincker, EBoss,E.ak, P., Iudicone,D., Not, F., Ogata, H., Pesant, S., Raes, J., Sieracki, M.E., Speich, S., Kandels Scalco,E., Siano, R., Vincent, F., Zingone, A., Dimier,C., Picheral, M., Searson, S., Horák, L., A., Jaillon, O., Lima Aury,J. Berney,Ć, Le Bescot, N., Probert, I. Carmichael, M., Poulain, J.,Romac, S., Colin, S., 99 unique,enveloped marine andclarifies evolution. phylumAmoebozoa reveals a new c 433. orphanprotistan lineages innovel a eukaryotic super T.,Ishida, K.,Hashimoto, T.,Simpson, A. Microbiol., Environmental the Dermamoebidae Clade LKM74 anditsUnusual Life Cycle. Lara,E. (2017). 10.1111/jeu.12414. CommonLanguage Protistology! in Stamatakis,B. delA. Campo, J.Yilmaz &P. Vargas,de C. 2017. UniEuk: Timeto Sp

Accepted Article275 : -

2.

Protistologica, Ehrenberg,C.G., 1838: Überdas Massenverhältniss der jetzt lebenden Kiesel Dutrochet,R.J.H., 1824. Recherchesanatomiques De Vargas,C., Audic, S., Henry, N., Decelle, J., Mahé, Logares,F., R., Lara,E., Cavalier Brown,M.W.,Heiss, A.A., Kamikawa, R., Inagaki,Y.,Yabuki ,A., Tice,A.K., Shiratori, Blandenier,Q., Seppey, V.C. Singer, W., D.,Vlimant, M., Simon, A.,Duckert, C. & Kang,S., Tice,A.K., Spiegel, F. Silberman, W., J.D., Pánek, Čepička, T., Kostka, I., Hibberd,D.J. 1983. Ultrastructure of colonial the colouless delCampo, Kolisko,J., M.,Boscaro, V.,Santoferrara, L.F., Massana, R., Guillou,L., Grassi,B.,(1881).Intorno aic Fenchel, 1986. T. Protozoan filter feeding. – - - M.,Bittner, L., Chaffron,S.,, Dunthorn, M.,Engelen, S. 296. Lewis, Acinas,S., S.G.,

Stein (Phalansterii Mol

64

Karp :257

Biol - Smith, T.,Chao,E., E.,&Lewis, R. 2016. 187 Mycamoeba bioRxiv -

ionof ribosomalRNA enhanceto understandingof eukaryotic diversity – Evol Boss, Krzic, L., U., Reynaud, E.G.,Sardet, C., Sullivan, M.B. &

265.

19

Eukaryotic planktondiversity sunlitin the ocean.

:523 msx

278085;doi: https://doi.org/10.1101/278085 162 - da ord.danov.) and

535. gemmipara . doi: . 10.1093/molbev/msx162. - Mendez,G.,Lukeš, J., Malviya, Morard,S., Mulot,R., M.,

Bork,P., Bowler, C., Gorsky, G., Grimsley,Hingamp, N., hetognati. J.Eukaryot. Microbiol., lass (Cutosea)of deep -

nov. gen.,nov. sp., the First Cul Conglomeratals Polierschiefer vonJastraba i G.B.,& A.J.Roger, 2018. places

Spongomonas uvella s reserved. Reale Ist. LombardoSci.Lett ProgressProtistol., - group.

etphysiologiques sur la structure

- 64 branching,ultrastructurally GenomeBiol. Evol - :407

Genephylogeny of protozoan , Flegontova,, O., Guidi, Mol.Phylogenet. Evol

- (Spongomonadidaord. 411.

1 : 65 : Science,

DOI: turedMember of - 114. Eds. .Ser., ep evolutionep of J.Eukaryot. 1 , p.109 , .,

348 10 2: :427 185

- eaka (6237): - n 135, – - ., This article isprotected right by All copyright. 314 Molecular2006. phylogeny and evolution of morphologyin thesocial . Cavender,MilanoJ., Eukaryot. J. Microbiol genusand of the speciesconcept forProtostelium mycophaga (Protosteliida,Amoebozoa). SSUrDNAof the Protosteliumleads to a newphylogenetic understandingof the Organisms. Cavalier Kingdoms.Fungal C Smirnov,A.V., Spouge, J.L., Stern, R.F., Stoeck, Zimmermann,T., J. D.G.,Mitchell, E.A.D., Nitsche,F., Romeralo, M.,Saunders, G.W.,Simpson, A.G.B., R.,Jahn, Jirků, M Cepicka,I., Decelle, J., Dunthorn,M., Fiore representsa deep li (Amoebozoa: ) robustlyreveals phylogenyits and shows that Kang,S. Roger, A. J., Tice,A. K., Vlček,Č., communitydatasets by ecological guild. J.S.&Kennedy, P.G. 2016. FUNGuild: An open annotation tool forparsing fungal Protistol., multiflagellarprotist, Lawrence,KS. (Year2000). p. 827 Bradbury,P. (ed.), An Illustrated Guide Protozoa.to the 2nd ed. Society Proto of ) RibosomalRNA genes chal Protist, AdditionallyRevealing thatShell Composition Does notPredict Phylogeny in theArcellinida. of the (Amoebozoa)Corroborates F https://doi.org/10.1111/j.1095 and actin genes. phylogenetic reconstructionof Amoebozoa based concatenatedon analyses ofSSU 235e241.3, (Teleostei:Blennidae) and its relationship immuneto

AcceptedBOL Protist Working Group:Barcoding Eukaryotic Richness beyond the Animal,Plant, and Article :661 Pawlowski,J., Audic, S., Adl, S., Bass, D., Belbahri, L., Berney, C., Bowser, S.S., Pánek,Zadrobílková, T, Walker Nguyen, Mikjrukov,K. A. Meisterfeld,R. 2002. Order Arcellinida 1880.Kent In:Lee, J.J., Leedale, F.G. & Lara,E.,Heger, T. Ekelund,J., F.,Lamentowicz, M. &Mitchell, A.E. D. 2008. Lahr,D. J.G., Grant,J. &Katz,R. L. A. 2013. Multigene PhylogeneticReconstruction Lahr,J Lahr,D.J.G., Grant,Nguyen,J., T.,Lin, J.H. D. Kar, 1990. A pirhemocyton Schaap,P., W Shadwick,J.,D.,L., Silberman, J.,D., & Spiegel, F., W., Saint RuggieroM.A., Dennis P. G., Orrell, T.M.,Bailly, Bourgoin, N., T.,Brusca, R.C.,

164: – - Smith, T., Guiry,M.D., &Kirk

663. 34 Protist, - PLOS ONE 323

:391 Exupéry,1943.A. PetitLe Prince. Publ. Reynal &Hitchcock,NY.

.G.,Lara, E. &Mitchell, E.A.D. 2012.

- N.H.,Song, Z. ,Bates, S.T., Branco, S., Tedersoo L.,Menke, J., Schilling, 339. - PLoS ONE 401. ., Keeling, P.J.Kostka,., M., Kudryavtsev, Lara,A., E., Lukeš, J., Mann, PLOSBiol., 159: - Multicilia marina

Curto,A.,Rozen, D. E.,Dingermann, T.,Mutzel, R. &Baldauf, S. inckler, T.,Nelson, M., Alvarez . doi: . 10.1111/jeu.12476.

&

165 10 Mylnikov,P.A. 1998. The fine structureof a carnivorous (6): e0130114.(6): doi.org/10.1371/journal.pone.0119248 lenge the monophyly of Hyalospheniidae the (Amoebozoa: - , e22780. , http://dx.doi.org/10.1371/journal.pone.0022780. 176. - 8312.2012.01962.x

10

(11):e1001419. – neageof the group. 860. -

like parasiteof the blenny, Cienkowski,1881(Flagellata ). , Brown, G., M. Gentekaki, W., E.,Hroudrová, M., , P. 2015., AHigher Level Classification of All Living

FungalEcol., & - Donno,A.M., Gile, G.H.,Holzmann, M., s reserved. ourof the Six Major Lineages, while

Čepička, 2016.I. First multigeneanalysis of

Biol.Linn. J. Soc. & - - Curto,E.,Elgie, B., Hagiwara, H., plasmaNeumann 1909.

20 Katz,L.A., 2011. Comprehensive Molec.Phylogen. Evol.,

:241 -

2017.Variation in the 248. Blennius pholis

, 107

& (3):469 Schindel,D.

Int. J.Parasit.Int. 98 Science, L. zoologists,

– :41 Europ. J. 476. - rDNA -

51.

This article isprotected right by All copyright. AcceptedVanormelingen,P agrégé. cycle typewithin the group.Biol. Direct., diversityAcanthamoebidae of (Centramoebida,Amoebozoa) and identification ofa novel life Clau Spiegel,F. K.W., A.,Bonkowski,Wilkinson, M., Dumack, K., Lahr,D. J. Voelcker, G., E., subclades. and cytoskeletonanalyses providenovel and well Amoebozoaon with flat bodyforms. Molec. Phylogen. Evol., Molestina,R. 2016. Phylogenomics of '':Anew molecular phylogenetic perspective placozoans. Dellaporta,S.L. &Rokhsar, D.S. 2008. The Trichoplaxgenomeand nature the of K., Grimwood,J., Schmutz, A.,Kuo,Mitros, Salamov, T., A.,Carpenter, M.L.,Signorovitch, A.Y.,Moreno, M.A., Kamm, Springer al.) Refere eds. Centramoebida,and Pellitida). In:Archibald, J.M.,Simpson, A. B.,G.and Slamovits,C., Cavostellida,Schizoplasmodiida, F Shadwick,J.D. L. 2017. Protosteloid Amoeboazoa(Protosteliids, Protosporangiida, Science Publishers,4600 558 стр., ArticleBiology Eukaryot.Microbiol., Diversityand Evolution of 169 Vadell,S.L., S.M., &Baldauf, S.L. 2018. A new classification of . the Landolt,J.C., Nanjundiah, V., Queller, D.C., Strassmann, J.E., Spiegel, F.W., Stephenson, Eukaryot. J. Microbiol., genusand of the speciesconcept forProtostelium mycophaga (Protosteliida,Amoebozoa). SSUrDNAof the genus Protosteliumleads to a newphylogenetic understandingof the Strukturder und dem der Wachsthum Thiereund Pflanzen. Berlin. Trichosphaeriumsieboldi. : 1 β, S.,Zhang, β, J., Handbookof theProtists - Srivastava,M.,Begovic, Chapman, E., J., Putnam, N.H., Hellsten, U., Kawashima, T., Spiegel,F. W. Smirnov2008.A. Amoebas, Lobose. Simpson,A.G.B., & Roger, A.J.2004. Thereal “ki Sibbald,S Sheikh,S.,MatsThulin Cavende Shadwick,J.,D.,L., Silberman, J.,D., & Spiegel, F., 2017. Variation W., i Schwann,1839. T. Mikroskopische Untersuchungen überdie Uebereinstimmung in Schleiden,M.J.1838. Beiträge Schierwater,B.,DeSalle, 2018.R. Placozoa. S VanVichelen, J., D’Hondt, S.,Claeys, M., Vyverman, Berney, W., C.,Bass, D. VanTieghem, M. 1884.Ph. Tice,A. K.,Shadwick, L. FioreL., Tekle,Y. I. Tekle,Y. I., Anderson, R.,O.Katz, L. A., Maur 28.

14 Bull.Soc. Bot. France chaudinn,F. 1899. "Untersuchungen uber den generations wechselvon

: R693 : MolecularPhylogen. Evol., Nature, - . J., . Cenci, U., Colp,M.,Eglit, Y., O'Kelly,J.C. . 2016. . AHotspot of Amoebae Diversity:8 New Naked Amoebae R896. doi.org/10.1016/j.cub.2004.08.038 & nce Works(e

Wood, F. C. 2017.Wood, Longamoebia is not monoph 454 doi:10.1111/jeu.12394. , &

Shadwick,L. L., Ndiritu, G.,G. Brown, M.Aguilar, M., W.,

Brown,M. 2016. Expansion W. of themolecular and morphological doi:10.1111/jeu.12476.

(7207):955

Paramoeba Schn.

J.,Shapiro, H., Grigoriev,Buss, I.V., L.W., Schierwater, B., ,

(SecondEdition of Handbook the of Protoctista byMargulis et 31 Abh. Konigl. Preuss. Akad.Wiss - book)DOI 10.1007/978 :303 ractoviteliida, and sporcarpic membersof Vanellida, Cœnonia - 577 P. –

960.doi:10.1038/nature07191

zurPhytogenesis. Berlin:Veitet Comp. spp.and theirKinetoplastid . (doi: http://dx.doi.org/10.1016/j.ympev.2017.06.019.(doi: - r, J.C., Escalante,r, R.,Kawakami, S.I., Lado, C., 306.DOI: 10.1080/00378941.1884.10828252 - 11 Donno,A. M., GeisenS

:69DOI 10.1186/s13062

Encyclopedia ofMicrobiology , , genre nouveauMyxomycètes de a plasmode s reserved.

- resolvedrelationships ofamoebozoan CurrentBiol., er - Alcala,X. X., Romero, A.,M.

ngdoms” ofeukaryotes. - 3 -

319 99 : 144 : - & ., Berlin., Suppl.1 32669 .,Kang,S., Schuler, A.,G.

28 Archibald,J.2017.M. yletic:Phylogenomic

- - :R97 154. 016 - 6_12 - . . Oxford:Elsevier 0171

- 98. - 1

nthe

- 0. & Current Protist, -

93. J.

& &

This article isprotected right by All copyright. Echinamoebida Corycida (C) Tubulinea(P) Incertae sedis (F) AMORPHEA classification in genera.known G genus, Ffamily, O order,class, C phylum,P kingdom.K Table1. Higherranks of theeukaryotes indicating the position Linnaeanof ranks, andnumber the of Appendix Appendix Appendix Supportinginformation Figure1. Overview theof diversity protistsof amongst eukaryotes. Figure legend. 10.1080/01490451003702925. with Particula 55 Associatedwith thePlanktonic Bloom

Accepted Article 61 : - Wilkinson,D. M. &Mitchell, A.E. D. 2010. Testate Amoebaeand Nutrient Cycling 87. Amoebozoa CRuMs (O) S S S

Translation3. Eastguide for Asian users. Funct 2. Supplementary1. references. 93 21 rReference toSoils.

online (C) Evosea (P) Mantamonas Rigifilida (F)

11

255 ional group assignments.

databasesare too poor to evaluate workor with thisclade. Archamoebea (C) Cutosea (C) Eumycetozoa (C) Variosea (C) Elardia (C)

106

(G)

(Arcellinida

Geomicrobiol. -

forming CyanobacteriumMicrocystis.

63

) s reserved.

J. , 27

:6, 520

- 533.DOI: *The

state theof

Acta Protozool . This article isprotected right by All copyright. Microsporida (O?/F) Cryptomycota(F) Bilateria (K, ~35 P) Ctenophora (P) Cnidaria (P) Hexactinellida (C) Accepted (Fungi) ~ Article Obazoa 8,6 (G/F?)

00

Opist Breviatea(F) Apusomonadida (F) Discosea (P)

3

>150 hokonta Nucletmycea Incertae sedis Holozoa: Holozoa Centramoebia (C) Stygamoebida (C) (C)

35 4

Opisthosporidia (O) Rotosphaerida (O) Metazoa Choanoflagellata (C) Ichtyosporea (O) (C) Blastocladiales(O) 25 (without Choanoflagellata, Porifera and Metazoa) and Porifera (without Choanoflagellata, 6

Porifera Aphelidea(F) ~8,000

Corallochytrium

Basidiomycota (P) (P) Calcarea(C) Demospongiae (C) (P) s reserved. 9 14

742

57 140

4

, ~6,400 Syssomonas

~1,600

This article isprotected right by All copyright. Picocystophyceae(C) C Pedinophyceae(C) Chlorodendrophyceae (C) (C) Trebouxiophyceae (C) Ulvophyceae(C) (P) Chloroplastida Glaucocystace Pterocystida (O) Centroplasthelida (C) (O) Pavlovales (F) Haptista(P) Cryptista (C) Incertae sedis DIAPHORETICKES Zoopagomycota (P) Olpidium Neocallimastigaceae (F) Acceptedhloropicophyceae (C) Article Archaeplastida Panacanthocystida (O) Haptophyta (C) Palpitomonas (O) (G)

21

: ae (F)

Microhelliela maris, Ancoracysta t

( Rhodophyceae (P)

72,000 sp +

~200 4

16

(G)

80 Eurhodophytina (C) Proteorhodophytina (O/C) Cyanidiales(O) 11

Embryophyta

850

)

Mucoromycota(P) wista s reserved.

, Rappemonads, ,

~140

This article isprotected right by All copyright. Accepted Opalinata (O) Article Phragmoplastophyta (C) Klebsomidiophyceae(F) Mesostigma viridae Chlorokybusatmophyticus (P) Palmophyllophyceae (C) Pycnococcaceae (C) Nephroselmis Mamiellophyceae(C) Pyramimonadales(C) Sar Embryophyta(K) Characeae (F) Coleochaetophyceae(O) Zygnema

(G)

taceae (F)

Stramenopiles (P)

Gyrista (C) (C)

Hyphochytriales (O) Developea(F) (O/F) Placidida (F) Actinophryidae (F) Pirsonia Peronosporomycetes (C/O)

49 31

excluding Peronosporomycetes and Ochrophyta and excluding Peronosporomycetes

Chrysista (C) (G) s reserved.

*

Pseudophyllomitidae(F?) (O)

*

Ph Eustigmatales (O) Chrysophyceae(O) aeophyceae(O) 46

This article isprotected right by All copyright. Oligomymenophorea (C) AcceptedPlagyopylea (C) Nasso (C) (C) (C) (O) Spirotrichea (C) Heterotrichida (O) Article Xanthophyceae (O) Schizocladia (O) Raphidophyceae(O) p horea(C) Hypotrichia

73

15 139

41 23 263

58

183

+ Hypotrichia+ 263

Alveolata, others

433

Ciliophora (P) Incertae sedis: (F), Protococcidiorida (F) Apicomplexa (P) Dinoflagellata(P) Oxyrrhismarina Acavomonas Colponemidia (F) (F) (O)

Karyore (C) (C) (C) (O) (O) 26

(G)

lictea (C)

Diatomista

~350

300 s reserved.

18

Diatomea(C) (F) ~400

This article isprotected right by All copyright. Accepted (C) (C/O?) (C) Filoreta (O) Vampyrellida (O) (P) Chlorarachnea (F) (O) Metromonade Silicofilosea(C) Article (C) Sainouridae(F) Pansomonadidae(F)

(G) (P) (P) Variglissida (F) Marimonadida (F) Spongomonadida (F) (G)

>34 a (F)

Taxopodida (F) (C) (C)

~950

1 50 (P + environmental clades+ environmental

Viridiraptoridae(F) Glissomonadida (O) Paracercomonadida (F) (F) ) >>204 s reserved.

This article isprotected right by All copyright. Accepted genera lackingDNA sequence informationor known require to taxonomic revisio described speciesare indicated by M; morphologicaldiagnosis indicatedare by R(ribo indicatedby P; robustclades recoveredin phylogeneticanalysis thatdo no monophyleticbest as as wedetermine; can if polyphylyor issuspected, it is notes to this table canbe infound theLITERATURE CITED. Named clades are Selectedreferences to the literature since2012 can be infound Appendix 1. authorityisindicated and the reference is to this manuscript (“emend.Adl et2019”). al. notdo have nomenclaturalpriority. theIf taxon name hasbeen emendedherein, the square bracket following inappropriateare and incorrect names used in theliterature, or retain oldest the term thatcorrectly described the grouping,emended necessary;if in the purposesFor of authorityto whom the taxonname isattributed appears immediately after the taxon name. Table 2. Article Preaxostyla Parabasalia Excavates Tremula Aquavalon

(G)

Classificationof the higher ranksof the protists and multicellular organisms. The (G)

Discoba Metamonada Polycystinea (C) nomenclatureand stability names of inthe classification, we have to tried (P) Heterolobosea Tsukubamonas Jakobida Fornicata 94

133

Kinetoplastea (C) Symbiontida (F) Diplonema (O) Euglenida (C) ~470

(G)

MTOC, microtubularorganizing center.

s reserved. - group); monotypic group with onlyone

t have t

Citationsin the *Denotes n.

that This article isprotected right by All copyright. extracellularenvelope one with to several opening(s)). Mi coveredwith tectum a Cellsoftennaked, with well and/orsubpseudopodia with little coordinated movementof c the some groups;alternatively, amoeboid locomotion involvingthe extension and retraction of li Organismsalmost all demonstrating ‘amoeboid activity’ AmoebozoaLühe 1913, microaerophilic,with lar and resorbed atposterior; cell alsocan produce broad lamellopodia;anaerobic or end, movingposteriorly as cellmoves forward (filopodia appearing attachedto substrate), perpendicular anteroposteriorto axis isolatesa second posteriorly Amoeboid cellsgliding (10 ● region; tubular mitochondrialcristae; phagocytosis of bacteria. extension of flanges to forma proboscis and the posteriorcilium lying within theventral develop ingenera; most with two heter laterallyand ventrally as flangesthat delimit a broad ventral region whichfrom pseudopodia Glidingcells (5 ● &Larsen Patterson 1990 (Apusomonadida) Dodge 1927(Opisthokonta), clade containin Opisthokonta andtwo otherclades, Apusomonadida and Obazoaisa clade thatis robustly recovered in phylogeneticand trees consitsof the Incertaesedis huxleyi Moestrupand Sengco 2001 (Rhizaria), Thalassiosira pseudonana (Archaeplastida), followingwithin fall the specifiedclade intended toapply ato crown qualifying clade; clause (Amoebozoa). isa This node Shearand Dodge 1927 (both Opisthokonta),and Theleastinclusive cladecontaining AMORPHEAAdlal.2012 et fe cycle.fe Amoeboid locomotion with steady flow of cytoplasm the or occasional eruptionsin Breviatea Accepted Apusomonadida Article

(Lohmann)Hay and Mohler 1967(Hapt , Lenisia

Cavalier ,

Chelonemonas Amorphea: Obazoa – g 15 µm), with dorsal cellmembrane underlain bythin thecaextending , Homosapiens thermo Pygsuia

Karpov&Mylnikov 1989 - Smith& 2004 2

ora cuticle ge mitochondrionge sensu , – Hasle andHiemdal1970 (), - Subulatomonas 15 µm)with15 single anteriorly developed,differentiated glycocalyx;in several groupscells are - - P.biforma directedcilium; filopodia projectingunilaterally cell,from , baseddefinition in which all Mancho

Linnaeus 1758 (Opisthokonta), Cavalier 3 . . Two groups are testate (enclosed in a flexiblehard or

Brownal. et 2013(R) Homo sapiens

and directionof movement; filopodia atforming anterior phila – odynamic cilia,anterior the enclosed bysleeve

Euglena gras Brown et al. Arabidopsisthaliana - - Smith1998 like organelle;ingestsbacteria; can cysts.form .

. Nanneyand McCoy 1976(Alveolata),

, s reserved. ophyta). Multimonas Dictyosteliumdiscoideum

Linnaeus 1758, (Breviatea),and

– Klebs1883 (Excavata), and

the name the does not apply anyif of the 1

-

inin all certainor stage(s) of their directedapical cilium and in some tochondrialcristae tubular Breviatea of of specifiers the extant;are it is

, Podomonas

(Linnaeus) Heynhold 1842 Amastigomonas Neurospora crassa .isIt theinclusive least Neurospora crassa Thecamonas trahens natans , Thecamonas

Raper1935 ytoplasm. , Emiliania

Shear& - . like

This article isprotected right by All copyright. isolateof 8 sedis date,no moleculardata a on true (2017)an for isolate that isa distinct genusnamed 7 necessaryto clarify its position among Amoebozoa. treeshowsit affinities with Variosea,although with support. no More robustdata are hartmannelid morphology(monopodial cells with pronounced frontalhyaline cap) but in SSU 6 Stereomyxa Parmulina Hartmannia Incertaesedis amoebozoans,Dictyostelia the (Eumycetozoa)and in cells(usually also calledspores).Sorocarpic developme fruitingbody consisting of either distinct stalkcells and spores or non 5 provethis case, the non everbeenobserved in Amoebozoaand ispotentially synapomorphic Amoebozoa. for Should one tomany propagules termedspores. As defined here, this of kind sporocarphas only 4 Paragocevia surface; theventral surface remains Knownfree. amoebae in of the genera 3 ventral the surfaceof thecell remains Knownfree. amoebae in of the genus 2 pseudopodia are used forcell movementover the changethe conformation of the entire cell body by extending and retracting pseudopodia; 1 reduction of thebikont kinetid Biciliated,uniciliated, or multiciliatedstages in the lifecycle ofsome taxa;sometaxa exhibit Evosea,and Discosea. Manytaxa exhibiteither sporocarpic life cycles consistentwith sexhave beenreported i relatedorganelles (MRO)in archamoebians.Most only reported toasexual,be sex but and (ramicristate),with exceptions;few mitochondria secondarilyreduced to

Th taxon nameThe species The Amoebae aggregate into a multicellularmass thatdevelops intoa multicellular,subaerial ability The a of or a cell typein a multicellularorganism activelyto Accepted ArticleSingle amoeboidcell differentiates into a usually stalked, subaerial structure thatsupport Layer of fibrous material covering the Monolayerscales of coveringthe cell adhering to thesubstratum thefrom dorsal surface; e name .

Vannella * ,

* Unda * Penardochlamys ,Malamoeba 7 and , Schoutedamoeba minuta Amoebozoa: Subulamoeba

Ovalopodium. isused in Tekle etal. (2016) as wellTekleas in and (2017)Wood foran Ster

as notedin Cavalier eomyxa - sporocarpicamoebozoans arethe products of reductive e * , Malpighamoeba , Belonocystis*, * * , Thecochaos , , toa unikont kinetid.

ramosa Pseudothecamoeba

Stereomyxa

isused in Tekle etal. (2016)and andTekle Wood - cell,adhering to the substratum from dorsal the describedby VanVichelen et al. (2016)h Smithet (2016)al. and Kang et al. (2017). Boveella * * , , Triaenamoeba s reserved. Microcorycia are availableit andthus remains

substratumand/or for feeding. n allthree lineagesmajor Dracoamoeba * *

, , Biomyxa, ,

Rhabdamoeba Copromyxa nt isnt infound two lineagesof

* , 4 * Micro , Unda , orsorocarpic Corallomyxa,

(see Tice2016) etal. (Tubulinea). glomus * * 8 - , , differentiatedencysted Schoutedamoeba Zonomyxa * 5 ,

fruiting. Gocevia, Oscillosignum Cochliopodium. – Gibbodiscus

Tubulinea,

incertae

asa *

volution.

- .

6 To To , * * s , ,

This article isprotected right by All copyright. intermedia pseudopodia.tubular Theinclusive least cladecontaining branched,or capable of altering thelocomotive toform monopodial or polypodial, with Cellsnakedor covered withh a ●●Elardia Kang etal. 2017 (R) Echinamoeba,Micriamoeba containing adoptingsubcylindric Cellstubular, vermiform or flattened,with orwithout spine ●●EchinamoebidaCavalier lineage aswell this but requires demonstration bymolecular data. “Microcoryciidae”clear;is not by their morphologicalch Microcorycia,Zonomyxa Trichosphaerium 12 11 Trichosphaerium Theleastinclusive cladecontaining protrude pseudopodiaor are enclosed hard in test made of spicules with multiple apertures. Cellscovered with leather flexible, ●●Corycida Kang et2017al. observationbeen has o includedbiciliated stages, which undergo copulation;no confirmationfurther ofthis 10 hyaloplasm the ( relocationof the main cytoplasmic massof the celland include 9 are known.No sporocarpybeenhasreported. No convincingevidence of stag pseudopodia.Monoaxial flow of the cytoplasm in everypseudopodium inor theentire cell. afrom flattened,expanded one to monopodialor polypodial,with subcylindrical section.cellsIf are flattened orbranched t pseudopodia polypodial (in cells) are tubular, cylindrical, or subcylindrical, rounded in cross Organismsproducing lobose pseudopodia (lobopodia) ●Tubulinea

Variable cellprojections, smooth outline, in with roundedtips, which participate in the

Schaudinnreported(1899) a complex life cycle in Accepted The genus Strain numbersand source data forthese isolates areprovided byKang al.et (2017). Article , and , Vermamoeba vermiformis,Echinamoeba silvestris

Smirnovet 2005al. Atrichosa Rhizamoe sensu

until the opposite isshown. Theposition of the genera sp. 11 almonopodial underform certain conditions. The leastinclusive clade .

Amphizonella Smirnov2008). btained. Cavalier

and ba saxonicaba - , Smith 2004(R)

Vermamoeba

Parmulina

ard test; tubular produceor tubular pseudopodia;if flattened - Smithet2016 al. isconsidere

- like coating formingone or severalopeningsused to Amphizon , es Diplochlamys .

which , were listedby Meisterfeld (2002)under 10 heyare capable ofaltering the locomotive form . . Two are groups testate,and two sorocarpic taxa .

s reserved. ella sp. , Trichosphaerium Trichosphaerium 11 9 , . aractersthey maybelong to this Diplochlamys The entire The cell or individual

- Amoebaproteus, like subpseudopodia;capable of and d here a synonymjunior of boththe granuloplasmand

Micriamoebatesseris.

(Corycida)that 12 sp.

Penardochlamys, .

11 ,

- This article isprotected right by All copyright. Spumochlamys, Planhoogen Mrabella,Nebela, Oopyxis Geoplagiopyxis Alocodera,Apodera, Bullinularia, Centropyxis, Certesella, Cornutheca, Difflugia, thick,digitate pseudopodia,ormove usinga flattened,disc chitinoid self eitherTest completelychitinoid comprising or organic or mineralparticles, recycledor ●●●●DiffluginaMeisterfeld 2002 Bullinulariaindica 13 Pyxidicula Ellipsopyxis Arcella circularor lobed, surrounded bya collar; produce thick,digitate pseudopodia. flattenedsaucer chitinoidsiliceous or elements;always r or mineralparticles held togetherby organican cement, or composed of self Test rigidor more orless flexible,either completelychitinoid comprising or recycledorganic ●●●●SphaerothecinaKosakyan 2016 Schoenbornia*,Sexangularia Paraquadrula Lagenodifflugia Incertaesedis recycledorganic or mineralparticles bound together,with single a main opening. self Cellcovered with hardor highly rigid organicor mineral extracellular testconsisting of either ●●●Arcellinida1880Kent Rhizamoeba adhesive uroidals a subcylindricalmonopodial one when rapid in movementor under specific conditions; Nakedamoebae with locomotive alteringform afrom flattenedexpanded reticulateor one to ●●●&PonsPussard 1976

AcceptedSSU The rRNAsequence of Article - secretedelements (calcareous,siliceous, or chitin , s,scales orplates (often ),from or composed of siliceous, calcite, or Cornuapyxis ,

Suiadifflugia * raadia - , Geopyxella , . secretedplates (idiosomes)held togetherby organican cement; mayproduce

*, Arcellinida: *, *, *, Pentagonia - probably shaped,hemispheric or more elongated eggto

Lamtoquadrula

Gibbocarina,Hyalosphenia, Hoogenraadia tructures alwayspresent. AY848970,and represents probably a contamination. *, *, Planocarina,Porosia, Proplagiopyxis *, Cucur * , Trigonopyxis , *,

Conicocassis Argynnia *, *,

* Lamptopyxis , Pseudawerintzewia , Padaungiella,Paracentropyxis bitella *, *, Trigonopyxisarcula Zivkovicia *, sensu Leptochlamys * , ,Cyclopyxis Awerintzewia

*

* Kosakyanet2016 al. oundedin radialsymmetry but varying in height from 13 *, , Microchlamys , sensu . *.

Netzelia,Protocucurbitella

Flabellula,Gephyramoeba s reserved.

Smirnovet2017 al. * *, ,Distomatopyxis *, *, *, *,

Mag Pomoriella AY848967is Geamphorella oid), aoid), sheet hrebia * ,

* Pseudonebela , Protoplagipyxis , - *, likehyaline projecti *

,Lesquereusia, Longinebela, Plagiopyxis * *, ,Microquadrula

- Pontigulasia shaped;pseudostome almostidentical to *, *, -

likechitinoid structure,or Ellipsopyxella Jungia *, * Pseudocucurbitella , *.

Leptomyxa, *

, *, *, *, * -

Quadrulella , Physochila, , secreted Antarcella *, *, on. *,

* , , *, This article isprotected right by All copyright. leastwith oneconeof ; several taxa contain a sporocarp state. Thelea thatalso includes obligate amoebae; the kinetid ofciliates or unikont, associated at cellsmay be the withpointed, long, often branchingand occasionally anastomosing subpseudopodia; ciliated Amoebae elongatedor flabellateduring locomotion andsometimes branchedto reticulate, ●●Variosea Cavalier Mylnikov(1998),Hibberd (1983), and Pánek kinetidstructures of ciliated stages are diagrammed in Spiegelet al. (2017),Mikrjukov and moresporocarps. However, some membersare obligate ciliatesor obligate amoebae. The amoeboid stage thatcannot produce cilia with theobligate a cellsthatreversibly amoeboidare orciliate, that then ontogo develop obligateintoan 12 Squamamoebajaponica containing features.Most taxa with onlyofa subset theselife cycle stages. Theleast inclusive clade and stages.fruiting Some species appear beto exclusively cil in Amoebozoa.Many membershave complexlife cycles Representatives of cladethis vary can across almost entire the range of morphologies seen ●Evosea Parachaos Copromyxella sorocarpicdevelopment in somespecies and subcylindrical);alterationno of the locomotive no form; a Nakedamoebae with tubular,subcylindrical pseudopodia the (or entire cellismonopodial ●●●EuamoebidaLepşi 1960 branched andmay anastomose. organicparticles; pseudopodia conical,pointed, consist solely of hyaloplasm, the sometimes proteinaceous,Test with calcifiedinner layer, or completelychitinoid with recycledmineral or ●●●●PhryganellinaBovee 1985 (Lahret2013), al. s beta tubulin (Lahret al., 2011),SSU rRNA (Laraal., 2008)et and multigenephylogenies 14 pseudopodia;with symbiotic Test reinforcedwith mineralparticles, slit ●●●●

This species This typicallypositionedas sister clade both of Sphaerothecina and Diffluginain Accepted themostIn complete version spores afrom sporocarp germinateas ciliated amoebae, Article Heleopera sphagni Kang * Physarumpolycephalum , Polychaos , * ,Deuteramoeba, Glaeseria, Hartmannella, Hydramoeba

et2017al. (R)

sole state oisit listed here asa separate lineage. - Smith etal. 2004 (R) * ,Ptolemeba, Saccamoeba, Trichamoeba

(Cutosea),and Leidy1874 ,

orpresent as ciliated amoebaes,or be one state a in life cycle sensu

Cryptodi

Smirnovet al. 2011 14 (Eumycetozoa),

.

Entamoebahistolytica . Amoeba, . Cashia - fflugia, Meisterfeldia likeaperture, numerous sma 13

etal. (2016). s reserved. Protosteliumnocturnum

12

thatinclude amoeboid,ciliated * , , , Copromyxa, moeba differentiatingmoeba into one or dhesive uroidalstructures; * iatedwith amoeboid no ,Phryganella, Wailesella

(Archamoebea). *.

lldigitate * ,Nolandella,

(Variosea),

st *.

This article isprotected right by All copyright. 14 nocturnum delicatestalk supporting single spore.least The inclusive cladecontaining componentin anucleus 1 pigmentationcontained in lipidvisible droplets Sporocarpicamoebae with acutelypointed subpseudopodia andusuallyorange ● condensed forms;cell movement slow; ciliated stages unknown. anteriorand posterior parts of fullyextended cells,or all around the cell body in more rarelybranching; never reticulate; pseudopodia oftenbranching and present mostlyin the present, p the Binucleate amoebaewith filose ● inclusive cladecontaining spine Flattenedamoebae, fan ● tubasferens. unknown. Theleast inclusive cladeconta numerous fine, tapering hyalinesubpseudopodia, directed anteriorly; ciliated stages Flattenedamoebae capable of forming fan ● groups are establis clades underthe similarly levelhigh regardless ofthe traditional ranks until more robust certain higherlevel taxa proposed in thesestudies at this time. Hence wemost list variosean representedin themultigene trees. Th support for manyof these groupings,while manyimportant variosean taxa arenot yet genera intohigher rankclades. However, SSU phylogeny shows ornolittle statistical 2015)al. and multigene phylogenye (Kang 13 dendroida inclusive cladecontaining – ● ● ● ●

Recentwithpapers relativelybroad taxon sampling, based on SSU phylogeny (Berney et The The genus 9 unikont kinetids not associatedwith nucleus; taxa withoutcilia with ring ● ● ●Flamellidae Cavalier Accepted●Protosteliida Olive&Stoianovitch 1966 Article Heliamoeba Filamoeba - like hyalinesubpseudopodia, directed anteriorly; cili

and and Flamella,Telaepolella Planoprotostelium ronounced pseudopodia makingup mostof the cell total dimension; cell body

Phalansteriumsolitaruium. Page1967 (R) Protostelium mycophaga

Berney, Bass & Geisen2015 hed. - -

- shaped, triangularor crescent associatedMTOC; sporocarpsof variable morphology,with long, Smith2016 (R) Flamella balnearia,Protostelium nocturnum, Acramoeba Filamoebanolandi

- likepseudopodia; with clearlydistinct cellbody always is

subsumedinto .

erefore,we preferto cautiousbe about including

. ining

Protostelium - t2017)al. suggest groupingof some variosean shaped orsemicircular locomotive with form sensu

and s reserved. (R) (M) Flamella aegyptia en masseen F.sinensis. Filamoeba Protostelium

Shadwicket Spiegel in Adlet2012 al.

14 - shapedlocomotion, in with numerous . ;one taxonciliated amoebae with

ated stagesated unknown. least The (Shadwickal. et 2017). and Heliamoeba mirabilis. Telaepolella .

Protoste - shaped lium

This article isprotected right by All copyright. branches,but can be formedanywhere around the cellbody; multiple contractile ; numerous finepseudopodia concentratedmostly extremitiesat the of the lateraland terminal severalmain branches often with sma branched pseudopodia; trophozoites movingslowly; main cell body elongated, consisting of Uninucleate,branching amoebae with slender,pointed and/or filose ●● Grellamoebarobusta. Grellamoeba ballistosporousin another.least The inclusive cladecontaining stages unknown;two species sporocarpic;sporocarps deciduous in onespe contractile vacuoles;some species morebranched than others; MTOC absent; ciliated locomotion;lobed nucleoli present in atleast one stage of life the cycle; multiple small finelypointed hyaline subpseudopodia oftenheavily concentrated at the leadingedg Uninucleate amoebae, thin, flabellate, fan ●●● Ceratiom Ceratiomyxella tahitiensis,Nematostelium ovatum, Schizoplasmodium cavostelioides a fragmentof a feedingplasmodium; kinetidsbikont. least The inclusive cladecontaining developz from ;one taxon ( withstalk cup ;prespore plasmodia;or plasmodia withoutdirectional streaming and a beaded appearance during Exclusivelysporocarpic group with multinucleate,highly branching and reticulate amoebae, ●●● Acramoebadendroida. branched hyalinesubpseudopodia never forming a network; Uninucleate amoebae, flattenedhighly branched, with veryslender,pointed, sometimes ●●● well. combinesseveral monotypiclineages; manyof them group with each otherin SSU treesas applyisbecause it fullysupported inphylogenomic a study b 15 Schizoplasmodiidae,Soliformoviidae. Soliformovumirregula with ciliatedamoebaes and obligate amoebae. Theinclusive least cladecontaining Uninucleate, flabellate tobranching amoebae; several memberssporocarpic, one species ●● This isthe This only group revealedpaperin the by etLahral. (2011) which weto suggest ● Accepted● Article ● ● ● Angulamoeba FractovitellidaetLahral. 2011,

Soliformoviidae Lahr&Katz 2011(R) Schizoplasmodiidae Shadwick& Spiegel in Adl et2012 al. Acramoebidae yxella,Nematostelium, Schizoplasmodium - like apophysis that fits intoannular hilumspore;on spores always oocystsderived from the that germinates from spore the or from

cellsdeveloping from multinucleate fragmentsof plasmodia; sporocarp Berney,&Bass Geisen2015 (R)

Smirnov,Nassonova & Cavalier ris,Nematostelium gracile

Ceratiomyxella , sensu

Soliformovum

llerlateral branches, never forminga network; ) with ) scale -

Kanget 2017al. (R) shapedto irregularly triangular with numerous s reserved. , and .

.

- coveredciliated amoebaes that can - Acramoebadendroida Smith 2008 (R) (M)

ciliatedstages unknown. yKang etal. (2017)and 15 Soliformovumirregularis

- like,sometimes

. Acramoebidae, . cies and eduring . and This article isprotected right by All copyright. with intersectingsegments of var multiplybranched andanastomosing, and can growintogiantnetworks (up toseveral mm) sometimes branchedpseudopodia; movement of entire cells very slow; main the cellbody is Multinucleate,highly andbranching ret ● kinetosomes. Roundedcells with multiple radiatingprojections, which mayciliabe arising thefrom solitary ● KP864088). inclusive cladecontaining contractile vacuoles present;movement very slow;ciliated stages unknown. Theleast posteriorend usually with pointed or no fewpseudopodia branching; andno many narrow,especially in the mostextende branched andanastomosing pseudopodia; whole the cellbody isstrongly branching and Multinucleate,highly andbranching reticulate amoebae with slender,pointed, sometimes ●● Ischnamoeba ciliatedstages unknown. least The inclusive cladecontaining condensed organisms,often branching; movementslow too beto directly observable; pseudopodia producedalmost exclusively distalat partsof cells and mo pronounced in condensed cellsor in condensedparts of individual cells;very thin neverreticulate, with whole cellsoften bent, but not extensively branched; branching more well Uninucleate,branching naked amoebae, cells usually extendedthin, and flat,showing no ●● Cavostelium, displayingsome typeof sculpturing;cystsof some species displayingsculpturing as well. single,nondeciduous spores; morphology variable and taxonspecific; spores ofall species amoebae have akinetid amoeb reduced unikont kinetids cell,per not associated with thenucleus; species without ciliated amoebawith possible sexlifein cycle; the ciliated amoebae possesses one toseveral, subspeudopodia,anastomosing in someta multinucleate reticulateplasmodia, all characterized by producing long, filose, Sporocarpic group with various typesof amoebae, uninucleatefrom amoebae to ●● Angulamoeba some species with ciliate ● ● ● ● ● Accepted● ●HolomastigidaLauterborn 1895 Article - Dictyamoeba Darbyshirella Ischnamoeba CavosteliidaShadwick& Spiegel in Adl et al. 2012 (R) defined celldefined body, except often a slight broadening in thearea containing the Darbyshirella

Schizoplasmodiopsis,Tychosporium

Artodiscus sp.isolate F4(Genbank: KP864094). microcystivorans

Berney,Bass & Geisen 2015 Berney,Bass & Geisen 2015 Berney,&Bass Geisen2015 * d amoebaestages. least The inclusive cladecontaining , Multicilia , . Darbyshirella ter

ae that germinate spores;from sporocarps in allspecies with and yingwidth and numerous terminal branching areas; .

A.fungorum

d parts,while morecondensed parts are wider; iculatenaked amoebae with slender,pointed, restris xa;one taxonwith ciliatedamoebae and obligate s reserved.

(M) (R) . and Angulamoeba .

Ischnamoeba Darbyshirella

Ischnamoeba montana .

.

sp. (Genbank re re pronounced in

nucleus; and This article isprotected right by All copyright. towardaggregationan center thatsignals with a chemicalattractant acrasin)(an with peripheralreticulate nucleolus; upon starvation,amoebae aggregating,often i priorzygote to germinationof the macrocyst; amoebae aciliate,haploid, with nucleuswith which towardsuchit that the aggregate lays down common acystwall to a form macrocyst in sex,when presentassociated with zygote a thatcauses haploid amoebae aggregateto maturity;spor whorlslateralof branches (polysphondyloid); cells of stalks dead, consisting of walls, only, at unbranched orsparsely branched (dictyosteloid),or cellular and regularlybranched with terminalsori ofhaploid spores;stal fruitingbodies developing aggregationfrom of amoebae; sorocarps consisting of stalks with Sorocarpicamoebae, also knowncellular as slime molds or social amoebae, with stalked ● fruticulosa Theleastinclusive cladecontaining the granularcytoplasm; where sexiswell studied, zygote the cannibalizes haploid amoebae. widepseudopodia with acutelypointed subpseudopodia an amoebae of myxogastrids andprotosporangiids andamoebae of dictyostelids and flat form amoeboid state whichfrom sporocarpsdevelop ( andProtosporangiida); ciliated a lifecycle withbikont a ciliatedamoebae state that gives rise to Protosporangiida);with alife cycle havinga singlehaploid amoeboid state (Dictyostelia);or All ● Phalansteriumsolitarium of bodytheir or producing cytoplasmic eruptions. Theleastinclusive cladecontaining shorttapering cytoplasmic projec one centriole per kinetid;ciliary usuallypocket surrounded by a collar; some species form Uniciliatesedentary cells,colonial or solitary; ciliumarises from apical the partof the cell; ● stages unknown. cell;very strong vacuolaractivity across thewhole network; movement very slow; ciliated branching;branching, filose wherefront phagocytosisoccurs; posterior part of cells the is much less reticulateand morecomplex at the anterior front, formingwide, a very densely reticulate, non cytoplasmic contentsare distributed across the whole network,with network Multinucleate,highly andbranching reticulate amoebae; cell body indistinct; nuclei and other ● in simpler forms;ciliate branches,especially in complexnetworks, but can be formedanywhere aroundthe cell body concentratedpseudopodiaextremity mostly abundant fine are oflateral and at the terminal ●Eumycetozoa ● ● ●●Dictyostelia Li

Accepted Article● ● known members eitherfruit, sorocarpically (Dictyostelia), or sporocarpically(Myxogastria, Phalansterium Arboramoeba the haploid the cellsare ingestedand digested by zygote the and meiosisoccurring in the es usuallyellipsoid, spherical in some species; cystspresent in some species; Arboramoeba reticulata.

Zopf 1884Zopf ster1909, Berney,&Bass Geisen2015

Cien d stages unknown. . k

ows

and - like,pseudopodia are mostlypres k sensu sensu P. filosum i

1870 tionsand move oversubstratum the using the conformation

ks (sorophores)ks acellular (acytosteloid),cellular and Sheikh etal. 2018 (R) Kang etal. 2017 (R)

Dictyosteliumdiscoideum, Physarum polycephalum, . Phalansterium

Dictyamoeba s reserved.

(M)

.

vorax.

d no pronouncedd no streaming of entat anterior the offront the

anonciliate obligate significantly n streams, - permeable and

This article isprotected right by All copyright. 17 Willkommlangea Physarum,Protophysarum, Stemonaria, Stemonitis, Stemonitopsis, Symphytocarpus, Macbrideola,Meriderma, Mucilago, Paradiachea*, Paradiachaeopsis, Enerthenema,Fuligo, Kelleromyxa, Lamproderma, Leocarpus, Lepidoderma, Leptoderma, Diachaeopsis,Diachea, Diderma,Didymium, Echinosteliopsis, , Elaeomyxa, Barbeyella,Brefeldia, Clastoderma, , , Co Containing taxa predominantlywith darkcolored spores,in mass. ●● Tubifera. Metatrichia,Minakatella*, Oligone Cornuvia,Cribraria, Dianema, Dictydiaethalium, Hemitrichia, Licea, Lindbladia, Lycogala, Containing taxa with light ●● plasmodialstate andone species known tolack ciliatedamoebae. crosssection with streamingof central granular cytoplasm. Onespecie karyogamyof gameticciliated amoebaes in sexualspecies); plasmodia usually intubular microtubules; ciliatedamoebae developingintoplasmodia (involvingplasmogamy and amoebaes with rootletsas with Eumycetozoawith rootlet 3 consisting ofa b maycontain thread s sporangia,aethalia (massivederived fruiting a wholefrom plasmodium),or plasmodium sexualspecies;sporocarps be can individual sporangia (withwithout or stalks), clustered intoindivi differentiatesintoone or moremultinucleate spore Sporocarpicamoebae where amultinucleate obligate amoeba ● it. On thebasis of his description,it seemsreasonable conclude to itwas a 16 Rostrostelium,Speliostelium, Synstelium, Tieghemostelium Coremiostelium,, Hagiwaria, Heterostelium, Polysphodylium, Raperiostelium, and bulkof the remaining cellsbecoming spores. fruitdirectly; anterior cells becoming stalk cells in dictyosteloi aggregatedeveloping into slug a haped plasmodiocarps; fruitingbodies initially coveredby extracellularan peridium and ●●Myxogastria Macbride1899 [

Manytaxa need inof revisionbecause of rampantparaphyly. ●●Lucisporidia Cavalier Accepted●●Columellidia Cavalier Article 17 dual, uninucleate dual, spores thatundergo meiosisafterspore walldevelopment in

was seen onlyonce by VanTieghem (1884)who described butnever illustrated . 17

- likespore -

- orbright - Smith 2013(R) Smith 2015. (R) - suspending capillitium;spores germinating as bikontciliated - MyxomycetesLink 1833, shaped,multicellular mass that can migrate then fruitor ma,Perichaena, Prototrichia, Reticularia, Trichia, - colored spores,in mass.

s reserved. Acytostelium,Cavenderia, - forming masseswhere thecell cleaves

sensu , prob , d andpolyspondyloid species Alwisia,Arcyria, Calomyxa, matricha,Craterium,

-

theplasmodium ably Haeckel 1866] Amaurochaete,Badhamia,

– Physarella,Physarina, s known tolack

Coenonia* and ofseveral

(R) -

16

.

.

- This article isprotected right by All copyright. Mastigamoeba, amoebaes with hyalinelate whenassociated present, with microtubularcone connected tothe nucleus. Ciliated Ciliatedamoebaes oramoeboid organismswithout cilia. Thesingle motile anteriorcilium, ●●●MastigamoebidaFrenzel 1897 derivates complementsof microtubules;without typical mitochondria, in several cases mitochondrial microtubularcone, in some cases both the kinetosomeand the axoneme have atypical pseudopodi differentinvertebrate or hosts; ciliated amoebae usuallywith hyalinelateral Amoebae orciliated amoebae, anaerobic or microaerophilic, free ●●ArchamoebeaCavalier Armaparvus, occasionallocomotion; locomotive cells f pores penetrate envelope, the allowing subpseudopodia protrude to forvery slow, plasma membrane andhaving oval scale Amoebae boundedby a continuous thin, ●●Cutosea Cavalier developintoa stalked sporocarp bearing a single, tetranucleate spore. columnsupon which cleaves it single into uninucleate presporecells that individually obligateamoeba is multinucleate plasmodiumsecreting an extracellular slime m ciliatedWith amoebaes developingcleavage from of germling a from tetranucleate spore; ●● developingintoa single two oftenresembling very early developmental stages of myxogastrid plasmodia;individually ciliatedWith amoebae as Protosporangiida; obligate amoebauninucleate plurinucleate,to ●● presporecells site of meiotic prophase andmeiosis completed in sporecomplement. uninucleate toplurinucleate obligate amoebathat develops intoone or more sporocarps; Eumyc one to sometimesfour, spores;more, life cycle with ciliatedamoebae stage with rootletsas Exclusivelywithfruiting, microscopic(protosteloid) sporocarps with a microscopicstalk with ● ●●ProtosporangiidaShadwick &Spiegel in Adlal. et 2012 (R)

Accepted Article●● ●●Protosporangiidae Spiegelin Adlet al. 2012 Ceratiomyxa etozoawith 3 rootlet consisting of a bandof only two microtubules; givingrise to a , i.e. , ,have beendemonstrated. a; unikont,a; with single kinetosomeat the base of cilia,connected to the Sapocribrum,Squamamoeba

Mastigina Schroeter1889 - Smith etal. 2016 - *. Smith 1983 pseudopodia.ral to to four

- sensu sporedsporocarp.

sensu

lattened,oval, rounded orirregularly triangular. - somewhat flexible,envelope separated thefrom

Cavalier like substructurewithin denser a matrix; small .

Endamoeba Cavalier s reserved.

- Smith 2013

- Smith et2004al. Clastostelium,Protosporangium

* , Endolimax, , Iodamoeba,

- livingor endobiontsof Ceratiomyxa

ound or

.

.

This article isprotected right by All copyright. packedhelical structures. Acceptedsubpseudopodia ofdactylopodial type;cellthick wideridges,never wrinkled; short, wide triangular pseudopodia and,in some, lancetOblong, ●●●DermamoebidaCavalier subpseudopodia. occupies more than half of body the length; never produce discrete pseudopodia or folds and/or ridges;anterior hyaloplasm often anforms antero Flattenedamoebae, oblong, lingulate, or irregularly tria ●●●ThecamoebidaSchaeffer 1926 subpseudopodia. Flattened generallyfan ●●Flabellinia Smirnovet 2005al. withouta pronounced axis; ciliated st altering thelocomotive toform the tubular, subcylindrical one; cytoplasmic flowpolyaxial or Flattenednaked amoebae, never producing tubular,subcylindrical pseudopodia andnever ●Discosea derivedfrom the microtubularcone. Ciliatespossessing a rhizostyle arising thefrom basal body of cilium the and probably Article●●● Golgidictyosome. peroxisomesabsent; mitosis closed with endonuclearc Cilia andkinetosomesabsent; with mitosomesinstead of classicalmitochondria; ●●● rhizostyle,derived thefrom lateral microtubularroot. when severalnuclei present,each nucleus isconnected itsto own microtubularco Ciliatedamoebaes with single immobile cilium, microtubularcone associated with nucleus, ●●● polykinetids;ciliated amoebae often Anaerobicor microaerophilic ciliated amoebae with slow ●●●PelobiontidaPage 1976 Rhizomastix Entamoeba Tricholimax

Cavalier - shaped orirregularly triangular cells;with smooth a cell surface or with few

Casagrandi&Barbagallo 1895 Frenzel 1897

Alexeieff1911

Sappinia,Stenamoeba, Entamoeba - Smith et - shaped,oblong or irregularly triangular cells, never with pointed Dermamoeba,, Paradermamoeba - sensu Smith 2004

al.2004 .

Cavalier sensu Rhizomastix with hyalinepseudopodia. lateral agesunknown; several taxa sporocarpic. sensu

Stratorug Smirnov2011al. et - Smith 2013

Smirnoval.et 2011 s reserved.

coat,multilayered or consisting of tightly .

osa, osa, Tricholimax ngularamoebae, usually with dorsal entrosome andspindle; reduced

- Thecamoeba

beating beating monokinetid orimmobile -

lateralcrescent and rarely *.

. ,Mastigella

.

ne;with .

This article isprotected right by All copyright. cristae flattened,ribbon forkedor branched form;elongate, expanded area ofanterior hyaloplasm; mitochondrial Flattened,elongate amoebae resembling tooth ●●StygamoebidaSmirnov 2011al. et (P) species. 20 Pessonella fimicola concentratedin a “hump”,often raised over the substratum; one species of subpseudopodia;wide anterior hyaloplasm up to ofa half the cell;posterior granuloplasm Locomotive form fan ●●●VannellidaSmirnov al. et 2005 paramoebids(Sibbald et 2017).al. symbiont(PLO), which appeares haveto originatedonly oncethe in evolution of the provisionally, basing on prese the of parasitictheir life style. No moleculardata on thisgenus are available,isso it left among (Grassi,1881) are not triangular but monopodial in locomotionwhich maya consequencebe 19 Pseudoparamoeba,Vexillifera pseudopodia. widean Locomotive form mostly a shapehas of an irregular triangle with basementdirected forward; ●●●DactylopodidaSmirnov al. et 2005 untilpositionit isbetter resolved. and doesnot showDermamoebi Dermamoeba 18 germinating active into trophozoites. the ramifications;these pseudomycelia disappear and cystsare releasedprior turninginto ramified structures(pseudomycelia) with sphericalcysts in aterminal position on active c Flattenedlingulate amoebae withoutdifferentiated glycocalyx;with complex cyclelife where ●●●

Accepted This genusmay be a juniorsynonym of Two known species of this genus Articlespecies The Mycamoeba ) with ) protosteloid sporocarps. ellstransform into coccoid stages,which undergo subsequentbuddings, eventually teriorhyaloplasm; fibrousaxial cores both in dactylopodia and inthe floating

* 20 , Ripella, , Vannella. ,however phylogenetic the analysisin thispaper uses a limited number of taxa Cunea,Janickina Mycamoeba

Blandenieret2017al. - shaped tospatulate; cells do not discreteform p - like;MTOC know

gemmipara .

*

19 da asda a clade, so wethis list as genus a separate branch

, Korotnevella ,

– Mycamoeba gemmipara.

J Clydonella,Lingulamoeba 18 . sensu in Blandenieretal. (2017) groups with chaetognathi 21 (M) n in onen in species. Vannella

Kang2017 etal. s reserved. - picksor splinters, temporarily acquiring , Neoparamoeba , being a life, ofform some nce ofnce a kinetoplastidintracellular

(Grassi,1881) and

Stygamoeba,Vermistella

, Paravannella, , , Paramoeba, seudopodia or J.pigmentifera Vannella Vannella

to to

. (

V.

This article isprotected right by All copyright. tubular)mitochondrial cristae in theunicellular stage. secondarilywith lost; pair a of kinetosomesor centrioles, sometimes modified; flat (rarely Single posteriorcilium without mastigonemes, present in atleastone life cycleor stage Opisthokonta substratum;MTOC, when known,bar partlyor naked; can formventral flattenedsheet of hyaloplasm used adhesion for to the Dorsalsurface covered with a flexiblewithout coat defi ●●●HimatismenidaPage 1987 Paragocevia Endostelium, attached integratedwith plasma membrane,or is located on thedorsal surfaceonly, and isloosely Thickcell coat envelops entire the cellwith theexception of subpseudopodial tips andis ●●●PellitidaSmirnov & Cavalier Balamuthia,Dracoamoeba, Luapeleamoeba, Protacanthamoeba, Vac and speciesculture in appearas a branched, flattenedsheet;at least two taxa, furcatednear theirbase (acanthopodia);without adhesive uroi Flattenedwith prominentsubpseudopodia, flexible and tapering ato finetip andsometimes ●●●AcanthopodidaPage 1976 Acanthamoebacastellanii. inclusive cladecontaining MTOClocated near the dictyosome; severaltaxa with protosteloid sporocarpy.least The ●●Centramoebia Cavalier potent of the mitochondrialcristae,in thesetwo genera we suggest keeping this assemblage asa Takinginto accountthe superficial similarity of the ultrastructure, including unique the shape theynotdo aform clade, but th separatebranches in phylogenetic studies. In thephylogenomic studyof et Kang al. (2017) 21

Accepted Article These genera grouptogether in some SSUphylogenetic trees, but usually they appearas Luapeleamoeba, ialbranch in the treeunless opposite the isproven with increased taxonsampling.

tothe plasma membrane;MTOC, when known,trilaminate. One genus, *

,Pellita with severalprotosteloid sporocarpicspecies.

Cavalier .

contain species with protosteloid sporocarpy. - Smith1987 - Pellita cat

Smith etal. 2016 (R)

isis the only region of the tree thatisnot fullysupported. - Smith 2011 alonica,Gocevia fonbrunei,Endostelium zonatum, ,emend. Adl e - like. Cochliopodium sensu s reserved.

t2005al.

Kanget al. 2017

nedaperture; ventral surface entirely

, Ovalopodium, Parvamoeba. Endostelium, Gocevia,

d; trilaminated; MTOC;some Acanthamoeba,

uolamoeba Acanthamoeba .

This article isprotected right by All copyright. phenotypeswith several2 Zoosporewith posterior cilium; flat mitochondrialcristae; when ●●● Cavalier competing phylogenetic hypotheses. monophylet 22 phylogenychitinof synthases); both marine and freshwater. chitin reportedin cellwall (proven by staining with wheatgermagglutinin mostanimal parasites, some free cilium;without collaror cortical alveoli; some species onlyform elongate amoeboid cells; mitochondrialcristae but some mayhave tubular mitochondrialcristae; if present, single Single Ichthyosporea●● from f cil chrysomonadsand bodonids; life cycle includes unicilaitedroundish motile swimmingcells, cellsnaked; can clustersform of multiple cells;predatory phagotroph of heterotrophic the middle Predominantlyunicellular, roundish uniciliated motile swimming cells;cilium emerges from Syssomonas means (conservedciliary toolkit expressed in transcriptome). apparatushas beenobserved in cultureconditions and furtherdemosntra free amoe Sphericalsingle cells4.5 Corallochytrium Incertaesedis Torruella e reference phylogenies are Carret al. (2017, Fig. 2), Hehenberger et al. Ichthyosporea, Theapparent composi whichspecifiers all the are extant. Neurosporacrassa Themostinclusive cladecontaining ●

Holozoa iatedamoeboid cells, amoeboid aciliatedcells with filopodia,and spherical cysts; known AcceptedTeretosporea Torruella2015 etal. (R) is a monophyletic cladeconsisting of at least Article - livingcells grow as osmotrophicchitin cell boid cells;marine saprotrophic, usually recovered coralfrom reefsin the Indian Ocean; reshwater. - celledtrophic organisms, -

tal. (2015, Fig. 1), later Lang etal. 2002 (R) icclade consistingof at least

22

Holozoa: Corallochytrium Tikhonenkov,Hehenberger, Mylnikov & Keeling 2017 (M) alpoint of cell, the ended byshort acroneme anddirects backward; cells

22 and Ichthyosporea Syssomonas multiforma. 22 limacisporum

Shearand Dodge 1927 (Fungi). isa This branch Cavalier tion ofHolozoa isFilasterea (

– – µm20in diameter; binary releasing fissions numerouselongated 20 µm20endospores thatare eventuallyreleased and become - Smith1998 [RhinosporidaceaeMendoza 2001]al. et -

Smith 1998 [MesomycetozoeaMendoza al. et 2002] Simionet al. (2017,Fig.3), etal.Whelan ,

Raghu Syssomonas, Ichthyophonus - livingand saprotrophic (

; Pluriformea Hehenbergeret al. 2017 is (R) a Homo sapiens

- Kumar1987 (M) Corallochytrium

s reserved. - Choanoflagellata,and Metazoa,. primary The walledschizont as ichthyosporeans; a ciliary

with hyphalmultinucleated filaments; flat

Linnaeus 1758(Metazoa), but not Ministeria,Capsaspora, Pigoraptor

and Sphaeroforma

Syssomonas.

parasiteof animals,spherical - baseddefinition in (2017,Fig. 2) (2017,Fig. 2), , LKM51isolate);

andmolecular tedby molecular

Theseare two

.

),

This article isprotected right by All copyright. sapiens (the Urchoanozoan), along with allitsof descendants, including is This a branch and King2017 [ChoanozoaCavalier 24 Journalof Eukaryotic Microbiology60 321,(3): published onlineMarch 2013. 11, 23 kin anat angle; fibrillarroot presentif minor and without obvious banding; multiple arcsof cytoskeletal (cortical) microtubules, with secondaciliated basalbody located solitarycolonial;or flatmito Phagotrophicwith collaractin of al.et 2005] ChoanoflagellateaCavalier ChoanomonadeaKrylov al.et 1980; Choanoflagelliida L Craspédomonadophycidées BourrellyCraspedomonadophyceae1968; Hibberd1976; CraspedomonadaceaeSenn 1900;Craspedophyceae Chadefaud1960; Choanoflagellata●● Kent 1880 Capsaspor Pigoraptor, Pigoraptor phagotrophic. nontapering tentacles supportedby microfilaments, unlike collarin choanoflagellates; Trophiccells naked, unicellular; uninucleate; aerobic with flat mitochondrialcristae; long ●● Shalchian haeckeli,;S. tapetis sexuale, Ichthyophonus, Palavascia patagonica, Pseudoperkinsus tapetis,Psorospermium mesnili,Creolimax fragrantissima, Eccrinidus flexilis, Ent Abeoforma whisleri,Amoebidium parasiticum, Anurofeca richardsi, Astreptonema, Caullerya characteristicamoeboid cells,but in others,amoeboid cellsabsent or unreported. mitochondrialcristae but Parasites of ,, and insects, or free Amoebidiidae Reeves 2003] (R) ●●● IchthyophonidaCavalier seeberi,Sphaerothecum destruens Amphibiothecumpenneri, Chromosphaera perkinsii,Dermo mature cellswith endospores continueto parasitic the cycle.

Acceptedclade The thatcomprises theMetazoa and Choanoflagellata i Choanomonada wasunfortunate an errorin spellingthatwas corrected inerratum, an Article etosometransition zone.

Linnaeus 1758and

a, with cilium, ciliatedamoeba and predator, as 24

Ministeria, Pigoraptor. Capsaspora, - baseddefinition including the most recentcommon ancestor of animals and Ministeria - Tabrizi2008al. et Ichthyophonus ‐ chondrialcristae; cili

filose Smith 1997emend. Cavalier Monosigabrevicollis - Smith 1998 [Ichthyophonae Mendozaal. 2001; et - - 1882 [CraspedomonadinaStein 1878;

supportedmicrovilli arounda single cilium;radial symmetry; isnot motile but a uses attachedstalk to thesubstrate; amoebawith cysticand aggregative stages; .

- Smith etal. 1991]

with tubular mit .

Capsaspora s reserved. ated basalated body associated withor ring

- Ruinen 1938. TheGreek root “choanē”(or livingand saprotrophic; usually with flat

ochondrialcristae; some ee, Hutner, andee, Bovee 1985; - erobryusoxidi, Enteropogon

Smith1998; Choanomonada

itcan present pluricellular clusters. cystidium,Rhinosporidium Amphibiocystidiumranae, s calleds Brunet central filamentin Ministeria

Hom 23 o

Adl and

This article isprotected right by All copyright. Savillea Acceptedgenus: and clockwise rotationwhich extends costalstrips to form mature pattern costae. of Type first followedby those forthe innerlayer ofcostae; assembly isachieved by a f of spindle the stripscostal in correc nakedwith ciliumdispersal; for juvenile attaches surface,to withdraws cilium, and deposits diagonalresulting in bothdaughter cells facing forwards;upper daughter cell (juvenile) is sedentary; cellcycle, and lorica production a onlyone layer aroundcell body, in whicharecostae case helical;adult loricate cells Lorica with costaearranged in two layers,outer longitudinal and innerhelical; occasionally ●●●●AcanthoecidaeNorris 1965, emend. stripsand a partial or entire organicmatrix inneron surface. Cellssurrounded by a basket ●●●AcanthoecidaCavalier Stelexomonas Mylnosiga Diplosiga Desmarella Cladospongia Salpingoeca disperse asnaked; under certain conditionscolonies of cellsmay develop. Typegenus: involvesamoeboid cell becoming anddividingoutsi nonrestricting glycocalyxislongitudinal surfaceby a peduncle extending thefrom baseof the glycocalyxtheca;or celldivision with Articlenonrestrictive and fibrous; istheca rigid andmicrofibril Vegetative cellswith glycocalyxthecaor that isentirely organic; glycocalyxis flexible, ●●●●Salpingoecidae Kent1880 brief motile anteriorend of extended the feeding cell;vegetative usually stage sedentary and stalked; Extracellularglycocalyx or thatisentirely organicand does not project above the ●●●CraspedidaCavalier in choanozoans,norexclusive them. to incorrectas the root “apoiko neitherhas be beenboth previously proposed for the clade containingchoanoflagellates and animals,but appliedas defined here. Theinformal term “choanimal”and the formal Apoikozoaterm have provedlater paraphyletic, t clade.Although “Choanozoa” was usedpreviously referto to assemblagean of protists that funnel) refers to thecollar, which current the in state of knowledge isa synapomorphy of the Acanthoeca .

, , Diplosigopsis Pachysoeca stage fordispersal. (juniorsynonyms

James - , shapedcell body; costal strips destined longitudinal for costae aredeposited , en formallydescribed noradopted. In particular, the term “Apoikozoa” is Codonocladium Stylochromonas

- EllisRecognized1929. genera: Clark1867. Recognized genera: t orientation; t strips are accumulatedin vertical bundles on the surface , , - Salpingoeca Hartaetosiga Smith1997, emend. Nitsche et al. 2011 hatusage was notadopted, and name the ismore appropriately - Smith 1997,emend. Nitscheet al. 2011 - ” ” refers tocolony whichformation, isneither universallypresent - Codonodesmus like loricaof siliceous costaecomprising rod

, . – Codonosigopsis

1882,emend. *, *, ,

Kentia in situ Salpingorhiza

sensu ccord tonudiform condition; celldivision is , with , restrictingtheca it isemergent and , s reserved. and Lagenoeca sensu ,

Nitscheet al. 2011 Codo Kentrosiga de the the de theca; juvenile daughtercells Acanthoeca,Helgoeca , Astrosiga

- Nitscheet2011 al. Sph based;sedentar siga

, aeroeca

Microstomoeca (juniorsynonym

), , Dicraspedella Aulomonas

,

Stagondoeca

y cellsadhere ato

- , , shaped costal

, Polyoeca Monosiga Codonosiga Choanoeca , Diploeca , orwards , ,

, ), , This article isprotected right by All copyright. calledMetazoa, Metazoa Haeckel 1874. 25 gonad,or glandulardigestive cells. moreor less independent;without mesoderm, nervous desmosomes,tissue, localized cellswith granularinclusions; cell typestransformable other into types as necessary;cells differentiation oflarva to a varietycell of types,includi juveniles;asexual reproduction by gemmules,budding or fragmentation;sessile adult; Flatmitochondrial cristae; sexual species, zygotes larvaforming (nine known larvaltypes)or ● tissueswith phagotrophiccells.Subdivisions beyond Porifera and network;epithelial actin surroundinga digestive tract;sensory cells digestive tract;without cell wall; ectoderm completelysurrounding body, and endoderm heterotrophicnutrition with secretionof digestive enzymes andosmotrophythrough a and extracellular matrixwith collagenand other fibrous characteristiccell membrane receptorsthat respond ligandsto throughelaborate signal transduction; smallto number of cells(e.g. Myxozoa 1970); Grassé coordinatio organs thatshare tasks individual, for the unless secondarilysome lost; secondarily reduced differentiation intoendoderm, ectoderm, mesoderm,and neuroderm; tissues organizedinto acrosome;embryonic development with blastula followedby gastrulation be that Reproduction sexualthrough eggan cell, fertilizedusually by a monociliated sperm cellwith Bütschli1910] ●●MetazoaHae Stephanacantha Platypleura Crucispina Calliacantha EllisRecognized1929. genera: newlorica immediately and there isnoswimming dispersalstage. Type genus: transversecostae are located horizontally; once of parfree longitudinaland helical costae are locatedvertically juvenileon cell,costal stripsdestined for accumulatedstrips andemerging fromparent lorica backwards; costal strips destined for celldivision isinverted with juvenile daughtercell being turnedupside down andpushe anteriorend of celland accumulated in bundles atthe top of the inner surface ofthe collar; by those forthe invertedorientation; strips destined innerfor the layer costae of are deposited first followed cycle andlorica productionaccords to tectiformcondition; costal strips aredeposited in (rings)in the anteriorchamber of lorica an helicalin posteriorchamber of some species,but usually comprises transverse costae Costaearranged in two layerswith longitudinalcostae outermost; internal costal layer is ●●●●Stephanoecidae Leadbeater2011 ●● Porifera●●

AcceptedThe Article

cladecomprising the Porifera, , , Diaphanoeca , Pleurasiga 25 Calotheca

Grant1836 [Parazo ckel1874, emend. Adl et al. 2005 [Animalia Linnaeus 1758; outerlayer oflongitudinal costae; stripscostal are exocytosed through , – Stephanoeca celljunctions withdesmosomes belt or zonulae adherentes; basal , - , myosin basedcontractile cellsbetween endoderm Polyfibula Campanoeca , Didymoeca *, Acanthocorbis Syndetophyllum ,

a Sollas 1884] Saepicula Trichoplax , , Kakoeca

Campyloacant

dsome species onlypossess transverserings; cell

in epithelium;nervous tissuein organized , s reserved. , Saroeca Amoenoscopa , Cnidaria,Ctenophora, and Bilateria is , Monocosta .

ng choanocytes, ng amoeboid cells,and ha

, proteins(laminin, nidogen,perlecan); Spinoeca

, Conion entlorica, juvenile cellconstructs , Nannoeca , Apheloecion , nof cells and tissuesby , Trichoplax Cosmoeca Spiraloecion , Parvicorbicula - ectoderm; some ,

Bicosta not not shown. , Crinolina Stephanoeca , gins gins the , dinto , ,

This article isprotected right by All copyright. and Cárdenas,2015; Haplosclerida Topsent,1928; Merliida Vacelet, AcceptedMorrowand Cárdenas, 2015 ClionaidaMorrow and Cárdenas, 2015; Desmacellida Morrow Hartman,1980; Axi and/ortetraxones andwhen theyare present, microscleresare highly Demospongiaewith skeleton a composed of siliceous spicules which can monaxonesbe ●●●●●HeteroscleromorphaCárdenas, Pérez and Boury basalskeleton (Vaceletia).Dendroceratida Minch pithedor and stronglylaminated with pith grading bark. into One genushas a hypercalcified Demospongiaewith skeleton a made of spongin fibre ●●●●●KeratosaGrant 1861 Verongiida1985; Bergquist, 1978. Hajdu,Picton, Pomponi, Kayaland Collins ChondrillidaRedmond, Morrow,Thacker, Diaz, Boury centriole,the nuclear apex, the Golgiapparatus and similaritiesin embryonicdevelopment. all.Synapomorphies include the followingultrastruct Mostlywith sponginskeleton, otherwise with siliceous spicules (Chondrilla),orno skeleton at Hooperand 2012. Wörheide ●●●●●VerongimorphaErpenbeck, Sutcliffe, De Cook, Dietzel, Maldonado, van Soest, aggregation of captured crustacean prey;one order Spongillida living in freshwater. outerciliated cells; one family(Cladorhizidae) with extracellulardigestion, byamoeboid cell meglascleresand microscleres,triangular axial proteinaceous filamentin sp Heteroscleromorphahave high a diversityof siliceous spicules;spicules differentiatedin ArticleVerongimorphaand Keratosa do not have (forthe part) most siliceous spicules, ●●●●Demospongiae So SceptrulophoraMehl, Hexasterophora1992; incertaesedis. Hexasterspicules. ●●●●●Hexasterophora Schmidt,1870 Amphidiscspicules. Amphidoscosida. ●●●●●Amphi reproductionwhen known isviviparouswith trichimella a larvae. multinucleate ,with differentiated some cells;electrical conductanceacross body; square Exclusivelyandmarine, especiallydeepin the ●●●●Hexactinellida Schmidt1870 axialproteinaceous filamentin spicules,whole formedby a single continuous doscophora Schulze 1886 Lychniscosida nellida Lévi,1953; Biemnida Morrowand Cárdenas, 2015; Bubarida llas 1885

Schrammen,1903; Lyssacinosida Zittel, 1877;

, 2013; , ChondrosiidaBoury s reserved. - sea;siliceous spicules triaxonic,hexactinic; i n, 1900;n, Dictyoceratida Minchin,1900. ur ; -

echaracters: orientation ofaccessory Esnault,Cárdenas, Hajdu, Lobo spongin arefibres either homogenous - Esnault,2012

1979;Poecilosclerida - diversified.Agelasida

Esnaultand Lopes, icules;larva with

-

This article isprotected right by All copyright. Opisthosp not Themostinclusive cladecontaining ● DeSa genera,and it isprobably a sisterclade Cnidariato (Srivastavaand 2008, Schierwaterand 26 asexualbinary divisionbody possible.of horizontal rootletsfibrillar and one vertical rootlet; egg celland aciliate sperm in mid endoderm,ectoderm, mesodermor nerve cells; ventralcells having ated kinetosomeswith 2 connectingadjac undifferentiatedcells;with digestive glandularcells;belt desmosomes orzonulae adherentes Two layersepithelial of cells,with middle a layersyncytial of contractile fibrouscells, and ●●● hermaphroditic.Leucosolenida Hartman,1958, Lithonida Vacelet, 1981. Unambiguouscharacters congruent with molecularphylogenies unclear.Larva calciblastula; ●●●●●Calcaronea Bidder, 1898 amphiblastula.C Unambiguouscharacters congruent with molecularphylogenies unclear.Larva ●●●●●Calcinea Bidder 1898 viviparous,hermaphrodites. Exclusivelymarine, from shallowdepths deepto the ●●●●Calcarea Bowerbank 1862 [Calc hermaphroditic;viviparous cinctoblastula larva.Homosclerophorida Dendy, 1905. axialproteinaceous filamentin spicules(only observed in onespecies);true epithelium; all,tetraxonic, not differentiated bet Exclusivelymarine, from shallowdepths deepto the ●●●●Homoscleromorpha Bergquist1978 2015; TetractinellidaMarshall 1876; Trachycladida Morrowand Cárdenas, 2015. Suberitida2002; Chombard and Boury Cárdenas,2015; Sphaerocladina Schrammen, 1924; Spongillida Manconi and Pronzato, Topsent,1928; Polymastiida Morrow and Cárdenas, 2015; Scopalinida Morrow and

Nucletmycea AcceptedAlthough monotypic, geneticdiversity isolates of indicate thereare probably multiple Article Homo sapiens Trichop lle 2018). oridia,, and lax

26

Brownal. 2009 et [syn. lathrinidaHartman, 1958; Murrayonida Vacelet, 1981. entcells;without extracellular matrix; collagen fibres absent;without

vonSchulze 1883[Placozoa Grell (M)1971]

Linnaeus 1758 (Metazoa). The compositionof Nucletmycea isFungi,

Fonticula ween megascleresand microscleres, without defined Neurosporacrassa ispongia Johnston1842] - Esnault,1999; TethyidaMorrow and Cár HolomycotaLiu etal. 2009] (R) Trichoplax adhaerens

. The primaryreference isBrown al. (2009). et s reserved. - - sea;calcium carbonate spicules; sea;siliceous spicules orspiculesno at

Shearand Dodge 1927(Fungi) and

.

27, 28

denas,

- la yer; This article isprotected right by All copyright. Spataforaet al. 2016). Zoopagomycota,Ascomycota and (Hibbett et al. 2007 ,, , , Spataforaet al. (2016: Fig. 1). Its compositionis Papset al. (2013:Fig. 1),Chang et al. (2015:Fig. 1), Torru Jameset al. (Schaeff.)Redhead, Vilgalys and Moncalvo primary 2001. The reference phylogenyis Prins. Geerl.1895, (N.C.Schenck and G.S. Sm.)C. and Walker A. Schüßler 2010, Fresen1856, Nichols1999, allomycis is This a minimum ●●Fungi Rabdiophrys,Rabdiaster. Incertaesedis Parvularia sorocarpiceg. nuclei); free filopodia Aciliatepredominantly spherical or flattenedamoebae whichfrom elongated actin Nucleariidae1998, Patterson1983, 1999] Rotosphaerida●● Rainer 1968 [junior syn.Cristidiscoidida 1987,Page Cavalier nowdispersed across protists, and several other clades also d Variationsdiffer thefrom historical understanding Fungi of thatincluded social amoebae, 28 Since,first. Holomycota comehas intomore usagein of favour thesymmet consideredsynonymous, but Nucletmycea has nomenclatural priority having beenpublished 27 (Chytridiomycetes); not observed. amoeboid zoospores with posteriorpseudocilium; sporangia asin Rhizophydiales Thallus monocentric,epibiotic, penetrates hostwall with rhizoidparasitic inspecies; Incertaesedis whichspecifiers all the are extant. Additionalphylogenies Brown are etal. (2009,Fig. 3,4).This isa branch

Accepted ArticleThereisno agreement on definition, the thusplacement, of a cladenamed Fungi. Nucletmyceaand Holomycota were proposed at about same the period and theyare to be

29 extend;with discoid flat mitochondrialcristae; uninucleate orpolynucleate (with few

F.K.Faust 1937, .

R.T.Moore 1980 - livingphagotrophs that onfeed bacteria, andalgae. Some (2006:Fig. also1);see James et al. Coemansiareversa

Allomycesarbusculus Rotosphaerida: Nucletmycea:Sanchytriacea F.alba; - crownclade definition:thesmallest crown cladecontaining Saccharomycescerevisiae Thereare nounambiguous morphological, subcellular, or biochemical somehave symbiontseg

Batrachochytriumdendrobatidis

Pompholyxophrys,Lithocolla, Vampyrellidium, Pinaciophora,

Tiegh.and LeG. Monn1873,

E.J.Butler 1911,

eKarpov and Aleoshin 2017 s reserved.

Meyenand1838,

Rozella thermophilaN. (2013:Fig.2), Karpov et (2013:al. Fig. 3), Entomo Amoebor , , , ,

ella etal. (2015: Fig. 1),and

Longcore,Pessier and D.K. phthoramuscae ispersedacross protists. Rhizophagus intraradices . Rhizopusoryzae adix ,Nucleari Coprin . ,Karpov al.et 2014,

opsiscinerea - baseddefinition in rywith Holozoa. Rozella

(Cohn) - Smith1993,

Went and Went - based a,

This article isprotected right by All copyright. cystpenetrates host wall with chitin tube,its contents migrates into host the filosepseudopodia and/orlamellipodium; zoospores attachto host cell wall and encyst, then life cycl Intracellularparasitoids ofalgae with phagotrophicamoeboid vegetative stageand complex =Aphelidiomycetes Tedersooet al. 2018;=Aphelidiaceae Tedersoo et2018] al. 2018;al. =Ap ●●●●Aphelidea Gromov2000 [=AphelididaGromov =Aphelidiomyceta2000; Tedersooet directedwhiplash cilium (functional or rudimental); phagotrophic or osmotrophic. (penetration tube; spores/cystswith chitin cellwall and specialized apparatus penetration for into host cell Opisthokontintracellular parasites/parasitoidswith amoeboid vegetative stage. Invasive ●●● Karpov,Aleoshin Mikhailov & 2014. phylogenies. notingthat consensusthis may change with discovery the newof taxa and improved the majorityopinion of the mycologicalcommunity includeto OpisthosporidiaFungi, the in microsporidia,and more like otherFungi. Thestance taken in spore structure verysimilar Microsporidiato buta genomiccontent less reduced thancore Cryptomycota ()and Microsporidia 2018) etal. (Bass as some rozellids have a acrossthe eukaryote tree. A similardebate isongoing about dist the chitinous cellwall osmoheterotrophy)or as both traitshave beenconvergently derived constituency the of Fungi the will rely whichon traitsare deemed mostrelevant (presence of regardlessof whether the Opisthosporidia are included(Richards et2017),al. determ forthese poorly known organisms.Because there isno synapomorphy Fungifor the nature which ismore similarto otherOpisthokonta than Fungi,to because of the phagotrophic 2018).But alternativean interpretationplaces empahsis on Opisthosporidacell biology free opisthosporidians)suggests a genomiccomposition and metabolism morealigned with the transcriptome (thelineage has that mostretained ancestralcharacters within chitinous cell Powell2017).al. et On theother hand, all of the Opisthosporidia sharewith otherFungi a Rozella vegetative phase thatis unbound 2018).A pointmajor of contention has been the thatfact Opisthosporidia allhave a placementof all three lineagesat the base of the Fungi (Quandt et2017;al. Toruellaal. et clade (Toruella etal. 2018), but multip and transcriptomicdata providemodest support for the monophylyan of Opisthosporidia Microsporidia,in Fungi, the noting that isanthis ongoing point of contention. New genomic (Karpovet2014), al. comprising endoparasitic the l Rotosphaerida containingnucleariids. In classificationthis we include Opisthosporidia 29 and have intranuclearmitosis with spindle pole bo synapomorphies ofFungi. Most Fungi are filamentous,have chitinous cell walls,lack cilia,

Accepted ArticleHolomycotaisthe sister lineage to Holozoa and iscomprised of Fungi and the group - livingchytrid f

oftheir nutrition. Ultimately,additional cell biology and genomicsequencing is needed e; invasivee; cystwith infective short tubeof penetrationapparatus; zoospore with

haveintracellular an (parasitic) phagotrophic feeding mode (Karpov2014;al. et

helidiomycota Tedersooet al. 2018; =Aphelidiomycotina Tedersooet al. 2018; wallsomeat stage in lifetheir cycle. Recent analysis anof aphelid ungiwith degradative enzymes,than other Opisthosporidia (Toruella etal. posteriorvacuole); present,if zoospores with filopodia and/ora posteriorly ed byed a cell wall, unlike mostFungi, and thatAphelida and le molecularstudies nonetheless supportthe s reserved. dies instead of centrioles. ineages Cryptomycota,Aphelida, and

this classificationthis is to follow inction between

becoming the 30

ining This article isprotected right by All copyright. Paraphysoderma,Physoderma, Polycaryum, Sorochytrium, Urophlyctis Catenomyces,Catenophlyctis, Caternaria, Coelomomyces, Coelomomycidium, sporic type of meiosis. unciliatedcells, while sexualreproduction occurs through fusionof pl zone;one side massof membrane arounda cone radiating anteriorly thefrom proximal end of the kinetosomeand continuing on wrapto ter Thallus monocentricor polycentric; aerobic to facultativelyanaerobic, foundaquatic in and Y.T. James 2007,Blastocladiomycetes Y. T. James 2007] Blastocladiales ●●● Petersen1909 Blastocladiineae[= Petersen 1909, Blastocladiomycota Paramicrosporidium,Spraguea, Enterocytozoon,Glugea, Hessea, Metchnikovella, Mitosporidium, Nosema, Nucleophaga, Amphiacantha,Buxtehudia, Caudospora, Chytridiopsis, Desportesia, Encephalitozoon, ubiquitouslyin soil, ma both.Contains numerousdiverse lineages currently poorly bydefined morphology, found centrosomalplaque; extrusive specializedpolartube host penetration;for sexual,asexual or withchitin inner walland outer proteinaceo Ciliophora, Obligate intracellularparasites, usually animalsof but also protistssuch as Amoebozoa ●●●●Microsporidia Balbiani1882 Rozella. the green least,Chytridiomycota,at Blastocladiomycota, Peronosporomycetes, Basidiomycota, and chitin cellwall; endobiotic (intracellularorintranuclear) parasites; knownparasites be to on, Unicellular,holocarpic, zoos al.et 2017; =Rozellomycotina Tedersooet al. 2018] (R) emend Karpovand Aleoshin 2014, =RozellomycotaDoweld =Rozellosporidia 2013; Karpov ●●●●Cryptomycota M. M.D. Jones & A.T. Richards 2011[=Rozellida et al. Lara 2010, 30 Pseudoaphelidium,Paraphelidium mitochondrialcristae spore rounded ovalto with athick smooth cell wall, or zoospores released hostfrom wall; divisionslead to multinucleate plasmodiumwhich consequently vacuolefood with red phagotrophicamoeba which engulfshost cell contents; this resultsin a characteristic central

The placement The of Aphelid

Acceptedrestrialenvironments, saprobicand/or parasitic; uniciliated motile cells with microtubules Article

alga

or Apicomplexa;or without mitochondria and peroxisomes,with mitosomes;spores - - Coleochaete shaped nucleusthatalso terminates nearthe kinetosome and is bodycomplex (= microbody globule complex); reproducesasexually by - bound ;electronno

from tubular lamellar.to - brownish excretorybody; parasite growth andsubsequentnuclear rine,and water. fresh Subdivisions uncertain. Allomyces,Blastocladia, Blastocladiella, Blastocladiopsis, .Chitin orcell wall may secondarilybe duelost to parasitic habit. ea inea the Opisthosporidia isunstable andmay change. pores single

Vairimorpha

.

- celledwithsingle a posteriorcilium; cystswith us wall;without kinetosomes,centrioles orcilia; .

Amoeboaphelidium,Aphelidium, s reserved. - opaqueplug in kinetosome transition

produceseither a resting Amblyospora, anogameteswith a .

cappedby a

, This article isprotected right by All copyright. AcceptedPhysocladia,Podochytrium, Pseudorhizidium, Siphonaria, Rhizidium, Rhizoclosmatium Fayochytriomyces, Irineochytr Avachytrium,Chytridium, Chytriomyces, Delfinachytrium, Dendrochytrium, Dinochytrium, kinetosomeand connected toby it fibrous material;nucleus not associated with kinetosome; ribosomesaggregated around or near the nucl associatedstructure ashield, saddle, globule,wing stacked , plates or combination; parallel of microtubules extending from side the of kinetosome MLCto cisterna; kinetosome inclusion,electronan mitochondria and fenestratedor simple cisternaadjacent to lipid globules, paracrystalline Zoospores coveredby cell over coat body; containing a MLC composedof microbodies, Thallus monocentricor polycentric rhizomycelial, sporangia opercu Vélez2011al. et J.D.S. Barr 2001, emend. Letcher and Powell emend.2006, Mozl. ●●●●● Cohn1879, emend. Schröter emend.1892, D. J.S. Barr 1980,emend. Caulochytrium globules,branched m striatedrhizoplast joining kinetosome andnuclear envelope; MLC with onetonumerous lipid kinetosomeand joined byuniformly dense material;pulsating ; scattered ribosomes; with posteriorlydirected, laterallyins with haustorium;sporangium inoperculate, sessile oraerial at tip of hollow Thallus monocentric,eucarpic with endogenousdevelopment; parasitic, penetrating host ●●●●●Caulochytriales Doweld 2014 Incertaesedis Article oogamous. asexualglobule; reproduction by posteriorly uniciliated zoospores, sexual reproduction not typicallywith kinetosome ciliaryposteriorapparatus and includes non a Thallus monocentricor rhizomycelialpolycentric, endobiotic orepibiotic; aerobic. Zoospore Hibbettet al. 2007 ●●●●Chytridiomycetesde Bary1863, emend. Cavalier animals,on plants, protists, and other fungi. known sexuallyby zygotic meiosis; infound soiland water as saprotrophs also but parasitic fenestratedat poles duringmitosis; reproduction asexualby uniciliated zoosporesand wher associatedwith lipid globules;apparatus Golgi with stackedcisternae; nuclear envelope cisternawhi directed cilium,nine ciliaryprops, microbody Thallus monocentric,polycentric, or filamentous; uniciliatedzoospores posteriorly with a ●●●Chytridiom

ch maysimplebe or fenestrated(=rumposome), microbodies,and mitochondria

. Chytridi ycotaDoweld emend. 2001, M. J.Powell inet Hibbett al. 2007

‐ icrobody,simple membrane cisternae andspherical mitochondria. opaqueplug at base of cilium; micr omycetes: - associatedstructures; theMLC isadjacentcisterna lipidto the ium,Obelidium, Odontochytrium,Pendulichytrium, Blyttiomyces,Zygorhizidium, Dangeardia. erted cilium; erted non

-

lipid globule complex(MLC) consisting of a - s reserved. ciliated eus;non -

ciliatedcentriole at45° angle to centriole anda ciliated kinetosome, ‐ - Smith1998, emend. M. J. Powell in ciliatedcentriole parallel ciliatedto

otubule rootwhen presenta bundle lateor inoperculate. - Standr.2009, emend. - stalk. Zoospore

.

- e This article isprotected right by All copyright. Acceptedabsent. kinetosomeand connected along theirsides by a broa encircles MLC;non mitochondrion,lobed microbody,and fenestrated cisternaproximal to kinetosome;rough oval;ribosomes dispersed; MLC posterior to nucleus with sin a parasite of greenalgae; penetrates hostwith peg Thallus monocentric,eucarpic with endogenousdevelopment and inoperculate sporangium; ●●●●●Mesochytrial Incertaesedis Lobulomyces,Maunachytrium and Golgiapparatus absent. absent joined withdense a amorphous bridge, one to three lipid globules in MLC; the MLC cisterna anterioror posterior plug extensions, non ribosomalaggrega inoperculate;rhizoids isodiametricranging from0.5 Thallus monocentric,eucarpic with endogenousdevelopment; sporangium operculate or ●●●●●Lobulomycetales R.D. Simmons 2009,emend. associatedstructure ashort, straight spur. angle to kinetosome andconnected by a dense band overtheir anterior ends; kinetosome between lipid globule andnucleus,mitochondria scattered;non Articlefenestratedcisterna and microbodyassociated with lipid globule and micr kinetosomeand centriole, and lacking associated endoplasmic reticulum; MLCanterior with sphericalto oval; ribosomes clustered,posterior nucleus,to the covering anteriorends of parasite of greenalgae; penetrates hostwith single, a weakly branched rhizoid.Zoospore Thallus monocentric,eucarpic with endogenousdevelopment and inoperculate sporangium; ●●●●●Gromochytriales Karpov&Aleoshin 2014 Nephrochytrium, Allochytridium,Catenochytridium, Cladochytrium, Cylindrochytridium,Endochytrium, fenestratedcisterna; lacking paracrystalline inclusions and kinetosome linked microtubulesin a cord ciliatedkinetosome and joined byfibrillar bridge, ciliary baseat plug of cilium, up 25to cross ribosomalaggregation; MLCwith fenestratedcisterna; non andbe rhizoidsortapering;nonapophysate, catenulate,can isodiametric withzoospores swellings;sporangium operculate or inoperculate; rhizoidalaxis apophysate or Thallus epibiotic orendobiotic; eucarpic, monocentric or polycentric with inter ●●●●●Cladochytriales Mozl. ,simple orirregularly fenestrated; microtubules, kinetosome Mesochytrium.

Lobulomycetales:

Nowakowskiella,Septochytrium tion surroundedby endoplasmic reticulum, opaquean ciliar with plug es Doweld 2013

- ‐ Standr. 2009Standr. like microtubular rootsituated between the kinetosomeand the Algomyces,Alogomyces, Cyclopsomyces, Clydaea, .

Algochytrops

- ciliated centriole and kinetosomeparallel and -

Gromochytrium ciliatedcentriole withveil a and at 30° angle to s reserved. .

. -

like haustorium.Zoospore sphericalto

– 1.5 μmwide.1.5 Zoospore containsa d,dense fibrillarbridge; ciliar plug D.SimmonsR. 2012

. -

ciliatedcentriole paral gle lipidgle globule,large - ciliatedcentriole ata 30° - associatedstructures, - associatedstructure. obodysandwiched

calary lel to

- - This article isprotected right by All copyright. Arizonaphlyctis,Borealophlyctis, Rhizophlyctis, Sonoraphlyctis. Acceptedone tomany lipid globu multiple mitochondria;ribosomes either dispersed or aggregated in the cytoplasm;MLC with kinetosomeand attached bya bridgefibrillar alongthe lengthof thenonciliated centriole; axes.Zoospore possesses nonciliated a c inoperculateor endo Thallus monocentricor polycentric, eucarpic; interbiotic sporangium thatis either ●●●●●RhizophlyctidalesLetcher2008 Incertaesedis Urceomyces Staurastromyces,Terramyces, Rhizophydium, Uebelmesseromyces, Ulkenomyces, Operculomyces,Paranamyces, Pateramyces, Paludomyces, Protrudomyces, Gammamyces, Globomyces, Batrachochytrium,Betamyces, Boothiomyces, Collimyces, Coralloidiomyces, Dinomyces, shield;or electronno ciliatedcentriole; kine bridge; fibrillarbridge eitherperpendicular ordiagonalto between kinetosome andnon ciliatedcentriole eitherparallel slightlyor angled to kinetosome andconnected by a fibrillar microbodies,and fenestratedor simple cis aggregatedwith endoplasmic reticulumbinding or ramifying through; mitochondria; onefrom side of the kinetosometo a MLC oncisterna lipid the globule; ribosomes followingcharacters: microtubularroo Thallus monocentric,eucarpic, inoperculate or operculate. Zoospore with one ormore of the ●●●●●Rhizophydiales Letcher2006, emend. Letcher 2008 Article sexuallyformed. aggregatedwith layersendoplasmicof reticulum; di posteriorlylocated MLC with fenestrated cisterna and singlelipid globule; ribosomes Thallus interbiotic with multiple rhizoids, functionsas a prosporangium; Zoospore with ●●●●●Polyphagales Doweld 2014 Lacustromyces,Neokarlingia, Polychytrium fenestratedcisterna, and presentif 1 each ofth orlongerto than its diameter; one to many lipid globulesMLC; in may or maypossess not connectedby dense materialthroughout theirlengths, length of non aggregation;non multiple rhizoidalaxes; sporangia operculate orinoperculate. Zoospore with ribosomal Thallus monocentricor polycentric lacking intercalaryswellings; monocentricspecies with ●●●●●Polychytriales Longcore &D.R. Simmons 2012 e following:a ciliary a kinetosomeplug, .

Rhizophydiales: - Polyphagus. ciliatedce ‐ ‐ operculatewith one toseveral discharge shorttubes; multiple rhizoidial tosome denseciliary plug. les,simple MLCwhencisterna present;without microtubules. ntriole parallelor at slight angle (14 ‐ Gorgonomyces,Halomyces, Kappamyces, Paranamyces, associated structure when presenta solid spur,laminated spur

Homolaphlyctis

- 3 microtubularroots. t with t oneormore stackedmicrotubules extending

Alphamyces,Angulomyces, Aquamyces, entrioleis thatat acutean angle(<40°) to the ternaassociated with lipid globule (MLC);non . s reserved. .

- associatedstructure asa spur,a sc - like striated rootlet;resting spores

Arkaya,Karlingiomyces, -

24°)to kinetosomeand - ciliated centriole equal - - This article isprotected right by All copyright. with simple pores,except forthose associated with ascoge Acceptedconidiophores;vegetative body of single cellsor tubular, septate filaments(hyphae); septa fragmentationof vegetative hyphae(thallic),blastically single from cells,hyphae, or afrom single cell;asexual reproduction by conidiospores (mitos structure(ascoma, cylindrical,fusiform, clavate or globose,persistent or evanescent, with or withouta fruiting (teleomorph)or asexually (anamorph)only, or both sexuallyand asexually (holomorph); as ascus;mating types heterothallic, homothallic (selfing) or both; may reproducesexually produce from Sexualreproduction within (saccate asci structures); meiosis usually followedby mitosis to ●●●●Ascomycota Cavalier Woronin bodiesor membrane caps. IncludesEntorrhizales ( Phytoparasiticinfecting fungi rootswith regularlyseptate coiled hyph Tedersooet al. 2018] (M) Begerowet al. 2007;=Entorrhizomycota BauerR. et al. 2015; =Entorrhizomycotina and Incertaesedis Dikarya: inclusive cladethatcontains Ascomycotaand Basidiomycota and Entorrhizomycete. Unicellula Dikarya ●●● Hibbettet al. 2007 emend. Hibbett et 2018al. Incertaesedis Article Synchytrium. Synchytrium Theleastinclusive cladeof the Chytridiomycetes t ●●●●●Synchytriales Doweldemend. 2014, Longcore, DR Simmons &Letcher 2016 Incertaesedis Geran Barromyces,Brevicalcar, Bulbosomyces, Fimicolochytrium, Gaertneriomyces, Gallinipes, kinetosome;without electron cytoplas associatedwith the kinetosome or connectedby its root; ribosomesdispersed in the Thallus monocentric,sporangia epibiotic orinterbiotic. Zoospore with nucleuseither closely ●●●●●SpizellomycetalesD. J.S. Barr 1980, emend. D. J.S. Barr 1983 Oberw.1997; =Entorrhizales Bauer R. and Oberwinkler1997; =Entorrhizomycetes omyces,Kochiomyces, Powellomyces, Spizellomyces, Thoreauomyces, Triparticalcar m; MLC m; cisterna simple; non r or filamentousr Fungi, lacking cilia,often with dikaryotic a state. Theleast

species includedin James etal. 2006, Smith etal. 2014, Longcore etal. 2016.

one overto 1,000 ascospores,but usuallyascospore eight; wallsinsideform

Synchytriales: Polyphagales: - ata);ascideveloping directly ascogenousfrom hyphae, afrom crozier or

- Smith1998 ‐ Micromyces opaque materialin the kinetosome transition zone. Endocoenobium - ciliated centriole typicallyanglean at to the ciliated

.

Begerowal.,2007et [=EntorrhizaceaeR. Bauer . s reserved.

hatincludes

noushyphae and asci; cell walls Entorrhiza), Synchytrium taraxaci pores) formedby ae; septal ae; pores without

Talbotiomycetales -

and

ci .

.

This article isprotected right by All copyright. ascosporesaseptate, delimited by enveloping membrane system (EMS), wallformedwithin Acceptedascus produceto fournuclei, which mayor maydivide not once again mitotically; fusionof two vegetative cellsto an form compositiondiffers from thatof species ofSaccharomycetes; sexual reproduction initiatedby proliferating bymitosis followedby cell division produce to two daughtercells; cell wall Myceliumabsent or poorly developed; ascomata absent;v Erikssonand 1997] Winka (M) Schizosaccharomycetales1905; E. O. Eriksson al. et 1993; = E.O. ●●●●●● parasite of mammalianlungs. betweendelimiting the membranes; cystwalls ruptureto release ascospores;extracellular eightnuclei thatare delimitedby cyst the (ascus) vesicle; ascospo karyogamy,cystwall formation, meiosis,and in some,one mitoticdivision, produceto fourto divi Myceliumand ascomata absent;vegetative cellsthin 1994; =PneumocystidomycetesEriksson and 1997; =Pneumocystidaceae] Winka (M) ●●●●●● wetmixed woodlands. asc apexascus truncate, slightly thickened below wall,ascus with widepersistent;apicalslit, mitoticdivision produceto eightcylindrical ascospores, thin absent;cylindrical asci f Myceliumpresent, multinucleate; ascomata apothecial, stalked, fleshy;interascal tissue =Neolectales Landviket 1997;al. =Neolectaceae Redhead1977] (M) Article●●●●●● Archaeorhizomycesfinlayi (nucle togetherwith association an with of living roots plants. Distinctive molecularcharacters Phylogeneticallyamongplaced , differing by mycelialgrowth MMN on agar and James T. 2011; =Archaeorhizomycetales Roslingand James T. 2011] ●●●●●● interascal tissue. Myceliumpresent or absent; asciproduced from binucleate cells;do not croziersform or ●●●●● TaphrinomycotinaE. O. Eriksson and 1997 Winka parasites(especially on orplants) lic innerlayer, consisting of varyingproportions of chitin and glucans;saprobes, endophytes, lamellatewith thin electron a ding by ding fission;sexual reproduction initiated by of fusion two vegetative cells followedby osporesellipsoidal hyaline,to globose, aseptate; anamorph unknown; saprobic; infound ar largear subunit rRNA). Synonymous to "Soil Clone Group1 (SCG1)". Schizosaccharomyces Pneumocystis Archaeorhizomyces

Spegazzini1881[=Neolectomycetes Eriksson and 1997;Winka Neolectaflavovirescens

P.Delanoë and Delanoë 1912 [=PneumocystidalesE.O. Eriksson ormed binucleatefrom cellsundergo karyogamy, meiosis,and one .

-

denseouter layer and a relativelyelectrontransparentthick Roslingand JamesT. 2011 [=ArchaeorhizomycetesRosling

Pneumocystiscarinii

Lindner,1893 [=Schizosaccharomycetaceae Beij. ex Klöcker hen forming.

ascus; karyogamyand meiosis occur within the s reserved. .

.

- walled,irregularly shaped, uninucleate,

egetative cells cylindrical, - walled,walls in iodine;blueing rewalls are deposited

This article isprotected right by All copyright. ascosporesaseptate or septate, sometimesbecoming brown andornamented;anamorphs ascithick peridiumthin As [=ArthoniomycetesO. E. Erikssonand 1997] Winka ●●●●●●Arthoniales Henssenand Jahns exD. Hawksw. (conidiospores)varied morphology in and pigmentation. absent,or p membrane system;ascospore morphologyand pigmentation varied; asexual statepresent ascosporedischarge mechanism; usually eightascospores surrounded by enveloping fissitunicat crozier,in which meiosis and usuallyone mitotic division occur,becomes theascus; asci absent;ascogonium, ascogenous hyphae, and crosiers present; penultimate the cell of the ascomata discoid,perithecial, bodies;life cycle haploid withdikaryotic a stageimmediately prior to sexualreproduction; Myceliumpresent; hyphae filamentous,septate; septa with simple pores and Woronin ●●●●● Eriksson O.E. and 1997 Winka Pichia,Sa Ascoidea,Candida, Cephaloascus, Dipodascus, Endomyces,Lipomyces, Metschnikowia, thickeningsof various types; mostosmotrophic, some species parasiticon animals. withi ascosporesdelimited by envelopingan membrane system(EMS); ascospore wall formed division produceto eitheror eightfour nuclei; cellsundergoing meiosisbecome asci, insingle a c sexualreproduction by fusion of two vegetative haploid cellsor fusionof two haploid nuclei buddingor fission;walls usually chitin lacking exceptaround bud scars; ascomata absent; havingnumerous pores rathertha Myceliummostly absent poorly or developed; hyphae,when present,septate, with septa Winka,1997; = O.E.Eriksson and 1997]Winka ●●●●●Saccharomycetales Kudryavtsev1960[= ErikssonO.E. and anamorph. orgalls lesions; cells bud ascosporesfrom to a yeastform ellipsoidal,eightspored; ascospores developdirectly oftenintoasci, formingpalisade a layertheon host; asci orglobose myceliuminfects host and proliferatesthrough host tissue;dikaryotic cells or mycelium Vegetative myceliummostly absent; ascomata abs and 1997] Winka ●●●●●● Taphrinales Gäumann andC. Dodge W. 1928 [=TaphrinomycetesE.O. Eriksson exudates; fermentationpositive. bilayersofEMS, wall in iodine,blueing

Acceptedcomatausually apothecial, occasionally closed withelongated an poroid opening; Article n bilayersEMS;of ascospores aseptate, colourless or pigmented, often with wall - walled, fissitunicate,blueing in iodine, with orwithout a large apical ccharomyces, Scheffersomyces,Trichomonascus, Wickerhamomyces,Yarrowia. eor not fissitunicate, cylindrical,clavate or saccate; asci frequentlywith Protomyces, Taphrina. ellor within diploid cells, followedmeiosisby and, in some cases,one mitotic roduced vegetativefrom hyphaein athallic or blastic manner;mitospores -

or thick

- walled;interascal tissue of branched paraphysoids in a gel matrix;

cleistothecialor occasionally lacking; antheridium present or Schizosaccharomycespombe na single septalpore; vegetative cellsproliferating by

hyaline,aseptate;biotrophic on angiosperms forming

hyalineor pigmented;saprophytes in sugaryplant s reserved. ent;interascal tissue absent; dikaryotic

and O. E.and O. Eriksson 1986 - like, monokaryotic,saprobic .

dome;

This article isprotected right by All copyright. distribution,terrestrial, habitat usually boggyand mossy. bla clavate,inoperculate, thin hymeniumstipe; surface continuesblack, with stipe atearly development stage; asci furfuraceous; Ascomatascattered to gregarious, capitate, stipitate;stipe cylindrical,smoothblack, to Wang etal. 2009; GeoglossomycetesZheng et2009] al. Wang ●●●●●● Corda1838, emend. Schoch et al. 2009 [=Geoglossales Zheng Sclerococcomycetidae (Sclero Eurotiomycetidae (Eurotiales, Onygenales),Mycocaliciomycetidae (Mycocaliciales), (Chaetothyriales,Pyrenulales, Verrucariales), Coryneliomycetidae (Coryneliales), animalsand ra Sclerococcomycetidae.Important industrially medically; and saprobic, pathogenic on Chaetothyriomycetidae, Eurotiomycetidae,Mycocaliciomycetidae and Morphologicallyheterogeneous, circumscribed usingphylogenetic re ●●●●●● E.O. Eriksson and 1997,Winka emend. Geiseret al. 2006 (R) ( Trypethelium Strigulales ( ( Monoblastiales ( ( Botryosphaeriales ( ( Incertaesedis Mytilinidiales,Pleosporales). (Capnodiales, Note hyphomycetousor coelomycetous;saprobes, plantparasites, coprophilous or forming. structures;ascospores mostlyseptate ormuriform, colorless todark brown; anamorphs pseudoparaphyses;or as stromatictissue (ascolocular); interascal tissue present orabsent, of branched paraphysoids Ascomatavariable (apothecial,perithecial, cleistothecial), formedlysigenously from ●●●●●● E.O. Eriksson and 1997 Winka Arthonia,Chrysothrix, Melaspilea, Opegrapha, Roccella, Roccellographa. pycnidial; crustoseforming with algae, green lichenicolous or saprobic plants.on AcceptedValsaria Baggea,Patellaria ArticleEncephalographa Acrospermum, Oomyces ckish hyaline,ckish to septate when mature;paraphyses blackish filiform, to hyaline; global

thatthis group partiallyincludes loculoascomycetes.Containing Dothideomycetidae ), Venturiales), ( Strigulales ), Tubeufiales ( ascigerousportion capitate, club

Dothideales, Dothideomycetes:Containing Abrothalla relyplants,on some lineageslichenized. Chaetothyriomycetidae Monoblastia,Anisomeridium ), Microthyriales), ( ), Phaeotrichales), ( Botryosphaeria, Guignardia,Saccharata ), Superstratomycetales), ( Apiosporina,Sympoventuria, Venturia cicylindrical saccate,to thick ), Asterinales), ( - walled,usually J+, 8

Myriangiales) Tubeufia

coccales). Microthyrium , Phaeotrichum Bezerromyces Asterina

, Pleosporomycetidae (Hysteriales,Jahnulales, ), Natipusillales), ( s reserved. - - shapedto pileate, indistinguishable from spored;ascospores elongate,dark Superstratomyces ), Asterotexiales), ( ), Minutisphaerales), ( ), Stigmatodiscales), ( , Wiesneriomyces - les ( walled,fissitunicate, rarelywith apical

Geoglossum,Trichoglossum

Abrothallus ), Eremithallales), Natipusilla ).

), Trypetheliales ( Asterotexis - Mi delimitationto contain ),Valsariales ), Acrospermales nutisphaera ), Patellariales), Stigmatodiscus

), -

), Laurera, brown, .

),

This article isprotected right by All copyright. septateor occasionally multiseptate, ellipsoidal to fusiform,hyaline pigmented;or Acceptedapicalstructures, usually with iodine an bluewith iodine;ascithin and peridiumfleshy; often notwell Ascomataapothecial, discoid, sometimes immersed,occasionally clavate, stalked,setose, ●●●●●●Lichinales Henssenand Büdel 19 Cudonia,Rhytisma Hyaloscypha,Lachnum, Sclerotinia,Leotia, Vibrissea Microsphaera lichenicolous.Containing Cyttariales ( hyphomycetousor coelomycetous;saprobes or plant parasites, some lichenizedor pig apicalapparatus variable; ascospores aseptate or transversely septate,hyaline or typicallyinoperculate, cylindrical, thin sclerotioid;interasc sessile, frequently sometimesfleshy, hairywithor appendages,occasionally stromaticor Ascomataapothecial, discoid, cleistothecial, elongated or rarelyabsent; apothecia stalkedor ●●●●●● E.O. Eriksson andWinka 1997 Incertaesedis Pertusariales,Sarrameanales), Umbilicariomycetidae (Umbilicariales). Teloschistales),Ostropomycetidae (Arctomiales, Baeomycetales,Hymeneliales, Ostropa (Caliciales,Lecanorales, Lecideales, Leprocaulales, , Rhizocarpales, some saprobic.Containing Acarosporomycetidae Article(Acarosporales), Lecanoromycetidae algae,with thallus foliose, fructicose,crustose or occasionallysome absent; lichen pigmented;anamorphs pycnidial where mostly known; lichen withforming protococcoid ascospor apicalocularchamber; ascus wallsand thickened apex often stains bluewith iodine; ascinot fissitunicate,but thick apices,often with pigm a occasionallyevanescent; interascal tissue of simple branched or paraphyses swollentheat Ascomataapothecial, discoid, perithecial or elongated, sometimes stalked immersed,or ●●●●●● E. O. Eriksson and 2001 Winka ContainingLaboulbeniales, Pyxidiophorales. hyphomycetous,spermatial; ectopa two thin ovoid,thin haustoriumpresent; ascomata perithecial, surrounded by complex appendages, translucent, Myceliumabsent except in Pyxidiophorales;cellular thallus hyaline dark,to with basal ●●●●●● Engler 1898 mentedand longitudinally slightly asymmetrical; anamorphs occasionally present, - - celled,hyaline, elongate, one end modified as attachment to host; anamorphs walled,evanescent, maturingsequentially, usually with ascospores; four ascospores esone to severalseptate, occasionally, multiseptate, rarely plurilocular,hyaline or - walled;interascal tissue abs ,Oidium, Podosphaera

Lecanoromycetes:Candelariales ( ), and), ( altissue of simple paraphyses absent;or peridium thin ented orented iodine - walledo - walled,withthickened, a cap r apically r thickened,not fissitunicate,without well - defined; interascal defined; tissue varied; hymenium often stains rasiticinsects,on some maycoprophilous.be ), Helotiales), ( - Cyttaria walled,not fissitunicate,occasionally with apicalpore; - ent;asci fewandnot basal, fissitunicate, clavate, Thelebolus,Antarctomyces - stainingouter gelatinizedlayer; ascospores one staining epithecium;hymenial gel often present;

86[= Reeb et2004]al.

), Erysiphales), ( s reserved. Candelaria,Candelariella Botryotinia,Bulgaria, Dermea, ), ), (

- likeapex, often withinternal an Blumeria,Erysiphe, ).

Ascodichaena, - )

walled;asci

icolous, - defined defined - les, This article isprotected right by All copyright. ascomata;ascomata perithecioid, solitary, u Thallus comprisedof finehyphae loosely associated with Cyanobacteria anddeveloping CollemopsidiomycetesTedersooet al. 2018] ●●●●●● XanthopyreniaceaeZahlbr. 1926 [=Collemopsidiales Pérez Pisorisporiales ( Lulworthiales ( Incertaesedis Lasiosphaeria,Neurospora, Sordaria ( Vialaea Phyllachorales ( ( Pleurostoma rRNAsequences, containing Boliniales ( Definedusing molecular phylogenetic methods,by a parsimony comparison ofsmall subunit ●●●●●● E.O. Eriksson and 1 Winka Sarcosoma,Tuber Glaziella Helvella,Karstenella, Morchella, Peziza, Pyronema,Rhizina, Sarcoscypha, mycorrhizal. wheresaprobes known; soil,ondead wood dung; or some aseptate,hyaline darklyto pigmented, smooth or ornamented;anamorphs hyphomycetous, ascosporesexcept in cleistothecialspecies; ascospores usuallyellipsoidal or globose, with operculumor vertical slitexcept in cleistothecialspe cleistothecialspecies, thin (paraphyses);asci not fissitunicate,usually elongated, cylindrical more but or less inglobose carotenoidsas bright colours dark,to sometimes present;interascal tissuepresen Ascomataapothecial or cleistothecial,usually visible with unaided eye,leathery or fleshy; ●●●●●●Pezizales Schröter J. 1894 [= E.O. Eriksson and Winka1997] oftenweton wood. cylindrical,hyaline, often aseptate; anamorphs hyphomycetous where known;saprobic, fissitunicate,apex truncate, with apical J rings, often at forked base; the ascospores min simple paraphyses,usually with knob Ascomataap and Baral2003] ●●●●●● OrbiliaceaeNannfeldt 1932 [=Orbiliales Baralet2003; al. =OrbiliomycetesEriksson often gelatinizedthalli. anamorphspycnidia AcceptedKathistes, Ophiostoma Barrina,Coniochaeta Article ), Magnaporthales ), ( ), Chaetosphaeriales), ( Ascobolus, Ascodesmis,Caloscypha, Carbomyces, Chorioactis, Discina, othecial,small, waxy, translucent or lightly pigmented; interascal tissue of

Lindra,Lulworthia, Spathulospor Sordariomycetes:Koralionastetales (

Pisorisporium Phaeochora,Phyllachora .

Halorbilia l; lichenizedl; with cyanobacteria forming crustose, fruticoseor foliose ), ( Gloeoheppia, ), Sordariales), ( - walled,lackingobvious apical wall orthickening apicalapparatus, Gaeumannomyces,Magnaporthe, Ophioceras , ), Trichosphaeriales( Orbilia Chaetosphaeria,Melanochaeta

. ). Heppia -

like apices, unitedby a matrix;asci minute,not Cryphonectria,Diaporthe, Gnomonia,Melanconis,

Annulatascus,Cephalotheca, Chaetomium, Bolinia, Camarops ), Pseudovalsa,Schizoparme, Sydowiella, Valsa, nilocular,with carbonized a to hyalineexciple; ,

Lichina,Peltula s reserved. a ), Meliolales ( Trichosphaeria Koralionastes,Pontogeneia 997 (R) cies, forciblydischarging

), Calosphaeriales), ( species hypogeousand .

Armatella,Meliola

). ), Coni),

- Ortegaet2016; al. ochaetales ), Ophi Calosphaeria, ), ), ostomatales t

ute, This article isprotected right by All copyright. Accepted(Geastrales, Gomphales,Hysterangiales, Phallales). Amylocorticiales,Atheliales, Boletales, Jaapiales, Lepidostromatales),Phallomyc perforateor imperforate. Theleast Fruitin ●●●●●● Doweld 2001 dominanceof glucoseand presenceof xylose. aWith type B secondary structureof 5SRNA; the a cellwall carbohydrate compositionwith ●●●●● Doweld 2001 (rusts),animal pathogens, non pores;septal pores occluded bya plug; centrosome multilayered; manyplantare pathogens laterally;cell wall with parenthesome xylose; pore absentcaps but with microbodies atseptal (phragmobasidia);metabasidia typicallytransverse compartment(holobasidia); holobasidia remainwhole or fragmentat septation after meiosis bymeiosis inseparate a compartment(metabasidia), but in someit occurs samein the groups;mycelial yeastor states; karyogamytypically in probasi ;clamp connectionspresent in hyphaeatbaseor of basidia some in (parenthesomes homothallism); cellwall with xylose; septa with swellingn basidiaon nucleifrom thathave notundergone karyogamyand meiosis (secondary asexualreproduction mayoccur throughproduction of conidiospores or via sporesproduced one ormore mitoticdivisions and migrationof the nucleiintothe of parent the mycelia remain pairedbut not fused; karyogamyquickly followedby meiosis, compatible myceliaopposite of mating typesresults in adikaryotic myceliumin which nuclei longitudinally,typically with fourspores per basidium but ranging onefrom to eight; fus Articleproduceda in fertilewith layer orwithout fleshysporocarp; basidia wholedivided or Mycelium ●●●●Basidiomycota R. MooreT. 1980 Contains Symbiotaphrinales, Xylonales. based6on loci phylogeny (nucSSU, nucLSU, mitSSU, 5.8S, RBP1, and RPB2). contained bythe superclass ‘’ (BS: 100%;PP:1) sensu Schochet al. (2009); Stronglysupported as a separateclass within thePezizomycotina 100%; (BS: PP:1) and ●●●●●● Xylonomycetes R. Gazisand P. Chaverri 2012 photobionts. with crust conidiogenesisphialidic; conidia bacilliformto ellipsoid; lichenized and lichenicolous fungi gelatinousperispore usually present;conidiomata pycnidial; conidiogenous cells cylindrical; hyaline(rarely brownish matu in fissitunicate,with ocular chamber,ovoid tosubcylindrical, usually stalked; ascospores branched andanastomosing, often irregularly thick, net g bodies hymenomycetousor gasteroid;basidia two ose,epilithic or endolithic, or lichenicolous andforms Cyanobacteria as present,but some withyeast a state primarilyin the Tremellomycetes;basidia Collemopsidium,Xanthopyrenia -

multilayeredendoplasmic reticulum)usually present, elaborate in - patho respecimens), oblong ovoidto - inclusive cladecontaining Agaricomycetidae (Agaricales, genicendophytes, and rhizosphere species.

s reserved.

lywith septate basidiosporeborne

-

like physes;ascibitunicate,

ear pore;ear septal pore caps -

to eightto - diumor teliospore, followed fusiform,1

developing basidiospores; - spored;parenthesomes - septate,with Xylona. etidae

ionof This article isprotected right by All copyright. symplechosomes.With 2006] ●● Spiculogloeales ( intranuclear.Containing Agaricostilbales ( microbodies,nucleoplasmic spindle colacosomes, teliospores,curved h withoutassociated microbodies,aseptate basidiospores during germination andno Dimorphic,nonphytoparasitic, with fucose ascell wall carbohydrate component,septal pores ●●●●●● R. Bauer et al. 2006 (rusts),animal pathogens, non pores;septal pores occluded bya plug; centrosome multilayered; manyplantare pathogens laterally;cell wall with parenthesome xylose; pore absentcaps but with microbo (phragmobasidia);metabasidia typicallytransversely with septate basidiosporeborne compartment(holobasidia); holobasidia remainwhole or fragmentat septation after meiosis meiosisin aseparate compartment (metabasidia),but in someoccursit in same the Mycelialyeastor states; karyogamy typicallyin probasidiumorteliospore, followedby ●●●●● Bauer R. et al. 2006 [=Urediniomycetes Swann and Taylor1995] ( Mrakia parenthesomessacculate orabsent. Containing Cystofilobasidiales ( Dimorphic fungi; fruiting bodies gelatin ●●●●●● TremellomycetesDoweld 2001 Cerinomyces,Dacrymyces Fruitingbodies gelatinous;basidia furcate, rarelyunisporous; parenthesomes imperforate. ●●●●●●Dacrymycetales Hennings1898 [=DacrymycetesDoweld 2001] ( (Hydnellum,Sarcodon), Lactarius,Peniophora, Ru Phanerochaete,Phlebia, Polyporus, Sparassis, Trametes), (Hymenochaete), (Corticium, (Botryobasidium,, Ceratobasidium, ,Hydnum, Tulasnella), Incertaesedis Sirobasidium Tremellodendropsis

Accepted●●●●Atractiellales Oberwinklerand Bandoni 1982[= R. Baueret al. Article

), Filobasidiales ), ( Punctularia), ,

Agaricomycetes:Auriculariales Syzygospora,Tremella Mycogloea,Spiculogloea Polyporales ) .

Filobasidium Atractiella,Phleogena, Saccoblastia Trechisporales Gloeophyllales ssula), .

(Antrodia,Coriolopsis, Donkiopora, Ganoderma,Lentinus, - pathogenicendophytes, and rhizosphere species. Sebacinales olobasidia,and radiateconidia; septal pores without - pole body(SPB) separation, metaphasic SPB ), Holtermanniales ), ( ). ous orous absent; basidia septate ornonseptate;

(Trechispora)

(Gloeophyllum), Agaricostilbum,Chionosphaera ).

s reserved. (Auricularia,Exidia, Hyaloria), (Piriformospora,Sebacina),

and Tremellodendropsidales Holtermannia

Hymenochaetales Russulales .

Cystofilobasidium, ), and), Tremellales

(Heterobasidion,

) and Thelephorales

Cantharellales dies atseptal

Corticiales

This article isprotected right by All copyright. (nanometer Characterisedby teleomorphic members that maytremelloidform haustorialcells =Spiculogloeomycet ●●●●●●Spiculogloeaceae Denchev 2009[=Spiculogloeales R.Baueret 2006;al. Pucciniastrum,Pucciniosira Mikroneg Pucciniales ( ( aWith metaphasic intermeiotic SPBduplication. ContainingHelicobasidiales ●●●●●● R. Baueret cells. With multinucleatehyphae and multiple sporesproduced simultaneouslysporogenouson MixiomycetesBauerR. et al. 2006] (M) ●●●●●● ( ( colacosomefrom colacosomesWith and septal pores without microbodies;with colacosomesand taxa derived ●●●●●● R. Bauer et al. 2006 Erythrobasidiales ( metaphasicSPBs intranuclear. Containing Cys cellWith wall carbohydrate compositionwithout fucose; cytoplasmic SPBseparation; ●●●●●● R. Bauer et al. 2006 With microbodies. =Cryptomycocolac Bauerand R. 1990; =Cryptomycocolacales Oberwinklerand R. Bauer 1990; ●●●●●● Jaculispora septalWith pores a ●●●●●●Classiculales R.Baueret 2003al. [= R. Bauer al. et 2006] Microbotryum,Ustilentyloma Heterogastridium AcceptedHelicobasidium Article Mixia osmundae. Mixia Cryptomycocolax eria, Nyssopsora,eria, Ochropsora,Phakopsora, Phragmidium, Pileolaria, Puccinia, . -

fusionmycoparasitism). Coleosporium,Cronartium, Dasyspora, Diorchidium, Melampsora,

Kr ), Pachnocybales ), ( amer1959 [=MixiaceaeKramerC.L. 1987; =Mixiales R. Baueretal. 2006; fungi; metaphasicSPBs intranuclear. Containing Heterogastridiales ), Leucosporidiales), ( Cryptomycocolaxabnormis omycetesR. Bauer et al. 2006] (M) Bannoa,Erythrobasidium ssociatedwith microbodies and tremelloid haustorialcells. esQ.M. et al. 2015] Wang

Oberwinklerand R. Bauer1990 [=Cryptomycocolacaceae Oberw. ), and), Septobasidiales ( ), and), Sporidiobolales ( Pachnocybe Spiculogloea. Leucosporidiella al. 2006al.

), and), Naohideales ( . s reserved.

tobasidiales ( ), Platygloeales (

Auriculoscypha,Septobasidium Rhodosporidium,Sporidiobolus

, Mastigobasidium

Cystobasidium Eocronartium,Platygloea Naohidea ), Microbotryales), ). ),

Classicula, ). ).

), This article isprotected right by All copyright. wholefrom blueB(DBB) reactions are positive;coenzyme Q present;sugars are fermentedby most species; nitrate isassimilated; urease anddiazonium dolipores witharch an of endoplasmic reticulum,but ‘micropore’ chlamydospores maybe present;cell walls are multi form terminallytrueonhyphae disarticulate that with artroconidia;pseudohyphae and Colonies smooth are or velvety, greyish toolivaceous black; budding cells ellipsoidalare =Moniliellales Q.M. etal. 2014;Wang, =Monilielliomycetes Q.M. et 2014]al. Wang (M) ●●●●●● Malassezia furfur. coenzyme Q aresugars not fermented,urease anddiazonium blueB (DBB) reactions positive;are wallcorrugated with a groove spiralling thefrom bud site;lipid dependent lipophilic;or enteroblbase, Cells Denchevand R.T. Moore 2009;=Malasseziomycetes Boekhout et al. 2014] (M) ●●●●●● ( (Golubevia Georgefischereriales ( ( ( localWith interaction zones andnointracellular hyp ●●●●●● Begerow al.et 2007 pores;swellings absent septal at pores except in wallcarbohydrates dom parasitescausing rustsand smuts; meiosporesproduced septate on oraseptate basidia; cell Mycelialparasiticin the andphase, many with saprobicyeast or ballisticonidial plantstates; ●●●●● Bauer R. et al. 2006 dependens whorlsconidiaand bear a on dematiaceousand subhyaline dematiaceousto sympodial conidiogenous cells thatoccur in With multinucleatehyphae, simple poresepta, conidiophores are that subhyaline to Aime andSch ●●●●●● AcceptedRobbauera ArticleEntyloma Ceraceosorus

globose,ovoid cylindrical; or Moniliella Malassezia Tritirachium ), Exobasidiales), ( ), Microstromatales), ( -

cellhydrolysates; sexual morph unknown. ), Tilletiales ( - 9 is xyloseformed; inabsent whole ell2011; =TritirachiomycetesAime and Schell2011] (M) asticand percurrent;cell wall multi ),Doassansiales (Do

Stolk Stolk and Dakin,1966 [=Moniliellaceae Q.M. etal. Wang 2014; Baill. 1889 Baill. [=Malasseziales MooreR.T. 1980; =Malasseziaceae Limber Eballistra, Georgefischereria, Gjaeru inatedby glucose;xylose absent; parenthesomes atabsent septal Tilletia Kordyana,Laurobasidium, Exobasidium, Graphiola

1940[=Tritirachiaceae Aime andSchell 2011; =Tritirachiales n elongatedrachis; teleomorphnot known. ). Microstroma, Quambalaria,Volvocisporium

budding assansia,Melaniella, Rhamphospora

typicallymonopolaraon more lessor broad s reserved.

- -

- Tilletia cellhydrolysates; s lamellate,and inner the layerthecellof 9 ispresent;xylose and absentfucose halcoils.Containing Ceraceosorales - lamellar;hyphal septa typicallypossess Moni ; centrosomes ; globose,unlayered.

mia, Tilletiariamia, liella acetoabutans - like st exualmorph ructures mayalso be

Tritirachium ), Entylomatales ), Golubeviales), )Robbauerales . ),

unknown.

and

This article isprotected right by All copyright. Oedogoniomyces,Telasphaerula. oogonia. antherozoids producedin antheridia andnonciliated female gametesproduced within uniciliatedcellsautospores or while sexualreproduction is oogamous via of fusion unici mitosis;aerobic and anaerobic; asexual reproduction occurs via productionof posteriorly MLC;Golgi app around nucleus; the fenestratedcisterna (=rumposome) adjacent to the microbodyin the kinetosome; microtubules radiating anteriorly striated the from disc; ribosomalaggregation centriole parallel ciliatedto the unbranched thallus,often withbasal aholdfast. Zoospores ovalpossessing non a Thallus epibiotic, filamentous (hyphalor rhizomycelial),either extensive or a simple ● heat resistant. pore swellingwith electron an morphssometimes produced; species havedolipore a septumthatis electron not forciblydischarged, and brown at maturity;arthroconidial and/or yeast oneither the basidium or the swollen primary cell;basidiospores symmetricalsterigma,on swollenfrom ba Xerotolerant;basidiomata notproduced in culture;basidia arising somaticfrom hyphae or 2013;al. =Geminibasidiomycetes H.D.T. Nguyen and Seifert 2015] ●●●●●● GeminibasidiaceaeH.D.T. Nguyen et al. 2013 [=Geminibasidiales H.D.T.Nguyen et vertically. electran reticulumthat form theseptal pore cap; septal pore capsometimes absent; septal porehas dolipore septawith adseptaltubular extensions thatarise sheetsfrom of endoplasmic Xerophilic;produ al.et 2005; = Zalaret al. 2005] (M) ●●●●●● pore, the barrel conidiogenesisbasauxic; hyphal unbranched orsympodially proliferating, continuous with conidiogenous cells,smooth; Conidia arthrospore ●●●●● Wallemiomycotina Doweld 2014 Sporisorium,U Thecaphora,Melanotaenium, Urocystis enlargedWith interaction zones. ●●●●●● R.Baueret 1997al. ●

Accepted●MonoblepharidomycetesJ.H. Schaffn. Article on Wallemia Gonapodya,Harpochytrium, Hyaloraphidium, Monoblepharella, Monoblepharis, Wallemia ichthyophaga.Wallemia - densenon

Geminibasidium. stilago - aratuswith stackedcisternae; nuclear envelope fenestrated atpoles during sidium shaped, dolipore cebasauxic andanamorphs do produce not basidiomata in culture;with

Johan - like,verruculose, short cylindrical,becoming spherical; conidiophores ). - -

bearingcells (primary cells) with basal a lateralprojection occurring membranousseptal pore occlusion and striations thatare oriented - Olsen1887 [=WallemiaceaeR.T. Moore 1996;=Wallemiales Zalar - dense membranousseptal pore occlusion; some species are kinetosome with a striateddiscpartially extending around the

- ContainingUrocystales ( septa withsepta single a pore, flaring outnear the periphery of like.

) and ) Ustilaginales (

1909 s reserved.

Doassansiopsis,Floromyces, Anthracoidea, Ustanciosporium,

- like asexu - denseat the - ciliated al liated This article isprotected right by All copyright. layeredspore wall; wall subtending of hyphae continuous with thespore walland coloured spore clustersor occasionallyor in other roots, or subterranean structures such as rhizomes,either singly,in Spores byblastic expansion of hyphal the tip or intercalarily in formed hyphae, either in soils ●●●●●● J.B. Morton and Benny 1990 Gigaspora,P sporeto the base;spores with 1 hyphae,sometimes with conspicuous a colourchange distant septumto the mostproximal andwalls inner that spores with up tothree walls wallor groups: multiple layeredouter wall, and hyaline middle Spore formation byblastic expansion hypha of (chlamydosporic),or sometimes with complex ●● mycorrhiza. intrahyphallystalkin the sporiferous of saccules, arbuscularforming or vesicular sporogenouson structures, orlaterally centrallyor within sporiferous a saccule or loosespored to compact sp onor the surface of soils or sometimes in eitherroots, singly, in spore clustersor multiple Glomoid chlamydospores formedterminally, subterminally intercalarilyor hyphae,in either in ●●●●●Glomeromycetes Cava Geosiphon species vesicularform arbuscular or arbuscular mycorrhiza. betweenand plants fungi, fungalspores mayhave two morphs,but often onlyone isknown; Known to form with roots plant orthalli, Sieverdingal.et 2011] ●●●●● C. and Walker A. Schüßler 2001 [=Archaeosporomycetes centrioles,conidia, and airborne spores. complexspores with multiple w vesicles;withoutcilium; presumedasexual spores outside or within roots host; of some Filamentous;primarily endomycorrhizal, forming arbuscules in roots,sometimes with ●●●● Glomeromycotina (C. and Walker A. Schüßler) 2016 involve chlamydospores andsporesproduced in sporangia and sporangioles. include zygosporeproduction by gamet Glomeromycotina.Characters associated with sexualreproductive states, where known, Theleastinclusive cladecontaining , Mortierellomycotina, and Moreaupro 1954,parte] (R) Mucoromycota ●●● Doweld 2001emend.

Accepted●●●● C. and Walker A. Schüßler 2001 Article .

acispora,Racocetra, Scutellospora multiple

may ofbe several components or layers; spores with subtending

- spored;sporocarps loose tocompact, with a mono orocarps,on subtending hyphae: complex multi

lier all groupings,all others simple (blasticchlamydospores); without - 3 walllayers; pore rarely open. - Smith 1998,emend. Oehlet al. 2011 angialconjugation. Asexual reproductive can states

Spataforaand S s reserved. .

or withor cyanobacteria;if symbiosisoccurs

tajich 2016[ F. Archaeospora,Ambispora, Acaulospora,Diversispora,

-

- walledspores

to - - multiple arbuscular - This article isprotected right by All copyright. AcceptedPilobolus Choanephora opposedsuspensors. Traditionalsubdivisions artificial. merosporangia,sporangiola, orsporangium; reproduction byzygosp with plasmodesmataat septal pores; asexual reproduction with one to manyspores in Filamentous, generallysaprotrophic, with exceptions;septa absent except in hyphae; older ●●●●● Fritz1832, emend. Schröter 1897 [=Mucoromycetes D suspensorsproduced in a subterraneansporocarp. Filamentous,hyphae coenocytic; saprobic and ectomycorrhizal; zygospores with apposed ●●●●● Moreau exK.R. Benjamin 1979 [ suspensors. reproductionby more orless zygosporesglobose formedon opposed or apposed merosporangia,or rarely by chlamydospores, arthrospores, or blastospores; sexual thatcontain micropores at maturity;asexual reproduc ectomycorrhiza;mycelium branched, coenocytic whensometimes young, producingsepta Saprobes,or rarely gall ●●●●Mucoromycotina Benny2007 rhizoids onlyoccasional; giantcells absent; zygospores naked. terminate with sporangiola;spores globoseto ellipsoid irregular, or smooth ornamented;or absent;ramifications gracilous, reproductionvia sporangia andsporangiola;sporangia spherical, multi Articlesporangiophore apex,erect, coenocytic initially, irregularily but septated at maturity; asexual sporangiferous,sporangiophores basall Myceliumwith anastomosinghyphae, dichotomously branching,bearing stylospores;hyphae =Mortierellomycota Tedersooet al. 2018] =Mortierellomycotina Kerstet al. 2011; =MortierellomycetesDoweld 2014; ●●●● A. Fischer1892 [ Caval cilium;without centrioles, conidia, and aerial spores. formedin soil,sometimes within rootsor other host tissue,sometimes with vesicles;without Endomycorrhizal, forming arbuscular mycorrhiza;asexual spores =Paraglomeromycetes Oehlal.et 2011] (M) Redeckerand D. 2001; = C. and Walker A. Schüßler 2001; ●●●●●● Funneliformis, Glomus, Rhizophagus,Sclerocystis, Septoglomus shap same the asor slightly lighter than orit hyaline to subhyaline; subtending hyphaefunnel ed, cylindrical ed, or constricted; arbuscularforming mycorrhiza. Paraglomus , Radiomyces

, Cunninghamella,Lentamyces

J.B.Morton and D. Redecker 2001 [=Paraglomeraceae J.B. Morton , - Saksenaea forming,non

primarilyhorizontally expanding, erecting hyphaesometimes

, - Syncephalestrum haustorial, facultative mycoparasites,or forming yinflated and elongating towardsthe

, s reserved. Lichtheimia Endogone,Sphaerocreas Paraglomusoccultum tionby sporangia, sporangiola, or . =EndogonomycetesDoweld 2014]

Backusella

, Mucor ier - Smith 1998; .

,

(chlamydospores)usually Claroideoglomus, , Mycotypha Chaetocladium ore,typically with - spored;columella oweld 2014] (P) . .

, .

Phycomyces , -

, This article isprotected right by All copyright. Accepted sporangia, merosporangia,conidia, and c gametangialconjugation. Morphologies associated with asexualreproductive include states .Sexual reproduction, where known,involves production the of zygospores by Theleastinclusive cladecontaining Entomop Moreaupro 1954,parte] Zoopagomycota ●●● Gryganskyi, M.E. Smith, Spatafora andStajich 2016 [ZygomycotaF. Olpidiumbrassicae. micro parallelcentrioles linked nucleusto by shared, tapering,striated rhizoplast;no root sporangiumsingle, endobiotic; nucleus associated withbasal the body, no nuclear cap;two and vesti generallywithsingle a coneglobule, Thallus monocentric,holocarpic or eucarpic, with hyphae; no zoospores posterior,uniciliate, Tedersooet al. 2018] (M) Smith 2013; OlpidiomycotaDoweld =Olpidiomyco 2013; ●●● Piromyces Cyllamyces,Feramyces, Neocallimastix, Oontomyces, Orpinomyces, Pecoramyces, envelope isretainedduringmitosis. around nucleus, the forminga posterior unikont fan; kinetidand without props; nuclear Articlea skirt,strut, spur,and circumary ring, microtubules stretching from spur the and radiating origin;uni environments;asexual reproduction; mitochondria absent; ofmitochondrial largerherbivorous mammals and possibly in other terrestrialand aquatic anaerobic Thallus monocentricor polycentric; anaerobic fermentative, infound digest 2007] 1993, =NeocallymastigacetesM. J.Powell 2007,Neocallimastigomycota = M.Powell J. ●●● oftenabundant in culture.Sexual reproduction is unknown. polyhedraland pigmented likesporangia. Chlamydospores are filledwith oilglobules an and withwithout or conspicuous columella.Sporangiospores are globose,ellipsoidal, or verticillate sporangia and chlamydospores.Sporangiophores may be branched in a cymoseor Theleastinclusive cladecontaining the genus Tedersooet al. 2018] ●●●●●Umbelopsid Olpidium Neocallimastigaceae1983, Heath emend. Barr 1989 [;=Neocallimastigales J.L. Liet al. tubulesor dictyosome; side

gial kinetosomes, gamma - . fashion. Sporangiafashion. are typicallypigmented orred ochre, multi

and multiciliatedzoospores with a kinetosome

(A.Braun) Rabenh.1868 [= J.Schröt. 1889; =Olpidiales Cavalier ales Spatafora,Stajich andBonito 2016 [=Umbelopsidomycetes

- bodycomplex lacking; pathogens of terrestrialplants. - likeparticles andrough endoplasmic reticulum; Anaeromyces,Bu - shaped striated rhizoplast tofused both the functional hlamydospores. hthoromycotina,, and s reserved. Umbelopsis wchfawromyces,Caecomyces, tinaDoweld =Olpidiomyceta 2013;

-

associated . Asexual . reproduction by Umbelopsis. complexincludes that

-

or singleor iveof system - spored d - This article isprotected right by All copyright. Accepted●●●●Kickxellomycotina Benny2007 Rhopalomyces,Sigmoideomyces, Stylop zygosporesglobose with apposedsuspensors. amoebae;asexual reproduction by conidia ormerosporangia; sexual reproduction by Filamentous,hyphae co ●●●●Zoopagales Besseyex BenjaminR.K. 1979[= Benny2007] controlledat (3) duringinterphase. Nuclear numbers in vegetative cellsand conidia are lowand apparently sizedchromosomes that condenseduring mitosis a centon Differs Basidiobolomycetesfrom and Entomophthoromycetes by vermiform, moderately 2012;=Humber Neozygitales Humber2012] ●●●●● secondaryform conidia. reproductionby conidia formedby blastosporogenesis; conidia forciblydischarged and often reproductionby thick Filamentous,primarily withoutsepta; ●●●●● G. 1880 [=EntomophthoromycetesWinter Humber 2012] Basidiobolus ranarum from cytoplasm the by a layer nuclear of Article and cytoplasmic membrane fragments. centrioles) not but not always locatedat the spin Mitosesinvolve barrel μm ≥10 long)with large a central nucleolus thatisthe major feature ofuninucleate cells. Differs Entomophthoromycetesfrom and Neozygitomycetes by unusual (M) ●●●●● withoutprior gametangialconjugations. gametangia fromdifferent with thickbi possible meansor passively dispersed;secondary conidia produced. often Resting spores Primaryspores trueconidia, uni cystidiashape; or rhizoids formedby some taxa. Conidiophores branchedor unbranched. multinucleate hyphalbodies; protoplasts either hyphoid amoeboid or andchangeable in mycelium,coenocytic or septate,wal occasionallyfacultative parasitesof . Somatic state consistingof a well Obligate pathogensof animals(primarily arthropods), cryptogamic plants, or saprobes; ●●●●Entomophthoromycotina Humber2007

Neozygitaceae Basidiobolus - layeredwalls asform zygospores after conjugations of undifferentiated - 4 - (5).

- Eidam1886 [= Doweld 2001emend. Humber 2012] walledzygospore, strictly homothallic, where known; asexual . -

Neozygites shapedspindles, mitoticorganelles incorporating microtubules(but Ben enocyticseptate;or parasites ofsoil ,fungi, and Ancylistes,Completoria, Entomophthora,Meristacrum.

or same the hyphal bodieshypha or oras azygospores arising - Ze’ev,KennethR.G. and Uziel1987 - , . pluri

led or protoplastic,ledor which may fragment to form mostlyparasites ofinsects, mites, and spiders; sexual - , or , multinucleate, forciblydischarged bydiverse

age

.

s reserved. Amoebophilus,Piptocephalis, dleand poles, the nuclear content isolated

ral metaphase platebut uncoil

[=Neozygitomycetes ly nucleilarge (often

- defined defined

This article isprotected right by All copyright. m single nucleuseccentric, with internalchannels where microtubular triads pass; central core;axopodia supportedby triads of microtubules, bearing ellipsoid ; Ac Microheliella Incertaesedis DIAPHORETICKES Martensella,Martensiomyces, Spirodactylon, Spiromyces mycoparasit unisporedsporangiola (merosporangia) produceda on sporocladium; saprobic or Filamentous;hyphae possessing septa withlenticular a cavity; asexual reproduction by ●●●●●Kickxellaceae Linder1943 [=Kickxellales Kreiselex K.R. Benjamin 1979] prev sexualreproduction by conical biconicalor zygospores. Note that this groupincludes taxa lenticularcavity; asexual reproduction occurs by lateral elongate monosporous trichospores; filamentousthallus d Endosymbiontsof freshwaterarthropods with basalcell attached host,to the whichfrom a ●●●●● Lichtwardtand Manier 1978 Tieghemiomyces h bisporous merosporangia;sexual reproduction by a zygospore, often ornamented; obligate Hyphaeregularly septate; septa containinga lenticular cavity; asexual reproduction by ●●●●●Dimargaritaceae BenjaminR.K. 1959 [= R.K. Benjamin 1979] aquatic,and marine isopods,as well as springtails. cellsthatdisarticulate from corresponding the thallus; in digestive the tractsof terrestr Kickxellomycotina with branchedfilamentous, thalli; asexual reproduction by arthrospore and Lichtw. ●●●●● Manierex Manier a reproductionby zygospores thatare globose,biconical, or allantoid andcoiled. asexualproduction by1 unbranched,or regularly septate; septawit fungias a haustorial parasite, orbranched, septate, subaerial hyphae; myceliumbranched Saprobes,mycoparasites, or obligate symbionts; thallus arising afrom holdfast otheron austorialparasites of especiallyfungi, Mucorales. itochondrialc

Acceptediliated,centra Article iouslyreferred asto trichomycetes. 1968] ic,isolated soilfrom and dung.

Cavalier

Diaphoretickes: ristaetubular; cortical filogranular network. lcentrosome with two concentric shellsdense of materialdenseand a .

evelops;hyphae septate, with orwithout branching; septa contain a Adlal.et - Smith 2012(M) -

or2 - spored merosporangia,trichospores, or arthrospores; sexual

2012

nd Lichtwardtnd 1978 [=Asellariaceae ManierManierex Harpella, Orphella,Smittium, Zygopolaris. h median, disciformh median, cavities containingplugs; Coemansia,Dipsacomyes, Kickxella, Linderina, s reserved.

Dimargaris,Dispira, Spinalia, Asellaria,Baltomyces, Orchesellaria

.

Microheliella maris .

ial, . -

like This article isprotected right by All copyright. Cyanoptyche cellulosicwallcell except phycobiliproteins andotherpigments; ated and nonated species or life cycle stages;without peptidoglycanwall between its two membranes; type chloroplastsofother organisms in likethat, cyanobacteria,it ahas co Unicellularcolonialor algae;plastid in the ofform a cyanelle,which isdistinct from the 1986] ● Glaucophyta Skuja 1954[Glaucocystaceae 1904 West Glaucocystophyta Kies andKremer mitochondrialcristae; starch storagepr plastidreduced in some; usuallywithwall cell otherextracellularor covering; flat a cyanobacterium;plastid with two membranes withoutperiplastid endoplasmic reticulum; Photosyntheticplastid with chlorophylltype ArchaeplastidaAdl al.et 2005 possiblyonfeeding small viruses colloidalor particles. c Oblong cellseparated in two byofa cleft; picoplanktonic size; marine;without plastid; PicozoaSeenivasan al. et 2013 [Picobiliphyteset Not al. 2007] (M) consistof several genera. beneath cell the theon long cilium;mitochondria with tubular cristae;peripheral vacuoles located just cytoskeletoncomposed layers of of microtubules and microfilaments;tripartite tubular hairs Biciliatedcells withproboscis a TelonemiaShalchian speciesno or genera described. characterized,rare lowabundance organisms, known onlyenvironmentalfrom samples, and Marine andfreshwa RappemonadsKim et al. 2011 with lamellarcristae; characteristic (ancoracyst). anterior;posterior cilium withvane, short and traverses cellalong a groove; mitochondria dense glycocalyx;one pair of heterodynamic cilia; anterior Smallovoid marinecytotrophicpredators smallon protists; cell covered by a thecaand Ancoracysta Acceptedytotrophic;two cilia insertedlaterally; mitochondrion with cristate; tubular heterotrophic, Article

Janouskovec2017 etal. , Glaucocystis membrane; not observed. ter 5 ter - Tabrizi2006 – Glaucocystis 7 µmcells with 2

, Gloeochaete

- likestructure locatedat ciliary the pole anda complex

(M) .Reported onlyin freshwater. oduct. .

- – a 4 containingchlorophyll

fro s reserved. m an m ancestral primary endosymbiosis with Picomonasjudraskeda

ciliumwith mastigonemesat its Ancoracysta twista - a

Griessmann 1913,may only, with

Cyanop nspicuous hora a . . Poorly .

. .

, This article isprotected right by All copyright. freshwaterhabitats. with nucleusand ER; contains mannitol; reproductionby cell division; inhabiting marineand Unicellular;single highly lobed plastid with eccentricor cent Rhodellophyceae ●●● Cavalier terrestrialareas. carbohydrate;reproduction by cell association with mitochondria andER;cells with floridosidelowas a molecular Unicellularwithsingle a branched orstellate plastid, with orwithout ; Golgi Porphyridiophyceae ●●● S.H. Yoon et al. 2006 historybiphasic if known;inhabiting freshwateror marine environment ordinaryvegetative cells;Golgi Pluricellularwith monosporangia andspermatangia usuallyoutbycut curved walls from Hommersand Compsopogonales ●●● Skuja 1939[ Saunders G. andW. Stylonematales,based on phylogenetic analysis. Clade consistingof Compsopogonales, Porphyridiophyceae, Rhodellophyceae, Proteorhodophytina●● Muñoz acidicand high temperature environments. heterotrophsor obligate photoautotrophs; celldivision endosporeor formation;inhabiting Unicellu MoehnDoweldex 2001] Cyanidiales●● Christensen T. 1962 [Cyanidiophyceae Merola1981,al. Cyanidiophyta et reproductiontypically oogamous;triphasic life historycommon. linkedforms surroundedby perinuclear endoplasmic reticulum; cell wall cellulose;of cells in filamentous poles verybroad; telophasespindle andnuclear envelope persistingwith closedmitosis chromosomaland interzona externalendoplasmic reticulum;cytoplasmic carbohydrate reserve ; chloroplasts,unstacked with ,and chlorophyll microtubularstructu Redalgae without ciliated stages, and without centrioles, or basal bodies, otheror 9 2 + RhodoplantaeSaunders and ●

Accepted Article Rhodophyceae lar, spherical lar, or ellipticalinthick shape; cell wall lack ofor cell wall; facultative

bypit plugs, formedbetween cellsafter incomplete celldivision; sexual

2004] , Erythrotrichia Erythrolobus

Thuret 1855,Thuret emend. Rabenhorst 1863 [Rhodophyta 1901,Wettstein res Dixoniella –

presenceof polar rings instead; two lmicrotubules notconverging towards polar sorings, spindle

, Hommersand2004] emend.Adl et al. 2005 , , - Rhodochaete – Flintiella - Gómez et al.Gómezet 2017 (R) Glaucosphaera Smith1998 [RhodellophytinaCavalier ERassociation; encircling thylakoids in theplastid; life division;inhabiting marine, freshwaterand even moist , Porphyridium Cyanidioschyzon . s reserved. ,

Rhodella

.

.

ric pyrenoid;ric Golgi association , - Cyanidium membraned simple

- . Smith 1998] Boldia, - a only,lacking ,

Galdie

- weight ria

.

This article isprotected right by All copyright. Accepted Batrachospermum Pluricellular;plugspit characterized by two layers. cap ●●●●Nemaliophycidae Christens reproductionunknown. zonatelyirregularlyor divided, apomeiotic, borne in ostiolateconceptacles; sexual branched erect filaments;pit plugs with single a caplayer and membrane; tetrasporangia a basallayer oflaterally adheringbranched filamentsand laterally adher Pluricellularare that crustoseand smooth to tubercular orwith erectbranches; composed of 2004] ●●●●Hildenbrandia Nardo1834 [Hildenbrandiophycidae Saunders G. W. and Hommersand marine environment. carposporophytedeveloping directly thefrom carpogonium or its derivative; inhabiting mostly bearingapical an e tetrasporangia) generallyterminal or lateral on the filaments;carpogonia terminal or lateral, tetrasporophyticphases; reproductive cells(monosporangia, spermatangia,carposporangia, history fundamentallytriphasic formingbranched filamentsin which thecells are linked throughout by pit connections;life Pluricellularwith Golgi Florideophycidae ●●● Cronquist1960 ArticlePseudobangia environment. membranes; typicallyforming conchospores in fertile cellrows; inhabiting mostlymarine divisions;sporophyte filamentous,with pit growth;carposporangia and spermatangiaproduced in packets bysuccessive perpendicular gametophyte macroscopic,initially uniseriate,becoming pluriseriateor folioseby diffuse Pluricellularwith Golgi Bangiales ●●● Nägeli1847 [Bangiophyceae A. 1901]Wettstein Clade containingBangiales andFlorideophycidae,based phylogeneticon analysis. Eurhodophytina●● G.W.Saunders&Hommersand 2004 (R) Chroodactylon monospores;inhabiting freshwater,brackish and marine environment. pyrenoid;Golgiassociation with mitochondria andER; reproductionby cell division or Unicellularpseudofilamentousor or filamentous; various plastidmorphologies with orwithout Stylonematales ●●● K.Drew 1956[Stylonematophyceae Yoon H.S. et al. 200

Bangia . ,

Chroothece , xtension, the trichogyne, whichto thespermatangia attach; Colaconema

, Bangiomorpha – – ER/mitochondrion; growth bymeans ofapical cells andinitials lateral ER/mitochondrionassociation; life Hildenbrandia , Purpureofilum

consistingof gametophytic,carposporophytic, and , en 1978en Entwisleia , .

Boreophyllum

plugs withsingle a caplayer, but lacking , , Rhodosorus Nemalion s reserved. , Dione , Acrochaetium Palmaria ,

Rhodospora historybiphasic, heteromorphic, , Minerva

, Rhodychlya , , Porphyra , Balbiania Bang Rufusia ingsimple or iopsis 6] , , , Thorea ,

Pyropia Stylonema Ballia ,

, .

, .

This article isprotected right by All copyright. Codium,Pithophora, Pseudonochloris, Rhizoclonium free (phyllose),or cushiony formsof compacted tubes;thallus oftenmultinucleate andsiphonous; phycoplastabsent; thallusbe can branched orunbranched, mono calcified;cell division fur by betweenor more 2 microtubules; cilia with scales and rhizoplasts; cellwall moreor less microtubular rootletsin cruciatearrangement, and smallerrootsof twoalternating sizes, Swimmingcells with oneortwo of pairs cilia Ulvophyceae ●●● MattoxStewart & 1984 (P) . Plastidthylakoids single stacked;or glycolatedehydrogenase present; cell division without Chlorophyta●● Pascher emend.1914, Lewis and McCourt 2004 Rubisco smallsubunits encoded the in nuclear genome. structurelinking pairs 9 of microtubules atbasa covering;swimming cells with ciliamultiples in oftwo, rarelyor single cilium, with stellate chlorophyll Plastidwith two membraneswithout periplastid endoplasmic reticulum;p Crane 1997] emend.1982, Bremer 1985, emend. Lewis and McCourt 2004; Chlorobiota Kendrick and ● Halymenia in Gelidiales). receivedpostfertilization the diploidplu nucleus;pit from carpogonium the or carpogonial fusioncell, indirectlyor anfrom auxiliary hascell that Pluricellularwith sexual historieslife generallycarposporophytetriphasic; developingdirectly ●●●●Rhodymeniophycidae G. Saunders&Hommersa W. lackingnaked, andcaps membranes. Pluricellular;carpogonia terminaland sessile; carposporophyte developingoutward; pit plugs ●●●●Ahnfeltiophycidae Saunders G. &W. Hommersand 2004 Sporolithon Mas calcificationin the ofform calcite. plugpit with twolayers cap atcytoplasmic faces, outerdome shaped, membraneabsent; Pluricellular;carp ●●●●Corallinophycidae Le L. Gall& G. Saunders2007 W.

AcceptedChloroplastida Article - tophora livingdiplob , a . , Nemastoma

Melobesia and Acrosymphytum

ionticlife cycle,iso ogonialbranches two b

Adlet 2005al. [ViridiplantaeCavalier ;starch insideplastid; cell wall oftenwith cellulose,or scaly extracellular , , Metagoniolithon Peyssonnelia rowingwith mitoticspindle centric closed, and persistent; , Bonnemaisonia Corallina -

orheteromorphic. Ahnfeltia - , celled; tetrasporangia zonateor cruciate in division; Plocamium , Neogoniolithon , Harveylithon , without , mastigonemes;basal bodies with 4 s reserved. , lbody transitionzone; with centrioles; , Pihiella Ceramium gs withgs membranesonly (single inner cap , Rhodymenia .Note: Theinclusion of Acetabularia,Caulerpa, Chladophora, . -

Smith1981; Chlorobionta Jeffrey ,

, Hydrolithon Porolithon nd2004

, Gelidium

, -

Sebdenia

or distromaticsheet , , , Rhodogorgon Gigartina Lithophyllum lastidwith .

, Gracilaria , , , This article isprotected right by All copyright. single parietalchloroplast. counterclockwise basalbody orientation; a covered with or rigid thin,hair Unicellular Pedinophyceae ●●● Moestrup1991, emend. Scherffelia,Tetraselmis autotrophyand osmotrophy. Treated as prasinophyte cladeIV (Nakayamaet al. 1998). scales tofused aform th rootletsstructure in X2X2 configuration;with organicextracellular scales, outerlayer of Cellswithpair a ofcilia, inserted in a ciliarycilia pit; beatin breast Chlorodendrophyceae ●●● Fritsch 1917 Tr Incertaesedis Chlorophyceae: Scenedesmus,Volvox Chlamydomonas(P), Desmodesmus, Floydiella, Hydrodictyon, Oedegonium,Pediastrum, aplanospore sexualreproduction by isogamy, anisogamy, or oogamy; asexual reproduction by with furrowing,with formation ofplasmodesmata cell outsideof colony; basalbodies andextendsto nucleus; in colonial basal forms, bodies reoriented to face microtubules;basal bodies displaced clockwisedirectly or opposed; rhizoplastconnects bodies withmicrotubular 4 roo Swimmingcells with onetohundreds of cilia, without mastigonemes;when or 2 4 cilia,basal Chlorophyceae ●●● Christensen1994. Nannochloris, Oocystis, Pabia,Prasiola,Prototheca, Trebouxia and autotrophy. reportedbut not observed; lichenose and free with ;asexual reproductionby autospores orzoospores; sexual reproduction bodyorientation;closed mitosiswith metacentric spindle,semi prominentrhizoplast,cruciate, displaced counter asmaller alternatingroot, betweenor 2 moremicrotubules; basal bodies with microtubular rootletsin cruciatearrangement, including a m Swimmingcells with oneortwo of pairs cilia, without mastigonemes;basal bodies with4 Melkonian1990] (P?) ● questioned. Oltmannsiellopsis ●● Trebouxiophyceae Friedl1995[Pleurastrophyceae Mattox1984,al. et Microthamniales

Acceptedeubaria,Trochiscia Article , with , singlecilium; closed mitosiswith persistentspindle; phycoplast absent;

s,akinetes, autosporic;or osmotrophyand autotrophy. Botryococcus,Chlorella, Choricysti

closedmitosis; cytokinesishas phycoplastwithmicrotubules, sometimes in Ulvophyceae causesinstabilityin and phylogenies, themonophyly is .

.

.

eca; eca; metacentricspindle collapses at telophase;nutrition by Marsupiomonas,Pedinomonas tletsin cruciatearrangement, alternating between and 2 more Carteria,Cylindrocapsa, Hafniomonas, Mychanastes,

Fawleyinal. Adletet al. 2012 - s reserved. living forms; mostwith cell walls;osmotrophy - clockwise andcounter s,Coccomyxa, Microthamnion, - cellconnections;haplobiontic life cycle;

.

ultilayeredstructure, and - cl

(P). osed mitosis;cytokinesis - stroke pattern;basal body Bracteacoccus,

- clockwise basal - likeappendages;

This article isprotected right by All copyright. Accepted prasinophyte cladeV (Fawley2000).al. et pyrenoidplastid; the in cilia;no trailing cells bearing a single ciliu Plastidwith prasinoxanthin;with without or scaly covering;vegetative cellswith two cilia or Pseudoscourfieldiaceae Melkonian1990] ●●● Treatedas prasinophyte clade III (Nakayamaet al. 1998). freshwaterspecies; sexual reproduction by hologamy; mostlymarine, somefreshwater. shaped chloroplastwith pyrenoid andeyespot; contractile vacuolearybases near in covercell body and a, except in atleastone species Cellslaterally compressed; two cilialaterally; inserted square ●●● 1998). pattern;mostly marine, some freshwater. Treatedas prasinophyte clade II (Nakayamaetal. orscales,scales absent;scales ornamentedwith spiderweb eyespotposteriorpresent;if cells and/or commonlypresent;2 cilia, single orno cilium present; cilia or equal unequal in length; Cellstypically solitary, singlewith ,sometimes two;prasinoxanthin Mamiellophyceae ●●● Marin&Melkonian 2010 [ Articleal.et 1998). associatedduct system; phagotrophyin some. producingsome conspicuous cyst (calledphycoma); with oneor morelargevacuoles and pyrenoidshaped; present;some with eyespot(s) bearingsingle a cillumobserved in some,which mayrepresent gametes;chloroplastcup Swimmingcells with 4 Pyramimona ●●● (Santoset2017). al. polyarabinose,mannose, galactose and glucose. Coccoid,but Picocystophyceae ●●● L Chloroparvula,Chloropicon. layeredcell wall; marine. Smallcoccoid cellswith a diameterof 1.5 Chloropicophyceae ●●● Lo Py Nephroselmis Bathycoccus cnococcaceae Guillard1991emend. Fawley 1999[Pseudoscourfieldiales and Cymbomonas,Halosphaera, ovoid or tri dales Chadefaud 1950

[Nephroselmidophyceae Cavalier ,Crustomastix, Dolichomastix, Mamiella, Monomastix, Mantoniella

Picocystis. – intrusionof mitochondrial membranesinto pyrenoid. the 16 cillia;16 helical structure in thecilliary transitional region; trailing cells - lobed formsobserved in old cultures opesSantos dos &Eikrem 2017 Treated asTreated prasinophyte clade A VII &B (Santosal. et 2017). pes dos Santosdospes &Eikrem 2017

cilia with 1

m m rarelyobserved in –

Pterosperma,Pyramimonas. 4μm; pyrenoid absent;without cilium;with Pycnococcus,Pseudoscourfieldia. s reserved. Treated asprasinophyteTreated cladeI(Nakayama ; severallayers body of and cilliaryscales;

Treatedas prasinophyte cladeC VII - 2 layersof flattened, rounded orelliptical - – Smith1993, emend.Yamaguchi 2011]

Nephroselmispyriformis

Nephroselmis - ; layered ; cell wallcontaining - like oruniformly reticulate

ordiamond Pycnococcus

.

- shapedscales culture;

;si Treated asTreated ngle, cup .

- -

This article isprotected right by All copyright. Accepted wall glycolateoxidase;ciliary peroxisome present; cell wallcellulose;of organic scales covercell presenceof multilayeredstructures adjacent to the cili Asymmetrical cellwith of pair lateral cilia withoutmastigonemes, emerging a pit;from emend.Lewis and McCourt 2004; Mesostigmata Turmelet al. 2002] (M) ●●● structure(MLS) at ciliary root. Sarcinoid packetsof cells;subaerial; biciliated zoospores; cilia with hairs; multi ●●● Cu/Znsuperoxide dismutase; ciliary peroxisome. cycle;with desiccation multinucleate cells;with withoutor sexual reproduction; sexualspecies with haplobionticlife filamentsbranching ornonbranching; with non cellwithplate; primaryplasmodesmata between adjacentcells in filamentous forms; thylakoids stacked;open mitosis; usually with phycoplast,butsome with phragmoplastand with distinctive multilayeredstructure of microtubularrootletand cyt Asymmetricmotile cells, whenwith present, of pair cilia withoutmastigonemes; basal bodies Charophyceae2009; Smith 1938,Jeffrey 1967Streptophyta, Mattox and Stewart1984] Streptophyta●● Bremer & 1981Wanntorp [ Migulaemend. 1897, Karo Article Prasinococcus,Prasinoderma. newlyproduced cellwall. asTreated prasinophyte clade VI(Fawley 2000).al. et which oneofthe daugh cellwall; chloroplast cup Marine;planktonic;solitary or formingloose colonies;no cilium;without scaly covering;with ●●●●Prasinococcales Guillou ;benthic marine. thallus;cell diameter 6 Thallus macrosc ●●●●Palmophyllales Zechmanetal. 2010 in plastidmulti Marine;solitary, in loose colonies,orcells grouped in gelatinous matrix;strongly supported Palmophyllophyceae ●●● Leliaertet al. 2016 and cilia. Mesostigma Chl orokybus Mesostigma viride - gene andgene nuclearribosomal DNA phylogenies. opic,crustose or erect; subspherical cells in gelatinous matrixmake up Lauterborn1894 [Me Geitler 1942[Chlorokybophyceae Lewisand McCourt 2004] (M) - – resistantcysts (zygospores); glycolateoxidase peroxisomes; in tercells retainsthe parent wall, while other is the released with a 10 - shaped andwith pyrenoid;cell division by unequal binary in fission μ Palmophyllum m; eachm; cellwith single cup

Chlorokybusatmophyticus

et al. 2004,al. et as in Leliaertet al. 2016 .

sostigmatophyceae MarinMelkonianand 1999, ,

Palmoclathrus,Verdigellas s reserved. - motile vegetative p

arybasal bodies;with - shapedchloroplast lacking

.

hase; somehase; with oskeletalanchor;

.

- layered

let al.

This article isprotected right by All copyright. Thalassiosira pseudonana Accepted(Rhizaria), Theleastinclusive cladecontaining Sar organsof the sameindividual, or in thesame organ.Subdivisions shown. not differentiated spermand egg cells, mayonbe different sexual individuals, differenton protectiveembryology test; with tis possiblemany; inalternation of generationswith fertilizationeggby of sperm inside othercharacteristic cell and cytoskeletalanchor; openmitosis with phragmopl Ciliatedbasal bodies,when present,with distinctive multilayeredstructure of microtubules Plantae1836; Haeckel 1866] ●●●●Embryophyta Engler1886, emend. Lewis and McCourt 2004 [Cormophyta Endlicher filaments;primarily in fresh water. antheridiumwith severalshield cellsand a manubrium that gives rise spermatogenousto reproductionoogamous with spermcells; differenti carbonateaccumulates in cellwall manyof species; haplobiontic life cycle; sexual cells,with whorlsbranchletsof radiating from mononucleate cellsat nodes; calcium Thallus attachedto substrate with rhizoids;thalluscent a CharophytaeEngler 1887] ●●●●Charophyceae Smith 1938,emend. Karol et al. 2009 [CharalesLindley 1836; Coleochaete,Chaetosphaeridium ArticleThallidiscsof cells or branched ●●●●Coleochaetophyceae Jeffrey 1982 centrioles.no Withoutciliated stages; sexual reproduction via conjugation;thalli unicellular or filamentous; ●●●●Zygnematophyceae vand with nonmotile female gameteand motile male gamete. Celldivision wayby some of ofform phragmoplast; some oogamous,others anisogamous Phragmoplastophyta ●●● Lecointre& Guyander 2006 sexualreproduction unknown. chloroplastsparietal; cleavage furrowduring cell divisionno but cellplate phragmoplast; or Coccoidunbranched or filaments;one or two chloroplastswith onepyrenoid; most Klebsormidiophyceae ●●● vanden Hoek et al. 1995 Burkiet al. 2008, emend. Adlet al., 20 Tetrahymena thermophila Spirogyra, Staurastrum - celljunctions; diplobiontic life cycle,with vegetative propagation

Cleve 1873(Stramenopiles). is This a node

E en Hoeken et al. 1995, emend. Hall et2009 al. filaments;sheathed hairsas extensions of the cell wall. ntransia,Interfilum, Klebsormidium . Chara,Nitella, Tolypella sue differentiationsue coordinated by hormones;

Bigelowiella natans

. Nanneyand McCoy 1976(Alveolata), and

12 s reserved. ated spermated and eggproducing organs;

astat cytokinesis; plasmodesmata and

Moestrupand Sengco 2001

ral axisral of multinucleate internodal .

.

- baseddefinition in

This article isprotected right by All copyright. genes,detected mostlyin theanalysis small of size fractions(pico and nanoeukaryotes). Uncultured groups detectedin molecular marine surveysamplifying directly 18SrDNA Incerta sedis microaerophilic,in marine sediments. Incertaesedis m Ciliawithouttubular hairs or absent; without plastids, typically withoutvegetative cellwalls; ●●● Heterotrophs, mostlyphagotrophs, ●●Bigyra Cavalier anteriorcilium and long posteriorcilium; cell with wide,shallow ventral furrow. Incertaesedis nano genes. Theseclades are mostl Uncultured groups detectedin molecular marine surveysamplifying directly 18SrDNA 2014 Incertaesedis mitochondrialcr mastigonemes intwo opposite rowsand a posterior usually smooth cilium;tubular Motile cellstypically biciliate,typically with heterokontciliation ● definedAdl in et al., 2012. Theprimary reference phylogeny isBurki et al. (2008,Fig.1). clade.apparent The composition ofis: Sar Alveolata, Rhizaria, and Stramenopiles, as 1967(Haptophyta). The name isderived thefrom acronym of the three groups united gracilis ( Homosapiens clause which al Amoebozoa), ostof them phagotrophic often but osmotrophic saprotrophs invertebrate guts. Accepted ArticleStramenopiles OpalozoaCavalier Smith 1991 emend. 2006 - eukaryotes).

– Klebs1883 (Excavata), l of specifiers the are extant; it isintended to apply ato crown clade; qualifying

the name the does apply not anyif of the following fallwithin specified the clade Opalozoa:Environmental li

Opalozoa:Spherical or D Stramenopiles: Stramenopiles:Environmental lineages MAST Arabidopsisthaliana Linnaeus 1758(Opisthokonta), istae; typically,4 microtubular kinetosomalroots.

- Patterson1989, emend. Adl et 2005al. Smith 1998emend. 2006 (R)

Platysulcus. ydetected in analysis the smallsizeof fractions(pico and

withoutvegetative cellwalls (Linnaeus)Heynhold 1842(Archaeplastida), Cantina,. - neage MASTneage shapedcells with two cilia; Marine bacterivorousheterokont cell with short s reserved. Dictyosteliumdiscoideum

(Lohmann)Hay and Mohler in Hay al.et -

12Massana al.et 2014 (R)

- 21,MAST – .

anteriorcilium with tripartite

-

25 Massana25 al.et Raper1935

Euglena

– inthis

This article isprotected right by All copyright. Ps ,Cyathobodo withoutor lorica; solitary and colonial. post plastids;phagotrophic with cytostome, supported bybroad microtubular rootlet No. 2 of Biciliatewithwithout or tripartite mastigonemes, typicallylackingtransitional helix; without ●●●●Bicosoecida Grasse 1926,emend. Karpov 1998 Placidia,Suigets attachto substrates byposterior cilium during feeding;double Biciliatecells withoutplastids; described species have mastigonemeson anteriorcilium, ●● withoutspecific secondarily lost. Roundedaciliated yeast ●●●●● Zelleriella host of and linked to the host’slife cycle. amphibiansand some fish; life cycle complex,with sexualprocesses induced byhormones pellic formingoblique longitudinal rows files;or microtubularribbons supporting longitudinal Multiciliatedwith cilia originating fromanterioran morphogeneticcentre, the and falx, ●●●●●Opalinea 1926 Wenyon , reptil or One two anteriorpairs of anisokont cilia; uninucleate; endobionts in intestinal tract of ●●●●●Proteromonadea Grasse 1952(P?) vertebrate guts. microtubules, ranging singletsfrom to ribbons; cyst kinetosomeand cilium; cilia withouttubular hairs evenlyspacedcortical ridges underlain Pluriciliatedwith double ●●●● Opal Incisomonas Solenicola Phagotrophicand non ●●●●Nanomonadea Cavalier eudodendromonas. Accepted● Article ● Placidida ● Moriya 2002 etal. eriorcilium; predominantly sedentary,often attach to substrate with posteriorcilium; with ularridgesbetween ciliaryrows; two to manymonomorphic nuclei; endobionts in .

inata 1926, Wenyon emend. Cavalier and , Solenicola

Incisomonas,

host. umonas, Wobblia Environmental samples 17form geneticallydistinctclades calledsub es,and mammals.

Alexeev1911 Blastocystis

- , photosynthetic free - Filos,Halocafeteria, Nanum, Paramonas, Pseudobodo, - . strandedtransitional helix thetransitionalat regionbetween like cells,anaerobic commensals/parasites of intestinal tracts; cilia

andtheir related environmental 18S rDNAsequences. -

Smith2012 (clade MAST

.

.

Karotomorpha, Adriamonas,Anoeca, , Caecitellus, , ,, Protozelleri - livingciliated cells. Includes the uniciliated s reserved. - Smith 1997[ Patterson 1985] - forming;many are osmotrophic in

- 3)

- strandedtransitional helix. .

- ella, types, by

This article isprotected right by All copyright. Acceptedeyespots;sexual reproduction. Spindle ●●●●●Labyrinthulida Doffein 1901 Slenderoblong zoospores. ●●●●●Oblongichytrida Bennettet2017 al. pseudopodia. Pseudost ●●●●●Amphifilida Cavalier Paramphitrema. anaerobic/micro Phagotrophsor ; planktonic or benthic; aerobic, freshwaterand marine,and ●●●●●Amphitremida Poche in manyspecies. organelle calledbothrosome; Golgi Producingectoplasmican network of anastomosing branched wall ●●●●Labyrinthulomycetes Dick2001 Article nan genes. Theseclades are mostly detected in analysis the smallsizeof fractions(pico and Uncultured groups detectedin molecular marine surveysamplifying directly 18SrDNA MAST Incertaesedis stages of theirlife cyclemost in species. Heterotrophicphagotrophs andin somecases osmotrophs, biciliated cells present in some Sagenista ●●● Cavalier genes,detected mostlyin theanalysis small of size f Uncultured groups detectedin molecular marine surveysamplifying directly 18SrDNA al.et 2014 (R). Incerta sedis oeukaryotes). Themajority of cladesthese aform sister group Labyrinthulomycetesto - 10,MAST - shaped omesinstead of truebothrosomes, ectoplasmic elementsin the ofform Bicosoecida Amphifila, Sagenistaenvironmental lineages

- vegetative cellsdistributedin an extensive ectoplasmic net;zoospores with

aerophilicenvironments. - 11,MAST - Smith 1995 Fibrophrys,

environmentallineages MAST - Oblongichytrium - Smith2012

20 1913emend. Gomaa2003 etal. Massanaet al. 2014 (R) , Stellarchytrium. -

derivedbiciliatescales; zoospores with insertion lateral

Sorodiplophrys.

Amphitrema,Archerella, Diplophrys,

s reserved. MAS

ractions(pico and nanoeukaryotes). T -

4,MAST -

16, MAST 16,

- 7,MAST - less filamentswith an - 22,MAST - 8,MAST

- 24Massana - 9,

This article isprotected right by All copyright. Th ●●●●Rhizidiomycetaceae Karling 1943 Thallus eucarpicand polycentric. Karling1939] ●●●● Karling 1939 [Hyphochytridiomycetaceae Fischer 1892, emend. Thallus holocarpic. ●●●●Anisolpidiaceae Karling Single anteriorlydirected cilium. Hyphochytriales ●●● Sparrow1960 Developayella,Develorapax. Free swimming,naked, heterotrophic,bearing two cilia,anterior ciliumwith mastigonemes. Developea ●●● Karpov et Aleoshin 2016 nanoeukaryotes). genes. These Uncultured groups detectedin molecular marine surveysamplifying directly 18SrDNA 2014 Incertaesedis Cell Gyrista●● Cavalier with tubularcristae; ciliary transitional region with transitionalhelix. Free ●●●●Pseudophyllomitidae Sh Thraustochytrium,Ulkenia Japanochytrium,Monorhizochytrium, Parietichytrium, Schizochytrium, Sicyoidochytrium cells;eyeno Cellsproducing a small ectoplasmicnet;presence ofinterphase ●●●●● Thraustochytrida Sparrow1943

Acceptedallus eucarpicand monocentric. Article s withs helicaldoubleor helix/ringsystem ciliary transitionzone. -

livingphagotrophic biciliates,anterior cilium with tubularmastigonemes; mitochondria -

spots;no sexual reproduction.

cladesare mostly detected in analysis the smallsizeof fractions(pico and Gyrista:Environmental lineages

- Anisolpidium,Canteriomyces Smith 1998

1943,emend. Dick 2001 iratoriet al2016 (MAST

Hyphochytrium Latrostium

Althornia,Aurantiochytrium, Botryochytrium, , s reserved. Rhizidiomyces MAST . .

- - 1,MAST

6)

, Rhizidiomycopsis - 2,MAST centriolesin vegetative

Pseudophyllomitus - 23 Massanaal.et .

(P) .

This article isprotected right by All copyright. Accepted openorthomitosis; cilia never formed; freshwater and marine. covered mitochondrialcristae; two typesof extrusomes prey for double interlockingcoils; single central nucleus or several peripheral nuclei; tubular Axopodi Actinophryidae ●●● Claus1874, emend. Hartmann 1926 and external generative(auxosome). part Biciliateparasites ofdiatoms thatdifferentiate into intracellular an feeding part (trophosome) ●●●Pirsoniales Cavalier Phytophthora,Phytopythium, Pustula. Lagenidium, oogenesis. synethizerequired sterols sexual for reproduction. Characteristic periplasmic pattern of Obligate biotrophs and facultative ●●●● Salisapilia,Saprolegnia,Thraustotheca. Apodachlya,Aquastella, Geolegnia,Leptomitus, Newbya,Pythiopsis, Protoachlya, Complexkinetosome morphologicallydifferent generations ofzoospores, which mayhave cilia lost secondarily. ArticleObligate biotrophs and facultative parasites. Oogamous sexualreproduction. Two,often ●●●● Pontisma, Eurychasma Incertaesedis gametangia thick with sixincludingparts, four oogamousroots; reproduction thatresults in the formationof kinetosomesitting above theplasma membrane withcentral a bead; kinetid basestructure uniciliate;cilia anteriorlyinserted; anteriorly directed cilium shorter; transitional plateof lanosteroldirectly squalenefrom oxide;zoospores biciliate and heterokont but rarely haplomictic Thallus mainlyaseptate; cellwall of glucan Peronosporomycetes ●●● Dick 2001 [ Winter1897, emend. Dick 1976] - walledsexual spores knownoospores, as due to contact between male Peronosporalean lineage Saprolegnialean lineage

a emerging amorphousfrom centrosome nuclei;near axonemal microtubules in with siliceous elements;autogamy reported within cell cysts; d

Pythiella, - Albugo,Bremia, Chlamydomyzium, Halophytopthora,

B in themost derivedgroups. ,Halodaphnea, Haliphthoros, Myzocytiopsis,

nuclearcycle; lysine synthesized thediaminopimelatevia (DAP) pathway; Peronosporomycetes:

Rozellopsis, - associa - Smith 1998emend. 2006

Peronosp ted ted “K

Larain Adlet al. 2019

Larain Adlet al. 2019

Si

parasites. Oogamous sexualreproduction. Unable to rolpidium - bodies”.

Atkinsiella, ora,Plasmopara, Pythium, Pseudoperonospora, ,

Pirsonia. Haptoglossa - cellulose, mayhave minoramount of chitin; . Achlya,Aphanomyces, Aplanopsis, s reserved.

Ciliomyces,

- , capturealong axopodia; cysts

Lagena,Lagenisma, Olpidiopsis

Crypticola, Actinophrys , Hyaloperonospora, ivisionwith semi

Ectrogella, , Actinosphaerium

and female

- ,

.

This article isprotected right by All copyright. Accepted microtubular kinetosomalroots. Swim ●●●●●● Pascher1910 Phaeoplaca. Incertaesedis inlost some, as noted below. and ring with directmembrane connection to outer the nuclear envelope membrane;plastid DNA with cellwall; ch coverings,when present,include organic scales, silicaorganic scales, lorica, and cellulose helixwith 4 microtubular kinetosomalrootsand o mastigonemes with shortand long lateral hairs on the shaft; kinetosomeusually with 4 forms;swimming cells biciliated Predominatelyciliated cells, but also capsoid,cocco ●●●●●Chrysophyceae 1914 Pascher Picophagus ArticleIncertaesedis nanoeukaryotes). genes. Theseclades are mostly detected in analysis the smallof Uncultured groups detectedin molecular marine surveysamplifying directly 18SrDNA Incertaesedis envelope. with girdle lamella; chloroplastsendoplasmic reticulum usually attached to presentor absent; transitional helix present or absent; chloroplast usually fewandin number Unicell ●●●●Chrysista Cavalier plastidscommonly containing chlorophyll andc1, oftenc2. Commonlywith chloroplasts,endoplasmic reticulum surround plastids like a membrane; ●●● Ochrophyta Cavalier - c type genophore;eyespots present or absent; plastidpigments include mingcells with onlyone cilium visible bylight microscopy;photosynthetic; four

1&2, fucoxanthin,viola ular, or ular, filamentousor parentchymatous; ciliary supra

– loroplastwith girdle lamella;outer chloroplast endoplasmic reticulummembrane , 6 gyres locatedabove the major transitionalnoplate; paraciliary rod;cell

Chrysowaernella

Chrysophyceae: Chrysista:Environmental lineages ,, Chrysista:Environmental lineages MOCH

- Smith 1986 - Smith 1986emend. Cavalier

, -

Aurearena xanthin,anthaxanthin, and neoxanthin; plastid secondarly Chryososaccus, Chrysosphera,Cyclonexis, Lygynion, Chromulina –

one anteriorlydirected and one laterally directed; tripartite

ne largene striated rootor rhizoplast; ciliarytransitional

.

, Chrysomonas s reserved. id, filamentous,id, and parenchymatous - Smith&Chao 1996 -

3, MOCH3,

.

- tzhelix ancestrally; eyespot size fractions(pico and - 5 Massana2014 etal. thenuclear

a

This article isprotected right by All copyright. Acceptednuclearenvelope membrane;plastid DNA with ring chloroplastendoplasmic reticulummembrane with direct membrane connection to outer the pores forms;cell wall present, containingalginate compounds and cellulose; plasmodesmata or paraciliarylittle rod; tono substantial tissue di transitionalhelix microtubular kinetosomalrootsbut no striated kinetosomalrootor rhizoplast;ciliary insertedlaterally Filamentous,syntagmatic, p ●●●●●Phaeophyceae Hansgirg 1886 [Kjellman1891, Pfitzer 1894] Pseudocharaciopsis,Vischeria and vaucherioxanthin. located but outside of the chloroplast;pl outernuclear envelope membrane;plastid DNA with ring outerchloroplast endoplasmic reticulummembrane with direct membraneconnection to the transitionalplate; no paraciliarycell wallsrod; presen kinetosomal rootor rhizoplast; ciliarytransitional helixwith 6 gyres located above the major and oneposteriorlydirected; 4 microtubular kinetosomalroots and one large striated Coccoid organisms,single cellsor colonies; swimmingcells biciliate ●●●●●Eustigmatales Hibberd1981 Synura,Tesselaria rootsand one large striated kinetosomalroot orrhizoplast. mastigonemes with shortand long lateral hairs on their sh swimmingcells usually with two anteriorlydirected cilia ArticlePredominatelyciliated photosynthetic cells, some benthicform palmelloid colonies; ●●●●●●S usuallyplate, circular, with slender simple spines. Phagotrophiccolorless cellswith two visiblescales cilia;composed of unperforated base ●●●●●●Paraphysomonadida Scoble Cavalier & Spu photosyntheticability, and arecolourless; heterotrophic species canphagotrophic.be Swimmingcells with two cilia visible bymicroscopy;light some secondarily lost ●●●●●● OchromonadalesPascher 1910 microtubular kinetosomalroots. Swimmingcells with onlyone cilium visible bylight microscopy;photosynthetic; ●●●●●● Andersen1989 mella,Pedospumella, between cellsin parenchymatous forms;chloroplasts with girdle lamella;outer ynurales Andersen1987 typicallywith 6 gyres locatedabove major the transitional noplate; –

. one anteriorlydirected and one posteriorlydirected; usually 4

Botryochloropsis,Eustigmatos, Monodopsis, Nannochloropsis,

Ochromonas arenchymatousor ciliated; swimming cells with two cilia usually .

Hibberdia

.

astid pigmentsinclude chlorophyllsviolaxanthin,a,

.

ff s reserved. erentiation occurringin parenchymatous - Smith 2014 Paraphysomonas. - type genophore;eyespots present or t; chloroplastt; without girdle lamella; –

- one bearing tripartite tubular typegenophore; eyespot present afts, two microtubular kinetosomal Chrysodidymus,Mallomonas,

–

one ant eriorlydirected three This article isprotected right by All copyright. Sargassum,Turbinaria sexualreproduction. withoutpyrenoid; diploid life stageonly with meiosisproducing gametes;(mostly) oogamous Sporophyte parenchymatous,with apicalcell growth; several sc ●●●●●● Boryde Saint Asterocladon,Asteronema, Chordaria, Ectocarpus, Scytosiphon isogamous,anisogamous or oogamous sexual reproduction di Gametophyte andsporophyte uniseriate filaments,either branched or unbranched, with ●●●●●● Besseyemend.1907, Silva Reviers & 2000 vegetative cells. group otherfrom brown isalgae reflected in their continuousdivision and elongation of species lackheterotrichy and phaeophycean hairs.Note thatthe early divergence of this Simple branchedfilaments with apica ●●●●●● Kawai2007al. et reproduction. scattereddiscoid plastids without pyrenoid; isomorphic life cycle;oogamous sexual Gametophyte andsporophyte parenchymatous, with apicalor marginal growth ●●●●●● BorySaintde Phaeurus cycle;oogamous sexual reproduction. severalscattereddiscoid plastids with pyrenoid; no Gametophyte smalland filamentous;sporophyte largerand pseudo ●●●●●● Setchell&Gardner 1925 reproduction. withoutpyrenoid; heteromorphic life cyc Sporophyte parenchymatous,with intercalary growth;several scattered discoid plastids ●●●●●●Ascoseirales Petrov1964 information,but taxonomic classification is stillin flux. Notethat several subdivisions are separated on the ba abse

Acceptedff Article use growth;one or more ribbon nt; plastidnt; pigments include chlorophylls . .

Dictyota,Dilophus, Lobophora, Padina, Stypopodium, Taonia, Zonaria Chor Ascophyllum,Bifurcaria, Cystoseira, Druvillaea, Fucus, Hormosira, istocarpus,Discosporangium .

- Vincent1927 -

Vincent1828 - shaped plastids with pyrenoid;isomorphic life l growth;plastids multiple,discoid, without pyrenoids; Arthrocladia,Desmarestia le but gametophyte not free

a s reserved. and

.

trichothallic growth;heteromorphic life c

1&2, fucoxanthin,and violaxanthin. sisof life historyand sequencegene

. Adenocystis,Acinetospora, attereddiscoid plastids .

(P),

- - living;isogamous sexual parenchymatous; Himantothallus, ; several ; cycle; .

This article isprotected right by All copyright. Stypocaulon,Sphacelaria, Verosphacella isogamous,anisogamous or oogamous sexual reproduction. scattereddiscoid plastids without pyrenoid; usually isoan Gametophyte andsporophyte branchedmultiseriate filaments, with apical growth; several ●●●●●● Migula 1908 Splachnidium,Stereocladon heteromorphicalternation of generations; fi Gametophyte largeand parenchymatous,with intercalarygrowth; sporophyte smalland ●●●●●● Peters &Clayton 1998 one ormore terminalsterile cells. withoutpyrenoids, from one tomany per cell; plurilocular sporangium intercalary and having Crustosein atleast one phaseof the life historyor via disc a ●●●●●● Nakamuraex &Lim K propagules lackinga central apical cell. sexualreproduction can byoccur plurilocular or unilocular sporangia, or via vegetative divisionsub of the ofresult lateral divisions thallusfrom cells;prominent apical celllacking transverse An irregularlybranched oligostichousthallus, both branchesand reproductive structuresare ●●●●● whereasunilocular sporangia are intercalary. isomorphiclife cycle; anisogamous gametes;plurilocular reproductive structuresare lateral, Encrustingheterotrichous thalli; numerous discoid plastidsper cell without pyrenoids; ●●●●●● Akkesiophycus,Alaria, Chorda, Costaria, Laminaria, Lessonia, Pseudochoda heteromorphiclife cycle; oogamous sexualreproduction with eggssometimes ciliated. parenchymatous,with intercalarygrowth; severalscattereddiscoid plas Gametophyte smalland filamentouswith apicalgrowth; sporophyte large and ●●●●●●Laminariales Migula 1908 Ishige pseudoparen withoutpyreniods; terminal unilocular sporangia oruniseriate plurilocularsporangia; cortex Isomorphicalternation of generations,with apical cellgrowth; scattered discoid plastids ●●●●●● Ishige Yendo1907 [I Acceptedlamentous,with apical growth;one or more stellateor axial plastids with pyrenoid; Article .

● ● OnslowialesPrud’homme Draisma & vanReine 2008 Nemoderma -

- chymat apic alcells; multiple discoid plastidswithout pyrenoid; isomorphic life cycle;

ouswith assimilatoryfilaments; phaeophycean hairsin cryptostigmata. Schousboeex Bonnet1892 [Nemodermatales Parente etal. .

shigeacea Okamura1935, Choet 2004]al. Lithoderma,Neoralfsia, P

Onslowia . awai2007

anisogamous sexualreproduction. Nemoderma s reserved.

.

morphic alternationmorphic of generations; .

seudolithoderma,Ralfsia - type germination;plastids Chaetopteris,Halopteris,

tidswithout pyrenoid; Scytothamnus, .

2008](M)

.

This article isprotected right by All copyright. Accepted Pleurochloridella Distinguished from the basedupon molecularphylogenetic analyses. ●●●●●●Pleurochloridales Ettl1956 (R) Phaeothamnion Distinguished from Pleurochloridales the basedupon molecularphylo (R) ●●●●●●Phaeothamniales Bourrelly emend.1954, Andersen &Bailey in Baileyal.et 1998 diatoxanthin,and diadinoxanthin. present;plastid pig outer the nuclear envelope membrane; plastid DNAwith ring lamella;chloroplast endoplasmic reticulum membrane with direct membrane connectionto paraciliaryno rod;cells covered rhizoplast;ciliary transitional helix with 4 tripartite hairs;4 microtubular kinetosomal roots no but striated kinetosomalrootor directed ciliumbearing tripartitetubular mastigonemes and Filamentous,capsoid, palmelloid, ciliated, or coccoid; swimming cells biciliated ●●●●● Andersen&Bailey in Baileyal. et 1998 ArticleTilopteris sexualreproduction. scatteredplastids withoutpyrenoids; isomorphic alternation of generations;oogamous Polystichous construction ofthe thallus, which growsby a trichothallic meristem; several ●●●●●● Tilopteri but gametophytenot free severalscattereddiscoid plastids without pyrenoid; heteromorphic alternation of generations Gametophyte 2 ●●●●●●Syringodermatales Henry1984 oogamous sexualreproduction. severalscattereddiscoid plastids without pyrenoid; heteromorphic alternation of generations; Gametophyte andlarger sporophyte pseudoparenchymatous,with ●●●●●●Sporochnales Sauvageau 1926

.

– .

. 4 dales Bessey1907

cells; sporophyte parenchymatouswith apicaland marginal growth; mentsinclude chlorophylls Cutleria,Halosiphon, Haplospora, Phaeos - living;isogamous sexual reproduction. Bellotia,Carpomitra, Nereia, Sporochonus, Tomaculopsis withentire an or two

–

6 gyreslocatedabove the majortransitional plate; s reserved. a and c - piecedwall; cell chloroplast with girdle , fucoxanthin,heteroxanthin,

posteriorlydirected cilium without - type genophore;eye iphoniella,Phyllaria, Syringoderma trichothallicgrowth; genetic analyses.

. –

anteriorly - spots .

This article isprotected right by All copyright. Tribonema,Xanthonema Characiopsis,Chloromeson, Heterococcus, Monadus, Ophiocytium,Sphaerosorus, pleteor entire cell walls; el piecesor with com multinucleate with age;cell walls, when present, witheither H Filamentous,coccoid, and capsoid forms,sometimes becomingparenchymatous or ●●●●●● Tribonematales Pascher1939 heteroxanthin,and vaucherio or ent absent; plastid pigments include chlorophylls outernuclear envelope membrane;plastid DNA with ring outerchloroplast endoplasmic reticulummembrane with direct membranec celluloseand either entire orH loc kinetosomeal rootor rhizoplast; ciliarytransitional helix withapparently 6 double gyres directedand lacking tripartitehairs; 4 microtubular kinetosomalroots and one large striated with two cilia Predominatelycoccoid orfilamentous, rarelyamoeboid, ciliated or capsoid; swimming cells Heteromonadea Leedale1983, Xanthophyta Hibberd1990] ●●●●● Xanthophyceae Allorge 1930,emend. Fritsch 1935 [HeterokontaeLuther 1899, undescribed. alginatesbut lacking cellulose and plasmodesmata; eyespot present; major storage product plastidswith chlorophylls connection outerto the nuclear envelope membrane;plastid DNA with ring girdle la ciliaryandapparatus kinetoso tripartite hairs;ciliary transitional helix with ~5 gyres locatedabove the transitionalplate; Branched filamentousalgae with bi ●●●●●Schizocladia al.et Henryin Kawaial.et 2003 [Schizocladales Kawaial.et 2003] (M) Heterosigma,Merotricha, Olisthodiscus,Vacuolaria vaucherioxanthin(fw), (fw). marine and(m) freshwater(fw) species include chlorophylls plastid withor no very weak direct membraneconnection to the outer nuclear envelope membrane; chloroplastwith orwithout girdle lamella;outer chloroplast endoplasmic reticulum membrane kinetosomal rootor rhizopl microtubular kinetosomalrootspresent but poorly characterized; one large striated mastigonemes andone posteriorlydirected cilium lacking tripartitemastigonemes; Nakedswimming biciliates ●●●●●Raphidophyceae Chadefaud1950, emend. Silva 1980

Acceptedaboveated themajor transitionalplate; no paraciliarycell wallsrod; typical,probably of Article

DNAwith scattered granule mella;outer chloroplast endoplasmic reticulummembrane with direct membrane – Schizocladia

one anteriorly -

a and .

a . ast present;ast ciliary transitional helix no absent; paraciliary rod; aborate aborate reproductive structures lacking. c

with oneanteriorlydirectedcilium bearing tripartitetubular and ,Fibrocapsa, Goniostomum,Haramonas,

1&2; carotenoid composition distinctly di

- directedand bearing tripartitetubular hairs and one posteriorly - xanthin. - malroots, if present undescribed; chloroplasts parietal with shapedbisectional walls; chloroplast with girdle lamella; c

aswell as carotenoids (unverified);cell wallcontaini - ciliatedzoospores typegenophore; eyespots absent; plastid pigments

-

fuco - s reserved. xanthin (m),violaxanthin heteroxanthin (m),

. a

and –

an immaturean cilium bearing tubular

- typegenophore; eyespots pres c

1&2, violaxanthin, -

shapedoverlapping cellwall Botrydium,Bumilleriopsis, ff erentbetween - type genophore; onnectionto the ng ng -

This article isprotected right by All copyright. Accepted a growth phase(auxospore) over several days. causedby unusualan intern and ofunique pattern bearingsingle a anterior ciliumwith 9 +0 axoneme a andmastigonemes; life cycle diplontic lamellae3 of thylakoids and a ringnucleoid (rarel secretionand motility;chloroplasts usually present, bounded by4 membranes,and with openingsoften present in thevalves (so valves; the valves penetratedby simple or chamberedpores arranged severalgirdle bands (as hoopsor segments) covering thecylindrical ‘girdle’ lying between integratedsilicified elements and comprised oftwo valves,each one at end ofthe cell,with traceof cilia exceptin the spermof centriclineages; cell wall complete, composed of tight Vegetative cellscylindrical with circular, a elongate ormultipolar cross ●●●●●Diatomeae pores; of exclsuively marine. girdle plates,and triradiate dorsalplates), often bearing ridges and spines and radiating lines comprisedof abutting silica plates(circular shield and ventralplates, elongate or triradiate chloroplastslike thoseof swimming cells but are surroundedby complete multipartite wal butanoyloxyfucoxanthin, diatoxanthin,and diadinoxanthin. Nonmotile cells possess eyespot;no plastid pigments include chlorophylls connection outerto the nuclear envelope membrane;plastid DNA with ring lamella;outerchloroplast endoplasmic reticulum membrane with direct membrane kinet directed (with mastigonemes)and one posteriorly directed; no microtubularor fibrillar Two typesof cells known: motile andnonmotile. Swimming cells with two cilia,one anteriorly Article●●●●● nanoeukaryotes). genes. Theseclades are mostly detected in analysis the smallsizeof fractions(pico and Uncultured groups detectedin molecular marine surveysamplifying directly 18SrDNA 2014al. Incertae tzhelix Unicellularaggregative;or no cell wall; nakedor with silica orfrustules scales;without supra ●●●●Diatomista Derelle al.et 2016emend. Cavalier Vaucheria Siphonousfilaments; elaborate sexual reproductive struc ●●●●●●Vaucheriales Bohlin 1901 osomal roots;ciliary transitional helix absent;paraciliary no rod; chloroplast with girdle

Bolidophyceae1999 Guilloual. et [ Boothand Marchant 1987]

sedisDiatomista: Environm .

31

Dumortier1821 Bacillariophyta[= Haeckel,1878] –

slowsize reductionoverseveral years during the vegetative phase, alwall morphogenesis, alternating with rapid sizevia restitution Bolidomonas

entallineages - called‘fields’ and ‘processes’, slits), involved in , s reserved.

ymultiple nucleoids);ciliated sperm cells a MOCH and , - Smith2017 (R) Tetrap c

turesas antheridia andoogonia.

- 1 1, MOCH1, - 3, fucoxanthin,19’ arma , Pentalamina - 2,MOCH

- in rowsother(striae); section,lacking any - type genoph - - 4

.

Massanaet ore; ls ly - This article isprotected right by All copyright. valve the face of cylindrical the valve in radiallysymmetrical,pattern radiating afrom central annulus (which mayoccupy whole the Usuallychain ●●●●●●Melosirophytina D.G. Mann, in Adl et al. 2019 marine;sexual reproduction oogamous. (proboscis);rimoportulae and other processes absent; girdle bandssegmental; exclusively Usuallysolitary, with long a pervalvaraxis; valves circular, ex ●●●●●●Probosciophytina D.G. Mann, in Adl et2019 al. Ellerbeckia girdle bandshoop symmetricalvalve pattern; rimoportulaeor protube Chain ●●●●●●Ellerbeckiophytina D.G. Mann, in Adl et 2019al. valve margin; rimoportulaeand o Solitary;valves circular, domed;elaborate articulating silica spinessecreted aroundfrom the ●●●●●●●Corethrophyceae D.G. Mann, in Adl et 2019al. Tenuicylindrus auxospore aforming dormant rest domed;a single simple processoften present near annulus; the girdle bands segmental; Chain ●●●●●●●Leptocylin apparentlyor absent; chloroplasts several, small; exclusivelymarine. annulus;pores simple; girdle bands segmental to strap Chain or forming ●●●●●●Leptocylindrophytina Mann,D.G. in Adl et al. 2019 and are far from complete lists. future,and would permit additionalsubdivisions. The generaare provided examples as only, botanicalcode (ICN).Some of b the classificationlevel (and thehigher level classification israther Nomenclatureflat). follows the and the known andanticipateddiversity of all diatoms, manyclades appearat a high Duedecade. to our poor taxonsampling outside of th 31

Accepted Article revision This reflects numerous advances in the phylogeny of diatoms the over the last - - forming(linked by valveheavily spines), valves silicified; with circular, radially forming(linked by shortspines or secretions), delicate; valves circular, flat .

- forming (linkedby . or marginal; girdle bandshoop

solitary;valves valve circular, pattern radiating afrom central circular - like; marine and freshwater;sexual reproduction as yet unknown. drophyceaeMann, D.G. in Adl al.et 2019 Aulacoseira

valve spinesor bysecretions);central valves circular, therprocesses absent; girdle bandssegmental. ingstage (rare in otherdiatom clades). asalnodeswill probably betterbecome resolved in the and some Proboscia - likeor segmental; marine and freshwater; s reserved. Melosira . cessessmall, restricted tothe mantle; e Mediophyceaediatoms, andpennate

- like;sexual reproduction oogamous

); rimoportulae); small,scattered on

tended into an eccentricbeak

Leptocylindrus - Corethron toppedor , .

This article isprotected right by All copyright. delicateplanktonic species; valve outlineusually bipolar,usually with projections or AcceptedMostlychain ●●●●●●●●Chaetocerotophycidae RoundR.M. & Crawford in Round etal. emend.1990, and/orperizonium; chl rimoportulaecentral or marginal;sexual reproduction oogamous; auxospore with scales secondarily)circular; valve radiating pattern from a circularor elongate annulus; Chain ●●●●●●●Mediophyceae Jouse&Proshkina rarelyapochlorotic. (the‘perizonium’) that facilitateanisometric expansion; chloroplasts many, fewone,or very with amoeboid ornonciliate ‘spinning’ gamete like;sexual reproduction oogamouswith nonmotileand eggs uniciliate sperm, or isogamous involvedin secretion; mucilage rimoportulae present or absent; girdle bands usuallyhoop (sternum);valve structure simple orchambered; ofareas special pattern radiating afrom central circular or elongate annulus or afrom longitudinal rib Chain ●●●●●●Bacillariophytina Medlin Kaczmarska & e 2004, like;sexual reproduction incompletelyknown, marine. complex;valve with center radialslits (apparentlymodified rimoportulae); girdle bandshoop Solitary,heterovalvar; valves circular, radially ●●●●●●Arachnoidiscophytina Mann,D.G. in Adl al. et 2019 Article sexualreproduction oogamous; marine. with theannulus, displaced towardsone side; valve structuresimple; rimoportula single,associated closely Chain ●●●●●●Rhizosoleniophytina Mann,D.G. in Adl et al. 2019 Actinoptychus,Coscinodiscus structuresexternally; girdle bandshoop valve the f submarginalcircular annulus; valve chambered; structure rimoportulaecentral, scattered on Solitary,robust; valves generallypatterncircular, radiating afrom central, subcentralor ●●●●●●Coscinodiscophytina Medlin Kaczmarska & 2004, emend. Endictya sexualreproduction oogamous. - - - formingor so forming,colonial solitary;or valve outlineorbipolarmultipolar, rarelycircular; valve forming, rarelysolitary; valves circular,radially symmetrical or with theannulus .

ace,or in a submarginal ring, sometimes with slit - forming (attachedforming by the valve and setae, poles where present,or by pads) sometimes developedexternally intoa spine; girdle bands segmental;

litary;valve outlinebipolar or multipolar, sometimes (perhaps oroplastsusually many,small. , Actinocyclus Aulacoseira,Melosira, Hyalodiscus - like;sexual reproduction oogamous; mostlymarine. Guinardia,Rhizosolenia ,

- Asteromphalus Lavrenkoin MedlinKaczmarska & 2004 s;auxospore usually with band symmetrical;valve structure chambered, s reserved.

Arachnoidiscus mend.

- likeapertures, ortubes cap

,

Aulacodiscus

,

poresor slitsoften present, Pseudosolenia

, Stephanopyxis .

, Stella - like elements .

rima

, horns at Paralia

.

- like

- - , This article isprotected right by All copyright. sometimes extremelyelongate, either isopolar or heteropolar)or multipolar;valve pattern Chain ●●●●●●●●Chrysanthemodiscophycidae, Mann,D.G. in Adl et al. 2019 Triceratium present(sometimes with external long tubes) or absent; exclusively marine. poles with well aabout cen veryvalverobust; bi outline Chain ●●●●●●●●Odontellophycidae, D. G. Mann, in Adl et2019 al. Pierrecomperia Leyanella centerof some valves;exclusively marine. apicesat the and some valves bearing often long spines(‘pili’); a single rimoportula nearthe annulus but more often with scatteredpores; small well oftenheterovalvar; valve outline bipolar; valve sometimes pattern organized about a central Generallychain ●●●●●●●●Cymatosirophycidae RoundR.M. & Crawford in Round et 1990al. Bacteriosira Thalassiosira involvedin chitin thread secretion);auxospores lacking perizonia;marine and freshwat rimoportulae;almost all members characterized by‘fultoportulae’ (special processes annulus;valve structure simple orchambered; generallywith oneortwo submarginal outlinealmost always valve circular; pattern generallyorganized radially a centralabout Cellsconnectedinto chains bychitin threads,colonial (forming sheets), or solitary;valve ●● Lithodesmioides central (withinannulus), the sometimes extended externallyintoa longtube. aor scatter of pores; valve poleswell lacking tri Chain ●●●●●●●●Lithodesmiophycidae RoundR.M. & Crawford in Round et 1990,al. emend. Hydrosera Dactyliosolen with but a fewlargerobustly silicified freshwater form setae;annulus centralor submarginal; rimoportulaecentral or submarginal; mostly marine, poles, the rarely multipolar or circular; pore fields presentat the poles, often also longhollow -

Accepted Article●●●●●● Thalassiosirophycidae RoundR.M. & Crawford in Round etal. 1990 orto multipolar; valve structure simple,with valve radiating pattern from - - - forming(linked by mucilagepads) or solitary, generally large forming(linked by valve the poles and/orcentral region)or solitary;valve outlinebi forming(linked by mucilagepads) or solitary; valve outlinecircular, bipolar(and then , . Extubocellulus

, tralcircular or elongate annulus; valve structure simple orchambered; valve , Cerataulus Skeletonema , , - Lindavia Cerataulina defined poredefined fields(‘ocelli’) often surrounded by a thick rim; rimoportulae . -

, forming by(linked spines on the valves),very small Helicotheca , ,

Cyclotella,Stephanodiscus, Cyclostephanos Pleurosira , , , Plagiogrammopsis - Hemiaulus Detonula

or multipolar,rarely valvecircular; pattern organizedradially ,

Bellerochea , Pseudauliscus .

, , Cymatosira Ditylum - , defined pore fields;rimoportula present, s reserved. Campylosira , Acanthoceras , .

Amphitetras s. , - Minutoc defined poredefined fields(‘ocelluli’) present

, Brockmanniella

ellus , , Trieres Urosolenia - - celledand sometimes , , celled,delicate forms; , Papiliocellulus Discostella

, Mastodiscus

a centralannulus , Odontella , Lithodesmium

Terpsinoë

,

, , , . er.

, - , ,

This article isprotected right by All copyright. absent;sexual reproduction confirmed;.exclusively not pole;rimoportulae present (one ateach pole orscattered along thesides of valve); the raphe Solitary;valve outlinebipolar; valve structuresimple; a rimmedpore fieldpresent ateach ●●●●●●●●Striatellaceae chloroplastsusually 2only 1, or a fewand large, less oftenmany and small. perizoniumgenerally differentiated into two series, distinct transverse and longitudinal; (although sometimeswith reproductioninvolving gametangiogamyand almost always with gametesof equal size accompanied (orreplaced?) by special slits (the‘raphe’) involved in motility;sexual simple orchambered; rimopo organizedbilaterally an elongateabout axialrib (sternum),as in a feather;valve structure Chain ●●●●●●●Bacillariophyceae Haeckel1878, emend. oogamous;exclusively marine. specializedregions with a spines; single off radiating anfrom elongate annulus;pore absent,fields though the setae mayend in De ●●●●●●●● Biddulphia central circularannulus; pore fields(‘pseudocelli’) present at poles; the rimoportulaecentral. centrallyand sometimes between centerand poles; pattern organizedradially aabout sometimes undulate;polarprojections small or largeand valve of Chain ●●●●●●●●Biddulphiophycidae Round andR.M. Crawfordin Round etal. emend.1990, present;e pattern radiating afrom circular orelongate annulus; valve structuresimple; rimoportulae Chain ●●●●●●●Biddulphiophyceae, D. Mann,G. in Adl et2019 al. Ardissonea marine. presentat the poles (andthen poorly differentiated, i.e.‘pseudocelli’) or absent; exclusively structuresimple or chambered (); rimoportulaepresent or absent; p withthen striaeextending inwards annulus, the from which istherefore ‘bifacial’);valve orga

Acceptedlicate,solitary; valve bipolar, outline ends the developed intonarrow setae;valve pattern Article nizedradially about a centralannulus, which circularbe can or extremely elongate (and - - - forming,colonial solitary;.valveor outlinealwaysalmost bipolar; valve pattern forming(linked by mucilagepads), generallylarge formingor solitary; valve outlinebipolar, with elevatedprojections at the poles; valve Chrysanthemodiscus xclusivelymarine. .

, Climacosphenia

T. 1860c West

Kützing1844 behavioraldi

, , rtulae generallyonly one or twovalve per none, or sometimes

Toxarium Biddulphiopsis Attheya.

ff

.

erentiationand/or morphological differences); - centralrimoportula; sexual repro , s reserved. Trigonium

marine. , -

celledand robust; valve outline Isthmia

Striatella , tenwith additionaldoming Lampriscus , Pseudostriatella ore fields

duction , Stictocyclus

.

, This article isprotected right by All copyright. chlorophylls plastidDNA w organicscales or with siliceous skeleton;chloroplasts, when present,with lamella; girdle gyres locatedbelow the major transitionalplate; paraciliarypresent;rod cells withnaked, microtubularor fibrillar kinetosomal anteriorlydirected and bearing tripartite hairs;tubular kinetosomes adpressedto nucleus; no Single cells, colonialciliatedcells or amoebae; swimming cells usually with one cilium, ●●●●● Silva 1980 Didymosphenia,Phaeodactylum Cocconeis Navicula of tens genera. freshwaterinterface. Thevast majori and freshwater,with manyexamples of genera or families transgressing themarine the raphe; gametesmorphologically similar,amoeboid or fusing throughexpansion; marine valve formation);usually 1 or2 chloroplasts pore fieldssometimes present atone or both poles; presentraphe (rarelyinfilled during rimoportulaeusually absent (exception:Eunotiales); valve simple structure orchambered; mucilagetubes); valve almost outline always bipolar, fru Usuallysolitary and motile, less often chain ●●●●●●●●Bacillariophycidae Mann D.G. Round, in Crawford &Mann emend. 1990, Thalassionema Cyclophora m amoeboid,orwith ‘male’ gameteswith non often but polar; raphe absent; ‘male’ and ‘female’ gametesof equal o not)or often present at thepoles; rimoportulaepresent orabsent, very variable location in secondaryevolution of radialsymmetry); valve usually structure simple; pore fields(rimmed valve outlinebi Chain ●●●●●●●●Fragilariophycidae RoundRound, in Crawford&Mann 1990, emend. Bleakeleya exclusivelymarine. sizeequal but‘male’ gameteswith non poles,at the rimoportulae presentor absent; rapheabsent; ‘male’ and ‘female’ gametes of outlinebi Chain ●●●●●●●●Urneidophycidae Medlin 2016(P?).

Accepted Articlearine and freshwater. - - formingor colonial (linked by pads or stalks,less often by valve or solitary; spines) forming(linked by spineson valves), the colonial by(linked pads) or solitary;valve , -

Seminavis or multipolar,rarely valvecircular; structuresimple; pore fields , ,

, Frustulia

Asterionellopsis a Astrosyne ith scattered granule and - .

Eunotia

ormultipolar, very rarely circular(with reductionof sternum the and c Plagiogramma

, , 1& 2, fucoxanthin,diatoxanthin, and diadinoxanthin.

Haslea Diplon , , Licmophora

Achnanthes eis . ,

Stauroneis ,

Sellaphora , , Amphora , Synedra - typegenophore; eyespot;no plastid pigments include Dimeregramma roots;ciliary transitional helix, when with present, 0 , tyof diatom species belong here, classifiedinto many , Rhabdonema

Bacillaria - ciliumprojections that generate movement; , Pleurosigma - , , , - cilium projections that generatemovement;

formingor colonial (linked by orstalks living in Tabellaria Entomoneis percell, positioned to avoid the areabeneath s reserved.

, Nitzschia , , Grammatophora Rhaphoneis , , ,

Asterionella Gomphonema Gyrosigma stules sometimes heterovalvar; ,

Epithemia , Pseudo , Delph - , , nitzschia , Achnanthidium , Diatoma Surirella r unequal r size, Sta ,

Cymbella ineis urosira

sometimespresent , , , .

Cylindrotheca

Psammoneis Tabularia ,

, , –

– , 2

, ,

This article isprotected right by All copyright. Acceptedtypegenopho connection outerto the nuclear envelope membrane;plastid DNA with scattered granule with girdle lamella;outer chloroplastendoplasmic reticulummembrane with direct membrane transitionalplate; no paracilia kinetosomal rootor rhizoplast; ciliarytransitional helixwith 2 gyres located belowmajor the onabsent immature cilium;3 Ciliatedcoccoidor organisms; swimming cells with one ●●●●●Pinguiophyceae Kawachial.et 2003 Pulvinaria,Sarcinochrysis biciliatedwith four microtubular kinetosomal roots. Sarcinoid,capsoid, ciliated or filamentous; cells typi ●●●●●●Sarcinochrysidales Gayral&Billard 1977 no kinetosomalroots. Ciliatedor ●●●●●●Pelagomonadales Andersen&Saunders 1993 hexanoyloxyfucoxanthin,19 eyespot;plastid pigments include chlorophylls chloroplastswith girdle lamella;plastid DNA with sca paraciliarypresentrod or absent; cellsnakedor with organicthecae or cell walls; transitionalhelix, when with present, 2 gyreslocated below major the transitional plate; kinetosomal rootson uniciliated cells; four microtubularrootson Articlepresent,directed posteriorly; kinetosome(s)adpressed tonucleus; no microtubular or fibrillar ant Ciliated,capsoid, coccoid,sarcinoid orfilamentous; swimming cells with 1 or2 cilia ●●●●● Andersen& Saunders 1993 Vegetative cellsamoeboid; zoospore ciliated;with chloroplasts. ●●●●●●Rhi Pteridomonas Apedinella,Ciliophrys, Mesopedinella, Palatinella, Pedinella, Pseudopedinella, Naked,organically orscaled loricate ciliated cells; with orwithout chloroplasts. ●●●●●● Zimmermannet al. 1984 Silica skeletonpresent on atleast one life stage; with chloroplasts. ●●●●●● Haeckel1894 eriorlydirected cilium bearing bipartite or tripartite hairstubular and second cilium,when coccoidorganisms; when ciliated,a single ciliumwithout a second kinetosome; zochromulinales O’Kelly& 1994 Wujek re;eyespots absent; plastid pigments include chlorophylls .

Aureococcus,Aureoumbra, Pelagococcus, Pelagomonas .

- but – ry rod; cellsry nakedrod; enclosedor in mineralized lorica;chloroplast 4 microtubular kinetosomalrootsand one large striated - anoyloxyfucoxanthin,diatoxanthin, and diadinoxanthin.

s reserved.

a 1,&c 2

Ankylochrisis,Nematochrysopsis,

cally withcally organiccell wall;ciliated cells ttered granule

or two cilia;tripartite present hairs or , , fucoxanthin,19

Rhizochromulina biciliated cells;ciliary - D typegenophore; no ictyocha a -

and .

c Actinomonas, .

1&2, .

–

- This article isprotected right by All copyright. or morphologicallyundifferentiated mononucleate cells via hypha a hypnospores)developing outsidehost to zoosporesform via the formation of Trophozoites parasitic,dividing by successive binary fissions;released trophozoites (termed Holm,1999; Norén& Moestrup, 1999] Perkinsidae●● Levine1978, emend. Adl et al. absent. Non ●●●AlphamonaceaeAdl al. et 2019 carotene;chlorophyll sporangiumwall; plastid pigmented by chlorophyll pseudoconoid,coccoid wedge andchromerosome present; cellssurrounded by thin Immotile coccoid cellsreproduce by binary division; zoospores with heterodynamiccilia; ●●●Chromeraceae O ,Chilovora, Non ●●●Colpodellaceaeal.Adl et 2019 vaucheriaxanthin andβ pyrenoid;sporangia carryoperculum;an plastid pigmentedby chlorophyll dozensimmotileof autospores andmotile biciliatezoospores, respectively; prominent Immotile vegetative cellswith laminatedcell walls; autosporangia and zoosporangia contain ●●●Vitrellaceae Oborník &Lukeš 201 biciliate;micropore present;cystsat least in somespecies. microtubulesbeneath alveolae; conoid by four membranes; Photosynthetic,or non Colpodellida●● Cavalier cristaetubular or ampulliform. Corticalalveolae, sometimes secondarilylos ● Polypodochrysis fucoxanthin,and violaxanthin.

Accepted ArticleAlveolata - - photosyntheticpredatory ciliated cells on other protists; carbohydrate reserve granules photosyntheticciliated cell predatory otheron protists, (found oncein blood).human Alphamonas

Cavalier .

. mitochondrionwith tubularcristae; highly flattenedcortical alveoli; -

borník&Lukeš 2012 c Smith 1991 -

absent. photosyntheticand predatory; complex plastids,when presentbound - carotene;chlorophyll - Smith1993, emend. Adl et2005, al. 2019

Glossomastix,Phaeomonas, Pinguiochrysis, Pinguiococcus, Chromera

.

2 -

like structure with apicalcomplex and rostrum; .

t; witht; ciliaryorpit micropore; mitochondrial c s reserved.

2005[Perkinsozoa Moestrup Rehnstam & absent. a

,violaxanthin, i Vitrella

.

sofucoxanthin and β -

like tube;zoospores a , violaxanthin, zoosporangia - - This article isprotected right by All copyright. one m C ●● Oxyr ;cilia inserted laterally;cytotrophic predator. (Theremay be multiple species). Withouttruecingulum and sulcus;intranuclear mitotic spindle;with amphiesmalvesicles and ●●● Palustrimon Deep branchingcolponemid alveolate;cytotrophic predator; longitudinal feeding groove. ● predators. Bicili Acavomonidia ●●● Tikhonenkovet al. 2014 sometimes on micro groove;micropore absent; nontubular mastigonemes present;cytotrophic predators and Biciliate;t Colponemidia ●●● Tikhonenkovet al. 2014 cytotrophy,we expectbetter taxonsampling improveto the resolution of thisnode. sequencesobtained are divergentand manyremain be to described. Poorly sampleddue to environments. These described genera are most pro Biciliatealveolates, typically cytotrophic predators, infound soil, freshwater,and marine ●● Incertaesedis Colpodella Incertaesedis posteriorpolar ring. ,and micropores,and a microtubular cytoskeletonw biciliate;apical organelles includingan incomplete conoid (openalong one side),, ●● Palustrimonas●● e u ColponemidaCavalier Di

Acceptedll Article l t

s i or ate; rigid rigid cells;ate; lack longitudinal grooves and apicalcomplex structures; cytotrophic p rhis marina. n

wi l o e f flagellata ew t

h w

hree a t

Acavomonas w w v and as. es o a

Dujardin 1841 [Oxyrrhinaceae Sournia 1984] (M) v - cili Perkinsidae Perkinsidae:

membranedalveolar pellicle; two microtubulebandsarmour longitudinal es; bea Voromonas

a B

nuc i ü

t n Pattersonand Simpson, 1996 i ,, Rastrimonas, t - ng

sch

t invertebrates. he l

eus t . o l

i 1885, e i1885, - m

Smith1993emend. Adl al. et 2019 (P?) t : Phagodinium : he o t but phylogenetically, morerelated to Perk Psammosa y t il p

ce e i ca

s ll’ t l m a l s y g

l en e a . e f

t and t d d – i

.

no Okamotoet2012 al.

t Fe y .

p k

i n

a ca l

o so r n y ll s reserved. on g m y it ,

e

ud

one wi

et i t nalcilium h

bablymultiple generaas DNA

a

t ch r l .1993, ans r

o m v X e oso - – r cellparasites

se bea

e

morphologicallyclose to m m

ith bothan anteriorand cili

end. t e i ng s um

r

insidae. e po A m r dl i bbon s a t i e e . n

r t i

i ng condensedng o a

- r l li .2005 l k y

e w

w i t

h on i t

h l y

This article isprotected right by All copyright. Incer GroupI), host (oroutside the central capsule). laminaand a pharyngea extendinginto trophont cytoplasm; sporogenesis occursoutside the Parasites ofCiliophora andRadiolaria, with trophontepi ●●●●Euduboscquellidae Coats&Bachvaroff 2012 II. Incertaesedis sporogenesisoccurs in Parasites of theearly developmental stages (eggs and larvae) of some species of finfish; Incertaesedis and remain condensedduring interphase. looselyaroundcell.V arrangementof cilia; lacking well defined cingulum and sulcus; transverse cilium wrapping (schizogonous)divisions; motile cells (i.e.dino externalan parasitophorous membrane inside thesporogenesis host; by palintomic Aplastidicintracellular parasites of and metazoan, generallysurroundedby Syndiniales ●●● Loeblich III1976 Stylodinium, O v c sedis Incertae Thecadinium,Thecadiniopsis,Togula. Pyramidodinium,Roscoffia, Plagiodinium,Planodinium, Pileidinium, Gyrodiniellum,Halostylodinium, Heterodinium, Moestrupia, Paragymnodinium, Phytodinium, Dactylodinium,Dicroerisma, Gloeodinium, Grammatodinium, Gynogonadinium, Bispinodinium,Bysmatrum, Adenoides,Akashiwo, Amphidiniella, sedis Incertae nucleoproteins package chromatin;c du a y od c li r AcceptedEllobiopsis Article i d l n e i ]. n g tae sedis tae

on i

A u i n m m l t y e Dogelodinium, Keppenodinium ,Myxodinium, ; y

r . l not

p o

hase o Syltodinium,Synchaeta , d : RP :

Thalassomyces Syndiniales:Ellobipsidae: theclade isclosely reklated to MALV Syndiniales: Di Di h i n i g n n i

u h and oflagellata oflagellata - m l parasite,parasite of (environmental Marine AlveolateGroup I). y ,

v -

A shapedchromosomes, attach tothe nucleus membrane byapex the l acuo a pod theyolksac of embryos. c Pi k sc i

n i

l Ichthyodinium n a Cabra,Cladopyx Sabulodinium,Sphaerodinium, Spiniferodinium, Testudodinium, : Naked : and thecate genera with uncertain affiliation.e.g., : Pa : g i i nood t u

ed. t . m y

p r , a

i

caleu Foss C i s n i ac i t u i . l

c Euduboscquella osed

m Ankistrodinium,Apicoporus, Archaeosphaerodiniopsis, h

il d one ,

s k i

Pseudadenoides,Ps . n

P a

un

o

r (environmentalMarine Alveolate(MALV) Group I). r

Amoebophrya,, Merodinium, y ll d flagell o k a, o i t no ood is,Crypthecodinium, Cucumeridinium, no t

i s reserved. c sporesor gametes)with a dinokont Caryotoma, Caryotoma, m

w h

i i n n. a i t s os i t u t es ones

[ m, Bl i s

(environmentalMarine Alveolate w

as

w Rhinodinium, i some borderedby a perinematic ring t i

t h t and od h

d

C e i i n n r x eudothecadinium,

ep cen i o tr a k anuc l es i a dood tr r y

i C o on l l ha

ear es;dinoflagellate/viral Schyzochitriodinium, i

n d tt i u u

on sp m r i ng

, i 190 nd Haplozoon,

pa l - e. I and I MALV 6 r

, no , t

- o like f

t l he on

g l i e f e r -

This article isprotected right by All copyright. N D W a et f unc se W t m con C P C d P sporogenesisoccurs outside host. the Parasites ofAppendicularia ●●●●Sphaeriparaceae Loeblich 1970 III Synd sporogenesisoccurs inside the host by fragmentationof the plasmodium. active nucleicdivisions intoa plasmodium that generallythefill whole bodythehost;of Parasites of cr ●●●●Syndinidae Chatton 1910 (environmentalMarine AlveolateGroup IV) eachthen cell of this structure individualize dinospore(s). into mul host; the palintomic schizogonous divisions insideoccur host the and produce swimming a Parasites ofDinophyceae, Radiolaria and Ciliophora; feeding througha cytopharynxinside ●●●●Amoebophryidae Cachon 1964 (environmentalMarine AlveolateGroup II) h o i o r i e e r no r o ss ssod i i i r aspedo o t t m nc

Acceptedm l Article

i r h h lco e es t ticellulartemporary structure (termedvermiform) after evaginationan to leavehost, its l u pho i . 2000 . k a

l a a rt g inium,Solenodinium i l n a i pal oop r t t n a h u od e od or r i rt

n ● ● ● y i

m l p ce n o t ex on i ● ● ●● he r i u i li w g - n e n e t b ● ● s f ll m e

i i r i i e s sensu u calc u ( u haped,an t u

●G Di N o ● ll d h en a en

,Erythropsidinium, Greuetodinium, t m l m a, u c u ●●

os oc

m noph n t y s r , ustacean and Radiolaria.Sporogenesis occurs inside host, the and startby , Nusuttodinium, , he t y t ot i c ph i C a i ng t m r S ● a r c il l e t i e

y m t ● uca caphod i c nod i pe e t v s

m es l hecal G o s pa y es. i ph r t f r t i ceae m bod e on lli y a i m l c r

es m i t i g p c

t n c e t i a c o

l e r y i o s nod e i l ph i

) ) con i

n c n oc s m H p f

i

co n l as P i i . l li e. r n u ae a

y al i ec k f ascher u i g m m c e t

n

w es, m and Radiolaria; feeding through acytopharynx inside host; the t

i c

v t i d o he a , p c i um a k

es se , g a

r K y i el t

i n S c n e

h s Pellucidodinium, Pellucidodinium, t o p i

he i

l c i i

e ap p ng e f F 1894 z n r Fenso

o l ca i a es, i 1914 g . nc ng

on i t i

pa d

S calstructure complex. u a a

i i d t n l

l l pala

od e v a t y a

l i i t Atlanticellodinium,Sphaeripara. a [ v eo u . i r ff e

N n m

i r r m i Foss s i r

g a n

n oc n l 1878,e i e ae n i e b , i m u

t

( g

l i Le eta t m. e fr es t il ph

ed abu

uc ( il ee i a p s reserved. n s i a

m t l e

t i n .1993 o G - ph u o m l li s a onse d p P m n

v y m s ong t i h y k o i m i scus, en ng i on) i ale ceae x no l es y n

or k d

r

od

w m m d i r . a t l i i e hus n. kos, G f

noph o ll al i

e N n m Fenso y t . w il i o A

Barrufeta, u v e H or e

er c es m bed f n

ansen P o t ce

y il t

i , Lep , Amoebophrya r

r l n i ceans; uc m o a c o l m

i l l r t t m n es) ed i a, e i t t e i n ud u he r o

f

y i

m e r P dod & l

be t a e t i

t h nalp e Chytriodinium h

, a

t

M w a ed r t t a i C m

h ops a ng l i i t oes . n t a l a

p

h od m 199 i b n c

u h l a , a y i

honod a ay m s i s i tr

es

t n

c , v . es. Few es. i d up , x

3 i

r acuo W

u or i m uc ] no l

m a

a

als i

t i n m , k r al i i n t n

a ud l D ay i es; o , u r tr a y w

m i

u k on u nal n i c no a. , g o t b u t

w j r e e n r

g

This article isprotected right by All copyright. B nu d W fine striations. as a wide loop; descending cingulum encircles the cell about 1.5 to 2 times; cell surfacecircular with apical structure complex connected to the sulcal extension; sulcus invades2017 the episome episome. about once; cingulum encircles the cell about U U longitudinal Hat Closed,circular loop B Fu G Elli D complex structure Mi a e l r a - - au . 2004 . y i ach shaped apical structure complex connected to the sulcal extension; sulcus encircles the cell shaped apical structure complex. nu m v rr t l Accepted Article r p ech h - o od g o likeapical projection; counterclockwisespiraling t e

t i i w d calap w b e sensu r i i d ous

j n

a i - e

of na, i i li rr i l n r u lof sensu k g et

i e Margalefidinium m. t u e

hecal

g l a m P i

s cal u su s t t t he

tr i , l t ychod t a

ar r Cochlodinium strangulatum. ud K a r i

● ● ● ● ● ● ● ● ● l c f .2000 s structure complex structure i a

m ace g ●● ●● ●● ●● ●● ● ●● ●● ●● t t tr p i o r r nalse h ● i l en o i

. an a c t

●● ●● ●● ●● ●● ●● ● ●● ●● t

i A t t

il scu o o es, ● s i - g e a, m r shaped apicalstructure complex. t

Torodiniales Boutrup,Moestrup & Daugbjerg 2016 G P Cochlodinium Margalefidinium Levanderina Ceratoper K A

u r sensu s c

i ph m t a r l a s K y i a f e y i g r o , e t r a chod r l p

i en o m i ldo on; very on; large episome. r - s S d r h m

d . l i o c o od

i n i i d Few aceae

n i r r c l i n s i e d m i u i i n i tr g um r sca n m. r od ap i i

i i na um i esce c d a u

kno t

i

m i i , o n l K t cal n t

es

Moestrup et al. 201 abu ed

b iaceaeLoeblich III 1980,emend. Reñé and de Salas2013 B Levanderina i , Cl o F. Schütt emend. u

i n e f Tak sec w

m.

o Fenso structure c structure apa t r F. Gómez, Richlen & D.M. Anderson 2017 by n l - gho i a d shaped

t f t

a i ed & oss a on r

ya ède

l t t S

z h m

m by t i twice; smooth cell surface; eyespot in the

w i l h et c

e

a. r s reserved. ezy a k

&L

ep

a

ep .

t e a

p

omplex

t i r l s e r

.2005

i i a Kapelodinium, Torodinium a ese d so 1921,

lli nons ch l g . c apical structure complex; w

m e 1993 F. Gómez, Richlen & D.M. Anderson l 4 m e; n ; e

t Ceratoper w ann

a ;h

e

a d

e

i t r t l i e m i h v v

a a f e es.

p l ll en su 185 ec o y t oph l

ae, r d t a A f ed . 9 ace rr c G , i y an

d h

w e t t . i r o e n

m ad he g H s

- i t um de ed t end. he ansen r i r na, i e a r

,

or i t l v d i e Kirithra. on ed i ft A F sce i s o s ; no ; l m /

ø and r

ch i

ph d r J r n i g

g

ø l t o ap i h

i e an b t r M r o g s. l o e,usua i l oes ensen i cal us, p z l ed as tr

t up i s. s. n

t et ll o

y i n

This article isprotected right by All copyright. Apocalathium,Blastodinium, Chimonodinium, C Vulcanodinium. Qia, O A e s p Al P G A f d d Al l W Leiocephalium,Pelagodinium, con l W E t W B g W a a y oss y x a e i l r y m sopo a a pe s t t b onyau obu v v m chae i i i i t i i rt g r t t t t l

Acceptedl t t Articlet

end l e e d h h h h ca oc y e i ud ud t r i n m il

a o o cu i l ee

a C n a s a a a o g i l l l r y ,Palatinus, Parvodinium e i n i es ae ae i x t r

l l nalp nalse eous u i a, l s e v v r t w

p ng ar t ● i , o abu n i o w r l

t eo eo x shed e

ax,L

●● y i C i f g d i s,Pyrodinium, t con t usua B i

ns r

h t end t as

i e fr i i abu l hout l n o n d b ae ae

● l l r

e om a i a i r species

r i a de u y r n P t gh t i x t

t i i he ck a t mm i m ngu e es, by i i t ng ll i con con e l on u u r a ● ● ● ● ● i

y n i r ap t t ap , m - se e m

t ●● ●● ●● ● ●● he

he i

li i a i d p con Ja ng ll on fr e k w t ● , l , n t t i l a. od i a r h

a a n as e calpa tr

om Bl ● ●● ● i ●● ● i Ceratocorys, t d ea rt ch e a t

e i i i

y h t ● n n ● ph ● f and

m w t i t s i as he t ea r n

a cu

i i i T G P S B i ; l i r a ng ng da or ● o i o n i a i t l g y u n s o y he o e c uess t c on r t r ●● t l c od i ar u P m a

t i e op co v r r a, alp l i ng wi no ( he Ju i , r li li gh i r g e r dae ap y

d

y , es g g i l ●

i non o r lli it r t a l a t n i au T r ast O n

abu ds ht ht n hout ophacus,Tripos. ● i t f t i a l. a t i aceae i l e o als aceae

- hecalp ca u a e i T s e t a n s ca ll l ve h Ansanella,Asulcocephalium, Bi

m* t F t t aca t m l , s aceae h l w T t es, hecalp hecalp r o P es assoc l a

e l enso ) and ) i eops a l o P r u lli i c e n ca t o r t C e , i

t r ass i t h,

e g m

a. can i

l or l acospha u P l Di H on a f es oo

o r a r o M r b i Fe e eous r ae n d o l e t p rm e m ( a r i e

r

i li o g i r s,Pentaplacodinium, i ap

f c T a M l pos i a ll n t a,Fukuyoa, F l ope be ea od l n l e a c e es, a

a a v a, d n t a i i pe so oes k u ed n s t

es c i t t e e y e e c e e

t el1894 tr m g k r r Prosoaulax, Prosoaulax, l t r

(~ u a

t or m r s s l e bound i e ec

i f i up ap t v r n i e c , w a l o a

a, od tr r l ) es 190 es and w e a g.

l r i P

r l i es or o 1980 u

a t . and

i t m

t i cal

abu eta h e Di

e i g t

p c 1993

v ( h t s reserved. C f

r i t eae n ~ h , (

es. ng r e (

i

p M an f d o P a

r a i

a L 210

x o z v p yp l l po l i m l p opsa t a i EV .2005 a) n t

ed es r . ndbe

i t a e

m g i

t can Aduncodinium, A

i a , a 199 cal t S i ops s r

m on r ope

p i t

t nal i ) ag t c M ch abu g o ng

e i

e l ca w P

e p li e

a) r li t 3 n be r o i ili ill s, i h n

a r i s,

ne r g, & g, o

b t , a ( t f o l i

d l e h e

er tt )a

d EAV r a t r

e g

6 t Di o i

r P t i e r od i u t ( c f p abu m n a l

of ec P i

an obu u r 1930 l r r on k m t p r a i ll n eas. epe he D ops e r en ese i - y l t n r o

eche na ) , l opsa r t i i o i

au

;e t ap l n i i k g o by G

a ud d u l d w p es. e

n f r r i t m i n . w

g a s,Duboscquodinium, r nie r y i i ;

i i T 5 on d c ow t i

esentda m z M as m espot b h nalse

, e l -- l h a i ed da e ops n j i B S oes y a e ch b ll l i

m 6 r )

s i i espot e t a, tr i u r y p n i

y. a,Biecheleriopsis, e e g a y g l r m m t l o v a r

i a a t na r

l r tr s, e P o he i ood n d 2009 A t ea al b t , x r t i n up l es g t y i i r

on v m i r P scu e u o H e od pe r

d i y. s i s; d s; d d e ng t r n t r

ph i e i . y oc o

( a e n n e i

i has nalse

A r pe Al a

T v n t s t a ll i E i g d

u ope u i es r e y L , 7 i d h i r u m

exand e m s m

r ee w - P) G i i l B by m, Yihiella. m, n s t a .

- i a f i

f , c , 15 i n o i t i

2009 r oss t ;e ops t v n i l w h c i

g a n u es. o r d a s e i i a, i i x m f u es; i t y odo

n h on ors il r i i espot i shed , s i i s, s tr

Niea, Niea, u u

t

o e m, m

has m n i r x , nae g a,

by

This article isprotected right by All copyright. F ho W Pseudophalacroma, Metadinophysis,Metaphalacroma, f cili W plate. Al plate. Al Al Heterocapsa. Al Unruhdinium thecate and athecate taxa. e.g. Generawith diatom H N S E o o c n e o r v v v v i i m ss r m ary t t s

Accepted Articlet

e e e e houtc h i e co i pps o o o o cu o s. r il a ob l l l l l

s m ae ae ae ae o Centrodinium. Corythodinium, Oxytoxum.

po li A

c

g i u f p e r i e m

o n a n r r con con con con ll i r e essed g u n c k a, ph a,Leone . .

g t s u no

● ● u

A

u l . S i t t t t u w ●● ●● m

so a a a a l p w um m t i

i i i i oecke ,L a t n n n n n. h ● ● l

,a en r c i i i i

t ng ng ng ng Di P

i i t

M ssod o n fr r

r i ans r su r ll a, su noph g o -

o esopo

derivedchloroplasts and reduced peridinin a, t t t t u r Si m he he he he r

o l i Ci l

cus, ● ● ● ● ● ● a u v cen Luc i nophys l n one c c c c , , Theleodinium, cus; ●● ●● ●● ●● ●● m ●● e t y alp alp alp alp i h r u sa

se a r b m

t ●● ●● ●● ●● ●● ●● i u e r and r

u

a l i poss s ll ,

l l l l es s one t a a a a cili l Oxytoxaceae Lindemann1928 , Centrodiniaceae Amphidomataceae Sournia 1984 Heterocapsaceae P a,

t M es KryptoperidiniaceaeLindemann 1925 (= “dinotoms”)

t t t t h e i P s,T es, es, es, es, odo

o ys K s a Blixaea,Durinskia, Galeidinium, Kryptop um Naiadinium, Naiadinium,

r

,Dinofurcula, m L

i o cili o b s t

e r f f f f f i o a r l l

oce ce o a e o o o o m i Or o a g l poso i o rm rm rm rm m d f o f r f m i ll g y tt o n

pad a, n 1926

ous ss al e i i i i

i t po n n n n t tr Th h

r hoce

g g g g l P m i u e en su l r

a odo m. r

o e; cilia a a a a r ann p

ce e t r i dinofagellates

a. u l acospha t t t t P p a

abu abu abu abu r r a c

r t l

au e Hernández s reserved. a Di e esen e u 1910 F

m

e s, se L l nophys l enso l l l

sene x a a a a ap pas. i t nde t t t t O r end i i i i t i on on on on i es. a xyph cal e t m

ll i r m

v i o o o o a, Tintinnophagus,a, Ty a, ng e e, Bl i f – f f f ann s,

y -

6 7 5 5 e P

epha

Becerril2010 one on s and t

- -

t Hi e he l l

i 6 6

a a

s,Parahistioneis, a n 19

l s t t y l l l t i i

. a a

t t t aph e

w

- one i ud ud r k 2 t t 1993 chloroplast aseyespot; one n ocy i i avy no t t 8 t ud ud i i i

nalse nalse r a

w e i s not r i i

s,Latifascia, nalse nalse

sod

cili t n l a, e

fr n um w

G eridinium, g omp i r r n av i i t e aa e i h u r r s; scales. s; s; one s; antapical c i i

y m e e o r l ; ea s;one antapical s. de f r r ,

t ese annod P t hecalp P he r Amphidoma, r ha l i f y e i es n ll

ce l tday ac a, t i e ll n r , one , r l o i a i u a, m t

m. es. a,

This article isprotected right by All copyright. (schizogony), sporocytes 8 nakedform spores. 1939 with two paranuclearbodies opposi Toxocystis* bands(grooves, epicytic onfolds?) surface, bulbous, knob Spirogregarina* residuum described. stageslater in free spermsac, sporogonia (oocysts?), sporoblasts (sporocysts?)and with rodlets(rhoptries?). epithelialcells. formation oflarge numberof merozoites. Brumpt1913 parasitoporousvacuole intestinal in epithelium or freein intestinallumen. arrangedin bundles forminga pyramid on body surface, amylopectin granules,in large nakedsporozoites. epicellular,syzygy macroof twoof forms meronts: macromerontwith periodof intranuclear development, micromeront Dobellia* Christalloidophora Incertaesedis Mackinnonia*,Myriosporides*, *, Subdivisionsuncertain. tissues,where developmentoccurs, followedby sporozoite release in the faeces. sporozoites existinside intestinal epith fertilizationhost,with the in oocysts releasedwith sporogonyin aqueousenvironment; Merogonyabsent; extracellular gamogony and sporogony; in some species, gamogonyand Incertaesedis Apicomplexa unclear. Merogonyand gametogony absent;both several families described butposition within Incertaesedis bodyflexion, longitud fission,endodyogeny, endopolyogeny, and/or schizogony/merogony; locomotion by gliding, produceto haploid progeny;asexual reproduction of haploid stagesoccurring by binary pellicularmicrotubules; sexual complexconsisting of one ormore polarrings, rhoptries, micronemes,conoid, and sub leastAt one stageof the life cycle with flattened sub ●●

Accepted Article Apicomplexa Levineemend.1980, Adl et al. 2005 –

Sphericalcystswith spherical cytomeres, cytomeres sphericalform sporocytes

Ikeda, 1914 Ikeda,

Légerand Duboscq 1910 –

Apicomplexa: Ap Apicomplexa:Agamococcidiorida Levine1979

Rhabdospora* intracellularin mononuclearleukocytes,

Wood and Wood Herman 1943 icomplexa:Protococcidiorida Kheisin 1956

Dehorne,1934 Echinococcidium* Spiriopsis* inalridges, and/or cilia;mostly parasitic. – Gemmocystis*,Rhytidocystis

Angeiocystis*,Coelotropha*, Grellia*,Eleutheroschizon*, Lifecycle stillconfused, sporozoites invade intesti Spermatobium* -

Aggregata and micromerozoitesproducing gametocysts,oocyst with 1000

ity,where by known, syngamy followedby immediate meiosis Laguesse 1906

Arvyand Peters 1972 – te eachte other, not motile.

Merozoites with 2to 4 fuchsinophile crystalloids.

Porchet1978 – eliumbriefly, theiron way coelomto or vascular

Frenzel 1885 elongate, falciformwith onebroaderend, nucleus

Eis Joyeuxella* –

El en 1895en Sawayella*. ongate,spindle s reserved. –

Merontsin hostepithelial cells, merozoites . -

– pellicularvesicles apical andan

–

Brasil1902 – with s

– Young stagesin spermsac cells,

endothelialcells and erythrocytes, highlydivergent 18SrRNA.

with micronemes and paraglycon. - liketerminus at each end. inglespines and spines

- Trophosphaera*

shaped,cylindrical, with spiral –

Merogonyin host Globidiellum* nalepithelial cells,

Le CalvezLe -

This article isprotected right by All copyright. AcceptedHepatozoon,Ithania* *,, *, Ganapatiella*, Gibbsia*,, Haemolivia, syzygy;endodyogony isabsent. Microgamontsproduce o ●●●●● Léger 1911 oocysts. microgametes; syzygyabsent; zygote rarelymotile; sporocysts usually formedwithin Mature gametesdevelop intracellularly; microgamont typicallyproducesnumerous ●●●● Leuckart 1879(P) monophyletic with subdivisionsartificial and unclear at time.this longitudinal of pellicular ridges; heteroxenous or homo of microgametes, motility generallyvia with gliding possibilitybodyof flexion andundulation cilia,where present, found exclusivelyin microgametes(male gametes); with theexception Completeapical complex, including a closed conoidall in or mostasexual m Conoidasida ●●● Levine 1988(P) marine invertebrates(atleast tunicates). inclusions,bicilia Aciliate,motile infective stage (resemblingsporozoites); spore ●●●●Nephromycida Cavalier ArticleHaemohormidium*,Sauroplasma*, Serpentoplasma*, . axopodium present;without oocyst; sexualityprobably associated with the formationof large Piriform, round,rod ●●●●Piroplasmorida Wenyon1926 Plasmodium,, Rayella*, Saurocytozoon* ,, , Mesnilium*, , Parahaemoproteus, process;oocyst formedin which sporozoites develop. Zygote motile asookinete with conoid;ciliated ●●●●Haemospororida Danilewsky 1885 heteroxenous. (ookinetes)with conoid; macrogametes andmicrogametes formingindependently; Apic Aconoidasida ●●● Mehlhorn et al. 1980 [=Hematozoa Vivier 1982] (P) alcomplex lackingconoid asexual in motile stages; some diploid motile zygotes

- like “Strahlen”.

ted stages ted exist; mostof life cycle extracellular; symbionts/parasites of - shapedor amoeboid; conoid and ciliain absent all stages; polar ring ,, , *, Legerella*, Orcheobius*,Rasajeyna*. ne tone four microgametes,which associatewith macrogamete in Anthemosoma* -

Smith1993, emend. Adlet al. 2019 *,, Babesiosima*, Bartazoon*, Chagasella*,

Nephromyces,. , , s reserved.

microgametesproduced by schizogonous ,Echinozoon*, * xenous. This groupisnot

.

- stage with ,

Haemocystidium,

otile stages; -

like

This article isprotected right by All copyright. Accepted Xiphocephalus,Zygosoma* Sycia*,, Thalicola*, Thiriotia, Trichotokara, Uradiophora*, Urospora, Pyxinioides,Rhabdocystis*, Sphaerorhynchus*, Steinina, Stenophora, Stylocephalus, Porospora*,Prismatospora, Protomagalhaensia, Psychodiella,Pterospora, P Paraschneideria,Phyllochaetopterus, Pileocephalus*, Polyplicarium, Polyrhabdina, Monocystella*,Monocystis, Nematopsis, Nematocystis*, Neoasterophora*, Paralecudina, Hentschelia*,Hirmocystis*, Hoplorhynchus, Lankesteria, Lecudina, Leidyan Diplauxis*,Enterocystis, Ganymedes,Geneiorhynchus, Gonospora, Gregarina,Heliospora, Caliculium,Cephaloidophora, Colepismatophila, Cystobia*,Cystocephalus*, Difficilina, Apolocystis* septum; syzygyfollowed by encystmentof gamonts;oocysts with 8sporozoites. Trophozoite within epimerite gregarineswith septumor in gregarineswithout ●●●●●Eugregari Selenocystis,Veloxidium. moresporozoites. Trophozoite aseptate;with syzygy;encystment of gamonts;oocysts contain 4 ●●●●●Archigregarinorida Grassé1953 (P) trophozoite. end oftrophozoite, cytoplasmic buds,16 merozoites differentiatedat anterior end of two pouches atanterior end; Incertaesedis Article sporocystsabsent; asexual reproduction (merogony)inabsent some species. to gametocystthat contains tofew many oocysts, which eachcontain sporozoites; pairedfrom gamontsin syzygywithin gamet the production of gametocyst;similar numbers of macrogametesand microgametes maturing Mature gamontsusually develop extracellularly; syzygy of gamonts generallyoccurringwith ●●●● GregarinasinaDufour 1828 (P) Toxoplasma,Tyzzeria*, Wenyonella*. ,, , Selenococcidium*, Selysina*, Spirocystis*, Lankesterella,Mantonella*, Merocystis, , Nephrois Dorisiella*,, Elleipsisoma*, ,, Hyaloklossia, , Caryotropha,, , , Defretinella*, *, Dorisa*, enclosedsporocyst in within oocyst. producelarge number of cilated microgametes;zygote is nonmotile; sporozoites always Microgametesand macrogametesdevelop independenty; syzygy isabsent; microgamonts ●●●●● Léger 1911

, Amoebogregarina,Ancora, Ascogregarina, Asterophora, Blab

Gregarinasina: norida Léger1900 (P) ,Meroselenidium, Merogregarina,Platyproteum, Selenidium,

(examples) Exoschizon Digyalum

Atoxoplasma,Barrouxi

.

Koura et 1990al.

Hukui 1939Hukui s reserved. ocyst;syngamy of mature gametesleading –

epicytic folds, schizogonyanteriorat

-

a*,, , onlytransverse epicytic folds, ospora, Ovivora*,Pfeifferinella, ericola, a, Lithocystis,a, yxinia, –

8 oreven This article isprotected right by All copyright. separatedby one or two microtubules). Somaticdikinetids with postodesmata(overlapping postciliary microtubular ribbons ●●●Postodesmatophora Ger phylogenyplaces a familya higherat hierarchical rank. investigations (morphologicand/or genetic).Families arranged are alphabetically, unless contains some polyphyleticor paraphyletic taxa markedby (P) which require further and recentphylogenomic analyses (e.g., Gentekakiet al., 2014). Thecurrent classification 32 form synkaryon the or zygotic nucleus. present,by conjugation typically with mutualexchange of ha transversemicrotubular ribbon arising in theregion oftriplets 4 9,tripleta kinetodesmal fibrilstriatedor rootlet homologue arising near triplets5 one diploid ;somatic havingkinetids a postary microtubular ribbonarising f Cellswith nucleardimorphism, including a typically polygenomic macronucleusand at least Ciliophora●● Doflein,1901 [Ciliata Perty, 1852; Bütschli,1887] sporocysts). putativelybiciliated male gametes. Oocystswith many(10 microgametocytesor microgametoblasts apparently followed by thei from posterior the part of female merogamonts.Male gamogony:budding of multinuclear motile andsexually differentiated. Female oogamy: continuous budding of macrogametes proceedswithin thesame individual(merogamont) throughout its lif Permanent multinuclearityand gametogenesis: nuclear division merogonyof and gamogony ●●●●Blastogregarinea andChatton Villeneuve emend. 1936, Simdyanov 2018al. et cel host aciliate;oocysts without sporocysts containing4 nakedsporozoites; epicellular localization in Oocystsand merontswith attachment“feeder” organelle; anisogamous, microgametes 2019al. Machadoella* Coelogregarina*,Farinocystis*, Gigaductus*,Lipocystis*, Lipotropha*, Lymphotropha*, gamonts;oocysts contain sporozoites. 8 Trophozoite ●●●●● Grassé 1953

Acceptedordering The of themajor taxa followsarrangement the of most SSU Article

l.

Cryptosporidium withor epimerite mucron; multiple rounds ofschizogony/merogony; pairing of Chattonaria , , , Menzbieria,Ophryocystis, Schizocystis*, Syncystis, Tipulocystis*

, Siedleckia .

assimovaSeravin, & 1976 ●●●●●Cryptogregarinorida Cavalier .

32

Apicystis,Aranciocystis, Caulleryella*, s reserved.

– 16) free sporozoites (no ploid gametic nucleithat tofuse – 6;sexual reproduction, when - Smith 2014 emend Adlet espan;merogamonts r dissociation r small into - rRNAphylogenies

– 8,and a

rom .

This article isprotected right by All copyright. ●●●●●SpirostomidaeStein, 1867 ( ●●●●●Peritromidae Stein,1867 ( ●●●●●●Maristentoridae Miaoal.,2005et ( ●●●●●● Maristentoridae the and Folliculinidae. aWith node ●●●●●Coliphorina Jankowski,1967 ●●●●●Gruberiidae Shazib etal., 2014 ( ●●●●●Fabreidae Shaz ) ●●●●●Condylostomatidae Kahlin DofleinReichenow, & 1929( ●●●●● ●●●●●Blepharismidae Jankowskiin Small and Lynn, 1985( ribbo Polygenomic macronucleusdividing by extra ●●●●HeterotricheaStein, 1859 ●●●●●Geleiidae Kahl,1933 ( ●●●●●● ●●●●●●CryptopharyngidaeJankowski, 1980 ( sedimentsand anoxic waters. nucleiin clusters, typicallytwo macronucleiand one micronucleus; typically in anoxic and oneintraoral (intrabuccal) kinety cnidocyst surfacenon N ●●●●●LoxodidaJankowski, 1980 ●●●●●Kentrophoridae Jankowski,1980 ( postciliarymajor ribbons separatedby two groupsof microtubules. diploidofDNA; amount macronucleinot dividing but replaced bydivision of micronuclei; Two to manymacronuclei containing approximately sometimes but slightly mor ●●●● Corliss, 1974

Accepted Articleon - co ns separatedby one . Climacostomidae ntractile Loxodidae - like organellessome in genera; - - ciliated,except forsingle marginal (‘bristle’?) kinety;extrusomes assomatic baseddefinition: the clade stemming from the most recentcommon ancestor of ;somatic cilia as ofdikinetidsfiles mainly the on right surface withleft the Bütschli,1889(

Dons, 1914 Dons, ( ib et al.,ib 2014 et ( Repak,1972 ( )

Peritromus)

Anigsteinia ) Folliculina)

;stomatogenesis monoparakinetal or buccokinetal; Fabrea)

Climacostomum) Gruberia) ) oral kinetidsas two dikinetidal Maristentor)

-

macronuclearmicrotubules; major postciliary

, s reserved. Cryptopharynx) )

Blepharisma)

Chattonidium

perioral kineties

,

e than the This article isprotected right by All copyright. and leftmargins of body; the DNA replication in themacronucleus accomplished bya usuallyclockwise the into cavity, oral either arou Conspicuous rightand left oraland/or preoral ature; leftserial oralpolykinetids leading, ●●●●●Spirotrichea Bütschli,1889 resemblinga cirrus. sometimes accompaniedby a partner ki Somatic kineties aslinear polykinetids; each kinetosome bearinga kinetodesmal fibril,and Incertaesedis microtubulesof rhabdos. delimitedby circumoral dikinetids, but apparently withoutnematodesmata and bu kinetiesabsent; extrusomes asoral toxicysts; S Incertaesedis ciliaryrows; caudal cilia. watersof anoxic Cariaco Basin,Venezuela. Atleast two adoralorganelles; longitudinal positions283 unique molecular signature ‘GAAACAGUCGGGGGUAUCAGUA’(spanning nucleotide archwayWith Incertaesedi Armophorea and (A) Litostomatea (L)). the mostrecent common ancestor of theSpirotrichea (S)and Lamellicorticata (i.e., Groupidentified by phylogenomics. a node With ●●●●SAL Gentekakiet al., 2014 chromosome. one ormore micronuclei;each macronucleuspossibly organizedsingle as a composite Nuclearapparatus acluster of simila [Protocruziidae Jankowski,1980; Protocruziidia Puytoracet de al., 1987] Incertaesedis Po ●●● Lynn,1996 ●●●●●Stentoridae Carus,1863 ( omati

Accepted Articlelygenomic macronucleusdividing by intramacronuclear microtubules. c cilia bristle s - -

305in shaped kinetyaroundoral opening andextending posteriorto body end; with Protocruzia SAL: SAL:Mesodiniidae Jankowski,1980 SAL: Intramacronucleata: -

like, at of least twoarranged types, in girdles around thebody Cariacothrix Phacodinium Phacodinium. GenBankaccession number GU819615);confirmed only deepfrom Cariacothrix caudata .

Stentor) Orsiet al., 2012 [Cariacotrichea Orsiet al., 2011] Prowazek,1900 [Phacodiniidia Smalland Lynn, 1985]

Protocruzia r - . sizednuclei with paradiploid macronucleisurrounding

netosomein some regionsof body, the thus

. s reserved. oralregion apical, domed, circular,and

Faria da Cunhada Faria and Pinto 1922 - nd a broadnd anteriorend alongor anterior based definition:the clade stemming from

lge ; brosse ;

This article isprotected right by All copyright. AcceptedPerilemma present.Possibly, comprises also ●●●●●●PerilemmaphoraBe ●●●●●●●●Pseudoamphisiellidaeet al., Song 1997 ( Paradiscocephalus) ●●●●●●●●Discocephalidae Jankowski,1979 ( membranes. hypotrichs;anlage ofundulating membranessplits formed,which always are derived thefrom right developmentof frontoventral caudalcirrioriginate from rightmostdorsal kineties anlagenby frontoventral frontalcirrus originates anteriorfrom end of undulating membrane Leftand right marginalrows intrakinetally;form epiapokinetal stom ●●●●●●●Discocephalida 1982Wicklow, ●●●●●●●●Uronychidae Jankowski,1975 ( ●●●●●●●●Gastrocirrhidae Fauré ●●●●●●●●Euplotida ●●●●●●●●Certesiidae Borror&Hill, 1995 ( Article●●●●●●●●Aspidiscidae Ehrenberg,1830 ( Hypoapokinetalstomatogenesis in subsurfacetube. ●●●●●●●EuplotidaSmall and Lynn, 1985 kinetosomesin cysts. overor replacement of only ventral infraature;somatic typic fibrils;stomatogenesis generallyapokinetal, sometimes hypoapokinetal or parakinetal; turn side;somatic dikinetids with ciliaanterior at basal bodies and retentionof kinetodesmal structure; somaticature usuallyin dikinetidaldorsalonrows side and formingcirri flattened; rightpreoral ature as paroral and/or endoral with diplo Ador ●●●●●●EuplotiaJankowski, 1979 fragmentation. complicated migratingstructure called replication extensiveband; chromosomal alzone usuallywith numerouspolykinetids (paramembranelles);body dorsoventrally

- transverse cirralanlagen; dorsal kinetyanlagen formedin secondarymode;

e Ehrenberg,1838 (

rger,2008 - transversecirral anlagen of primary type; migratingcirri are not - Fremiet,1961 (

Euplotes)

Diophrys Aspidisca) Certesia) Diophrys s reserved. Discocephalus - mostcirral anlage all in traditional Gastrocirrhus)

(P) transversely to endoral form and paroral ,

Leptoamphisiella Uronychia)

andthe discocephalids.

allyresorptionno of all , Prodiscocephalus multi

-

orpolystichomonad - atogenesis;left anlage; many - segmentation mode; , Pseudoamphisiella)

,

- on ventralon most

- This article isprotected right by All copyright. ●●●● ●●●●●●●●●Spirofilidae vonGelei, 1929 ( ●●●●●●●●●Schmidingerotrichidae Foissner,2012 ( ●●●●●●●●●Psilotrichidae Bütschli,1889 ( ●●●●●●●●●Pseudoa ●●●●●●●●●Psammomitridae Jankowski,1979 ( ●●●●●●●●●PlagiotomidaeBütschli, 1887 ( ●●●●●●●●●Parabirojimidae Daiand 2011Xu, ( ) ●●●●●●●●●Oxytrichidae Ehrenbe ●●●●●●●●●Keronidae Dujardin,1840 ( ●●●●●●●●●KahliellidaeTuffrau,1979 ( ●●●●●●●●●Holostichidae Fauré ●●●●●●●●●H ●●●●●●●●●Gonostomatidae Smalland Lynn, 1985 ( ●●●●●●●●●EpiclintidaeWicklow and Borror, 1990 ( ●●●●●●●●●AtractosidaeBourland, 2015 ( ●●●●●●●●●Amphisiellidae Jankowski,1979 ( monophyletic andhave limited support from molecularphylogenetics of small subunit rRNA. thatthis taxonisartificial. Many theof families listedhere alphabetically notare streaksin two groups fordifferentiation of ventral somati stomatogenesisparakinetal or apokinetal, if groups (i.e., sporadotrichs); frontoventralcirri, typicallyconspicuous, arranged in specific,localized frontal and v V ●●●●●●●●Stichotrichida Fauré somaticature; kinet epiapokinetalor parakinetal; complete turn with ciliaanterior at basal bodies andlossof kinetodesmal fibril;stomatogenesis ventralon side, rarely with j diplostichomonad;somatic ature usually in dikinetidalrows dorsalon side and forming cirri as paroraland/or endoral, paroral diplo margins of dorsoventrallyflattened body, rar Adoralzone usuallywith numerouspolykinetids (paramembranelles)along anteriorand left ●●●●●●●Hypotrichia Stein,1859

Accepted Articlecirrientral as one or morelongitudinal and linear (not zig ●●●●●Trachelostylidae Smalland Lynn, 1985 (

alteriidae ClaparèdeLachmann, and 1858 ( osome mphisiellidaeet al., Song 1996 ( - resorbingcysts. umpingbristles instead of andkineties cirri; somatic dikinetids dorsalature typicallyregularly distributed in longitudinal files; - Fremiet,1961 (P) -

Fremiet,1961 ( rg,1830 (P) ( - Deviata

Kerona orpolystichomonad, endoral mono Spirofilopsis Psilotricha,Urospinula) Atractos) - Plagiotoma)

over replacementor of ventral and dorsal apokinetal, mayoccur with five orsix anlagen elyaroundbroad apicalend; rightpreoral ature Amphisiella s reserved. , ) Cyrtohymena Parabirojimia

Psammomitra) Kahliella Holosticha,Uncinata)

Schmidingerothrix) Epiclintes) Trachelostyla) Cotterillia, Gonostomum) Pseudoamphisiella) , Strongylidium)

cature (i.e.,sporadotrichs)

) , Halteria

- Bistichella) zagUrostylida)as in , , Tunicothrix) Gastrostyla

, Meseres)

,

Oxytricha - ,rarely

files orasfiles .Note entral ,

This article isprotected right by All copyright. ●●●●●●●●Choreotrich ●●●●●●●●●Tontoniidae Agatha,2004 ( ●●●●●●●●●Strombidiidae Fauré ●●●●●●●●●Pelagostrombidiidae2004 Agatha, ( ●●●●●●●●●Cyrtostrombidiidae2004 Agatha, ( stomatogenesisin a subsurface tube. shaped extrusomes (trichites);usually with polysaccharidiccortical platelets; hypoapokinetal fragmented;somatic dikinetids withcilium a only anteriorat the or left basal body; contractile tail thatmight lostbe secondarily;usually two somatic kineties that bemight Adoralzon ●●●●●●●●Oligotrichida Bütschli,1887 body;hypoapokinetal stomatogenesis; enantiotropic cell division. monostichomonad;naked orwith somatic lorica; aturein one to manyrows arranged around membranelles,C Adoralzone broad around apicalcell end, usually composed of large collarand small buccal ●●●●●●●Oligotrichia Bütschli,1887 ●●●●●●●●●Urostylidae Bütschli,1889 ( ●●●●●●●●●Pseudourosty Pseudokeronopsis) ●●●●●●●●●Pseudokeronopsidae Borror& Wicklow,1983( ●●●●●●●●●Hemicycliostylidae Lyual., 2018 et ( ●●●●●●●●●Bergeriellidae Liu etal., 2010 ( differentiating anlagenfrom ofmany short oblique kinetofragments. present;be caudal cirri maypresent;be posteriorends are offset developed (= zig zig ventralsurface between and right left filesof marginal cirri and ranging afrom “single” offile S ●●●●●●●●UrostylidaJankowski, 1979 (P) ●●●●●●●●●Uroleptidae Foissnerand Stoeck, 2008 ( omatic ventralomatic ature as frontoventralcirri in zig

Accepted Article- zagor offset cirri to multiple andshort offiles cirriwhose anteriorand sometimes e C - shaped,polykinetids becomesmaller towardscytostome; naked; rarelywith - shap

ida Small&Lynn, 1985 ed,circular, or with secondaryventral endoralgap; lidae Jankowski,1979 ( - Fremiet,1970 (

Laboea Bakuella,Diaxonella duringdivision morphogenesis, zig -

zag) (e.g., Bergeriella,Neourostylopsis) s reserved. Cyrtostrombidium) , - Pelagostrombidium) Hemicycliostyla,Australothrix) Tontonia) zag files,running almost the fu Strombidium) Pseudourostyla)

Paruroleptus Eschaneustyla

Apoholosticha , Urostyla)

(P)

,

Uroleptus)

)

;transverse cirri may

,

- zagcirri

lllength of needle - This article isprotected right by All copyright. (Probably,synonymous with Petalotrichidae) Accepted●●●●●●●●●●Cyttarocylididae Kofoid andCampbell,1929( ●●●●●●●●●●Ascampbelliellidae Corliss,1960 ( Incertaesedis coverage andsettlement of tree topologyare currentlyst peduncle.Molecular phylogenies distinctlycontribute in far arrangedin specializedfields androws; frequentlywith extrusive capsules; with contractile Adoralzone circular;with hyaline,entirely partiallyor agglutinated lorica; ●●●●●●●●●TintinninaKofoid Campbell, & 1929 ●●●●●●●●●●Strombidinopsidae Smalland Lynn, 1985 ( ●●●●●●●●●●Stro ●●●●●●●●●●LohmanniellidaeMontagnesand Lynn, 1991 ( ●●●●●●●●●●LeegaardiellidaeMontagnes, Lynnand 1988 ( Adoralzone circular,rarely with secondaryventral naked.gap; ●●●●●●●●●StrobilidiinaJankowski,1980 (P) ArticleLynnella semiglobulosa surface; two macronuclearnodules. Adoral zone with (probablysecondary) ventral gap. middle dividers;stomatogenesis in subsurfacepouch; oral primordium parallel ventralto cell onlytheposteriorat basal bodies;endoral membrane extends acrossperistomial fieldi derived kinetid structures:one is monokinetidal, the othercomposed of dikinetids with cilia extendinginto bucc affiliation withaloricate the choreotrichids:proximalmost collar membranelles elongated, algorithmsused in molecular approaches. Morphological and ontogenetic data suggest an Sistergrouprelationship Lynnellidaal.,Liu 2015] et (M) Incertaesedis pronounced primordium(oral parallel to lateral cell surface). body;hypoapokinetal stomatogenesis in a subsurf body);somatic aturein oneto many longitudinal or curved rows arranged around entire (monokinetids,diated dikinetids, dikinetids with single umat anterior or posterior basal lorica;structure of somatic kinetids highlydiverse peristomial rim,proximalmost ones elongated, extending into buccalcavity; nakedor with Adoralzone circular,rarely with secondaryventral collargap; polykinetids extend across

Tintinnina: Choreotrichida: bilidiidaeKahl in Doflein andReichenow, 1929( alcavity; two longitudinalsomatic kinetiesboth of which with distinctly .

of of this monotypic genus and orderchanges depending on the Helicostomella Lynnella

Liu etal., 2011[Lynnellidae 2011; Liu et al., ,

Tintinnopsis

s reserved. Ascampbelliella)

evenwithin singlespecimens ace pouch;ace enantiotropic cell division less

(P),plus several further genera. Strombidinopsis) illinsufficient. - Cyttarocylis) reaching revision,but taxon Lohmanniella) Leegaardiella)

Strobilidium)

somaticature (P)

n This article isprotected right by All copyright. migrating oral kinetofragments. stomatogenesis telokinetal,commencing dorsal in or dorsolateral somatic kineties,and with membranelles;somatic dikinetids typicallyvery narrowly spac apparatuscomposed of a dikinetidalparoral membrane and several multi Postarymicrotubular ribbons arranged in asingle layerofright and between kineties;oral ●●●●●LamellicorticataVd clearlyno differentiated dorsal kineties. uniform,no clearly defined marginal cirral rows,cirri mixed with dikinetids dorsalon side,i.e., weaklyWith differentiated andn ●●●●●●Kiitrichidae,Nozawa, 1941 Prolicnophora attachedto substrate or by host ated, mobile, posterior adhesive disc. a; of Bodyhour ●●●●●●Licnophoridae Bütschli,1887 ●●●●●●●●●●Xystonellidae Kofoid andCampbell, 1929 ( ●●●●●●●●●●Undellidae Kof ●●●●●●●●●●Tintinnidiidae Kofoid andCampbell, 1929 ( Salpingella ●●●●●●●●●●TintinnidaeClaparède andLachmann, 1858 ( ●● Schmidingerella ●●●●●●●●●●Rhabdonellidae Kofoid andCampbell,1929( ●●●●●●●●●●Ptychocylididae Kofoid andCampbell,1929( (Probably,synonymous with Cyttarocylididae) ●●●●●●●●●●Petalotrichidae Kofo ●●●●●●●●●●Nolaclusiliidae Sniezeket al., 1991 ( ●●●●●●●●●●Favellidae Kofoidand Campbell, 1929 ( ●●●●●●●●●●Eutintinnidae Bachyal.,et 2012 ( ●●●●●●●●●●Epiplocylididae Kofo ●●●●●●●●●●Dictyocystidae Haeckel,1873 (

Accepted Article●●●●●●●●Stenosemellidae Campbell,1954( anteriordiscwith serialoralpolykinetids aroundoral region;ectosymbionts, temporarily - glass shaped,glass both ends discoidal; posterior discadhesive, with peripheral rings , Tintinnus) .

’ačnýal.,2010et oidand Campbell, 1929 (

on id andCampbell, 1929 ( id andCampbell, 1939 ( -

groupedsomatic ature,i.e., cirri ventralon side generally

Caryotricha

Dictyocysta) s reserved. Dartintinnus,Eutintinnus) Stenosemella) Nolaclusilis) ,

Kiitricha Favella) Undella) Tintinnidium) Dadayiella

Petalotricha) Epiplocylis) Cymatocylis Metacylis Amphorellopsis .

ed ined anteriorbody portion;

(P)

, , Parafavella

Rhabdonella

Licnophora

,

Ptychocylis) - rowedadoral , Salpingacantha , Xystonella) , ,

,

This article isprotected right by All copyright. ●●●●●●●CaenomorphidaePoche, 1913 ●●●●●●●●Sicuophoridae Amaro,1972 ( ●●●●●●●●Nyctotheridae Amaro,1972 (P)( ●●●●●●●●Inferostomatidae Ky,1971 ( ●●●●●●●●ClevelandellidaeKidder, 1938 ( vertebrates. life cycle host; of the endocommensals in diges anchoredin a karyophoremany in species; conjugation often synchronized with reproductive ofthose the third(heteromembranelles); paroral as diplostichomonad; cathetodesmal fibrils;oral polykinetids with a fourth ro Bodytypically flattened; somatic dikinetids with non ●●●●●●●ClevelandellidaPuytoracde & Grain,1976 Palmarella reduced,more orless straight. Perizonal withstripe f spacedsomatic ciliature. Short peristomium with cup deep, Preoraldome flattened, without torsion.Cortex,with interkinetalridges. Sparse widely ●●●●●●●●Tropidoatractidae Rot Cirranter Obpyriform clavateto Metopida with perizonalciliary stripe composed of four kineties. ●●●●●●●●Apometopidae Foissner,2016 kineties. Anteriorpartof body uniquely twisted to the left; with series of five perizonalsomatic ●●●●●●●●Metopidae Kahl,1927 (P) five or perizonalfewer stripe kineties. ●●●●●●●Metopida(P) Jankowski, 1980. Free Incertaesedis habitats. chromosomal fragmentation;stomatogenesis typicallypleurokinetal;in oxygen hydrogenosomes;contain cytoplasmic endosymbiotic methanogenicbacteria; extensive Somaticdikinetids; energy ●●●●●●ArmophoreaLynn, 2004 (R) Accepted●●●●●●●●Neonyctotheridae Affa’a,1987 ( Article

, Bothrostoma Urostomides. , Tropidoatractus

Armophorea: , Brachonella

- generatingorganelles as anaerobic mitoch

MylestomatidaeKahl in DofleinReiche & terová etal ,

Eometopus

Inferostoma)

Sicuopho

Clevelandella) Neonyctotherus) Nyctotherus) ., 2018., - s reserved. livingor endocommensal Armophorea with tive tractsof invertebrates and some , ra) -

microtubularretrodesmal and

ive rowsarranged in false kineties.

w of kinetosomes directlyopposite

, Parametopidium, - likebuccal cavity, adoralzone

now,1929 ( ondria or Tesnospira - depleted Mylestoma) - .

This article isprotected right by All copyright. side left of the proboscis. aWith hybrid circumoral kinety;a staggered dorsal brush;and a stripewithout cilia on the ●●●●●●●●DileptidaJankowski, 1978 around cytostome. the kinetiesalong proboscis,and with leftbranch ofcircumoral kinetyaccompanied by many obliquepreoral leastat one perioral kinety,extending along one borderof the ventral surface of the body, i.e., at base of the pro circular or elliptical, possibly with permanent cytostome, distant from extreme anteriorE end of ●●●●●●●Rhynchostomatia Jankowski1980 kinetidsadjacent to the oral region; stoma supporting thecytopharynx, nematodesmata but mayalso arise “oralized”from somatic and well dikinetids bearingclavate a;lamina corticalisor e severaldorsalsomatic differentiatedkineties as brosse or brush withkinetids specialized radialtransverse ribbon extendingtransversely into adjacent the somatic ridge; one to tangentialtransverse extending anteriorly into thesomatic ridgeto l the a laterallydirected kinetodesmal fibrilthatdoes not overlap those ofadjacent kineties;one Somat ●●●●●● with Armophorea. Notethat ●●●●●●●● ●●●●●●●●Disc oral pits; polykinetids inconspicuous, typicallyless thanten in number. with armour Discoid,lateral ●●●●●●●OdontostomatidaSawaya, 1940 Litostomatea. Smallsubunit ribosomal DNAanalysis asuggests sister group relationship with the absent; free tufts;several oral polykinetids small in oral cavity posteriorin cellhalf; paroral possibly Bodyglobularor conical, rigid, twistedto the left; somaticcilia small as orkineties cirrus

Acceptedlongate to flask Article ic monokinetidswith two transverseribbons, a slightly convergent postary ribbon, and

- LitostomateaSmall &Lynn, 1981 developed;oral atureas simple kinetids whichfrom nematodesmataarise, Epalxella EpalxellidaeCorliss,1960 - - likecuirass and oftenshort posterior spines;somatic cilia arising corticalfrom swimmin

Caenomorpha theother border; toxicystsventralin the band of the proboscis or distributed lycompressed, wedge omorphellidae Corliss,1960 ( - shaped body with dorsal proboscis of varying relative length; oral region

has beenhas geneticallycharacterized with Plagiopylea but g. g. Complexperizonal stripeciliary comprising morethan five kineties.

boscis, but with , Ludio , Sulfonecta

- (

Epalxella, orhelmet

togenesistelokinetal.

right branchright ofcircumoral kinetyaccompanied by

Discomorphella) s reserved. . -

Saprodinium) shaped, typicallynearly as wide as long, cto - endoplasmic fibrillarlayer oftenpresent

eft of the kinetid,one Saprodinium - like

This article isprotected right by All copyright. body,in but non Somatic ciliaseries as of apparently short kinetofragmentsin oneor more girdles around ●●●●●●●●Didiniidae1913 Poche, ●●●●●●●●●Pleuroplitidae Foissner, ●●●●●●●●●Homalozoonidae Jankowski,1980 ( ●●●●●●●●●Enchelyodonidae Foissneret al., 2002 ( absent,oralized somatic monokinetids bearnematodesmata forming the rhabdos. microtubulesextend supportto the cytostome Oral ●●●●●●●● pa Anteriorregion of body the (=head),bulb ●●●●●●●●LacrymariidaeFromentel, de 1876 Incertaesedis and/or monophylyas several members groupwith Trichostomatia,and its gener loss ofanterior basal body; toxicysts; predatory life style.Questionable supportits for ciliaa forming dorsal brush, monokinetids bearnematodesmata forming the rhabdos;a supportthe cytostome Oral region typica ●●●●●●●HaptoriaCorliss, 1974 (P) circumoral kinetydikinetidal throughout; internal oral basket clavate. condensed somaticciliature; dorsalbrush three shorter ventralthan one; distinct groove (fossa)on right Bodybroad ovoid; proboscis immobile only or slightly mobile,with side dorsal distinctly ●●●●●●●●Tracheliidae Ehrenberg,1838 Rimaleptus) ●●●●●●●●● ●●●●●●●●●Dileptidae Jankowski,1980 (

Acceptedcked kinetidsthatabut the circumoral dikinetids. Article region typicallycircularor elliptical, surrounded bycircumoral dikinetids whose Trachelotractus HaptoridaCorliss, 1974

Dimacroca

Haptoria: - ciliated regions,non llycircularor elliptical, with circumoraldikinetids whose microtubules -

cytopharynx;where circumoraldikinetids are absent, oralized somatic ryonidae Jankowski,1978 ( branch basallyin theclass Litostomatea. Chaenea.

partiallyreduced; somatic otherwisekinetids monokinetidalafter

1996( - ciliated kinetosomesare arrangedin meridional -

Apodileptus like,covered by shortoblique withkineties densely Pleuroplites)

- s reserved. cytopharynx;where circumor - Homalozoon)

to four Dimacrocaryon,Monomacrocaryon Lacrymaria Enchelyodon,Fuscheria) , -

rowedand isoarchistichad; sidecontaining and surroundedby

nteriorcondensation ofdikinetidal

, .

Pseudomonilicaryon)

Trachelius a Helicoprorodon aldikinetids are

.

,

This article isprotected right by All copyright. anaerobicendosymbionts in vertebrates. Acceptedmitochondria;stomatogenesis telokinetal, cryptotelokinetal in entodiniomorphids; typically absent;alveoli often filled with “skeletal”material; hydrogenos somaticmonokinetids; narrowly spacedsomatic dikinetids forma clavate field;toxicysts Oral regionor oral cavity densely ated,sometimes organized as “polykinetids” ●●●●●●●Trichostomatia Bü anteriorend; oral region apical;marine psammobiont. toxicystsdistributed along perioral ridge thatmakes onefrom toserveral turnsaround Body,elongate, ●●●●●●●Helicoprorodontidae Small&Lynn, 1985 ●●●●●●●●●Trachelophyllidae1882 Kent, ( ●●●●●●●●●Spathidiidae Kahlin DofleinReichenow, & 1929( ●●●●●●●●●Pseudoholophryidaeet Berger al., 1984 ( ●●●●●●●●●Enchelyidae Ehrenberg,1838 ( ●●●●●●●●●Apertospathulidae Foissneret al., 2005 ( ●●●●●●●●●Actinobolinidae Kahl,1930 ( ●●●●●●●●● Somatic kineties curvedanteriorly; three Article●●●●●●●●SpathidiidaFoissner &Foissner, 1988 ●●●●●●●●●Kentrophyllidae etal., 2015 Wu ( ●●●●●●●●●Litonotidae 1882 Kent, ( ●●●●●●●●●AmphileptidaeBütschli, 1889 ( between two macronuclearnodules flattenedbody, bordering slit a kinetidsas left and right componentsextending along theventral edge of the later integratedin oneor two dorsolateral kineties; somatica Bodyleaf ●●●●●●●●PleurostomatidaSchewiakoff, 1896 in 3 kineties;brosse typically - 5 kineties. - tionon both bodysides,typically more dense on the rightside like orlaterally compressed; free Acropisthiidae ,Monodinium. vermiform,contractile; somatic ation holotrichous; 2 a ofclavatefield cilia or“sensory bristles” usually clearly detectable Foissner&Foissner, 1988 ( tschli, 1889tschli, - like cytostome,surrounded by toxicysts ;voracious cytotrophs. Litonotus)

- Actinobolina) ro

- Amphileptus) Trachelophyllum) weddorsalbrush. Enchelys swimming, typicallyongliding substrate; the Kentrophyllum,Epiphyllum) oralregion ventral and elongated, with oral s reserved.

) Apertospathula)

Pseudoholophrya) Helicoprorodon Acropisthium

Spathidium) omesdeveloped from - ,

5brosse kineties;

Chaenea) .

; ; dorsal,; brosse micronucleuslying

;

oralized

ally This article isprotected right by All copyright. Accepted vacuole complexpresent only overlyingas its somatic kinetids Somatication markedlyreduced, as andtufts bands; ●●●●●●●●●Blepharocorythina Wolska, differentiated “polykinetids”;often commensals in mammalianhost. functioningas syna reduced,appearing o microfilamentouslayer between ecto Pellicleand thickened, firm often drawn outintoposterior spines; cortex with thick ●●●●●●●●EntodiniomorphidaReichenow inReichenow, Doflein& 1929 bya k duringstomatogenesis to becomethe proter’s vestibulum pole,lined byextensions of somatic kineties,with vestibulum parental migrating anteriorly Endoplasmic polysa ●●●●●●●●Isotrichidae Bütschli,1889 Entodiniomorphida (endo),and Macropodiniida. stemming from the most recentcommon ancestor of the Isotrichidae (Iso), Groupidentified by SSU rRNAphylogenies. a node With Article●●●●●●●Isoendo(R) ●●●●●●●●●Pycnotrichidae Poche,1913 ( ●●●●●●●●●ProtohalliidaeCunha da & Muniz, 1927( ●●●●●●●●●Protocaviellidae GrainCorliss, in 1979 ( ●●●●●●●●● ●●●●●●●●●Buetschliidae Poche,1913 ( Neobalantidium) ●●●●●●●●●Balantidiidae Reichenowin Dofleinand Reichenow,1929( mammals,except formarsupials appearorganized as “poly depressionor vestibulum, densely ated by extensions of somatic kineties whose cilianot do Cortexoften with thickmicrofilamentous layer between ecto ●●●●●●●●VestibuliferidaPuytoracde et al., 1974 aryophore;often endocommensals in ungulate ruminants. Paraisot

(P) ; oral ; asarea only a slightdepression ato deepone, often with well ccharidereserves; somatic mucocysts; richidae nlyinzones bands, or tufts, oftenas polybrachykineties, and kinetids”

da Cunha,da 1917 ( .

; endocommensalsin fishand herbivorous placental -

and endoplasm; 1971 Buetschlia) Pycnothrix s reserved. Paraisotrichia)

Protocaviella) , perhaps , Protohallia) presumed remnantof concrement somaticature typically -

baseddefinition: clade the ;macronucleus mayanchoredbe - oralcavity ornearat posterior

andendoplasm;

. Buxtonella

Dasytricha

Balantidium,

)

,

Isotricha markedly oralregion a .

- This article isprotected right by All copyright. characterthis does not exist. CON (O), (N), Phyllopharyngea (P), (P),and Plagiopylea hence (P), stemming from the most recentcommon ancestor of the Colpodea (C), Groupidentified by SSU rRNAphylogenies. a node With ●●●●CONTHREEPLynn in Adlet al., 2012 [Ventrata Cavalier ●●●●●●●●●●PolycostidaeCameron ●●●●●●●●●●Macropodiniidae Dehority,1996 ( ●●●●●●●●●●Amylovoracidae Cameron& O’Donoghue,2002 ( forestomach of macropodid andvombatid marsupials. cryptotelokinetal,or possibly apokinetal nematodesmata arising thesefrom kinetids;somatic mucocysts; stomatogenesis telokinetal Oral cavityanterioras an vestibulum lined byextensions of somatic kineties,supported by ●●●● ●●●●●●●●●●Troglodytellidae Corliss,1979 ( ●●●●●●●●●●Telamodiniidae Latteur&Dufey, 1967 ( ●●●●●●●●●●Spirodiniidae Strelkow,1939 ( ●● ●●●●●●●●●●Polydiniellidae Corliss,1960 ( ●●●●●●●●●●Ophryoscolecidae Stein, 1859 ( ●●●●●●●●●●Gilchristidae Ito,Ishihara & Imai,2014 ( ●●●●●●●●●●Cycloposthiidae1913 Poche, ( vestibularpart(s) function polysaccharide of reserves (e.g.,amylopectin granulesplaques) or thickened,often drawn into out spines; oftenbands, arra Somaticature markedlyreduced, appearing in tufts,sometimes elongated as spiralled ●●●●●●●●●EntodiniomorphinaReichenow in Doflein and Reichenow,1929 ●●●●●●●●●●Pseudoentodiniidae1986 ( Wolska, ●●●●●●●●●●ParentodiniidaeMiyazaki Ito, &Ima ●●●●●●●●●●Blepharocorythidae Hsiung,1929 (

Accepted●●●●●●●●RhinozetidaeVanHoven, Gilchrist &Hamilton Article - ●●●●Macropodiniida Lynn,2008 (R) threeP.“Ventrata” suggestsa ventral morphological synapomorphy forthe butgroup, ingas syna, of twoa pre parts, nged aspolybrachykineties, and functioningas syna; pellicle and firm sensu stricto.

& O’Donoghue,2003 ( - prominentskeletal plates in many species,composed ; in ; terrestrialashabitats endocommensals in the vestibularband in theperistomial regionand a

Polydiniella) Spirodinium) Cycloposthium) Troglodytella) Entodinium s reserved. Macropodinium) Blepharocorys) i,2002 ( Pseudoentodinium) Telamodinium) Gilchristia)

- ,

baseddefinition: clade the Parentodinium) Ophryoscolex

Polycosta) -

Attwell,1988( - Smith,2004] (R) Amylovorax)

; oral cilia often

Oligohymenophorea ,

Polyplastron) Rhinozeta)

This article isprotected right by All copyright. ●●●●●●●Synhymeniidae Jankowskiin Small&Lynn, 1985 ( ●●●●●●●Scaphidiodontidae Derouxin Corliss,1979 ( ●●●●●●●Orthodonellidae Jankowski,1968 ( ●●●●●●●Nassulopsidae Derouxin Corliss,1979 ( beneath kineties asnematodesmata; cyrtos conspicuous. Ribbon ●●●●●●Synhymeniida Puytoracetde al. in Deroux,1 radiallyarrangedmicrotubular ribbons, called phyllae. extendingposteriorly to accompanyribbons of moreanterior monokinetids; oral region with accompaniedby a left kinetodesmal fibril,a reduced orabsent transverse microtubularribbon thatisusually Theciliated stage with somatic kineties mostlyas monokinetids thateach havelateral a ●●●●●Phyllopharyngea Puytoracde et al., 1974 cytopharyngealbasket asymmetric. Conspicuous corticalpapillae dorsalboth on and ventral faces;mucocysts rod Incertaesedis Groupsnear Plagiopylea in molecularphylogenies. Incertaesedis Gr Incertaesedis Groupsnear Plagiopylea in molecularphylogenies. Incertaesedis Groupsnear Plagiopylea in molecularphylogenies. Incertaesedis

Accepted Articleoupswithin Plagiopyleamolecular in phylogenies. - like subkinetalnematodesmata arising somaticfrom monokinetidsand extending

CON CON CON CON CON - - - - - threeP:Discotrichidae Jankowski,1967 [Discotrichida threeP:Pseudotrachelocercidae Song,1990 threeP: threeP:Cyclotrichiidae Jankowski,1980 threeP: - directedt Paraspathidium Aske ransverse fibre,and a somewhat convergent postary ribbon nasia Discotricha

Blochmann,1895

Orthodonella Noland,1937 s reserved. , Lopezoterenia

Nassulopsis)

Pseudotrachelocerca Cyclotrichium

978

Chilodontopsis

,

Zosterodasys) Synhymenia)

.

.

, Scaphidiodon)

.

Fan etal., 2014] - shaped;

This article isprotected right by All copyright. Accepted ●●●●●●●●●Plesiotrichopidae Deroux,1976 ( ●●●●●●●●●Kyaroikeidae Sniezek&Coats, 1996 ( ●●●●●●●●●Hartmannu ●●●●●●●●●Dysteriidae Claparède &Lachmann, 1858( juxtaposed heteromerous. non often but temporarily attached; Bodytypically laterally compressed with dorsal surfacerounded, in extreme; free ●●●●●●●●DysteriidaDeroux, 1976 ●●●●●●●●●LynchellidaeJankowski, 1968 ( ●●●●●●●●●KryoprorodontidaeAlekperov and Mama ●●●●●●●●●GastronautidaeDeroux, 1994 ( ●●●●●●●●●ChlamydodontidaeStein, 1859 ( ●●●●●●●●●Chitonellidae Small&Lynn, 1985 ( ●●●●●●●●●ChilodonellidaeDeroux, 1970 ( Article withoutnon equal fields,which may separatedbe midventrally(except in FamilyKryoprorodontidae); thigmotacticventral somatic a; Bodytypically dorsoventrally broad; flattened, free ●●●●●●●●Chlamydodontida Deroux,1976 (P) macronucleusheteromerous. cytostomeand cytopharynx surroundedby phyllae and rod ature Oral typically composedof one preoral kinet ●●●●●●●Cyrtophoria Fauré ribbonsin Rhynchodia/Suctoria. anteriorlyeither in Cyrtophoria/Chonotrichia orposteriorly, beneath kineties as subkinetal Ribbon ●●●●●●Subkinetalia Gonget al., 2009 - atedadhesive regionor by flexible podite (except - like subkinetalnematodesmata arising somatifrom - atedadhesive regionor flexible podite lidae Poche,1913 (P)

- Fremietin Corliss,1956

somatic kineties typicallyventrally arranged in two roughly ventralcil

ia not thigmotactic,but ate attached to substrate by Gastronauta) Chilodonella) Chlamydonella Chlamydodon) Plesiotrichopus Hartmannula s reserved.

Chitonella) yand two circumoral kineties; true - . Kyaroikeus swimming,but mayat

jeva,1992 ( Atelepithites Dysteria

, c monokinetidsand extending, - )

shapednematodesmata;

Lynchella) )

)

(P), Gymnozoum) ) ; ; macronucleus Trochilia)

tach tosubstrate by

- swimming, This article isprotected right by All copyright. Accepted●●●●●●●Rhynchodia Chatton&Lwoff, 1939 ●●●●●●●●●●●Stylochonidae Mohr,1948( ●●●●●●●●●●●Isochonopsidae Batisse& ●●●●●●●●●●●Isochonidae Jankowski,1973 ( ●●●●●●●●●●●Inversochonidae Jankowski,1973 ( ●●●●●●●●●●●Echinichonidae Jankowski,1973 ( ●●●●●●●●●●●Actinichonidae Jankowski,1973 ( funnel or marsupium;macronucleus heteromerous, with orthomered reduced;stalk typically present; Body often flattened, leaf ●●●●●●●●●●CryptogemmidaJa ●●●●●●●●●●●Spirochonidae1854 Stein, ( ●●●●●●●●●●● ●●●●●●●●●●●Lobochonidae Jankowski,1967 ( ●●●●●●●●●●●Helichonidae Jankowski,1972 ( Article●●●●●●●●●●●Filichonidae Jankowski, ●●●●●●●●●●●Chilodochonidae 1895 Wallengren, ( directedapically towards funnel tomitesor buds produced byexternal budding; macronucleusheteromerous, with orthomere peduncle (ratherthan a “true” stalk, except in Fa Chilodochonidae);spines absent or poorly developed; usual attachment byundistinguished Bodytypically and cylindricallong withwell a ●●●●●●●●●●ExogemmidaJankowski, 1972 rDNAphylogenies place this groupas sister Hartmannulidae.to fordispersal; most species areectosymbionts on crustacean appendages.Small subunit nematodesmata;macronucleus heteromerous; unequal cell division inverted nextkineties to cytostome;cytopharyngeal apparatus with phyllae,but no shaped region,which mayorbe flared compressed;oral cilia absentor only as several Sedentaryand sessile formswith somaticcilia onlywallson pe of ●●●●●●●●●Chonotrichia 1895 Wallengren, .

Phyllochonidae Jankowski,1972 ( - like,and angular; spines common and of several types;collar .

internalbudding with up eightto tomites produced a in crypt nkowski,1975

1973 ( Crumeyrolle,1988( Stylochona Spirochona

- developedcollar (except Family Filichona Isochona s reserved. Heliochona

Lobochona milyChilodochonidae); Actinichona Echinichona Phyllochona Inversochona Chilodochona ) )

)

)

)

)

)

) ) Isochonopsis irectedantapically away from

)

rioral conefunnelor )

typical,producing “bud” a to few several )

- This article isprotected right by All copyright. ●●●●●●●●●Ephelotidae 1882 Kent, ( Accepted●●●●●●●●●Dendrosomididae Jankowski,1978 ( ●●●●●●●●●DentacinetidaeBatisse, 1992 ( ●●●●●●●●●Allantosomatidae Jankowski,1967 ( devoida, vermiform, of ature,derived from parental the kinetosomal field,but some of longer the larvae practically parentalcortex polygemmicin some species, orby binary fi prehensilewell as as suctorial tentacles; stalkedOften and loricate; tentaclesborne actinophoreson in some species,and others with ●●●●●●●●ExogenidaCollin, 1912 stalk.nor typical,with ated, migratorydispersal “larvae” or swarmersusually bearing neithertentacles microtubulesand an inner setof microtubular ribbonsphyllae); (= extrusomesat tentacle haptocysts;tips as tentacles supported byouteran ringof Mature sessile trophonts,usually non ●●●●●●●SuctoriaClaparède ●●●●●●●●●Sphenophryidae Chatton&Lwoff, 1921 ( ●●●●●●●●●Ancistrocomidae Chatton&Lwoff, 1939 ( Article cellsurface bare extend to coverthe entire bodyor sometimes with non Free ●●●●●●●●Rhynchodida&Chatton Lwoff, 1939 homomerous fosette cyrtophorines;posterior adhesivebounded region bysomatic kinetiesin right short Bodydorsoventrally flattened; ●●●●●●●●HypocomidaeBütschli, 1889 endosymbiotic parasites bivalve of molluscs and othermarine invertebrates. phyllae)enclosing toxic (?)extrusomes (acmoc apparatus Oral a suctorial supportedtube by radially arranged microtubular ribbons (= -

swimming,but typically attached to the host byoral the region; anterio ;oral ature absentor reduced to a fewpericytostomial kinetosomes

- . lateralleft kinety,a presumed homologue of the dorsal right kinetofragmentof Hypocoma ;migratory larval typicallyform largeor long, the formerwith complexventral ; noposterior adhesive region - ated kinetosomes,typically organized inthigmotactic a field,which may andincapable ofswimming; some endocommensals. .

&Lachmann, 1858 somatic kinetiesessentially restricted ventralto surface with a

which maybe dividedtwo, in leaving a large partof the Ephelota - ated,with oneto many tentaclesthatingest prey;

exogenous budding, mostoften monogemmic,but Dentacineta ssion withappreciable no invaginationof s reserved. ) .

ystsor haptotrichocysts); cytotrophicor Allantosoma

Dendrosomides Sphenophrya) Ancistrocoma) )

)

)

unequalcell division

somatickineties ; macronucleus

- ventralpit or This article isprotected right by All copyright. Accepted●●●●●●●●●Trichophryidae Fraipont,1878 ( ●●●●●●●●●Tokophryidae Jankowskiin Small&Lynn, 1985( ●●●●●●● ●●●●●●●●●RhynchetidaeJankowski, 1978 ( ●●●●●●●●●Pseudogemmidae Jankowski,1978 ( ●●●●●●●●● ●●●●●●●●●Endosphaeridae Jankowskiin Corliss,1979 ( ●●●●●●●●●Dendrosomatidae Fr ●●●●●●●●●DactylostomatidaeJankowski, 1978 ( ●●●●●●●●●Corynophryidae Jankowski,1981 ( ●●●●●●●●●Choanophryidae Dovgal,2002 ( ●●●●●●●●●Acinetopsidae Jankowski,1978 ( ●●●●●●●●●Acinetidae Stein,18 ectosymbiotic formscommon, some endocommensals. free monogemmicor polygemmic, with swarmersproduced completely internally and becoming loricate;Often tentacles frequentlyin fascicles; ●●●●●●●●Endogenida Collin,1912 Article●●●●●●●●●ThecacinetidaeMatthes, 1956 ( ●●●●●●●●●Tachyblastonidae Grell,1950 ( ●●●●●●●●●Spelaeophryidae Jan ●●●●●●●●●Severonidae Jankowski,1981 ( ●●●●●●●●●Rhabdophryidae Jankowski,1970 ( ●●●●●●●●●Praethecacinetidae Dovgal,1996 ( ●●●●●●●●●Podophryidae Haeckel,1866 ( ●●●●●●●●●PhalacrocleptidaeKozloff, 1966 ●●●●●●●●●Paracinetidae Jankowski,1978 ( ●●●●●●●●●OphryodendridaeStein, 1867 ( ●●●●●●●●●Manuelophryidae2002 Dovgal, ( ●●●●●●●●●Metacinetidae Bütschli,1889 ( ●●●●●●●●●Lecanophryidae Jankowski,1973 ( - swimmingin brood pouch ●●Solenophryidae Jankowski,1981 ( Erastophryidae Jankowski,1978 ( before 59( aipont, 1878 ( kowski inkowski Batisse,1975 (

Acineta emergencethrough birth pore Metacineta) Podophrya Tachyblaston Ophryodendron Severonis ) Trichophrya Thecacineta Choanophrya

( Paracineta Rhyncheta Manuelophrya Acinetopsis Phalacrocleptes s reserved. Erastophrya Solenophrya Dendrosoma Praethecacineta Corynophrya Lecanop endogenousbudding occurring Rhabdophrya Pseudogemma Dactylostoma ) )

) ) hrya ) )

)

)

Endosphaera

) ) Spelaeophrya

)

) )

) )

)

Tokophrya ) )

) )

)

; swarmerated )

) )

inpouch, a ; This article isprotected right by All copyright. Accepted●●●●●●●Bursariidae BorySt.deVincent, 1826 ( ●●●●●●●Bursaridiidae Foissner,1993 ( ●●●●●●●BryometopidaeJankowski, 1980 ( conspicuous ribbonresembling an adoralzone ofmembranelles. or manydikinetidal rows;left Oral structures inoralcavity, often very deepor trough ●●●●●●BursariomorphidaFernández parentalature maintained orreorganized; mucocysts; mostlyterrestrial. conditionor in reproductivestomatogenesis cysts; pleurotelokinetal or meroteloki left field; micronucleusmay inbe perinuclear space ofmacronucleus; division in freelymotile structuresas a dikin transverseribbons overlap one another, forming so the one kinetodesmal fibrilassociated with theposterior kinetosome;posteriorly directed associatedwith theanterior Ciliatedsomatic dikinetidswith onetransverse ribbonand at least one postary microtubule ●●●●●Colpodea Small &Lynn, 1981 ●●●●●●●●●Trypanococcidae Dovgal,2002 ( ●●●●●●●●● ●●●●●●●●●Rhynchophryidae Jankowski,1978 ( ●●●●●●●●●Prodiscophryidae Jankowski,1978 ( Article●●●●●●●●●PeriacinetidaeJankowski, 1978 ( ●●●●●●●●●Heliophryidae Corliss,1979 ( ●●●●●●●●●Enchelyomorphidae Augustin& Foi ●●●●●●●●●Discophryidae Collin,1912( ●●●●●●●●●Dendrocometidae Haeckel,1866 ( ●●●●●●●●●CyathodiniidaeCuhna,da 1914 ( ●●●●●●●●●Cometodendridae Jankowski,1978 ( aberrantlife cycle. budding) swarmercompleted kineties firstdevelop “parental”on surface of a brood pouch,but cytokinesis a of single singlyin or fascicles at the endsof sometimesmassive or arms trunks; Trophontssessile; with without or stalk ●●●●●●●●EvaginogenidaJankowski in Corliss,1979 ; often ; symphorionts, with species ofone endosymbiotic genusshowing a strikingly StylocometidaeJankowski, 1978 (

etidalrow in the right field andbrick exogenously kinetosome andone transverse ribbon, one postary ribbon, and oral field composed of few to manypolykinetids forming a after

- Galiano,1978 ,occasionally in lorica; tentacleseither scattered full emergence full of the “everted” bud (i.e.,evaginative Bursaridium Discophrya Heliophrya Bryometopus Trypanococcus Periacineta Cyathodinium s reserved. Stylocometes Dendrocometes ssner,1992 ( Prodiscophrya Rhynchophrya Cometodendron , ) )

Paracondylostoma

- - like; oralright field composedof one - calledtransversodesmata. Oral

) orribbon )

(P),

)

) )

Enchelyomorpha

Thylakidium ) ) )

) -

shaped polykinetidsthe in kinetosomesof larval

)

)

)

netal, This article isprotected right by All copyright. pleuromerotelokinetal;terrestrial and limnetic. pattern colpodid;division usually in reproductivestomatogenesis cysts; groove extendingobliquely leftonto body side;extrusomes globularor oblong composedof many monokinetidal rows;postorally, a more orless pronounced (diagonal) a epiplasmic microtubules;right oral field composed ofa dikinetidal row and a crescentic Oral cavitysmall very to large, in thelatter denselycase byated roof kineties havingsupra ●●●●●●●ColpodinaFoissner et al., 2011 ●●●●●●●●Sandmanniellidae Foissner ●●●●●●●●BryophryidaePuytorac de et al., 1979 ( colpodid;division in reproductive cysts; terrestrial. includingroof kineties;left asfield described order; for silverline pattern platyophryid or Oral cavityalmost flat;right oral afield single row of dikinetids ora compl ●●●●●●●BryophryinaPuytoracde et al., 1979 Marynidae PseudochlamydonellidaeBuitkamp etal., 1989 ( Ilsiellidae Bourlandal et Hausmanniellidae Foissner,1987 ( Bardeliellidae Foissner, 1984( Incertaesedis pleuromerotelokinetal,parental ature reorganized; mostlyterrestrial. platyophryid;usually dividein reproductive cysts; stoma polykinetid comprising few manyto monokinetidal rows; silverline pattern colpodid or composedof one severalto brick complexorganelle including roof and/orkineties monokinetid Oral structures inoralcavity; right oral field as single row of monokinetids, dikinetids,or a ●●●●●●ColpodidaPuytoracde et al., 1974 Acceptedccumulation of slightly disordered monokinetids;left oral asfield a crescentic polykinetid Article

Poche,1913 (

Colpodida: .,2011 ( Maryna

Bardeliella Ilsiella ) -

shaped polykinetidsand/or a comparatively large Avestina ) &Stoeck, 2009(

)

, Hausmanniella s reserved.

Hackenbergia

Bryophrya Sandmanniella togenesis merotelokinetalor

) )

alary fields; oral left field

, Pseudochlamydonella

)

exorganelle ;silverline )

- This article isprotected right by All copyright. Accepted ●●●●●●●Woodruffiidae Gelei,1954 ( ●●●●●●●Sorogenidae Bradbury& Olive,1980( ●●●●●●●Sagittariidae Grandori& Grandori, 1935 ( ●●●●●●●PlatyophryidaePuytorac de et al., 1979 (P) ( ●●●●●●●Ottowphryidae Foissneret al., 2011 ( semiterrestrial, fewlimn reorganized;with without or ability the to formaerial sorocarps; mostlyterrestrial or cystsor in freelymotile condition; stomatogenesis pleurotelokinetal, parental oralature not aperture;silverline pattern platyophryid,rarely c pseudomembraneconsisting of short withkineties two dikinetidseach along leftslope oforal occasionallymicronucleus in perinuclearspace of macronucleus; somewith postoral ellipticalwithfigure left the oral fieldcomposed of few to many Oral structures oncell surface; oralright asfield a single dikinetidal row, usually an forms ●●●●●●PlatyophryidaPuytoracde et al., 1979 ●●●●●●●Kreyellidae1979 Foissner, ( ●●●●●●●CyrtolophosididaeStokes, 1888 ( Articlelimneticand terrestrial, some marine. motile condition;stomatogenesis pleurotelokinetal, parental oral ature partially reorganized; perinuclearspace of macro oral left comprisingfield toup ten brick Oral cavityshallow; right oral asfield a single dikinetidalrow, anforms elliptical withfigure ●●●●●●CyrtolophosididaFoissner, 1978 stomatogenesiscysts; merotelokinetal; terrestrial. severalto brick fungiand yeasts; rightoral single as field monokinetidalrow; left oral field composedof one apparatus Oral on ce ●●●●●●● Grossglockneriidae1980 Foissner, [GrossglockneriinaFoissner, 1980] ●●●●●●●●Tillinidae Foissneret al., 2011 ( ●●●●●●●●Grandoriidae Corliss,1960 ( ●●●●●●●●Colpodidae BorySt.deVincent, 1826 ( - shaped polykinetids;silverline pattern colpodid;division reproducti in llsurface; with unique feedingtube used forpuncturing cellwalls of etic. nucleus;silverline patterncolpodid or kreyellid;division in freely

Etoschophrya Kreyella - Grandoria shaped polykinetids;occasionally micronucleusin

Tillina Cyrtolophosi ) s reserved.

Ottowphrya olpodid or kreyellid;division reproductive in Sorogena )

) ) Grossglockneria Sagittaria , Rostrophrya Platyophrya s)

) ,

Platyophryides (P). )

brick

, Woodruffia ) ,

- Pseudoplatyophrya shaped polykinetids; )

)

ve .

This article isprotected right by All copyright. “brush”. Acceptedcavity;associated oral ciliature astwo ormore assemblage forminga circular microtubularband thatsupports the wall a shallow of precytostomial extendinglaterally from each dikinetid,overlapping one another, and, in some species, dikinetids Oral radial to tangential to perimeterof oralarea with postary ●●●●●Prostomatea Schewiakoff, 1896 (P) ●●●●●●●Leptopharyngidae Kahl,1926 ( ●●●●●●●Microthoracidae 1870Wrzesniowski, ( small,with complete palisade ofnematodesmata. dikinetid,variably butdeveloped, its vestige alwaysappearsduring stomatogenesis trichocystswith anchor spaces,composed of monokinetidsand/or dikinetids; somatic extrusomes as fi epiplasmin some forms; and ofte Bodyfrequently broadly ellipsoidal with rightside morerounded, occasionally crescentic, ●●●●●●MicrothoracidaJankowski, 1967 ●●●●●●●Nassulidae de Fromentel,1874 ( ●●●●●●●Furgasoniidae Corliss,1979 ( palisadenematodesmata. of Articlefourpolykinetids restricted toa shallow oralcavity kinety,and extending lateralto left onto dorsal surface,but sometimes reduced tothree or hypostomialor beginsfrange inpostoral region, always therightto o a proximaland distal cartwheel Alveolocystspresent;somatic ciliature with distinctpreoral suture; ●●●●●●NassulidaJankowski, 196 delicatecyrtos (?), which extends anteriorly, then dorsallyand posteriorly. reduced in size only to one or two kinetosomes;cytostome Oral regionin middle third ofcell,with a ●●●●●●Colpodidiidae Foissner,1995 nematodesmata well somaticalveoli well transverseribbon, a divergent postary ribbon, and an Somatic ciliamonokinetids as and dikinetids; monokinetidwith anterior, an tangential ●●●●●

NassophoreaSmall &Lynn, 1981 (P)

n laterallyflattened; alveolocysts present; pellicle, and firm rigid, with thickened - developedwith pairedalveolocysts sometimes present; oral - developedas cyrtos in severalgroups. - liketip (fibrocysts) typicallywith a somaticfew kineties,separated by wide interkinetal

; somatic extrusomes; rod 7

Furgasonia

paroraland three oral polykinetids thatcan be Pseudomicrothorax,Leptopharynx

; usually ; left three oralpolykinetids;

s reserved. Drepanomonas,Microthorax

; cyrtos ; typicallywithlarge, complete , ,

Wolfkosia Obertrumia teriorlydirected kinetodesmal fibril; -

like,when present; - s ofs dikinetids, oftencalled a cytopharynxsupported by a

)

)

somaticbasal bodies with f stomatogenicf the microtubularribbons Colpodidium )

) synhymenium

right paroralright brous ;cyrtos .

This article isprotected right by All copyright. associatedare with endosymbiotic . Epalxella ciliatureinclu can encircledby one or two dikinetidsfiles of (?), but if here,they typically havedikinetids; somatic extrusomes as mucocysts; ribbonarising densefrom materialnear triple postaryribbon, well Alveoliwell ●●●●●Plagiop ●●●●●●● ●●●●●●●Prorodontidae 1881 Kent, ( ●●●●●●●Plagiocampidae Kahl,1926 ( ●●●●●●●Placidae Small &Lynn, 1985 ( ●●●●●●●Metacystidae Kahl,1926 ( ●●●●●●●Lagynidae Sola etal., 1990 ( ●●●●●●●Holophryidae Perty,1852 ( ●●●●●●●Colepidae Ehrenberg,1838 ( ●●●●●●●Cryptocaryonidae & Colorni,Wright 2002 ( ●●●●●●●Balanionidae Small&Lynn, 1985 ( scavengersdetrituson ridgessupported by two unequal rows of microtubules; mostspecies cytotrophicor parentalon ventral surface rowsbearing clavatea,varying subapical,surrounded by circumoraldikinetids; toxicysts,may inbe oral palpsextra or onebears to many caudalsomatic a; extrusome FamilyColepidae; somatic ation mayreducedbe in posteriorhalf of cell, which typically Alveoliwell ●● surroundedby circumoral dikinetids; S ●●●●●●Apsiktratidae Foissneret al., 1994 [Prostomatida Schewiakoff, 1896] omatic ciliature “radiallysymmetrical”

Accepted Article●●●●ProrodontidaCorliss, 1974

Urotrichidae Small&Lynn, 1985 ( (?); mitochondria(?); maybe replaced byhydrogenosomes, which many in species - - developed,including calcium carbonate concretions as skeletal platesin the developed,often filledwith dense material;somatic monokinetid with divergent yleaSmall &Lynn, 1985 (R) de polykinetidsde - developedanteriorly .

; cytostome ; sometimes in shallowatrium,which islined byoral

from parallelfrom perpendicularto bodyto axis, and developing ; stomatogenesis ; holotelokinetal, but may apokinetalbe in

Metacystis Holophrya Prorodon brosseabsent Lagynu - Plagiocampa ; paratenes ; typically conspicuous; oral region apical, oral,near kinetidsof “brosse” Placus - directed kinetodesmal fibril,and a transverse

Urotricha Balanion ts2 and 3,but if , s s reserved. ) , ) ) ) Plagiopogon

Vasicola brosse typicallythreeof ormore dikinetidal sas mucocysts;

Epalxella ; ) toxicystsabsent

) )

)

)

iscorrectly placed here,oral Epalxella oralextrusomes as )

. ;oral regionapical to Apsiktrata

cytostomepartially is correctlyplaced

.

This article isprotected right by All copyright. of tomites (catenulation) byor multiple transverse with fission tomitesremaining connected date),but with remnants oral of ciliature; fissio and somaticature markedly thigmotactic; Trophontvermiform; free ●●●●●●●Astomatop ●●●●●●●●Pseudocolliniidae Chantangsiet al., 2013 ( ●●●●●●●●Foettingeriidae Chatton,1911 ( ●●●●●●●●CyrtocaryidaeCorliss, 1979 ( ●●●●●●●●Colliniidae1910 Cépède, ( palintomyincystor a by catenulation; kineties S ●●●●●●● &Chatton Lw novelcorticalstructures including a “rosette” organelle andthe Cellswithpolymorphic a life cycle;usually as epibionts of marine Crustacea;in some forms, ●●●●●●Apostomatia Chatton&Lwoff, 1928 ribbons(except in Peniculia). directedoverlapping kinetodesmal fibrils,divergent postary ribbons, and radial transverse Astomatia and someastomatous Hymenostomatia) inresiding a ventral oral cavitydeeperinfundibulumor (maybe secondarily lost (?)in apparatus Oral with distinct a rightparoral kinety and typicallyleft oralthree polykinetids, ●●●●●Oligohymenophore ●●●●●●●TrimyemidaeKahl, 1933 ( ●●●●●●●Sonderiidae Small&Lynn, 1985 ( ●●●●●●●Plagiopylidae Schewiakoff,1896 ( Discomorphella indicatea relationship of Morphologyansuggests affiliation with the Odontostomatida,while ●●●●●●●Epalxellidae1960 Corliss, T ●●●●●●PlagiopylidaSmall &Lynn, 1985 ypicallyw Acceptedatureomatic with Article ; oral ; apparatus mayhave rosette;tomites formedby multiple fission,either by ith sandwich

(Odontostomatida)in molecular genealogies. x , horidaJankowski, 1966 y , and - like arrangementlike of the - Epalxella swimming,but attached hostto tissue; kinetiesdistinctly spiralled a dePuytorac et al., 1974 z

kineties thatkineties becan associatedwith an

with Plagiopylea. Trimyema

off, 1928 off, trophonts, sanguicolou Cyrtocaryum

nocytostome (in stages of life cycles known to Foettingeria Sonderia

, ) s reserved. nof tomont

Metacollinia

;somatic monokinetidswith anteriorly ) Sap )

Fusiforma,Pseudocollinia ) )

rodinium

- trophontby sequential formation )

s ors exuviotrophic Epalxella x , - methanogenassemblages.

y groupswith ,and SSUrRNA a . kinetyor

z

kineties. . phylogenies

)

a ,

b , and , - c .

This article isprotected right by All copyright. in species that undergo microstome AcceptedSomatic kineties with anteriormost kinetid asa dikinetid; oral region, inconspicuous, except ●●●●●●●TetrahymenidaFauré posteriorto and somewhat apart Stomatogenesisby proliferation of kinetosomes typicallyin mid ●●●●●●HymenostomatiaDelage &Hérouard, 1896 ●●●●●●●Radiophryidae Puytorac,de 1972 ( ●●●●●●●Maupas ●●●●●●●Intoshellinidae Cépède,1910 ( ●●●●●●●Hoplitophryidae Cheissin,1930 ( ●●●●●●●Haptophryidae Cépède,1923 ( ●●●●●●●Contophryidae Puytorac,de 1972 ( ●●●●●●●ClausilocolidaeP de ●●●●●●●BuetschliellidaePuytorac de in Corliss, 1979( ●●●●●●●Anoplophryidae Cépède,1910 ( monophyletic. structure(s).Small subunit rDNA phylogenies indicate that many families maybe not Articlecorticalcytoskeleton in theanterior region mayconspicuouslybe developed as Withoutcytostome; symbionts typical in digestive tractsof , especially oligochaetes; ●●●●●●Astomatia Schewiakoff,1896 ●●●●●●●●Conidophryidae Kirby,1941 strobilation; feeding on tissue offluids marineamphipods, isopods, decapods, and cirripeds. migrating tomite, trophontsnon stage;somatic kineties of tomitearched, followingrim of flattenedventral surface adhesive organelle Bodyovoid elongate; to free ●●●●●●●PilisuctoridaJankowski, 1966 ●●●●●●●●Opalinopsidae Hartog,1906 -

ciliated,immobile, characteristically attached seta to orcuticle host; of

which isciliatedbut lacks a cytostome; tom ellidae Cépède,1910 ( ; species of most genera permanentlyin so - swimming,but attached tohost in the feedingstate; uytoracin Corliss,1979 ( - Fremietin Corliss, 1956 from parentalfrom oral apparatus. - to

-

macrostome transformation; Conidophrys Opalinopsis Intoshellina Maupasella Haptophrya Anoplophrya Hoplitophrya Radiophrya Contophyra s reserved.

. ) ) . )

) ) Clausilocola Buetschliella

) )

ites producedby synchrony or -

called“neoten - ventral regionof the cell, ) oralstructure

)

ic” tomiteic”

attachment ; swith right with ventral mature

This article isprotected right by All copyright. ●●●●●●●●Frontoniidae Kahl,1926 ( ●●●●●●●●Clathrostomatidae Kahl,1926 ( S ●●●●●●●PeniculidaFauré extrusomesas typical trichocysts.fibrous kinetodesmal fibrils;cortical alveoli lie between kinetosomalrows of oralpolykinetids; Somatic kinetids with tangentialtransverse ribbons and promin ●●●●●●Peniculia Fauré ●●●●●●●●OphryoglenidaeKent, 1881 ( ●●●●●●●●Ichthyophthiriidae Kent,1881 ( resting cysts. severalspecies attackhealthy infishes; freshwaterhabitats; polymorphic l histophagous forms generallyonfeeding moribund or wounded invertebrates, though differentiated the oralapparatus replacementof parental oralstructures, accompanied by marked regression of th stage in thelife cycle threeoralpolykinetids, its wall “supported”by the organelle ofLieberkühn leastin at one Somatic ciliature verywithdense, preoralsuture; ●●●●●●●Ophryoglenida Canella,1964 ●●●●●●●●Turaniellidae Didier,1971 ( ●●●●●●●●TetrahymenidaeCorliss, 1952 ( ●●●●●●●●Spirozonidae Kahl,1926 ( ●●●●●●●●Glaucomidae Corliss,1971 ( ●●●●●●●●Curimostomatidae Jankowski,1968 ( Incertaesedis and othersas facultative obligateor parasites life cyclehistophagous in and parasitic species; in freshwaterhabitats, sometimes terrestrial, histophagousand several polymorphic formswith cytotrophicmacrostome stage; complex rightmostpostoral somatic kinety (membranelles)in oralcavity oral

Acceptedomatic kinetids predominantlydikinetids; somaticext Article b segmentof paroral (haplokinety, undulating membrane)and threeleft oral polykinetids

Tetrahymenida: TrichospiridaeKahl, 1926 ( ; stomatogenesisteloparakinetal, with dedifferentiation and - Fremietin Corliss,1956 (P) - Fremietin Corliss,1956 ; stomatogenesis monoparakinetal,typically involvingthe ; division ; free ; ; microphagous primarilforms Disematostoma Spirozon Colpidium

Glaucoma Ophryoglena Ichthyophthirius

Clathrostoma Tetrahymena -

a s reserved. swimmingor by palintomy incyst; a associated mainlywith invertebrate hosts. )

Curimostoma ,

Dexiostoma oralregion inconspicuous, with paroraland )

,

)

rusomes as trichocysts. ) )

) Trichospira)

, )

Turaniella ybacterivorous, but some entlyoverlapping

(P))

)

ifecycle, including

eparoral in

This article isprotected right by All copyright. ●●●●●●●●Rovinjellidae Matthes,1972 ( ●●●●●●●●Operculariidae Fauré ●●●●●●●●LagenophryidaeBütschli, 1889 ( ●●●●●●●●Epistylididae Kahl,1933 ( ●●●●●●●●Ellobiophryidae Chattonand Lwoff, 1929 ( ●●●● ectosymbionts, rarelyendosymbionts. manyspecies bydevelopment intoarboroid colonies; resting cysts; free mobile;dispersal stage as migratory telotroch;division isotomic or anisotomic, followedin attacheddisc, to substrate byscopula,but a zooidstrophonts, or sedentaryor sessile, commonly or withstalked inconspicuous adhesive Bodyinvertedbell ●●●●●●●SessilidaKahl, 1933 permanentlyonated mobile species. partof the scopula, which secretesthe stalk of sessile and species; (3) telotroch (infundibulum)at the base ofwhich cytostome; isthe (2)aboral, including kinetosomesas dikinetid Bodydivided three into areas:major (1)oral, with prominent a peristome borderedby a ●●●●●●Peritrichia Stein,1859 along dorsal the al tangentialtransverse ribbon; somatic extrusomes as mucocysts substratesto by a mucous thread;somatic kinetids onlyas monokinetids with broad, equatorial girdl temporarilyattached to thesubstratum by a mucousthread; Body Mignot,1987] ●●●●●●●Urocentridae Claparède & ●●●●●●●●Stokesiidae Roque,1961 ( ●●●●●●●●Paranassulidae Fauré ●●●●●●●●ParameciidaeDujardin, 1840 ( ●●●●●●●●Neobursaridiidae Dragesco& Tuffrau,1967 ( ●●●●●●●●Maritujidae Jankowskiin Small &Lynn, 1985 ( ●●●●●●●●Lembadionidae Jankowskiin Corliss,1979 (

Accepted Article ong the rightmargin of oral the opening and three polykinetids oral of three rowseach

●●●●Astylozoidae Kahl,1935 ( broadlycylindroidal, with larger, roundedanterior half

file(haplokinety) and oralan polykinetid thatboth originate in an oralcavity

e;caudal ciliaa conspicuous form tuft thatisused for temporaryattachment - leftwall. -

or goblet Urocentrum - shaped or conical

- Fremietin Cor - Fremiet,1962 (

Lachmann,1858 [UrocentridaPuytorac,de Grain & Epistylis Astylozoon

. Stokesia

Rovinjella Lagenophrys

) fewspecies presumed to secondarilybe s reserved. ) -

liss,1979 ( cylindrical; , Hastatella Paranassula )

Ellobiophrya )

Lembadion Neobursaridium )

Ma

Opercularia zooidswith dimorphic, mature ; ; free )

rituja somatication a as distinct )

; oral ; structures as a paroral - swimming,but maybe ) )

)

)

- ) livingor

, This article isprotected right by All copyright. ●●●●●●●●Cryptochilidae Bergerin Corliss,1979 ( ●●●●●●●●Cohnilembidae Kahl,1933 ( segments;scutica typically present. Paroraldikinetid shorter than otheroral structures, typically by reduction of paroral ●●●●●●●Philasteri scuticobuccokinetal. mitochondria corticallylocated,often as membranoids; somaticdikinetids usuallywith basal both bodies ciliated; mucocysts; involvement of kinetosomes inthe from the Paroraldikinetid with ●●●●●●ScuticociliatiaSmall, 1967 (P) ●●●●●●●●Urceolariidae Dujardin,1840 ( ●●●●●●●●Trichodinopsidae Kent,1881 ( ●●●●●●●●Trichodinidae Claus,1874 ( ●●●●●●●●Polycyclidae Poljansky,1951 ( g and microphagouson cellular debris host;from ectosymbionts, often on the integument or polykinetids runningtogether in a“ri contractile;oral structures with infundibularportions of oralpolykinetids 1 alwaysand 2 skeletalarmature ofdenticles and surroundingfibers a vestigial scopula ringsof cilia flattened; Bodyconical, cylindrical, or goblet ●●●●●●●MobilidaKahl, 1933 ●●●●●●●●Zoothamniidae Sommer,1951 ( Pelagovorticella ●●●●●●●●Vorticellidae Ehrenberg,1838 ( ●●●●●●●●Vaginicolidae de ●●●●●●●●Usconophryidae Clamp,1991 ( ●●●●●●●●Termitophryidae Lomin Corliss,1979 ( ●●●●●●●●Scyphidiidae Kahl,1933 ( Accepted illsof invertebrates, rarely endosymbionts. Article c zooid mobile, with permanentlyciliated trochal band, typicallycomposedof three

segmentor a “scutico” ; bacterivorous, ; obtaining prey from wateror fromdetritus adheringto the host, ; adhesiveaboralon disk pole, ,

Pseudovorticella da Small,da 1967

a , bbon” andbbon” oralpolykinetid 3 short, perpendicular tothe other two oral b , and , Fromentel,1874 (

c

segments;stomatogenesis by proliferation of kinetosomes -

vestige posterior to

- (P), a shaped,sometimes discoidaland orally

Scyphidia( - an fusedto chondriome; stomatogenesis

Trichodina Cohnilembus d b Leiotrocha Trichodinopsis Polycycla Usconophrys Carchesium

Haplocaulus segments;typically oral three polykinetids,often slightlycontractile; with ring a s reserved. Cothurnia (P) (P)) ) Termitophrya

Cryptochilum

) ,

)

Urceolaria a ,

, ) Epicarchesium and ) ,

Zoothamni

Pyxicola b

segments,with varying ) ) .)

,

Thuricola um )

(P),

; - oralregion not like,complex -

aborally Ophrydium ,

Vaginicola a

and ,

)

c

This article isprotected right by All copyright. paroralnot velum somatic kineties T ●●●●●●●Thigmotrichida &Chatton Lwoff, 1922 ●●●●●●● ●●●●●●●●Pleuronematidae Kent,1881 (P) ( ●●●●●●●●Peniculistomatidae Fenchel,1965 ( ●●●●●●●●HistiobalantiidaePuytorac de &Corliss in Corliss,1979 ( ●●●● ●●●●●●●●Dragescoidae Jankowski,1980 ( ●●●●●●●● ●●●●●●●●Ctedoctematidae Small&Lynn, 1985 ( ●●●●●●●●Conchophthiridae Kahlin Doflein and Reichenow,1929 ( ●●●●●●●●CalyptotrichidaeSmall &Lynn, 1985 ( paroraland scutica. segmentas a permanent scutica or scuticovestige; mucocysts;stomatogenesis proter’sfrom Paroraloften prominent aforming velum, with short ●●●●●●●PleuronematidaFauré ●●●●●●●●Urozonidae Grolière,1975 ( ●●●●●●●●Uronematidae Thompson,1964 ( ●●●●●●●●ThyrophylacidaeBerger in Corliss,1961 ( ●●●●●●●●Thi ●●●●●●●●Schizocaryidae Jankowski,1979 ( ●●●●●●●●Pseudocohnilembidae Evans& Thompson,1964 ( ●●●●●●●●Philasteridae Kahl,1931 ( ●●●● Paralembus ●●●●●●●●Paralembidae Corlissand Puytoracde in Small&Lynn, 1985 ( ●●●●●●●●Orchitophryidae Cépède, 1910 (P) ( ●●●●●●●●Entorhipidiidae Madsen,1931 ( ●●●●●●●●Entodiscidae Jankowski,1973 ( Acceptedhigmotacticcilia anterior as differentiations of somatic kineties,attach Article ●●●●Eurystomatellidae Miaoal.,2010et ( ●●●●Parauronematidae Small&Lynn, 1985 ( ●ThigmocomidaeKazubski, 1958 (

Cyclidiidae Ehrenberg,1838 ( )

gmophryidae Chattonand Lwoff, 1926 ( oftenspiralled aroundposterior cell pole,where cytostom - like;

oralpolykinetid 3 reduced absentor - Fremietin Corliss, 1956 Kahlilembus Urozona Cristigera Entorhipidium Entodiscus Dragescoa Uronema Thigmocoma Pleuronema Schizocaryum s reserved. Peniculistoma Orchitophrya )

Eurystomatella

Calyptotric , Ctedoctema

Philaster , Parauronema

a Cyclidium Thyrophylax

) ) Thigmophrya andelongate

)

)

)

)

;stomatogenesis proter’sfrom ) ) ha )

)

Pseudocohnilembus ) ) ) )

(P) ) (P))

) Histiobalantium b

Conchophthirus

segmentand with (P) tohost tissues;

Anophrys e islocated )

) , )

; c

This article isprotected right by All copyright. Incertaesedis Cercozoa: Discocelia Cavalie extrusomes. kinetosomesconnecting nucleusto with cytoskeleton;usually with microbodies and amoeboid,usually with filopodia;most with tubularmitochondrial cristae; cysts common; Diverseclade distinctive lacking morphologicalor behaviouralc Cercozoa●● Cavalier morphology,as there is DNAno sequence information. synonymCienkowskya)of unresolved. morenuclei, often located the in amoeboid base stalk of when present;complex cyclelife substrate with cytoplasmicstalk; free extrusomesalong axopodia;tubular mitochondrialcristae; in some cellsgenera, attached to Axopodialmicrotubules in irregularhexagonal prism; kinetocystand other types of Incertaesedis supportedby microtubules those in groups examined byelectron microscopy. With finepseudopodia varyingas simple, branching, or anastomosing patterns, often ● ●●●●●●●●Loxocephalidae Jankowski,1964 ( ●●●●●●●●Cinetochilidae Perty,1852 ( studies are neededin order clarifyto the systematicsof loxocephalids. the Non ●●●●●●●Loxocephalida Jankowski,1964 (P) ●●●●●●●●ParaptychostomidaeNgassam et al. 1994 ( ●●●●●●●●Hysterocinetidae Diesing,1866 ( ●●●●●●●●Hemispeiridae König,1894 ( ●●●●●●●●Ancistridae Issel,1903 ( cyclidiids. the paroraland scutica. Inmolecular analyses, often withinnested thePleuronematida closeto

AcceptedRhizaria Article - monophyletic groupthatis most closely

Cavalier

Actinocoryne*,

Rhizaria: GymnosphaeridaPo - Smith 2002 - Smith 1998,emend. Adl et 2005,al. emend. , Wagnerel Cienkowskya*

Ancistrum - la* swimminga Cinetochilum Hemispeira . Note: . Thisgroup is placed here basedsolely on , Gymnosphaera*,Hedraiophrys* Hysterocineta r - che emend.1913, relatedto Astomatia and Apostomatia; further ) Cardiostomatella Smith 2013 [ s reserved. s amoeboids or motile biciliatedcells; one or )

, Sathrophilus Paraptychostomum

)

Discocelis ,

haracters; biciliated and/or Mikrjukov2000 Dexiot )

(P) Cavalier

Vørs 1988].

richa )

, (possible junior

- Loxocephalus Smith 2018

)

This article isprotected right by All copyright. thaumatomonads,and da oftwo microtubules),sometimes a third (dp2; Acceptedmicrotubular roots instead ofa conspicuous densedistal transverse Anteriorplate. centriole has two glissomonads,cryothecomonads or oldercultures. Ciliar t resting cysts;some have multinucleateand multiciliatesyncytial plasmodialor stages in like,reticulopodia axopodia or ( (dependingspecies):on lamellipodia,filop propensityhigh for makingextensive non gliding;cytoplasm adherent posteriorto cilium drawn intoa out posterior tail, often pointed; duringsmooth forwardgliding.All but left.Anterior cilium beats asymmetrically left;to the posterior typicallydoes not undulate and/orto left;C1 directed backwards,pointing downwards towards the substratumor to the typically attached anteriorly to taperingnucleus. C2 points forwards, (orthogonalonly in cladeA1a2)by fibrillarconnections, thedistal one weakly striated; both attached(C1) sideto of youngeranterior centriole (C2)at usually strongly obtuse angle surfaceof their typicallysoftbodies adheres (except swim, but glideon surfaces bymeans of the long posteriorcilium whichto ventral the Phagotrophic Hollande1942]. [=Cercomonadidae Kent emend.1880, Karpoval.et 2006; emend Howe al2009; et emend Cavalier Cercomonadida ●●● Poche 1913, emend. Vickerman 1983, emend. Protogenes,Pseudospora, Rhizopl Incertaesedis ,and usuallyvacuole.one food filopodiumto the cell body; with rarely one, two, nuclei with a nucleolus,round one Articlenetwork;cell division longitudinal; phagocytosis of bacteria, prey transportedthrough sometimes visible bylight microscopy; filopodium branchingand anastomoses forminga filopodium Veryslow moving filose amoeboid cell, roundish in shape;usually a single highly branched Incertaesedis Pseudovolutella,Volutella. halfTest Incertaesedis Propsammonobiotus Micramphora,Micropsammella, Nadinella, Ogdeniella, soils.Including spherical, flattenedor pointed; mostlyin interstitial marine sand, but also in freshwaterand terminalcollar either straight or angled, testcircular in cross remains toconfirmedbe as theydo not secrete This clade isconsidered as mostlikely belonging Euglyphida.to However, positionthis Incertaesedis - coiled,either totall originatingbetween cell body the and the substrate througha ring

andheterotrophic biciliate Cercozoa soilfrom and freshwater;usually not do

Cercozoa: Cercozoa: Cercozoa:Volutellidae Sudzuki1979 Cercozoa:Psammonobiotidae* Golemansky 1974, emend Meisterfeld,2002 Alepiella,

(vp2 withoutan associated dense plate, unlike glissomonadsand , and , ransitionzone verywithshort; proximalhub

Chardezia,Edaphonobiotus, Feuerbornia, Frenzelina, Lesquerella, Dictiomyxa,Katabia, Myxodictyium, Pontomyxa, Protomyxa, Rhumbleriella

yor withorganic some attachedparticles; marine. Filomonas radiata

Dumack,Schuster, Bass etBonkowski, 2016 asma Katabia Cavernomonas Mylnikovand Karpov 2004; Cercobodonidae . . -

locomotory pseudopodiafeeding ofseven types odia (unbranchingor branching), bulbous, finger ,have slender a distal hub s reserved.

scales. Test resemblinga Greekvase with

only).Most have contractile vacuoles and

Cavernomonas

have spindle

Psammonobiotus

- sectionwith aboralend - Smith 2012; - latticestructure; unlike - shapedbody when ). Posterior). centriole somewhatdownwards Mylnikov1986, emend. - spokestructure , - like structure

the the

-

This article isprotected right by All copyright. transverseplateat its distal end; anterior cilium beats in ciliaryfashion towards left the (as in acronematic;unlike in cercomonads,the ciliary transition region has a single dense ciliaequal of thickness, simple withoutpara and oneanteriormicrotubular centriolar roots; contractile vacuole usually cellposterior;in and attached to the kinetid bywell which isexceptionallyelongated and ahas modifiedcytoskeleton, th singularlyare lackingin obviousmorphological specializations;apart from cercomonads;cytopharynxno deepciliaror groovepocket or isevident and most species protoplasmictail temporarily,isnotit drawn along out posterior the cilium as mostoften oval ovoid,or nothighly elongated; although some species may extend a ( ciliumislonger posterior the one isadherent to the celland not used for gliding includes also onederived non amoeboid;ance Heterotrophicbiciliates thatare coveredby a plasma membraneonly but not are strongly Mylnikovemend.1990, Mylnikov&Karpov 2004; Bodomorphidae Hollande1952] Ph  morerarely purely lamellipodial. microtubules.Pseudopodia often most finger centriole notoffset. Left root, present,if points left;does not nucleate secondary radiating itfrom more obvious nonagonalthan fibre.Centrioles inone plane, posterior bas at partially not obscuredby densediaphragm surface.Ciliar transition zone proximalhub longitudinallythrough posterior c backwards.Ventral roots vp1 and vp2 con nucleates diverging single micro facingside of both centrioles,but mai vp1).Fibrillar MNC linked (fr) to and partially surrounding base of dp1, attached to nuclear attachedto dorsal side of posterior centriole (unlikeCercomonadidae, whose only C1 is root Cercomonadswith a medialposterior microtubular root of tw Neocercomonas,Cavernomonas. nucleate a smallcone of microtubules. another fibrillar root(fs) usuallyon present dor centriole closeto centriolar junctionand base of dp1 present,if often connecting tonucleus; medialand ventral centrosome nucleates asmall cone of singlet microtubules associatedwith eitheror both ce region,where onecrosses overthe other. Microtubule nucleatingcentre (MNC) that roots(vp2) typicallymutually closely by attached dense materialat least in theiranterior centrioleboth bases.Ventralposterior (vp1)and ventralanterior (butposterior microtubules(lr)nucleates nearthe junction ofamorphous fibrillarmaterial projecting from ( only);posterior centriole nucleatedhas at its basal halfventral rootvp1 and sometimes Proleptomonas m).

Acceptedytocercomonas Article

Brevimastigomonas,Metabolomonas, Nucleocercomonas, Paracercomonas, eof central pair, sometimeswith noticeable densercentral hub structure; spokes ●●●GlissomonadidaHowe Cavalier & Paracercomonadida ●●●

strallybiciliates that glideupon substrata onthe longer posterior cilium, but only);in gliding species cell the posterior isusually rounded and cell the

. onl

y) alsodp1 dorsal of two orthree microtubules.A rootof one or two -

- gliding genus( like fibrillarroot attached (fr) directly indirectlyor posteriorto - Glidingcells typicallysmaller Cercomonadidathan (3 iliumviewed (if its from tip tobase) and orthogonally cellto

Cavalier tubules including two parallelconspicuous onespointing

- developedfibrous roots; typicallyleast at two posterior nlySheetC1. Cercomonas,Eoercomonas, Filomonas, - Smith 2018 - - -

xonemalrod,hairs, or scales, sometimes like material.Conspicuous dense ciliaraxosome latticewith obvious broad hub; peripherallattice sistently the rightto of plane passing - - likeor long thick,often branched filopodia; Smith 2009 [Heteromitidae Kent1880, emend. s reserved. Proleptomonas salside of C2; either or both ofand fr fs may - likeMNC dorsalon (fs) side of C2

o orthree microtubules(dp1) ); if exceptionallyif); anterior the enucleus isanterior Proleptomonas

in most - pointing)

ntrioles:

- 18 , - This article isprotected right by All copyright. ecosystems.Phylogenetically asdefined a well AcceptedPropagationby binary fission,plasmodia not observed. Inhabiting freshwater exclusivelyfeed protoplaston mater feedingby phagocytosis deadonor live eukaryotic cells, capable oflocal cell wall lysis to flutteringswimming locomotion differentto extent, involving both cilia. Heterotrophic nutrition, causingmotions of cell body during gliding(rotation, jiggling,vi bodyattaching not to glidingcilium or tosubstrate. Flapping motionof anterior cilium often acute synchronous.Cilia naked andheterodynamic,arising very close eachto otherinslightly a vacuolesnon at microscope,directly be slightlyelongate botuliform.to Isodiametric extrusomes, often2 slightlyelongate, glisten structures crystals.Digestive stagescontaining several globules of mediumrefractivity. Crystal envelope.Cytoplasm colourless, often opaque due todiverse globules, granules and roughlycentral, occasion ‘vesicular’ nucleus,close to ciliary apparatus, thusapical in ciliatestate. Nucleolus spherical, showingbridge families).Capable oftransforming into surface bulge.In ciliate state markedly exceeding 10 Biciliate,nakedcells, mostly occurring as rigid,variously shaped ,without rostrumor Viridiraptoridae ●●● symmetric. Smooth gliders;anterior ciliumpointssideways and somewhat backwards; centrioles ●●●●Allapsidae ArticleSwimmers. ●●●●P facingnucleus. posteriorcentriolar base asymmetric, sharplyangled with basallyextended tripletson side posteriorlyin parallelwith theposterior one;in one withgenus prominent a anterior rostrum; Smoothlygliding biciliate cells with shorter a anterior ciliu ●●●●Bodomorphidae Jerky gliders;antero ●●●●Dujardinidae Mollimonas Jerky gliders;anterior pointing anterior cilium: ●●●●Sandonidae smoothwalled cystscommonly present;sex unknown. Golgidictyosomes ty nuclearposterior except in aerobicspecies currently known;mitochondria with tubularcristae; microbody attached to cercomonads),and issometime

or angle.right Cells ongliding posterior cilium (mostlylonger anteriorthan cilium), cell –

roleptomonadidae 3  restrictedto starving cells, showing various shapes:1) Small, isodiametric or

min length,rarely to up . Allapsa,Teretomonas Proleptomonas

- Bodomorpha - likemorphology with severaldistinctadhesion sites. Cell containing single

defined positionsin cellperiphery, 2 ≤ HoweCavalier &

Howeal. 2009 et Howe&Cavalier - He picallyassociated with thenucleus, as isnot case the in allCercozoa; lateralpointing anterior cilium:

Hollande1952emend. Cavalier neath plasma membrane, not but in pseudopodia. Severalcontractile ss&Melkonian 2013 -

allyexhibiting lacuna/ae. Golgi bodies inclose proximity nuclearto ingparticles, Howe2009al. et . Proleptomonas

.

s reduced ato very shortstub without an axoneme;only , - Smith 2009 Allantion ∼ ialin(e.g. certain greenalgae), not bacterivorous. -

Smith,2011

6 ∼ 

0.5 m. Severalm. mitochondria scattered throughoutcell, ;almost exclusively inhabit soil or freshwater; .

–

 1 s reserved. - Sandona m (contrasting m most known glissomonad

attach -  supported,clade including the genera m. 2)m. Slender, fusiformor needle

Dujardina ed amoeboided state, retaining cilia and -

 Smithin Howeal. et 2009 , ∼ m in m diameter (late diastole),non Flectomonas

m that m points mainlysideways or

0.5 .

 brating).Cells capable of

mas seen with light , Neoheteromita, - fed fed

- like rods, - like - This article isprotected right by All copyright. pseudo perforations inPhaeodarea (thus TripyleaHertwig 1879), which have surroundedby it a havepseudopodia; lost theca with perforationscilia for and forpseudopodia, and three posteriorci amoebae,and restricted zoosporesto in ;ancestrally benthic glidingon ciliawith divergent kinetosomes,secondarily inlost Rhizaspidae andthe euglyphid usuallynaked Ancestrallywith organic robust extracellular theca,unlike mostother Cercozoa, which are ●●●Thecofilosea ●●●● Guttulinopsidae Olive 1970(R) attachedto nucleus by striated rhizoplasts. cilium to the centrosomalplateand nucleates the single ventral microtubule;both centrioles dorsalcape of single microtubules; dense forked fibreattaches the c beating cilium;non tr Biciliatesemi ●●●●Helkesimastigidae Cavalier as in mostCercozoa. nuclearenvelope; mitochondrial cristae orflat wit invaginationstubular of inner membrane ofnuclear envelope; peroxisome attached to the rhizoplasts;centriole shorter(1 submembraneskeleton; nucleusattached to cellsurface two anteriorstubby nipple centrioles attachedbasally dense a to spiral fibre, and laterally ato microtubular root; one or posteriorcilia possessing transition regionhub Biciliatetetraciliateor phagotrophic, with oneor two motile long, andhighly acronematic ●●●●SainouridaeCavalier posterorcilium; cristaetubular or Ancestrallyamoeboid bi Sainouroidea ●●● Agitata between ubiquitin monomers.Clad ciliatephasealternates with sedentaryamoeboid phase; one amino acid insertion only Pansomonadidae ●●● Vickermanin Vickermanet2005 al. Proleptomonas Aurigamonas Orciraptor Acceptedailing cilium for gliding, other the bearing a ciliary stumpor rarely a short motile laterally Article . Guttulinopsis Heterotrophiccell with two heterodynamiccilia, both cilia free body;from motile podialcontaining net a pigmented phaeodium, thus converting into it ‘central a Agitata,Aurigamonas. and liumonly, but some secondarilyplanktonic swimmers amongst which Ebriacea - ,

rigid cells with two parallel,longitudinally centrioles,offset one bearinga orwith scales;ventral filosepseudopodia emerge ventralfrom groove; two Bodomorpha Viridiraptor , Sandona 33 33 - Cavalier amoeboid phagotrophswith resting cysts;apical centrosomal plate with , Schuleret2018al. (R)

Olivorum Acantholus - ciliates,typically withoutscales or theca; - ,but exc and - like cilia without these structuresor butroots, with nine a Smith 2008 - , Smith2003, emend. Cavalier Dujardina Teretomonas , —

Puppisaman

, 1.5Xwidth) than in mostCercozoa (2 - flatcristae; microbody attached to nucleus.

Smith 2008. Cholamonas ludingthe genera e includescommonlast ancestor of

,

Flectomonas Helkesimastix. .

, Viridiraptor, Orciraptor . s reserved. -

, Homocognata, lattice andnonagonal fibre;p h peripheralvesicles, not elongatedtubules , Agitata Mollimonas

and centrioles bystriated -

Smith 2011

, Allantion

Sainouron. , cellsoften ongliding Neoheteromita

entriole bearing long the ,

— Aurigamonas Allapsa 2.5width); X fine

osterior

, , - fold

and This article isprotected right by All copyright. elaborate branches. surroundedby “teeth” or bypeculiar elongate extensions known“feet as provided with large shell openingplaced on oral the pole of themain axis; capsule opening organicconnections. orabsent incomplete, composed of numerous solitary,scattered pieces or spicules without Centralcapsule ●●●●●Phaeocystina Haeckel 1879 ligamenton the aboralpole. ventralboat ●●●●●Phaeoconchia Haeckel1879. cristae. polyhedralshells, or more solid,porous clam organ skeletons,when present,composed of scattered spiculeshollow or silica joined bars, by “phaeodium,” containing undigesteddebris, suspendedin theextracapsulum; mineral protrudin massof cytoplasm, and smaller,typically lateralopenings, as “parapylae”, with thinner pores oropenings; large opening known as an “astropylum”or oralpore withprotruding a Leptochlamydophrys. Chlamydophrys Thecofiloseaisproposed, called Helkesida Cavalier 33 phaeodarians. unlike manyImbricatea (see below), but hollow silica endoskeletonin all ebriids an capsule’,but not homologous with of that Polycystinea ofRadiolaria; silica scales absent, Anodeincluding a probably monophyletic cladecomposed of Sainouridae and Accepted ArticleCentralcapsule w Incertaesedis icmaterial; a wide variety includingof forms, geodesic frameworks, sphericalto

g strandsof cytoplasm; dense massof darkly pigmented granularcytoplasm, the Centralcapsule located eccentrically,aborally, in simple lattice shell typically Centralcapsule enclosed within bivalv - shaped valves,which are completelyseparated and rarely connectedby a

●●●●PhaeodareaHaeckel 1879[Tripylea Hertwig 1879] ●●●● ,

suspendedin thecentre of the extra Thecofilosea: Lecythium,Trachyrhizium, Diaphoropodon, ith thickened, doubleith thickened, Thecofilosea:Chlamydophryidae Saedeleer de 1934 (R) Castanella,Challengeron, Haeckeliana, Medusetta, Tuscarora. Aulacantha,Aulographis, Cannoraphis.

Coelodendrum,Coelographis, Conchellium, Conchopsis. ●●●●●Phaeogromia Haeck Mataza.

- layered,capsular wall containing twoof kinds - shaped,bivalve shells;tubular mitochondrial s reserved. e latticeshellcomposedof dorsal and - - Smith 2018(R) capsularcytoplasmic network;skeleton

el1879.

Clypeolina,

”, sometimes”, with

d most

This article isprotected right by All copyright. Acceptedcytotrophic. particles (agglutinated); cilia or flexible tectumwith one basalaperture for filopodia,sometimes including foreignmineral Uninucleate cells(some may form multicellularfused aggregates) surrounded byorganican ●●●● TectofilosidaCavalier Ventrifissura,Verrucomonas. ciliaryto groove unlike Thaumatomonadidaand cleft fromwhich branched pseudopods filose emerge for feeding separate from subapically,often apicalfrom notch Stro pseudopodia emerge slits.from chromosomes; thickenedcell wall with sevenwith layers poresextrusome for discharge; longitudinal furrowin anteri dorsoventrallyfunnel; andflattened oval Heterodynamicbiciliated cells with cilia sub ●●●●●Protaspidae Cavalier (1981). unknown.Electron microscopy (mainlybacteria, also yeasts,algae); division longitudinal, binary; sexual reproduction Article withtheca exosomes ( layeroutsideand scarcely thicker t flexible,in active cellsadherent throughout to cell surface, consistingof single smooth dense Thecate amoebaewith slit ventral ●●●●●Rhogost name Lecythium and areunrelated to hypothesized the ciliated common ancestor of Ebriace rDNAtreesshow ●●●●CryomonadidaCavalier Sagosphaera. withsimple a shell ope Centralcapsule locatedin thecentre ofa simple doubleor sphericallattice shell,not bivalve, ●●●●●Phaeosphaeria Haeckel1879. ngly ovalflattened cell with rigidtheca without scales; two unequal cilia emerging Protaspis

Rhogostoma,Sacciforma, Capsellina ), ,Rhizaspis, Fisculla. Cryothecomonas,Protaspis

omidae Dumacket al 2017. was pre Rhogostoma Pseudodifflugia ●●●●VentricleftidaCavalier Capsellina ning,lacking “feet”or “teeth”. - occupied). or halfor of cell;nucleus posteriorwith permanentlycondensed - - Smith2003 -

Smith 1993 (R)

Smith 1993 (R)

(Rhizaspididae)within the cryomonads,so theyevolved after of of silica scales absent;tubular mitochondrial cristae, Cryothecomonas,Protaspa ) or withoutor ) ( - Capsellina likeand not flexible cleft thatemits filopodia;theca thin, han plasma the membrane; thuswith symmetry; bilateral –

. . Includes

posteriorcilium used for glidingsurfaces;on ventral

-

(re shaped with parallellateralsides; ventral - - apicalseparated by a protrusion; ciliary withpit

named

. and

Rhogostoma s reserved.

Rhogostoma Auranticordis

Rhogostoma - Smith2011 Protaspa ,Cannosphaera, a andCryomonadidaby loss ofcilia

,

Sacciforma (previouslymisidentifiedas (P)

; with ; extrusomes. in Howe et 2011al.as the

bySimitzis and Le Goff

); phagotrophic andposterior This article isprotected right by All copyright. Secretedsurface Clautriavia ●●●●Variglissida Rhabdamoeba,Abollifer only the other glidingimbr Euglyphidaby absence the ofsilica scales andpresence of cilia, and from thaumatomonads, nonciliatestage feeding with broadlobose fan ventralcleft ( semi ( Spongomonas ●●●●Spongomonadida Hibberd,1983 [Spongomonadidae Karpov1990] imbricatesilica scales and theirclosest nonscaly relatives. internalor silica skeletonof Ebriacea and Phaeodaria. Includes Cercozoawith often which filos kinetosomes,and relatively pelliclerigid helped that todefine a distinct ventral groove from 35 Incertae independentlymade parallel thaumatomonad/in the spongomonad subclade. fourposteriorly groove andcilia secon aggregatesand elaborate extra structures opposite the thecalcontact zone cryomonads; in and sainouroids,and unlike themwith densedistal platebut without internal the dense absent;tubular mitochondrialcrista Secretedsurface silica scales orsecondarily lost, except in basallineages where ancestrally ●●●ImbricateaCavalier withoutplastids. Cellswith two subapicallyinserting cilia; openinternal skeleton of silic ●●●●EbriaceaLemmermann 1901 [Ebriidae Poche 1913;Ebriida Deflandre 1936] Pseudopirsonia

Ancestralcondition probably heterotrophic a gliding cell with twowith cilia divergent Accepted Withoutscales andwithout theca; marine heterotro Article - rigid pellicle underlain bymuciferous bodies and fourposterior cilia associatedwith Biciliatedcells with asymmetricalcell projection at anterior. sedis

e pseudopodsextended, butwithout the denseextracellular theca of Thecofilosea , Nudifila, Quadricilia Auranticordis

. Imbricatea: ●●●● ●●●●MarimonadidaCavalier -

directed gliding cilia in :diatom parasites)or interstitial gliding cells with somewhatdeformable, Ebria,Hermesinum, Botuliforma

silica scales orsecondarily lost; tubular mitochondrial cristae. Cavalier Silicofilosea Adlet 2005,al. emend. darilybylost euglyphids; centrioles multipliedand reoriented to make - , Smith 2011[Cavalier Cyranomonas icates,by absence of scales. ), or), ciliated Discomonas - Smith,2014 (R) .

e; ciliarytransitionregion longer inthan cercomonads Auranticordis amoebaes with two glidingposterior cilia anda

Chantangsiand Leader, 2010 -

Smith &Bass 2011 - - s reserved. Smith 2003] like pseudopods( .

, which , pseudopodia; also lost centrioles phicbiciliate swimming cells Auranticordis,Pseudopirsonia,

Adlet al. 2012

Rhabdamoeba Rhipidodendron,

a; phagotrophica;

35

). Differ). from

This article isprotected right by All copyright. Pareuglypha AcceptedIncertaesedis surroundedby vesicles. largeand conspicuous nucleuseasy to in see activelight cells using microscopy, held toge Testateamoebae, with shell a built of organic material; most taxa with secretedsilica scales ●●● amoeboid creeping. Thaumatomonadidae no evidencefo defined shape;cilia notclearly differentiated into anteriorand posterior; unlike Thaumatomonas morestrongly laterally inrolled than asymmetricor ovals with concave to lower flat surfaceand convex surfaceupper with rims scales eithersymmetric ovalswith heavilyout ●●●●●●Peregriniidae Cavalier extrusomesconsist of shaft with horizontal a and without withposterior a cilium; both cilia emerge fromthe same ciliar pit;cells with a rigid surface Unicellularheterotrophic, with shortanterior a cilium and a long posterior cilium;cells gliding ●●●●●● Thaumatomastix, Ovaloplaca,Scutellomonas, ArticleThaumatospina, Penardeugenia circularor rounded triangularbases. sides,unlike cornersby discrete struts,unlike upperan platebearing species transform completelyinto amoeba; an all have ovaltriangularor two excepta for ventral zone emits that pseudopodia for feeding;unlike Peregriniidae, notdo siliceous scales which isnaked ( for ongliding surfaces unlike Peregriniidae (see below),and a much shorteranterior cilium, ●●●●●●Thaumatomonadidae Hollande,1952 stages known. filopodia produced subapicallyor ventral from groove;cysts; multinucleate and multiciliate heterodynamic Heterotrophic,cells usually gliding that mayswim bodyalso; andflattened with two [Thaumatomastigidae Pattersonand Zoelfell 1991] ●●EuglyphidaCopeland 1956,emend. Cavalier

Esquamula therby organic cement; tubularmitochondrial cristae; filamentouspseudopodia; Biciliatedcells with ventral onlyWith oval two thecaeor scales; or filose lobose pseudopodia sometimesemerging; slender * Peregrinia ,Pileolus Euglyphida

cilia insertingsubapically ventrally; and/or some unikont; with extrusomes;

Thaumatomonas formedin vesicles attachedto mitochondria coverthe rigid cellsurface , ciliary , apicalpit not subapical and ventral, or cellsso amoeboid to aslack

Shiratori,Yabuki & Ishida,2012 Gyromitus,Peregrinia

*. ;

Thaumatomastix : Ampullataria - tiered bodytiered scales andwithou ●●●●●ThaumatomonadidaShirkina, 1987 - - Smith,2011 specificperforations supported atthe oval ends or triangle Gyromitus , Allas at theends (asin

pseudopodia,long ventral posterior pointing ciliumused r ciliary r gliding;locomotion byswimming or slow Allas,Hyaloselene, Reckertia, Thaumatomonas, ) or with) smallscales ( * ,Euglyphidion

onlyadditionally longhas s .

;upper plate lacks centralcleft with inrolled

- stripepattern and cap structure onthe tip. - s reserved.

turned upperand lower rims(as in

-

Smith 1997 Peregrinia * , Heteroglypha ,

t scales ont cilia or spinescales; Reckertia

); in); contrast to - tiered bodywiscales, pine scales with near * , , Matsakision Thaumatomastix .

Gyromitus * ,

); - th th ) This article isprotected right by All copyright. Accepted plants, marinesediments and plankton. Ovulinata elongated,with lengthperpendicular aperture.to leastAt two genera( withTest sel ●●●●●●Paulinellidae Saedeller de 1934, emend. Schaudinnula sands. with collar Scales circular,oval or kidney ●●● unresolved). causes longbranches in SSUrRNA genephylogenies (Laraet al., 2007) and the nodeis scales aroundthe aperture. (There isasingle sequence thisfrom genus,whic Test reinforcedwith relativelydiscoid large, plates; cross ●●● , freshwatersedime aperture with typicalindentation; shape flattened circularor in cross withTest a terminalaperture; thin ellipticalscales; presence of specialized scales aroundthe ●●● Playfairina Articleinvaginatedin some taxa;shape flattenedin cross tooth withTest bilateralsymmetry; scales ovalor round,sometimes of bothtypes ●●●●●●● Trinematidae Hoogenraad&De Groot emend1940, Adlet al. 2012 plants; . aperture;shape flattenedor circular i indentations;aperture surrounded with smallround oroval slightlyscales; subterminal Circulartoelliptical silicascales thatcan ofbe different sizes andshapes, without but ●●● flattenedin cross pattern;test stronglycompressed; specializedno type of scales around the aperture; shape withTest a terminala ●●● containing coveredTest with elliptical,discoid ordenticulated siliceous plates. Theleastinclusive clade ●●●●●●Euglyphina Kosakyan et al., 2016 ●●● Cyphoderiidae ●●● Saedeleerde 1934 ●●●● ●●●●Euglyphida ●●●●S ●●●●Assulinidae Lara etal., 2007 - shaped scales around theaperture, which islocatedon side the of the shell; aperture Campascus Sphenoderia )with totallyorganic testwithout silica scales;in litter and mosses, fre ; ; shapecircular in cross Tracheleuglypha * Assulina , Puytoracia , phenoderiidae2013 etal.,Chatelain f

- *. secreted siliceous reinforcements,or proteinaceous; when present,scales are

- section;in litterand mosses. * , ,Corythionella, , Messemvriella e Wallich 1864,emend Lara2007 etal. , perturecomposed of elliptic platesdisposed in a regular,alternate Trachelocorythion * ,

ntsand plants. Deflandre,1928 - , shaped, juxtaposed orimbricated; test aperture angled, some Sphenoderia - . section;in freshwatersediments and plants, supralittoral

n cross

Micropyxidiella, , Deharvengia Euglypha

-

section and s reserved. Assulina,Placocista, Valkanovia

Trinema Adlet - section;

, in litterand mosses,and freshwater Scutiglypha *.

Ovulinata,

al. 2012al. -

sectioncircular; withoutspecialized .

in litterand mosses;

* ,Pseudocorythion,

.

- section;in litterand Micropyxidiella ; specialized ; .

h typically shwater *. Corythion,

and

This article isprotected right by All copyright. descendants. commonancestor of Vampyrellida, Phytomyxea, without morphologicaldata. isIt defined here as theleastinclusive cladecontaining thelast sisterclade toEndomyxa, orbranches within it. Numerousenvironmental lineages exist Rhizariarobustly distinct Cercozoafrom and Retaria. Retaria as defined here iseither a This cladevaried has somewhatin definitionand compositionbut retainsa core groupof ●●Endomyxa Cavalier Chlorarachnion,Cryptochlora; Gymnoch acronematiclong smooth cilium( dispersalstage. Also includes minute marine picoplanktonicbacterivorous cellwith single reticulatepseudopodia with extrusomes;cell bodie associatedwith a and surrounded by four membranes in total;usually Amoeboid with plastidsof secondary origin;plastid containingchlorophylls ●●●Chlorarachnea Hibberd&Norris, 1984 Incertaesedis Actinosphaeridium,Cienkowskya tubular mitochondrialcristae; biciliated and amoeboid stages;can be colonial;cysts. not but organized in anyrecognizable pattern; kinetocystextrusomes pseudopodia;on aroudsheath cell;pseudopodia branchingcapabl Extracellularcapsule orlorica attached to substrate, or cell free ●●●●Clathrulinidae Claus1874 [Desmothoracida Hertwigand Lesser 1874] ,Minimassisteria. ●●●●Massisteridae Cavalier Heliomorpha (=Dimorpha Microcometes,Microgromia, Nanofila, , Incertaesedis pseudopodianot do anastomose; some with biciliatedswi appressed to thesub axopodiawith similar granules;pseudopodia supportedby internal microtubules andtypically the granules at frequent rather regularintervals, or with radiating,s veryWith branching fine unbranchedor granuloreticulopodia bearing obviousextrusomes as ●●●GranofiloseaCavalier elongated. a densesingle ordouble layered surface coat that mayextend cilium; up extrusomes highly ●●●MetromonadeaCavalier

Accepted Article Nonpseudopodialmarine biciliatedgliding cells; cytotrophic predator; nonthecate but with

Metromonas, Metopion,Micrometopion, Kiitoksia

Clathrulinidae Granofilosea*: -

- stratumduring feeding,in asemi Smith 2002,emend. Bass &Berney in Adlet2019 al. (R) ) - , Smith &Bass 2009 and - : Servetia :

- Smith 2007,emend. Cavalier Apogromia Smit

Paralieberkuehnia. Minorisa *, h 1993 (R) Clathrulin .

lora,Lotharella, Minorisa, ,

Kibisidytes DelCampo, 2013).

a s reserved. ,

Hedriocystis,Penardiophrys Filoreta e ofanastomosis, and with microtubules, s oftens anastomosing; withbiciliated a

, Leucodictyon,Limnofila, Mesofila, andprobably - immobile state;in mostspecies,

, mmingor glidingstage. Gromia - Smith 2011 .

Amorphochlora, - floating;sometimes mucous , Ascetospor ,

Partenskyella, ometimes branched, Belaria,Ditrema,

a

.

and

ea,and all its Bigelowiella,

b Viridiuvalis

,

.

This article isprotected right by All copyright. membrane ofinvaginated area;without polar capsules orpolar filaments; spore anterior Distinctive liddedspores; during spore developm ●●●●Haplosporida Caullery&Mesnil, 1899 capsules or filaments;parasites of invertebrates. Complexspore structure ●●●AscetosporeaSprague 1979,emen mitochondrialcristae; ciliateddispersal cells or gametes. non ofTest organic material, brown ●●● multinucleate open Aciliate,naked, free ●●● Phagomyxa,Maullinia. ●●●●Phagomyxida Cavalier Sorosphaerula,Spongospora. ●●●●Plasmodiophorida Cook,1928. parasitesor parasitoids plants of or stramenopiles. mitoticprofile due elongateto persi specializedsolid extrusome Amoeboid orplasmodial feedingcells producing biciliate tetraciliateor cells;some with ●●●PhytomyxeaEngler &Prantl, 1897 Leptophrys,Platyreta, Thalassomyxa, Theratromyxa, Vampyrella, Vernalophrys, Penardia freshwater,soil, or marine environments. surrounding the granular,sometimes highly vacuolated partand structure considerable sizes;sexual processes unknown; cytoplasm oftendifferentiated into a finely celldivision usually take amoeboid, free Exclusivelyheterotrophic, naked, phagotrophic amoeboid organisms;life cycle includes

Accepted Article - Gromia Filoreta granularcytoplasm; filopodia anastomose butnot intoa reticulum; multinucleate;tubular

Dujardin,1835 Bass &Cavalier ●●●Vampyrellida 1901, emend. West Hess et al. 2012 - movingtrophozoites alternating with anobligatory digestive cyst,in which main cellbody, but at least constituting pseudopodia; the free - mesh nets. - living, mainlybacterivorous reticulose amoebae that extensiveform

place;several taxa can to fuse plasmodiaform and reach -

one or morecells,with oneor moresporoplasms, without polar

— - - Smith,2009 Smith 1993 (R “satchel”

and opaque,with singleaperture; filopodia branched,with Filoreta stentnucleolus lying orthogonal to metaphaseplate; —

. d.Cavalier for penetrating for host cells; with distinctive cruciform

Arachnula,Gobiella, Hyalodiscus, Lateromyxa,

) s reserved. ent,spore wall produced insideouter of

-

Smith 2009 , Polymyxa

- Gromia less hyaloplasm,the latter often

,

Woronina,Ligniera

- livingin , .

This article isprotected right by All copyright. ,veinsthicker vestedwith amorphous, an mucoid m Acceptednakedand single walled,agglutinated, or calcareous; unusual characteristic beta packedinto paracrystalline arrays; majorityof possessforms a test, singlyin looselyor organized bundles, (ii)single helicalfilaments, and (iii) helicalfilaments functi membrane domains;tubular mitochondrial cristae; fuzzy (reticulopodia);bidirectional rapid (10 mm/s)transport of intracellular granules andplasma Filop Foraminifera ●●● d’Orbigny1826 skeleton. of Mainlymarine heterotrophs, with reticulopodia or axopodia,and usually having various types Retaria●● Cavalier parasite” parasitesof Crustacea with Unlike otherascestosporans, have abiciliated dispersal phase with twocilia; unequal marine ●●●●Paradiniidae Schiller1935 sporoplasmsurface, not intracellular;spores without operculum and lingula. Uninucleate sporoplasm with haplosporosomes;spore wallwith no ●●●● Article Paramyxa,Paramarteilia, Marteilioides, Eomarteilia Spore bicellular,consisting of a parietal cell and one sporoplasm;without orifice. ●●●●Paramyxida Chatton, Paramikrocytos Paramikrocytoscanceri definedall as lineages branchingin a cladeincluding unicellular( Hartikainen etal. 2013infecting aquatic invertebrates. Plasmodial ( Microcellparasites within the genera ●●●●Microcytida Hartikainen al. 2013 et Urosporidium. marine andsometimes freshwateranimals. interphasenuclei (“kernstab”); tubu openingcovered by hinged operculum; intranuclear spindle, a rudimentof which persistsin odia withodia cytoplasm, granular formingbranching and anastomosing network on inon reticulopodia; polymorphicassemblies of tubulin asconventional (i) microtubules Claustrosporidium

Mikrocytos

- chambered forms quite variable for “naked”athalamids, assuch - Smith 2002 (R)

and . . Spores unknown,in contrastto most haplosporids.

Larsson,1987

Paramikroc 1911 multinucleate plasmodialphase.trophic

larmitochondrial cristae; plasmodial endoparasites of

Mikrocytos ytos

)stages. Phylogenetically highly anddistinct, Bonamia,Haplosporidium, Minchinia, s reserved.

Farleyal.,1988et and

Mikrocytosmackini -

coated organellecoated unknown of - tubulin;wall structure in aterial; for thecate(soft Paramikrocytos orifice and formedon

whichbe can organic Paradinium Paramikrocytos

and Mikrocytos,

, “spot , prawn , )and

- This article isprotected right by All copyright. terminalaperture; wall agglutinated. composedTest of globularproloculus followedcoiledby a undivided chamber tubular with ●●●●●Ammodiscidae Spirillina chambersper whorl; wall of low composedTest of proloculus followedby enrolledan tubular chamber,undivided with or few ●●●●● Hohenegger&Piller 1975 endosymbionts. planispirallycoiled; some with complexinternal structures adapted hostto algal appearance of the test; generallyimperforate walls;chambers ortubular elongate,ofte randomlyoriented crystals refracting light in alldirections andresulting a in porcelaneous bi Test ●●●●● Delage &Hérouard 1896 extinctlarge Cornuspira followeda planispirallyby enroll agglutinatedor calcareous; in ancestral forms theis test composed of a spherical proloculus Bi ●●●● TubothalameaPawlowski et al. 2012 Astrammina,Crithionina, Notodendrodes, Ps overlookedin micropaleontologically diversity the of this mainlyunfossilized isgroup poorly known andhasbeen largely ;although considered marine comprisesall generatraditionally included intothe ,Astrorhizida, and the Single chamber(monothalamous) testwith organic an or agglutinated wall; the group ●●●●Monothalamea Pawlowski et al. 2013 Incertaesedis Foraminfera: Incertaesedis gamont. comprisingan alternation ofasexually reproducing agamontand sexually reproducing agglutinated materialor mineralizedwith calcite, aragonite,or silica; life cycle often fibrousorganic matrix; for multi foreign material; foragglutinated species, foreign materialsbound with an amorphousor walled)species, assuch membersof the genus -

Accepted Article ormulti -

or multi .

- ;more derived formshave multi chambered withtest tubularchambers at least in the juvenile stage;wall Foraminfera: - chambered,wall agglutinated or calcareous ofhigh Alveolina,Cornuspira, Miliammina, Pyrgo, Quinqueloculina, Sorites

Reuss1862

probablyalso belong tothis clade. Heterogromia, - - chambered(polyt ed tubular chambertubulared in magnesiumcalcite, optically a singlecrystal.

- Ammodiscus, Glomospira oriented foraminiferal research.

D elageand Hérouard 1896

- * chambered tests;the highly diverse group of

ammophaga,Bathysiphon Reticulomyxa s reserved.

thereare 4 halamous) wallsforms, containing Ammodiscus,Spirillina, .

-

5 cladesof fresh waterspecies ; , , proteinaceous with little orno .

- magnesiumcalcite with Allogromia, Patellina, and

.

. n

This article isprotected right by All copyright. ●●●●●●● Accepted●●●●●●● ●●●●●● Heterostegina, Operculina,Planoperculina, Planostegina ●●●●●●● ●●●●●● Schlumbergerella,Pararotalia ●●●●●●● ●●●●●● Angulodiscorbis,Planoglabratella ●●●●●●● ●●●●●● ●●●●●●● ●●●●●● Glabratelloidea (Loeblich & Tappan,1964) ●●●●●●● ●●●●●●●Haynesinidae Mikhalevich 2013( ●●●●●●●Elphidiellidae Holzmann Pawlowski & 2017( ●●●●●●●Ammoniidae Saidova,1981( ●●●●●●●Elphidiidae Galloway1933( ●●●●●●Rotalioidea Ehrenberg1839 emend. Pawlowski 2013 ArticlePlanorbulina) ●●●●●●●Rosalinidae Reiss,1963) ( ●●●●●●●Discorbidae Ehrenberg 1838 ( ●●●●●●Discorboidea Ehrenberg 1838 ●●●●●●Planorbulinidae Schwager1877 ( system.Subdivisions proposed below. ofWall low ●●●●● Delage &Hérouard 1896 calcareous. uniserial;chambers globularorcrescent Test multi ●●●● GlobothalameaPawlowski et al. 2012 ● Serioidea (Hol Nummulitoidea Blainville,de 1827 Calcarinoidea (Schwager,1876) Incertaesedis - Glabratellidae LoeblichTappan, & 1964 ( Bolivinitidae Glaessner,1937 ( Uvigerinidae Haeckel,1894 ( Nummulitidae Blainville,de 1827( Calcarinidae Schwager,1876 ( Buliminoididae Seiglie,1970 ( Rotaliellidae LoeblichTappan, & 1964 chambered,typically trochospirally enro - magnesiumcalcite, optically radial,bilamellar, perforate; some wi

zmann &Pawlowski 2017)

Cribroelphidium, “Elphidium”,Protelphidium )

)

Rupertina,Discano Elphidium)

Uvigerina, Rectuvigerina,Trifarina Ammonia) Buliminoides - Discorbis) shaped in earlystage; wall agglutinated or Bolivina, Brizalina,Saidovina Neorotalia,Baculogypsi

Planorbulinella,Hyalinea)

Haynesina,Aubignyna

Nummulites,Operculinella, Cycloclypeus, s reserved.

(

Rotaliella,Rossyatella lled but maytriserial,be biserial or

Glabratella,Glabratellina,

)

Elphidiella malina,“Rosalina”, Gavelinopsis,

)

na, Baculogypsinoides, na, )

)

)

)

)

th internalth canal This article isprotected right by All copyright. ●●●●● Te Hoeglundina,Robertina, Robertinoides. ofWall hyaline, perforate, optical radial aragonite; chambers with internalpartition. ●●●●● Loeblich & 1984 Tappan Orbulina elongatespines; pl ofWall low ●●●●●Globigerinida Delage &Hérouard 1896(P) ●●●●●●● ●●●●●●● ●●●●●●● ●●●●●●● ●●●●●●● ● ●●●●●●● ●●●●●●● ●●●●●●● ●●●●●●● ●●●●●●● ●●●●●●● ●●●●●●● ●●●●●●● ●●●●●● ●●●●●●● Incertaesedis ●●●●●●● Globobuliminidae Cushman,1927 ( ●●●●●●●Sphaeroidinidae Cushman,1927 ( Evolvocassidu ●●●●●●● Accepted●●●●●● Article ● .

Murrayinelliidae HolzmannPawlowski & 2017( xtulariidaDelage &Hérouard 1896(P) Oridorsalidae LoeblichTappan, & 1984 ( Buliminidae Jones,1875 ( Virgulinellidae LoeblichTappan, & 1984 ( Schultze,1854( Cassidulinidae d’Orbigny,1839 Rubratelliidae Holz CymbaloporidaeCushman 1927 ( Melonidae HolzmannPawlowski & 2017( Astrononionidae Cushman&Edwards, 1937 ( Discorbinellidae Sigal,1952 ( Nuttalidae Saidova,1981( Pullenidae Schwager,1877 ( Chilostomellidae Brady,1881 ( Cibicididae Cushm Stainforthiidae Reiss,1963 ( EpistominellidaeHolzmann Pawlowski & 2017 ( - magnesiumcalcite, bilamellar, perforate; surface may be coveredwith fine,

lina,Islandiella, Ehrenbergina Rotaliida: anktonicmode of life.

an,1927 ( mann & Pawlowskimann & 2017( Bulimina Nuttalides Stainforthia, Gallitellia Nonion,Nonionella, Nonionellina, Nonionoides Pullenia Cibicides, Cibicidoides,Heterolepa Discorbinella,Hanzawaia

Globigerina,Globigerinoides, Globorotalia, Chilostomella ( Globocassidulina,Cassidulinoides, Cymbaloporella )

Sphaeroidina

) Globobulimina s reserved. ) )

Oridorsalis Virgulinella Melonis) ) Rubratella)

Astrononion

Murrayinella ) Epistominella

) )

)

)

)

)

) )

)

)

)

This article isprotected right by All copyright. microtubulararrays in axopodia. Acceptedreproductionin gamontocyst;with lithosomes formingthe gamontocystwall; dodecagonal Pigmentedendoplasm, clears towards periphery; manysmall nuclei in endoplasm;sexual ●●●●●Holocanthida Schewiakoff 1926 spicules. reproduction;hexagonal microtubulararrays in axo lithosomes synthesized Golgiandin forming the gamontocystwall; litholophus stageprior to ectoplasmwith periplasmic cortex; sexualreproduction in gamontocyst; smallplaques as Pigmentedendoplasm, clears towards periphery; manysmall nu ●●●●●Chaunocanthida Schewiakoff1926 divisionsthatultimately release biciliatedisogametic cells;only marine isolates known. reproductionunkno algalsymbionts in endoplasm,and captured prey in ectoplasmnetwork; asexual tips attachedto contractile myonemesat periplasm; tubular mitochondrial cristae;often with base ofeach spicule; 20 rad microtubulararrays, with extrusomeskinetocyst and with centroplast a regioninside capsule (endoplasm) holding organelles; the axopodia, supported by capsule; outerthis network (ectoplasm amoeboid anastomosing dynamicnetwork of irregular pseudopodia extending from the Cellsurroundedby fibrillarcapsule outside ofcell membrane; axopodia, spicules,and ●●● skeletal the matter. Articlespecializedcytoplasmic envelope (cytokalymma) thatdynamically determines the shape of within and/orsurrounding thecentral capsule; thesiliceous skeletonis secretedwithin a varyingin shape simplefrom scattere skeletons,when present,of amorphous silica (opal)or strontiumsulphate (in Acantharia)and containingdigestive vacuoles andinsome casesalgaland/or cyanobacterial symbionts; pores andconnecting to a externalfrothy la axopodiaby supported internal microtubules,extending distally through thecapsularwall capsulum,which contains thenucleus or nuclei and cytoplasmic organelles; tubularcristae; Cellswith distinctive organic,non Radiolaria ●●● Müller sensu1858, Adl et al., 2005 chambersnumerous, trochospirallycoiled. composedWall of rod ●●●●●Carterina Brady1884[Carterinida Loeblich & T magnesiumcalcite. agglutinated,Wall with foreignparticles attachedto organiclining or cemented by low ● AcanthareaHaeckel emend.1881, Amphiacon,Conacon, Gigartacon,Heteracon, Stauracon

wn;sexual reproduction involving consecutive mitoticand meiotic Cyclammina,Eggerella, Reophax, Textularia, Trochammina - like spicules oflow ialspicules ofstrontium sulphate mergedat cell centre;spicule Acanthochiasma - living,porous caps d spiculesto highlyornate geometric )surrounded by periplasmicfibrillar innercortex; cell

- Mikrjukov2000 magnesiumcalcite held organic in lining;

Carterina yer,the extracapsulum;ex s reserved. , Acanthocolla, , Acanthoplegma

podia;contractile matrixat base of . ularwall surrounding intra the

appan1981]

cleiin endoplasm;clear .

- - tracapsulum typecentrosome at - shaped shells, . .

- -

This article isprotected right by All copyright. ● central the capsule. a simple tripod,a sagittalringwithout tripod or poroushelmet Centralcapsule o ●●●●●Nassellaria Ehrenberg 1875, emend. Haeckel 1887 Plegmosphaera,Saturnalis, Spongaster, Spongosphaera Actinomma,Didymocyrtis, Euchitonia, Hexacontium, Hexalonche, Hexastylus, Octodendron, (spicules single,or multiple andconcentricallya skeletoneither absent or when composed present, ofspicules or forminglatticed shells Centralcapsule typically sphericalwith uniformly distributedround pores in thecapsular wall; ●●●●●Spumellaria Ehrenberg 1875, Haeckel 1887, elaborate geometric capsularwall; skeletoneither absent or when present,composed of spicules or forming uniformlyon surface the Centralcapsule spherical ovateto with pores round the in capsular wall distributedeither ●●●●Polycystinea Ehrenberg1838, emend. Haeckel 1887 arrangedin irregularhexagons; siliceous tangentials microtubulesoriginate depressionsfrom in nuclear envelope; microtubulesin axoneme Axopodialpseudopods without kinetocysts (extrusomes),used formotility as oars;axopodial ●●●● TaxopodidaFol 1883 Stauracantha Daurataspis,Dictyacantha, Diploconus, Phractopelta, Phyllostaurus, Pleuras species,except at reproduction; sexualreproduction without gamontocyst. hexagonalmicrotubular arrays; manynuclei in endoplasm;algal symbiontsin all known Thickcapsule clearlydemarcates pigmented endoplasm ectoplasm;from axopodi ●●●●●Arthracanthida Schewiakoff 1926 gamontocystwall. visible with nucleus;outer endoplasm with anastomosingpseudopodia; capsule and periplasmic cortex Pigmentedendoplasm, clears towards periphery; ectoplasmclear; single large central ●●●●●Symphyacanthida Schewiakoff 1926 Accepted●●●●Collodaria Haeckel 1887 Article lightmicroscopy; sexual reproduction in gamontocystwith lithosomes forming the , several , environmental clades. .

vatewith pores localizedoneat pole;skeleton, when present,composed of Amphilithium,Astrolonche, Pseudolithium - Artostrobus,Eucyrtidium, Lithomelissa, Pterocanium, Pterocorys shaped,porous or latticed shells. of a of spherical capsular wall localizedor one poleat ofovatean

s reserved. rranged).Subdivisions not fullyresolved.

emend.Riedel 1967 picules,with external radialspicules.

.

.

- shaped“cephalis” enclosing

Acanthometra, pis, a witha .

This article isprotected right by All copyright. some species ichthyotoxic. with motile,ciliated stages; sexual reproduction may commonbe in prymnesiophyceans; mayalternate with nonmotile palmelloid (colonial),single celledor filamentousstages, or haplo oftenthe main storage product;eyespots recordeda in fewgenera ( 19’butanoyloxyfucoxnthin), a nuclearenvelope continuouswith outerchloroplast membrane; pigmentsmajor chlorophylls immersedor bulging pyrenoid; nucleus usually orposterior central; outer membrane of chloroplastswith thylakoids in groupsof threeand w twogenerally a withoutappendages, inserted apically sub or cilia;characteristic cell covering of unmineralized and/or mineralizedscales; motile cellswith motile cells mostlypossessing a haptonema, a filiformappendage situat Autotrophic, mixotrophic heterotrophicor single cells;some in colonies,or a fewfilamentous; ●● mineralized(si Thin microtubule Haptista ● clade outsideof Aquavonida. microscopicallyvi surfacesby means of both cilia,one pointing forwardsand one backwards; without light Heterotrophicand phagotrophic biciliates with long anteriorand posterior cilia; glideon ●● mitochondria with tubularcristae; rapidly swimming and rarelygliding protist; cytotrophic. pointofthe cell body; single contractile vacuole andnucleuslocated anteriorly; several shapeslightly flexible,n each otherand connected least byat one fibril;posterior kinetosomeisvery (>1long µm); With two smoothsubapical heterodynamic cilia; kinetosomesapproximately rightat angle to ●●● alldescendants.their adjacentsubstitutions (AU instead ofYG) in anonbinding partof the3° comple complementarysubstitutions U from lineages sharinga unique combinationof 18S rRNAsequence signaturesconsisting of two Definedas least the inclusive cladecontaining the last commonancestor of the rhizarian Aqu●● Sphaerozoum,Rhaphidozoum, Siphonsphaera, Thalassicolla extracapsulum;solitary or colonial forms. Skeletoneither absent or when composed present, ofscattered spicules within the , c1

Accepted Tremula Article Haptophyta Hibberd ex.1976,

A , and , - quavolon diploid cycles life - avolonidaBassBerney, & 2018

mentarysubstitution A from c2

Cavalier Howeal. 2011 et [=TremulidaHowe al. 2011] et M with liceous or calcareous)scales. Tikhonenkov,Mylnikov, &Bass, 2018 - based appendages(haptonema or axopodia) used for feeding;complex sible theca, scales sible theca, orcytostome. Molecular phylogenies showisa sisterit c3 - Smith 2003

in prymnesiophycea

ot flattened,with remarkabledepression lateral in themiddle lateral includingheteromorphic alternating stages; motile,cilia

b eta Tremula longifila. -

carotene,diadinoxanthin, and diatoxanthin; chrysolaminarin Edvardsen&Eikrem 2000 - - Ato G T toC(T)

ns, fucoxanthin19’ (e.g.hexanoyloxyfucoxanthin, Acrosphaera,Collosphaera, Collozoum, - Cand

- s reserved. G(A)in helix and a 48, specific motif of two

from G from ith no girdle lamella;chloroplasts with

- C C(U)to

- apically;usually 1 .

- Pavlova G(A)in helixone 11,

stemofhelix and25 ed betweenof pair , ted stage ted

or

2

); This article isprotected right by All copyright. (scales)embedded in it; axopodiaby supported microtubules forming hexagon Withoutcilium; nakedor coveredwith mucous,usually with organicor mineralizede Cavalier ●● Balaniger stages inthe life cycle;haptonema short or highly reduced; some species lack chloroplasts. Ce ●●●● ,Ruttnera, Tisochrysis. organicscales; nonmotile cellsusually covered with . Motilenonmotile or cells;h ●●●● stages;nonmotile cellscolonial and embedded in gelatinous material. cell the co Motile cellswith twoand cilianoncoiling short haptonema; one to fourchloroplasts per cell; ●●●● Pseudohaptolina. reported. organic, of sometimesspiny sometimesscales, absent; some alterna Motilenonmotile or cells,usually with two ciliacoiling anda or flexible haptonema;covering ●●●● shortto and noncoiling; cilia equal of or sub or motile stage alternatingwith ciliated a haploid stage;haptonema maybe long andcoiling c Unicellularcolonial,or mostly ciliated cells with mineralizedunmineralized and/or scales ●●● Exanthemachrysis single chloroplast,sometimes witheyespot an beneath short the cilium. longer the cilium mayhave or hairs thin scales; haptonemashort, taperedand nonc ciliummay have swelling a with denselystaining projectionson the side adjacent to cell, the Biciliatedwit ●●● overing cells; the some species exhibittwo stagesin thelife cycle,with a diploid non

Acceptedllswith calcifiedorganic scales duringsome stageof the life cycle;single alternating or Article CentroplasthelidaFebvre Prymnesiophyceae Hibberd1976 Pavlovales 1976 Green Pascher1910, emend. Edvardsen &Eikrem 2000 Schwarzemend.1932, Edvardsen &Eikrem 2000 Phaeocystales Prymnesiales Papenfuss 1955,emend. Edvardsen &Eikrem2000 - Smith inYabuki et2012; al. Centroheliozoa Dürrschmidt &Patterson 1987] , veredwith scales oftwo sizes;life cycle mayconsist of nonmotile and motile Calciosolenia,, Hymenomonas, , Wigwam h unequal cilia insertedsubapically laterally;or body scales absent;shorter

, Pavlova,Rebecca.

Medlin 2000 aptonema rudimentary absent;or motile cellscovered with small , Chrysocampanula, , ,Haptolina,

- Chevalier&Febvre 1984

- equallengthsinsert s reserved. 35

[CentroheleaKühn 1926 Emiliania, edapically or subapically. telife cycle stages Phaeocystis

Prymnesium,

Diacronema,

ma. -

related sensu .

oiling; lements

- motile ,

This article isprotected right by All copyright. 2018(M) ●●●●● a strongindentation onone side of a horizontal flat base. verticalstalk, hollowand inrolled) formingthe innerlayer and outer bipartite spine scales consistingof a Two contrasting typesof siliceousoval scales, or bilobedtangential plate scales (margin not ●●●●● bilateralsymmetry. scales with cylindricalattached onshaft heart the innerlayer are flattened, simplestructure, in usually ornamented with axialouterrib, spine and lowerplates, connectedby internal septae or Typicallywith unconsolidatedlayer of flattenedsiliceous platescales, which consistof upper ●●●● and Theleastinclusive containing clade, Zlatogursky2018 ●●● isolated,carefully studied andprovided with formaldescription. formallyintroduced and needsto avoided;be theorganisms designated by needit to 36 Incertaesedis Spiculophrys panacanthocystid increase regions(PINs) 2, 6, 7, 10, of12 SSU rR tapering towardsacute apices;expansions (but sometimesnoticeably inshort) typically lacking silica scales butwith numerous thin,pointed organic spicules Incertaesedis Febvre 35 centrosomeas trilaminardiscwith electronfibrous pattern;ball

One more One genusname Accepted ArticleCentrohelidaKühn was introduced includeto bothcentrohelids and gymnosphaerids; Choanocystiscurvata PterocystidaCavalier Raphidista ShishkinZlatogursky & 2018 - RaphidiophryidaeFebvre Choa Chavalierand Febvre (1984)were the firstwho recognized and named this taxon.

- and nocystidae Cavalier .

sometimescurved or branched butlacking wings, lateral emanating nearfrom

Centroplasthelida: Centroplasthelida:Spiculophryidae - conestructure containing kinetocystextrusomes along axopodia;

(R)

– - butnot Smith andvon Heydender 2007emend. Shishkin and

Heteroraphidiophrys - Smith &von der Heyden 2007(M) - Parasphaerastrum Chevalier&Febvre 1984emend. Acanthocystis nichollsi Pterocystisdevonica s reserved.

, mentionedin Mikrjukov (2002) was never -

with two typesof scales: platescales of shaped baseplate, which provides - 36 densecortex, flat mitochondri

. Shishkin &Zlat

. Choanocystis ,

Raphidiophrys heterophry

NA genepresent.

ogursky2018(M) Shishkin &Zlatogursky .

alcristae. oidea bere

-

This article isprotected right by All copyright. 39 expansionsin centrohelidsShishkin see etal., 2018. 38 regions apices;acute SSU rRNA short,gene lacking expansionsin panacanthocystid increase Lacking siliceous scales with but numerous thin pointedorgani ●●●●● instead of involvingmorphological and moleculardata. obviouslyunifya groupof closely related organisms which needa careful taxonomic revision 37 Pseudoraphidocystis mucouscoat. spinescales; siliceousif scales secondarilymissing ( With ●●●●● centrosomein alldirections orappressed substratum;to extrusomes conspicuous. Naked,without scales, spicules or mucuscoat; axopodiaradiating either fromthe ●●●●● secondarilymissing with without or replacingwithit organic spicules. mayhave wings lateral thatare greatlyreduced or absent; siliceous scalesmay be orthogonalwing) to th ( or truncatedand maybe samein the plane asthe blade orsomewhat bent away it from or(blunt pointed, but unbranched) axialan usuallyrib, in variousdegree extended apicallyprojectingas a needle neverdistinctly bilobed; outerbipartite spine scales typicallyofconsisting leaf narroweratone end, sometimes slightly indented one on side ( hollow not and inrolled sometimes but thickened) sometimes slightly(rarely markedly) Two contrasting typesof siliceous scales: tangentialinnerplate scales usuallyoval (margin ●●●● margin;organic spicules mayoccur. and lowerplates, connectedby internal septae; scales usuallysurrounded bya hollow Typicall Pterocystis

AcceptedSeparation of this genus from moreFordetailed description ofthe location an Genera Article

two contrastinglayers ofsiliceous scales:inner plate scales andouter bipartite leaf PteristaShishkin &Zlat Heterophryidae Poche 1913emend. Cavalier Pterocystidae Cavalier Oxnerellidae Cavalier ywith unconsolidatedlayer of flattenedsiliceous platescales, which consistof upper 38

. Pseudoraphidiophrys,Pseudoraphidocystis, Pterocystis, Raineriophrys (PINs)1, 2, 6, 9 7, Raineriophrys

) or ) markedlyextended asa distinct shelf or basal disc (sometimes calledbasal Pterocystis 37 e main blade ( .

ismultiply preoccupied and should beavoided. , Raineriophrys,Chlamydaster; Pseudoraphidiophry - - 12,14 infound Marophryidae. ogursky2018 Smit - Smith&von der Heyden 2007 Heterophrys h &Chao 2012(M) and with lateralwings; spine scale base mayroundedbe Raineriophrys

The genusname requires further justification. s reserved. d nomenclatureof SSU rRNA gene ); species); with pronounced a basal wing .

- Chlamydaster

Smith&von der Heyden 2007

Heterophrys, Sphaerastrum

Echinocystis cspicules tapering towards rarelyslightly both)on but )cell a distincthas

sometimesused s; - likeblade with - like point altogether

- 39 like .

This article isprotected right by All copyright. combinationof both, extending posteri depression (vestibulum);longitudinal grooves (furrows)and/or channelstubular (gullets) or a flat tubules;two cilia emergingsubapically dorsallyor rightfrom side of an anterior Autotrophic, mixotrophic heterotrophicor with ejectisomes(t [Cryptophyta SilvaCryptophyta 1962; Cavalier Cryptophyceae●● Pascher1913, emend. Schoenichen 1925,emend. Adl et2012 al. phagotrophicon bacteria; without ejecti substratum;double posteriortrailing cilium; when swimming,in slowgyromotion; one cilium canadhere to mastigonemes onanterior cilium; cilia emerge onleft Marine isolate, free ●● phylogenetic trees. meaning.For nomenclatural stability Cryptist hasand it been somewhat adopted in literature, the although without precision over its meaning,or rank,of Cryptista is meant. However, the hasterm uses in phylogenetic trees compositionand rank. Unless theauthority and date is 40 Chlamydomonasreinhardtii, Telonema subtilis, Emiliana huxleyi. apply not anyif of the following fallwithin ancestorof is This a node ● panacanthocystid increase regions(PINs) 2, 6, 7, 10, 12. similartoplate, than spineto scales. Geneof SSU rRNA usually having expansions only in structure,usually orn Typicallywith two types siliceous of scales:scales ofinnerlayer are flattened,simple in ●●●● devonica Acanthocys in panacanthocystid increase regions(PINs). Themostinclusive cladecontaining like withradially a symmetrical base. Geneof SSU rRNA usually athas least five expansions radiallyor symmetri inrolledmargin; outer scales mayofbe different types basedon plate the scale morphology platescales andouter scales different of morphology or only platescales withhollow a Usuallywith siliceous scaleswith or o ●●● Cryptista

Cryptistabeenhas used since 1989 with variety a definitions, of and varying in

AcceptedPalpitomonas Article Panacanthocystida ShishkinZlatogursky & 2018 Yogsothothidae Shishkin &Zlatogursky 2018 (M) .

tis nichollsitis 40 , ,Kathablepharis, Adlet - baseddefinition the cladefor stemming from the mostrecent common

Yabuki &Ishida2010 (M) - - calspine presentscales, in oneof two forms: funnel layeredMLS livingheterotrophic, heterokontbiciliate, with unilateral bipartite al.,2018 [Cavalier amentedwith axialouterrib, scales mayofbe different typesbut more , Marophrys marina - like structure on one ciliaryvacuolatedroot; cytoplasm; rganicspicules: scale orlyfrom thevestibublum on theventral side; - Smith1989, 2018] (R) somes; flat mitochondrialcristae.

the specified the clade: and

a is defined hereaccording latestto its use in s reserved. - Smith 1986] Yogsothothknorrus

sidewith anteriorcilium vigorous and

specified,isit uncertain which

and Yogsothoth. - bearingspecies with inner both

richocysts);mitochondrial cristae Palpitomonas Glaucocystis nostochinearum,

butnot a

- shaped,orneedle . . . Thename does Pterocystis -

This article isprotected right by All copyright. nonrespiratory,and lack a genome(e.g., hydrogenosomes or mitosomes), or without Anaer ● probablynotdo share the samenode. homologous to thatin Metam althoughrecent multigene phylogenies have markedlyincreased support for monophyly of Groupingof Metamonada andDiscoba andMalawimonads issomewhat controversial, (B f supportedby partsof theR2 microtubularroot, usually also supportedby microtubular fibres generatedby a posteriorly directedcilium (F1); right margin and offloor groove are taxa; feeding groove Typicallywith suspension Excavates[Excavata Cavalier Incertaesedis Ka arrayednear kinetosomes; tubular mitochondrialcristae; plastids not observed. supportedby bandsof longitudinal microtubules; extrusomesare large coiled membrane Free Kathablepharidacea ●●● Skuja 1939 [KathablepharidaeVørs 1992] Chloroplastsabsent. Cyat ●●● ,Teleaulax ,Hanusia, , , Proteomonas, , , Chloroplastsorleucoplasts present. ●●● Pascher1913 Incertaesedis components (IPC,SPC, respectively);includes heterotrophic species formerly known as locatedin lumen;chl complex;chloroplasts when presentcontain chlorophylls gullet/furrowcomplexes lined with ejectisomes; large with orwithout plastid nucleomorph Metamonada

Acceptedthablepharis,, Platychilomonas, Roombia Article ibre,composite fibre),and the left margin by theR1 microtubular root and C fibre. - swimmingcells with two heterodynamiccilia inserting subapically/medially;cell obic/microaerophilic,either with modified mitochondria thatlack cristae, are onada, andonada, of Discoba, separately. Apomorphy: Suspension homonadacea Pringsheim1944 thickenedby lamellarsheath;ingest eukaryotic preythrough an apicalcytostome

and some genera diplomorphicsuch as

EUKARYA Cryptophyceae

Grassé1952 emend.Cavalier

used capture for and ingestion of small particles from currentfeeding Goniomonas ( . Jakoba

-

feeding groove ofthe “excavate” type,secondarily inlost many

- : oroplastcovering comprised ofinnerand superficial periplast libera Smith2002, emend. Simpson 2003] (P) Bjornbergiella. previously .Recent phylogenies indicateMetamonada and Dicoba ,Cryptomonas, Falcomonas, ,

- s reserved. Cyathomonas),Hemiarma Smith 1987 Cryptomonas

a .

and c 2 andphycobiliproteins,

and -

feeding groove,

Proteomonas .

- ribbons Hatena .

, This article isprotected right by All copyright. allendobiotic andwith ‘di runs throughthe length of cell the axially and isintracytoplasmic; with standard geneticcode; Withoutdistinct feeding apparatus;one posteriorly directedcilium fromeach kinetid (F1) ●●●●Giardiinae Kulda& Nohýnková,1978 Enteromonas glutamine;several have single a andkinetid nucleus;endobiotic or secondarily free Wit ●●●●HexamitinaeKent, 1880 Apomorphy: cellorganization. nucleus the and cytopharyngeal apparatus; free stretchingas axoneme free axiallywithin cell; the various nonmicrotubular supportingfibres per kinetiddirected posteriorly, associated with cytopharyngeal a ortube groove, usuallywithciliated four kinetosomesbut sometimes only2 or3 ciliated; least at one cilium taxa (‘entero Usuallywith ‘diplomonad’cell organization, namely ofa pair kinetidsand two nuclei;some ●●●Diplomonadida 1926Wenyon, Dysnectes assemblage w beating within the groove;with relatively cristaelarge feeding groove;biciliated, but with 2 Free ●●● “ R2 microtubular root (secondarilyinlost Diplomonadida and Caviomonadidae). kinetid. cilia per kinetid;usually with a feeding groove or cytopharyngealtube associated with each aWith single andkinetid nucleus,or a pairof kinetids andnuclei;2 ●●FornicataSimpson, 2003 Ince kinetosomesper kinetid (secondarilymodified in anumber of lineages) mitochondrialorganelles anaerobic,and nonrespiratory (secondarily inlost ); gr mitochondria; mostlyciliatedcells, ancestrally with four kinetosomesper kinetid,though a

Accepted Article eatvariation exists; some free h cytopharyngealtube or withgroove; alternate an geneticcode rtaesedis Metamonada: - living, marine,anaerobic/m Nonrespiratorymitochondria without cristae. Apomorphy: “B fibre” originatesagainst , Ergobibamus monads’)have single a kinetid andnucleus,probably secondarily; each kinetid , ithin Fornicatain molecularphylogenies. Gyromonas - like organisms”(Kolisko et 2010)al. (P) , plomonad’cell organization. , Hicanonectes

Barthelona

- icroaerophilicciliated cells with broad a ventralsuspension living,many endobiotic, some parasitic.Apomorphies:

- 4 kinetosomes;posterior cilium with 1 ,

, Kipferlia

s reserved. - livingendobiotic,or often parasitic. .

, Trepomonas - lacking mitochondria;paraphyletic Brugerolleia Aduncisulcus

, , Trigonomonas - 4 kinetosomesand 1 – ,

TARcodon for Carpediemonas .

- , 3 vanes and

, or Trimitus - living. . ,

- four four 4 . -

This article isprotected right by All copyright. Monotrichomonas free absent; usually of “ lamelliformundulating membrane; costa, comb Two ●●●HonigbergiellidaČepič Pentatrichomonoides exceptionallyfree absent;axostyle usually of “ membrane;B Four ●●●Trichomo Incertaesedis presumablysecondarily. Apomorphy: parabasal apparatus. acristateto hydrogenosomes; mostlyendobiotic, parasitic,some some free externalan spindle, includin multiplication ofcomplete orpartsof the ciliaryapparatus in othertaxa;closed mitosiswith connect toa pelta frequentlywith additionalcilia (one to thousands);one Golgiapparatus to the ciliaryapparatus; kinetidancestrally with four cilia/kinetosomes,but Cellswithparabasal a apparatus ● fibre anddorsal endobiotic fan; or free ventralgroove rudimentarylost; of microtubular cytoskelet simple, consisting nuclearfrom Single cili ●●●Caviomonadidae Cavalier supportmonophyly, perhaps due to misidentification/polyphylyof Chilomastix electronas an microtubules;all endobiotic, except one for free feeding groove with posteriorcytostome; cellsurface often underlain bya corsetof ( Single ciliaryapparatus with four kinetosomesand eithertwo ( ●●●Retortamonadida 1952Grassé, (P) Chilomastix Accepted Article●Parabasalia - – living,some endobiotic. – more more than20 ancestrally)(4 cilia with oneciliaryaxoneme sometimes supporting a six ancestrally)(4 ciliawith oneciliaryaxonemesupporting lamelliform a undulating aryapparatus with two or four kinetosomes anda single cilium withoutvanes; , )emergent cilia; posteriorcilium has 2 , nadida -

- typecosta,sometimes absent;comb Trichomonoides Parabasalia: dense sheetsupporting theanterior or Honigberg,1973 - – . living.

axostyle complex;reduction or loss of ciliary the apparatus in sometaxa,

Kirby,1947 , Pseudotrichomonas Cochlosoma ka etka al., 2010 (P?) . Note . thatmolecular phylogenetic studiescurrently notdo g a conspicuousg microtubular bundle; mitochondria transformed Trichomonas Trichomonas Tricercomitus. Ditrichomonas - , Smith,2013 Trichomitopsis

–

two or morestriated parabasal connectingfibres the , - Dientamoeba,Lacusteria living.

type”, sometimesof type”; mostlyen

,

, Pseudotrypanosoma, Cthulhu Caviomonas s reserved. .

- - likestructure, and infrakinetosomal body livingspecies. Apomorphy: “lapel” structure – - 3 vanes andisass like structure andinfrakinetosomal body , igin of the peripheralmicrotubules. Cthylla kinetosomebears sigmoid fibres that

dobiotic,some parasitic, ,

Iotanema , Hexamastix “ Retortamonas Tritrichomonas , Pentatrichomonas

Retortamonas Tetratrichomonas .

ociatedwith ventral a , Honigbergiella - living, ) or ) four

type”;usually

spp. , ,

, This article isprotected right by All copyright. parabasal fibres originate twofrom orparabasa four usuallyretained during cell division; one hemirostrum eachgoes to daughtercell; numerous each hemirostrumbears one ortwo ciliaryareas with hundredsto thousands of cilia; cilia Bilaterallytetraradiallyor symmetrical, with anteriorrostrum divided ●●● TrichonymphidaPoche, 1913 nucleus; the single thin axostyle;endobiotic. Multiple kinetosomesin a single arrangedkinetid inear an ●●●LophomonadidaLight, 1927 Spirotrichonympha,Spirotrichonymphella, Uteronympha. Microjoenia,Micromastigotes, Rostronympha, Spiromastigotes, Spironympha, multiplethin in bands, or reduced;endobiotic. ciliary the rows dividing between daughtercells;axostyle singleof “ Multiple kinetosomesin counterclockwise spiralrows; cilia retainedduring celldivision with ●●●SpirotrichonymphidaGrassé, 1952 Pachyjoenia Koruga Devescovina ramified;or endobiot multinuclear forms;parabasal body single or multiple,ellipsoid rod or “ crestaand paraxonemal associrod ‘privileged kinetosomes’,often discarded duringcell division in highlyciliatedtaxa; somewith multinucleate genera; four Uninucleate to multinucleate;akaryomastigonts in ●●●CristamonadidaBrugerolle Patterson, & 2001 Monocercomonas type”or “ railtype,sometimes lamelliform;A suprakinetosomaland infrakinetosomal body; if present, undulating membrane typically of U ●●●TritrichomonadidaČepička et al., 2010 (P?) Hypotrichomonas,Trichomitus. biramous parabasalbody; axostyle usually“ of costa,sometimes absent;comb ciliaFour with oneciliaryaxoneme supporting a lamelliform undulating m ●●●HypotrichomonadidaČepička et al., 2010 Tritrichomonas Accepted Articleninucleatebinucleate; or 0 , Macrotrichomonas Trichomonas , , Projoenia Foaina

type’’,secondarily thin or reducedsome; in multiple axostyles in , Parahistomonas ic. ,

Gigantomonas type”;endobiotic, some parasitic. , Caduceia Pseudodevescovi - to , – Macrotrichomonoides - 5(4 ancestrally) cilia; ancestrally with comb thousandsof cilia per mastigont; kinetosomes,except for

-

like structure present,but infrakinetosomalno body; ,

Calonympha - ated withated therecurrent cilium; axostyle ancestrally of typecosta, often absent; axostyle of“ , Simplicimonas , Joenia

na

, Lophomonas. ,

Rhizonympha s reserved. Holomastigotes,Holomastigotoides, Joenina Trichomonas ,

Coronympha

, additionto karyomastigontsin some Metadevescovina , lplates that aform rostral intube some; Tritrichomonas , Joenoides Dientamoeba

-

shapedrow partially encircling

, type”;endobiotic. Snyderella , Deltotrichonympha , Joenopsis Tritricho . intotwo hemirostra;

- , shaped,often spiralled , Mixotricha Histomonas , T embrane;A - Stephanonympha like structure, ritrichomonas monas ,

Kofoidia , ,

type”,or , - type ,

.

This article isprotected right by All copyright. libera baseddefinition: the clade stemming thefrom most recentcommon ancestor of Heterolobosea,Euglenozoa, Jakobida, and Tsukubamonadida;ancestrally biciliate.Node Agrouping rob ● cytopharynxmay present;be freshwater species only. Similar to Trimastigidae with but thickenedvane marginson posteriorcilium; lateral ● freshwater. conspicuous lateralcytopharynx; nonrespiratory mitochondria withoutcristae. Marine and cili posteriordirections Free ● Polymastix,, Sauromonas Microrhopalodina recognisable mitochondrion. byparallel rowsmicrotubules of Apomorphy:Absence of ventralgroove. Kinetosomes grouped intwo pairs.A manytaxa attach to gut wallan using anterior holdfast; closed mitosis with internal spindle orabsent non iscontractile some in taxa; microtubularpelta present in some genera; mitochondrion either which arises amicrotubular axostyle distantlyseparated by a Single kinetid (occasionallymultiple kinetids)consisting of two of pairs ●●●Oxymonadida outerlayer. subst withoutcristae or absent. Apomorphy: “I fibre”associated with root R2has ‘preaxostylar’ Heterotrophicunicells with cilia 4 and kinetosomesper kinetid;nonrespiratory mitochondria ●●Preaxostyla Simpson 2003 , Pseudotrichonympha,Rhynchonympha, Eucomonympha,Hoplonympha, numerousthin axostyles not do protrude outside the cell;endobiotic. ● Discoba ● um; posterior um; ● Accepted● Article Trimastigidae SavilleKent, 1880 Paratrimastigidae - livingexcavate ciliates bearing four ructure ,

Simpson inHampl et al., 2009 (R) Trimast

– -

recognised, endosymbionts,gut mostly in lowertermites and ustlyrecovered in multi latticeworkparacrystalline layer of ‘double Urinympha cili

, godo

Monocercomonoides,Notila Grassé 1952 um withum two vanes broad without thickenedvane margins,no ; ix.

a br

Zhang2015 etal. yi

, oad ventral feeding groovewhich in posteriorly beats the preaxostyle (microtubularroot R2 andparacrystalline I fibre), from Euglena .

Barroella,

,

Leptospironympha (nothomologous to thatof Parabasalia). Absenceof

gracilis ; - 1882 axostyleof consists parallel rows of microtubulesand -

genephylogenetic analyses, containing Blattamonas

, Spirotrichosoma,Staurojoenina

cili , Saccinobaculus,Streblomastix, Tubulimonoides

Naegleria a stretched roughlyanterior,in the right, left, and s reserved. ,

Opisthomitus , ,

Macrospironympha, gruberi Brachymonas Paratrimastix.

- cross’ thicknesscross’ withsingle, a fine , and , , ,Paranotil Tsukubamonas globosa , ,

Barbulanympha cili , , Teranympha, ated kinetosomes Cryptocercus xostyle formed Jakoba - directed a , ,

, . - . .

This article isprotected right by All copyright. ●●●PharyngomonadaCava vanes usuallyApomorphy: absent. complexlife cycle containingamoeba, ciliate, and cyst. discoidal,mitochondria sometimesacristate; discrete dictyosomes not observed; ciliary cytostome;closed mitosis with in multiciliate),sometimes nonfeeding;if capable of usuallyfeeding a use groove with eruptive pseudopodia;ciliated cells usually with two or fourcilia (rarelyuni while others some lack theamoeboid pha Typicallywith ciliatedand amoeboid phases,though many species lack theciliated phase, ● ventralgroove; dyctiosomes andciliary vanes absent. Roundedbiciliate cell,with four kinetosomesper kinetid;aerobic; ●●TsukubamonadidaYabukiet al., 2011 (M) nudum.nomen 27’’the18Sof rRNAmolecule. cristae. the Andalucina Without Free ●●●HistioninaCavalier Anaerobic, mitochondria acristate. ●●●●Stygi Aerobic, mitochondria cristate. ●●●●Andaluciidae Cavalier incarcerata stemof ‘‘helix 27’’ the 18Sof rRNA molecule (positions1050and 1085in the cristaeor anaerobic with acristate mitochondria. aWith G:Cbase Free ●●●AndalucinaCavalier possiblyplesiomorphic; free cilium;posterior cilium with asingle dorsalvane thatisdisti With two ciliathe head at of a broad ventral feeding ingroove, which beats posterior the ● ●JakobidaCavalier Accepted●HeteroloboseaPage &Blanton 1985 Article - - swimmingor sessile cells,some generawith lorica;aerobes with mitochondrial flat swimmingcells, attaching temporarily surfaces;to aerobic with tubular mitochondrial ellidae Pánek al.et 2016

18S rRNA genesequence AY117419).

- Smith,1993 - Smith 2013 - Smith,2013 - lier - Smith,2013 living.

- Andalucia. - , Smith2008 specificbas G:C ternal spindle;ternal mitochondrial cristae flattened,often

Stygiella,Velundella.

Jakoba

se;rarely amoeboid whenamoebae ciliated; often

s reserved. , e pair withine pair base the of thestemof ‘‘helix Moramonas .

Tsukubamonas.

nctive among excavates but ,

Reclinomonas

consumes preythrough pairwithin base the of the

, Andalucia - Seculamonas - like

or

This article isprotected right by All copyright. Swimmingcells with cilia; four without amoeboid aerobic. from; ● fragment.Apomorphy: Format Amoebae ofsome species aggregate to form bodies;fruiting nucleus mayor may not ●●●●● Poche, 1913 u Locomotionamoeboid orswimming with cilia;nucleolus fragmentsduring mitosis; ●●●●●Gruberellidae PageBlanton & 1985 Neovahlkampfia through Ciliated ●●●●● Jollos 1917(P) cilia emerging 2 from kinetosomes,although Amoebae orciliated; when presentusually with cilia four ortwo per kinetid,with parallel ●●●●Eutetramitia Hanousková etal. 2018 Amoebae;nucleus with centralnucleolus. ●●●●Neovahlkampfii parietalnucleoli. kinetosomes; finger Amoeboid orciliated; when presentwith two cilia per kinetid,with orthogonallyarranged ●●●●Selenaionidae Hanousková eta ciliatwo or per kinetid.Apomorphy: distinct helix 17 Amoebae usuallywith cylindrical,eruptive pseudopodia;swimming usuallyform with four ●●●Tetramitia Cavalier 17 pairs;obtuse usingfeeding a large groove andcytopharynx; with amoeboid phase;lack helix Amoebae usually flabellateor ovoid, eruptive movementrare; with cilia four side in ninucleate ormultinucleate; ciliated observedform in unidentifiedspecies of ●●●●Percolomonadidae Cavalier

Accepted Article - 1 regionin SSUrRNA thatis typical of Tetramitia. -

amoebae oramoeboid withoutcilium; quadri mitosis; single nucleus . , Gruberella Dactylomonas - like projectionon the proximal partof the recurrent cilium; nucleus with daeHanousková 2018 etal. - 3 places;nucleus with centralparietalor nucleoli. - Smith,1993 , Stachyamoeba. ionof fruitingbodies.

, Fumarolamoeba Selenaion , - Smith, 2008

l.2018

has

Neovahlkampfia

.

numerous monokinetids, s reserved. ,

Vahlkampfia ,

Heteroamoeba - Acrasis 1 in SSU the rRNAmolecule. cili Pharyngomonas ate or bi or ate

.

, , Allovahlkampfia cili ,

Naegleria ate;nucleolus persists Creneis .

.

,

,

Pocheina . uphas to 14

- by - side .

This article isprotected right by All copyright. Urceolus. Ploeotia Neometanema,Notosolenus, Pentamonas, , Peranemopsis, Petalomonas, Dinema,Dylakosoma, Entos descended. one orboth ingestionWith apparatus ca ●●●●Heteronematina Leedale 1967(P) Apomorphy:store. Pellicle ofprotein strips. stripscapable ofactive distortion(metaboly); where known,paramylon isthe carbohydrate aWith pellicle proteinaceous of strip Euglenida ●●● Butschli 1884, emend. Simpson 1997 in posterior heteromorphicparaxonemal rods, tubular/whorled in anterior ciliumF2and parallel a lattice microtubular roots; single mitoc pattern consistingof two functional kinetosomesand three asymmetrically arranged with tubular feeding apparatusassociated with ciliaryapparatus; basic pocket;with rareexceptions, emergent Cellswith two Euglenozoa●● Cavalier Pleurostomum apparatusopening slightly posterior to the ciliary ins Biciliate,locomotion asciliated amoebaor swimming ciliate; ●● Amoeboid withs a ●● Alwayswith multipleaerobic. cilia; ●● Amoeboid orciliated ● ●

Accepted Article● ● ● ●●●PsalteriomonadidaeCavalier ●●TulamoebidaeKirby al. et 2015 ●●CreneidaePánek, et2014 al. (M) ●●Stephanopogonidae Corliss, 1961 , Scytomonas

cili cili Anisonema, Atraktomonas,Biundula um F1.um cili , a; a paraphyletica; assemblage from which Euglenophyceae andAphagea , Tulamoeba Monopylocystis a, occasionallya, rarelyone, insertedmore, into anapical/subapical ingle ciliumor multiciliate; a - amoebae

, Serpenomonas - Smith 1981,emend. Simpson 1997 .

pable ofphagotrophy; lacking plastids; most glidesurfaceson on iphon, Heteronema, ; when ; ciliated,with cilia; 4 anaerobic. hondrion mostlywith discoidalcristae. Apomorphy: , Pseudoharpagon Stephanopogon - s, infused some taxa;when unfusedand with >~20 Smith,1993

, cili Sphenomonas

34

a with heteromorphicparaxonemal rods; usually

s reserved. naerobicwith acristate mitochondria.

,

Jenningsia Calycimonas,Decastava . ,

ertion;halophilic veryor halotolerant.

, Teloprocta

, with elongate ingestion . Keelungia,

,

Tropidoscyphus Harpagon cili

Lentomonas, aryapparatus , Dolium, , cili Creneis , ary are .

This article isprotected right by All copyright. Discoplastis,Lepocinclis, Phacus numeroussmall discoid chloroplastswithout pyrenoids, large paramylon grains. Solitary,with oneemergent ●●●●●●Phacaceae Kimet2010 al. phototrophicor heterotrophic; mostly freshwaterspe Single emergent ●●●●●Euglenales Leedaleemend. 1967, Marin &Melkonian 2003 of metaboly; mostlymarine or brackish sp 2 ●●●●●Eutreptiales Leedaleemend. 1967, Marin &Melkonian 2003 with pyrenoid pelliclewith helicallyarrangedstrips capableof metaboly locomotion; discoidal chloroplast(s) Cellssolitary, cytotrophic on microalgaewith two heterodynamiccilia ofunequal length; ●●●●●Rapaza Yamaguchial.et 2012 with extraplastidiceyespot and photosensory apparatus associated with membranesand chlorophylls Phototrophic,with one toseveral plastids of secondary origin with threebounding Butschli1884, emend. Busse and ●●●●Euglenophyceae Schoenichen 1925,emend. Marin &Melkonian 2003[Euglenea Rhabdomonas cilia;ingestionno apparatus. Osmotrophiceuglenids lacking photosensorya ●●●●Aphagea Cavalier impediment,especially many as traditional genera areprobably polyphyletic. Sphenomonas including Ploeotia coverrestricted subsets o apparatuses, areartificial. Some possibly monophyletic taxa have beenproposed would that Traditionalsystems based on,example, for the presence or absence of conspicuous feeding 34 –

Presently,there isno phylogenetic Accepted4 emergentheterodynamic Article , Entosiphon Petalomonas s surroundeds by three . The .

cili um andum second limitedtaxon sampling for molecularsequence data isa significant , Lentomonas , Notosolenus - Smith,1993, emend. Busse&Preisfeld, 2002 f phagotrophic the f : example, for Ploeotiida, the including cili

Astasias.s., Distigma a cili um;palmelloid stages,cysts and envelopes unknown; and a ofequal or unequal length; cellsnot rigid,usually capable .

Preisfeld 2002] , and , presumably cili b membranes; marine species. , and ,

; some ; species secondarilynonphotosynthetic; most taxonomyphagotrophic for euglenids as a whole.

um withinum reservoir, the or both ecies,rarely freshwater. Calycimonas s reserved. pparatusand plastids; one or two emergent

, Gyropaigne cies. Keelungia ,and presumably also taxa such as

; and the Petalomonadida, and the ; , Menoidium Rapaza. Eutreptia,Eutreptiella

cili

cili a non

a; mosta; motile. ,

Parmidium - emergent; . ,

This article isprotected right by All copyright. Incertaesedis polycistronictranscription. Apomorphy: ; mitochondrialRNA editing; Cellswith a kinetopl Kinetoplastea ●●● Honigberg 1963 homologous organizationto the in superficiallayer ofmitochondrion derivedphagotrophic euglenids. Apomorphy: Rod typepellicle Currently strips. treatedas a majortaxon within Euglenozoa,but are probably Microaerobicor anaerobic cells thatpossess rod Symbiontid ●●● metaboly, represent ~97%ofall marine diplonemids, globallydistributed. Previouslyrefered to as the deep ●●● Anteriorrostrum; large posterior vacuole; contain numerousextrusome ●●● ,Lacrimia, Sulcionema, Flectonema some sp Performextensive ●●● giant, flattened mitochondrialcristae. supportedwith paraciliaryapi rod; Heterotrophiccells exhibiting pronounced metaboly; both Diplonemea ●●● Cavalier Monomorphina,Strombomonas, Trachelomonas Euglenaformis,Euglenamorpha, Euglenari various shapeswith or Cellssolitary colonial,or with oneemergent ●●●●●●Euglenace Accepted Article ● Hemistasiidae ● Cavalier Diplonemidae ● Cavalier

Eupelagonemidae Okamoto&Keeling, 2018. ecies contain endosymbiotic bacteria; metabolyalways present.

Kinetoplastea: a Yubukiet2009 al. trans aeDujardin 1841,emend. Kim et al. 2010. ast, whichlarge isa mass(es) of mitochondrial(=kinetoplast; DNA; k) withoutpyrenoid. - splicingand editing of mitochondrial RNA; trophic stage present; -

Smith 1993,emend. Simpson 1997 - - Smith,1993, emend. Adlet al. 2019 Bordnamonas Smith,2016 emend. Adl et al. 2019 - - derivedorganelles with reducedorabsent cristae, calpapilla, feedingapparatus with ‘pseudovanes’; few seapelagic diplonemids (DSPD1 clade).Possible lackof Calkinisia aureus

Ascoglena,Colacium, , Euglena, a,Euglenopsis, Hegneria, Klebsina, , cili Cephalothamnium s reserved. um;one to several large chloroplastsof . . -

shaped epibiotic bacteria;lack - shape

.

trans Bihospites,Calkinsia, d epibiotic bacteria above - cili splicingof splice leaderRNA; a areshortand usually

, Rhynch

s; oidomonas Diplonema Eupelagonema. Hemistasia . ,

.

.

This article isprotected right by All copyright. ● dixenous (= two hosts) genera Blechomonas,Leptomonas, Paratrypanosoma, Ser pocket;exclusively body;phagotrophic or osmotrophic; cytostome, when present,simple and closeto ciliary mastigonemes andemerging anteriorfrom pocke Eukinetoplasticwith kDNAnetwork associated with ciliarybasal body; unciliated, lacking ●●●●● Trypanosomatida1880,Kent emend. Vickerman in Moreira2004 etal. surroundedby lappets; free with anteriorcilium with nontubular mastigonemes;phagotrophic; anterolateral cyto Eukinetoplastwith kDNAnot in a single network, in but parakinetosomalposition; biciliated ●●●●●Eubodonida Vickerman in Moreira2004 etal. (R) Node: osmotrophic;cytostome, whenantero present, biciliated,without mastigonemes; posterior cilium attachedor phagotrophicfree; or Pankinetoplastic kDNAnot in a single network,but ev ●●●●●Parabodonida Vickerman in Moreira etal. 2004 (R) Phanerobia,Rhynchobodo, Rhynchomonas Actuariola,Azumiobodo, Cruzella,Cryptaulax phagotrophicor osmotrophic; preciliary rostrum containi mitochondrion;biciliated, without conspicuous hairs; posterior cilium attached or free; Eu ●●●●●Neobodonida Vickerman in More . mostrecent common ancestor Groupidentified by SSU rRNAphylogenies. Node ●●●●Metakinetoplasti enclosedparasitophorous in membrane. endosymbionts(‘parasomes’) of certain amoebae (e.g. organisms(PLOs), oval cellswith single large a kinetoplast,nonciliated, live as a pocket thatcontinues as a furrow;ectoparasitic, freshwater,and marine. ●●●●Prokinetoplastina Vickermanin Moreira et 2004al. (R) Two genera: ●●●●●Leishmaniinae Maslov2012&Lukeš, (R)

Accepted Article-

orpolykinetoplastic kDNAin not a single network,but in multiple locithroughout the Cryptobia,Jarrellia, Parabodo, Proc Ichthyobodo

parasitic. Node:parasitic. monoxenous(=single host) genera naVickerman in Moreira et 2004al. (R)

arepolykinetoplastic andbiciliated cells with the cilia originating in - living Phytomonas,. ofNeobodonida, Parabodonida,Eubodonida, and Bodo .

ira etal. 2004(R) Ichthyobodo ryptobia,Trypanoplasma .

, s reserved. - Dimastigella,Klosteria, , lateral; free t, ort, emerging laterally and attached to -

baseddefinition: clade stemming from the geia,Strigomonas, , enlydistributedin themitochondrion; Paramoeba ng apical ng cytosome.

-

livingor commensal/parasitic.

.

. spp.),but are not

Angomonas Perkinsela Node:

and stome , - like This article isprotected right by All copyright. forwardand left. ciliumdirected straight behind gliding cell;anterior cilium very shortand thin, projecting stiffly tapering pointto at posterior cilium, or any intermediate shape; long p sideplastic, but cell can alsolonger be than wide, with anterior rounded with posteriorend with Gliding marine biciliated ~5 ● cristae. finepseudopodia arising ventralfrom depressi circulardepression on venter of cell,with collar somewhatplastic; pellicle underlies cell membranedorsalon and lateral surfaces;central Cells5 rounded, ● Aulacomonas extends toposterior end, givinga double cellsoccurring through use ofpseudopodia a in conspicuous longitudina ciliaryother; transition zone with long, a two Free Sulcomonadidae Cavalier Smith 1993,Diphylleida Cavalier ● Incertaesedis CRuMs: plasticity,some wi Collodictyonidae, probably This sister clade Amorphea, in informally referred asto CRuMs, includes atleast ● “ freshwateror soil. kinetosomes,a single ( and withtypical a respiratory mitochondrion with discoidalandcristae genome;two Small free ● Lotmaria,Novymonas, Porcisia, Zelonia, gene Groupidentified by SSU rRNAand GAPDHphylogenies, with relativelyslow evolution the of ●Collodictyonidae Brugerolleal. et 2002, emend. Adlet al. 2019 [Diphylleidae Cavalier ● ●Rigifilida Cavalier

Accepted ArticleCRuMs”(Bro Mantamonas

leftside of cell having angled shape or with (~1 short µm)rounded projection and right - swimming10 sequences. Micronuclearia - livingbiciliated cells, superficially similar Carpediemonasto butn ), Sulcomonas wnal., et 2018) [notVarisulca Cavalier

– Mantamonas plastica Cavalier 10µm in diameter,aproximately circular in dorsov Rigifilida,and Includesmonox th pseudopodia.th Gefionella, – 15µm long cellswith twoequal or four apical cilia orthogonal eachto -

SmithYabuki in et al. 2012 O’Kelly&Nerad1999 , Malawimonas Glissandra. Rigifila - - Smith andGlücksman in Glücksmanet2011 al. (M) Smith 2013] - µmcell; body flattened,characteristically seen wider longthan .

.

Mantamonas. - Smith 1993,Diphyllatea Cavalier enous genera

)or two ( .

- and dixenous genera lobed appearance. - .

part axosome;phagocytosis other of eukaryotic Gefionella s reserved. on, used tocapture bacteria; mitochondrial flat Allmembersexhibit some formof cellular - like margin ofreflected pellicle; branching Borovskyia,Crithidia, Leptomonas,

- Smith2012] (R) ) ventral ) ciliary vane; typicallyfrom

Collodictyon Endotrypanum - Smith 2003, entral althoughaspect osteriorly

lventral groove that , Diphylleia otclosely related ,

- . directed

(= (= -

This article isprotected right by All copyright. sporadica nodules,nodules occasionallyalsoin found anterior/posterior protrusions. straight, ~celldiameter long,but maybranched;be ‘arms’ often have same frequencyvarying but between movingin sameor opposite directions;‘arms’ usually more)short paired lateral ‘arms’ thatwave anteriorlyand posteriorly as if rowing, generallyat Gliding3 ● Hemimastix Spironemidae●● Doflein 1916 Incertaesedis phagocytosis;tubular and saccularmitochondrial cristae;with bottle supportedby microtubules; anterior differentiated intoa capitulum, which the site is of su mayor maynot run the whole lengthof the cell, with up aboutto a dozen cilia per row; Ellipsoid vermiformcells, to cilia typically15 ● Foissneret al. 1988 Planomonas likelycladesister to the Amorpheaand CRuMs. thin single ventrally/left anteriorcilium mayverybe thin or terminate at cellmembrane; long posterior cilium inserts rostrumat anterior; twocilia, unequal each emergingin separateshallow short pocket; apical Small(~5µm) benth ● Cavalier Meteora Accepted Articlebmembranousthecal platesseparate the cilia; thecalplates rotationally symmetrical, – . - 4µm cellround with thin, long, stiff anteriorand posterior protrusions; two (rarely

Hausmannet 2002al. (M) layeredtheca; discoidal/flat mitochondrial cristae;bacterivorous. clade This isthe , -

. laterally;rostrum contains extrusomesin rows; cellmembrane supported by a Spironema

Hemimastigophora ic cells,gliding dorsoventrally compressed, with leftward ,

Stereonema - Smith 1998 [=PlanomonadidaCavalier

:

Paramastix.

.

– 40 µm40 long, arranged in two lateral rowsthat s reserved.

Ancyromonas

, Fabom - - Smith 2008] shaped ext

linearlyarranged onas Meteora , - Nutomonas oriented rusomes.

,

This article isprotected right by All copyright. Clathrella Cla Cingula Cinetidomyxa Cichkovia Cibdelia Chalarodora Camptoptyche Branchipocola Boekelovia Bodopsis Bertramia Bertarellia Belonocystis Belaria Barbetia Aurospora Asthmatos Asterocaelum Aphelidiopsis Anaeramoeba Amylophagus Amphimonas Aletium Adinomonas Actinolophus Actinocoma Actinastrum Acinetactis Table3

Accepteddomonas Article

. Genera

incertae sedis

in eukaryotes, uncertain with affiliation within protists. s reserved.

This article isprotected right by All copyright. Gymnophrydium AcceptedGymnococcus Fromentella Errera Eperythrocytozoon Enteromyxa Endospora Endomonas Endobiella Endemosarca Endamoeba Embryocola Elaeorhanis Ectobiella Ducelleria Dobellina Diploselmis Diplophysalis ArticleDiplomita Diplocalium Dinoasteromonas Dinemula Dimastigamoeba Dictyomyxa Dallingeria Cytamoeba Cyclomonas Cyanomastix Copromonas Coelosporidium Codonoeca

41

s reserved.

This article isprotected right by All copyright. Nephrodi AcceptedNaupliicola Myrmicisporidium Mononema Monodus Monochrysis Microcometes Meringosphaera Megamoebomyxa Martineziella Malpighiella Magosphaera Macappella Lymphosporidium Lymphocytozoon Luffisphaera Liegeosia Lagenidiopsis ArticleKiitoksia Kamera Janickina Isoselmis Immuno Hyalodaktylethra Hillea Heterogromia Hermisenella Heliomonas Heliobodo Hartmannina Haematotractidium

-

plasma

nium

43

42

s reserved.

This article isprotected right by All copyright. Schewiakoffia AcceptedRigidomastix Rhynchodinium Rhizomonas Pseudosporopsis Pseudoactiniscus Protomonas Protenterospora Pleuromastix Pleuophrys Piridiu Physcosporidium Phyllomonas Phyllomitus Phloxamoeba Phanerobia Phagodinium Petasaria ArticlePeltomonas Peliainia Parastasiella Parastasia Paraplasma Paramonas Paraluffisphaera Paradinemula Pansporella Palisporomonas Ovicola Orbulinella Neurosporidium m

s reserved.

This article isprotected right by All copyright. 43 42 41 Urbanella Trichonema Toshiba Topsentella Thaulirens Tetrag Tetradimorpha Strobilomonas Stephanomonas Spongocyclia Spongastericus Sphaerasuctans Serpentoplasma Sergentella

Immuno a juniorProbably synonym of AcceptedBelonocystis Article onidium

- plasma Neumann 1909 (seeKar, 1990)

(Amoebozoa incertaesedis)

Nephridiophaga, a Zygomycete and

Luffisphaera s reserved. maybe the samegenus.

AcceptedThis article isprotected right by All copyright. Porifera Opi ArticleAmoebozoa Amorphea rank highest or Supergroup Table4. Recomended primersfor environmental samples. sthokonta 3

gellata Choanofla Arcellinida clades all Nearly Variosea Discosea, Tubulinea, Variosea Discosea, Tubulinea, nadida Apusomo Clades romorpha: Homoscle ngiae, Demospo

2 1

Por28S Por28S D3 28S Por28S Por28S 28S primers universal 28S HCO2198 LCO1490 primers Cox 1510R 42F18S, cloning R, 2 82F 1 primers) Folmer (modified HCO2198 LCO1490 Cox S20R RibA 18S, RibB 18S APU EK 18S, codes pair Primer st

step, Euk Euk step, & D C1 , , - - nd & -

D1 I I,

RibA RibA 1R

(Folmer (Folmer step, step,

Euk 1498 1498 Euk

- - – - - –

), 1520R 830F 878R 15F -

D5, D2

42F & 42F & & &

& &

,

2, & &

(bp) length Sequence 650 790 800 658 1,750 Variable ~ 660 ~ 1,800 variable molecule, SSU Entire 1,500 s reserved. - – –

660 830 830 900 -

2,200

Forward primer (5’ Forward CATCCGACCCGTCTTGAA GCGAGATCACCYGCTGAAT ACCCGCTGAATTTAAGCAT GGTCAACAAATCATAAAGATATTGG CTCAARGAYTAAGCCATGCA GAAACTGCGAATGGCTC GGTCAACAAATCATAAAGAT ACCTGGTTGATCCTDCCAGT ACCTGGTTGATCCTDCCAGT CTCAARGAYT AAGCCATGCA - >3’)

ATTGG

GCTAGTTGATTCGGCAGGTG CACTCCTTGGTCCGTGTTTC TCCGTGTTTCAAGACGGG TAAACTTCAGGGTGACCAAAAAATCA CCTTCYGCAGGTTCACCTAC C CYGCAGGTTCACCTA TAAACTTCAGGGTGACCAAA GACGGGCGG TGATCCATCTGCAGGTTCAC CTTCCTTTGGTTAAAACAC (5’ primer Reverse TGTGTACAA - >3’)

CTAC AAATCA

AcceptedThis article isprotected right by All copyright. Haptista Fungi ArticleFungi

8, 9

5, 6,7 mycota Chytridio lida: Hexactinel Calcarea: a Haptophyt 10, 11

4,

Euk 1F & AUPH1 AU4 AU2 18S, S1) citation (See ITS RS2R 983F EF EF1aZ EF ITS4 ITS5 ITS2, ITS1 LR5 LROR 28S, PolySSU1R PolySSU1 NS4 NS1 18S, mod 16S1fw primers 16S NL4F 28S D2 C2’mod C2 & 28S NL4F 28 S D3 S - -

1a 1a,* A

- ified partial partial D3 C

-

R, & inner inner & R, 1528R 1528R

5.8S D2, or D2, & & - & & -

- like, ** like, region

1R - -

, ified & ified 9 EFL Euk &

983F & & 983F NL4R D5, NL4R D5

, Table , Table - - & 16SH F &

, &

- B & & (

, or )

430 650 1 1 GGATAGDGG TTTCGATGGTA variable - ~ 1150 ~614 ~800 variable ~950 500 90 s reserved.

, , ~550 795 800 0 – – –

1 470 660 - - -

987 950 1,100 , - 000

590

or GAAAAGAACTTTGRARAGAGAGT AACTA GACCCGAAAGATGGTG ACCTGGTTGATCCTGCCAG AACCTGGTTGATCCTGCCAGT AGAGCTMTCAATCTGTCAATCCT inner and RTCTCACTAAGCCATTC, TCGACTGTTTACCAAAAACATAGC AACTA GACCCGAAAGATGGTG AGCACTTTGAAAAGAGA GAAA

TGATCCTTCYGCAGGTTCAC TGATCCTTCTGCAGGTTCACCTAC ACTTCTGGRTGICCRAARAAYCA GTTCTTGTGTTAATCTC GAACGGCCATGCACCACCACC CCCGTGTTGAGTCAAATTAAGC AACTAAGAACGGCCATGCAC TGA YRTAATTCAACATCGAGGTC ACCTTGGAGACCTGATGCG TCCGTGTTTCAAGACGGG TGCG ACCTTGGAGACCTGA TCCTTCYGCAGGTTCACC AC

This article isprotected right by All copyright. Stramenopiles Cryptista Accepted Article 13, 14

16 Euglyphid Sar sthelida Centropla

15

12

55 5’ F Nu 1757 & NuSSU 5’ F Nu Helio1979R Pav1702R & Hap220F Pry1572R & Pry421F V4F2R 1F & 1528R Pavlova PRYM01+7 528FLong Hapto1R Prym03 Lhapto20R_bis) & (Lhapto8 LSU1 Euk Hapto4 TAReukREV3 D1 TAReuk454FW EukF 2 EuglyLSUR EuglySSUF 1 F SSU 18S,

nd st 22 - -

& SSU SSU 34r

step step & step step

- - Pavlova 3’ R 3’ R

& SAR 28S

- & - EukR - - & 3 V4F

0024 0024

& R -

& -

V3

&

-

& - - -

-

variable variable 150 variable 830 variable variable variable 1 1 593 904 399 416 350 1 s reserved. , , , 400 070 000

-

400

CCAGCA(G⁄C)C(C⁄T)GCGGTAATTCC GGGTTCGATTCCGGAGAG GCGTACAGCTCATTATATCAGCA GCGTACAGCTCATTAT AGAGACA TCGTCGGCAGCGTCAGATGTGTATA CTGGTTGATCCTGCCAGTAGT CTGGTTGATCCTGCCAGTAGT ACCGGTCTCCGGTTGCGTGC AGCAGGCGCGTAAATTGCCCG 1Fabove see GTGAAATTCTTAGACCCACGGA GCGGTAATTCCAGCTCCAA GTAAATTGCCCGAATCCTG GGTATCGGAGAAGGTGAGAATCCT ATGGCGAATGAAGCGGGC

ATCAGCA

GCACCACCACCCATAGAATCWAGAAAGATC GTTTGGCACCTTAACTCGCG TGC ATGTGTATAAGAGACAGRACTACGAGCTTTTTAAC GGCCGGCTTCTTAGAGGGAC CAGGTTCACCTACGGAAACCT CACACTTACWAGGAYTTCCTCGTTSAAGACG TAGATGATAAGGTTTGGGTG TCAACGYRCGCTGATGACA GTGAAATTCTTAGACCCACGGA TGATCCTTCTGCAGGTTCACCTAC GATCAGTGAAAACATCCCTGG CGAAACCAACAAAATAGCAC TCAGACTCCTTGGTCCGTGTTTCT GCATCGCCAGTTCTGCTTACC ACTTTCGTTCTTGATYRA CCGTGTTGAGTCAAATT

AcceptedThis article isprotected right by All copyright. Alveolata Article

ta Dinoflagella a Apicomplex 20 Ciliophora 18, 19 Diatomea da Amphitremi 17 Assulinidae

**** 21, 22

23, 24

For For V418S 785R 3 V4, 18S TAReukREV3 WD1 TAReuk454F V4 18S & R4 PF118S V418S & R3_2 R3_1 primers two reverse & 3 primers) of 8F (mixture Diat_rbcL_70 998R rbcL step, R, 1498 82F 1 1R Assucox As 2 Euglycox1R Eucox1F 1 & EuglySSUR 0 46Fmix st nd st EuglySSUF

sucox 1F sucox

step, Euk Euk step, step, step, step, & , &

-

cloning 646F& 646F& &

Rev mix Euk Euk , ,

2 COI: COI: Next. Next.

& &

nd

&

variable variable variable 1,800 variable 263) 312 (amplicon 379 variable variable variable s reserved.

GAYATGGCKTTNCCAAGATTAAA TTCC AGAGACAG TCGTCGGCAGCGTCAGA CAGYGACGGGTAACGGGGAATTA CAGYGACGGGTAACGGGGAATTA; CAGYGACGGGTAACGGGGAATTA; CADCGACGGGTAACGGGGAATTA; ACTTTCGTTCTTGAT(C GCGCTACCTGGTTGATCCTGCC A AGGTGAAACTAAAGGTTCWTACTTAA A AGGTGAAGTTAAAGGTTCWTAYTTAA AA, AGGTGAAGTAAAAGGTTCWTACTTA 1 ATGCGTTGGAGAGARCGTTTC GAAACTGCGAATGGCTC AAYATGAGRGCYAGRGG :

and and and and ] 3:

2:

[ CCAGCASCYGCGGTAA ⁄ T)(A⁄G)

TGTGTATA

[ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG IIITATTCCATGCTAAASTATTCA IIITATTCCATGCTGIAGTATTCA; ACTTTCGTTCTTGAT(C⁄T)(A⁄G) GATCCTTCTGCAGGTTCACCTAC CCTTCTAATT 1 GATCACCTTCTA CYGCAGGTTCACCTAC 5¢ AGCACCCATTGAHAAAACRTAATG ACTTTCGTTCTTGATYRATGA : CCTTCTAATTTACCWACWACTG, and : CCTTCTAATTTACCWACWACTG, - CGTAATGAAARTGWCCYACC TACCWACAACAG ATTTACCWACAACTG

]

2 : AcceptedThis article isprotected right by All copyright. ArticleExcavates Rhizaria

Heterotroph Euglenida a Trimastigi gida, Paratrimasti : Preaxostyla da Oxymonadi : Preaxostyla sea Heterolobo Jakobida Parabasalia Fornicata a Foraminifer ae Cyphoderiid Cercozoa Syndiniales

26

25

d 27

See citation EukA R Mon EukB) & EukA & JITS JITS ITS2, ITS1 EukA ITS & B) EukA RR (or 16S &16SI EukA s17 18S Euglycox1R Eucox1F C 25F & 18S & 3NDF V4, 18S & 1 8S

ox UnonMet 1256R - , - F -

V4 V4 - I F 14F1 , 5.8S &5.8S - & &

& 1256R 1256R - & EukB ***, , 528F

R, (or R, (or

EukB* EukB ITS

Mon &

- &

F

- R

-

primer pairs primer with the Varies 1,800 variable variable variable variable variable variable 300 variable 1,200 ~500 variable s reserved. - 400

-

3,100

GGCAAGTCTGGTGCCAG CTGGTTGATCCTGCCAG GAAGTCATATGCTGTCTCAA, GTCTTCGTAGGTGAACCTGC TTCAGTTCAGCGGGTCTTCC TACTTGGTTGATCCTGCC AAGGGCACCACAAGAACGC GAYATGGCKTTNCCAAGATTAAA A CATATGCTTGTCTCAAAGAT

TAAGCC

TGATCCTTCTGCAGGTTCACCTAC TCACCTACGGAAACCTT CCGCTTACTGATATGCTTAA GTAGGTGAACCTGCCGTTGG TCACCTACCGTTACCTTG CGGTCACGTTCGTTGC AGCACCCATTGAHAAAACRTAATG GCACCACCACCCAYAGAATC GCACCACCACCCAYAGAATCAAGAAAGAWCTTC

AAGAAAGAWCTTC

This article isprotected right by All copyright. https://doi.org/10.1073/pnas.1117018109. Nuclearribosomal internal transcribed spacer(ITS) region as a universal DNA barcode marker for Fungi. 8. molecularphylogen 7. Cryptococcus species 6. Mycologia 5. nuclearribosomal sequence data 4. Phylogenetics andEvolution mitochondrialgenes in Demospongiae:Anew hypothesis forrelationships within G4 clade the (Porifera:Dem 3. https://doi.org/10.1371/ ParallelSequencing of V9 Hypervariableof Regions Small 2. eukaryotes 1. v.4.9.0 PR2in clades missed some species, of amplification * Selective general Protist general* Protist,

Accepted Article 21 Schoch, James Vilgalys Simmons,D.R. 2011. Phylogeny Powellomycetaceaeof nov.fam. and description of White,M.M., James, T.Y.,O’Donnell, K., Cafaro, M.J., Tanabe,Y. &Sugiyama, J.2006. Phylogeny of the Zygomycota based on Morrow A Torruella, G.,Moreira, D. &López 27

maral

103(6):1411 Env.Microbiol. Rep. .

, -

, , R. & R. , T. Zettle

C c.l., primers Stoeck General ceae Euglenophy s primers Medlin General Y.,Letcher, . 28 C yof the flagellated fungi(Chytridiomycota) and description ofa new phyl

. Seifert, , Picton ,

r, L.A.,r, McCliment, E.A., Ducklow, H.W. &Huse, S.M. Hester 28 . - journal.pone.0006372 J.Bacteriology

1420.

k.a., M. , ,

EukB EukA 62:174

P.M., B See citation See citation . E

1990 9 Huhndorf, . . , Erpenbeck , :113 - -

R F Mycologia Longcore,

& – . 190.

- 172(8):4238 Rapid geneticidentification andmapping of enz 119.doi.org/10.1111/1758

‐

García,P.2017.

s., ,98 . variable pair primer with the Varies , variable variable s reserved. J.E.,

Robert, D (6): . ,Boury - Mozley ; 4246.

**Spizellomycetales 872

V.,

- -

884 Esnault

Spouge, - - SubunitRibosomal RNA Genes Standridge, Phylogeneticand ecological diversity apusomonads, of a lineage ofdeep .

DOI:10.1

CTGGTTGATCCTGCCAG , -

N 2229.12507 J.L., . , Maggs , ; S.E., *** Chytridiomycota except Spizellomycetales except Chytridiomycota *** 080/15572536.2006.11832617 Levesque,

2009. , Porter,

C

. A

. & AMethod forStudying ProtistanDiversity MassivelyUsing C.A.,

D., Allcock ymaticallyribosomalamplified DNA severalfrom Powell, Chen,

. um (Blastocladiomycota).um , PLOS one Geranomyces variabilis

A . W. & W. L.2012. Congruence between nuclearand M.J.,

FungalBarcoding Consortium Griffith

4 (12): TGATCCTTCTGCAGGTTCACCTAC

PNAS ,G.W. ospongiae).

109 (16) ; * ;

*** &

gen. etgen. comb. Nov. Vilgalys See citations for DINOREF DINOREF for citations See Mycologia :

Molecular 6241 , R. , - 6246;

98(6):860 2006 .

2012 ‐ branching . A .

- 871.

This article isprotected right by All copyright. Ecology Diversityand temporal patterns ofplanktonic protist assemblages ata Mediterranean Long TermEcological Research site 23. parasitismapicomplexansthein origins dependencycloseand their of relatives and 22. DNAsequencing revealsa highly complex eukaryotic communityin marineanoxic water 21. diversityinpolycyclic a hydrocarbonaromatic 20. a monitoringWFD network (Mayotte is 19. 84911 metabarcodingapproach for Framework Water Directive clas 18. lowintra 17. organisms:Patterns in the globaldistribution of soil 16. (Stramenopila,Alveolata, Rhizaria) clade a in New Engl 15. 164(2):160 14. nuclearencoded genes. 13. Phylogenetics andEvolution 12. metabarcoding 11. Composition,Diversity and R 10. Science 9.

Accepted Article

- 406 Piredda Janouškovec,J., Tikhonenkov,D.V., Burki, F., Howe, A. Stoeck Lara,E.,Berney, C.,Harms, H. &Chatzinotas, A. 2007. Cultivation Vasselon,V.,Rimet, F Kelly,M., Boonham, N., Juggins,S., Kille, P.,Mann, D.,Pass, D.,S Lara,E.,Heger, T.J.,Scheihing, R. Lara,E.,Roussel Sisson E.Kim, &Archibald, J.2013. Ultrastructure and molecula E.,Kim, Simpson, A.G.B. & Graham,L.E. 2006. Evolutionaryrelationshipsof apusomonads inferred taxonfrom Cavalier Edvardsen, Egge Vandenkoornhuyse, , 93(1), , - 295 (5562):2051 DOI:10.1126/science.295.5562.2051 specificdiversity in free - - 6 182. ,

E, , C. , ,Bass, T., D.,Nebel, Christen, R., Jones, M.C.M.,Breiner, H

– - fiw200,d R., Tomasino,M.P., D'Erchia, A.M., Manzari, C., Pesole, G.,Montresor, M., Kooistra, F.,Sarno,W.H.C D. & Zingone, A.

Smith, &von T. Heyden,der S.2007. Molecular phylogeny, scale evolution andtaxonomycentrohelid of heliozoan. Bittner,L, Andersen, Audic, T, deS, Vargas, C.

a revi ,

Gulla B., Egge ew - - Molec.Biol. Evol. oi.org/10.1093/femsec/fiw200 Devaney,B.,Katz, L.A. & Grattepanche,J Delif,L., Fournier, B., D.M. Wilkinson, &Mitchell, E.A.D. .

Perspectivesin Phycology , E.S. , P.,

44 elative Abundance: ATest Marine for . ., Tapolczai,K. &Bouchez, A. Baldauf, ( 3 - living terrestrial ):

&

1186

Vaulot land,France).

S.L., - 1203

23(12):2455 , D. 2016., &

Mitchell,2011.E.A.D. COI geneand ecologicaldata suggestsize - Leyval, s reserved. pollutedsoil. . https://doi.org/10.1016/j.ympev.20 protists (Euglyphida:Assulina).

euglyphid amoebae testate

Ecol. Diversityand distribution of haptophytes revealedby environmental sequencing and C.,

3 -

and vernalpool. 2466. (

2 Straczek, ): Indicators FEMSMicrobiol. Ecol

77 2017. sification of rivers.

– T.,Kolisko, M., Mylnikov, A.P., &Keeling, P. 91

r phylogeny r of the 2013 . Assessingecological status with diatomsDNA metabarcoding: scaling up on

J.& - D.

82:1 .

2018 . Young . 454Pyrosequencing toDescribe MicrobialEukaryotic Community J.Plankton Res. – - app, M.,Sato, S. & Glover,R. - independentanalysis reveals a in shift ciliate 18S rRNA gene 12 W. & Richards,W. T. .

Seedand bank seasonal patterns of eukaryotic SAR .

, J.P.W. , .

SC140024/R, Journalof Biogeography Journalof Biogeography PLoS ONE . 07.04.019 201 62:365 .

PNAS 6.

2002

. Soilmicroorganisms behave like macroscopic - Mol.Ecol. 00(00):1 373.

112(33),10200 .

. 8(9): e74371.doi:10.1371/journal.pone.0074371

ExtensiveDiversity Fungal in Plant Roots EnvironmentAgency, Bristol. ISBN:978 2010

Gonimonas – .

15. doi:10.1093/plankt/fby020 15.

19(1),21 Multipleparallel marker tag environmental

43(3):520 2018.ADNA based diatom

38(4) – 2015.Factors mediating plastid 10207. - a 31 - vonlea : dependent high dispersaldependenthighand

. 640

-

532. - 650

sp.Nov. - richanalyses of6

.

FEMSMicro Protist

Molecular

- 1 biology

- 2017

.

AcceptedThis article isprotected right by All copyright. Article a single 28. coding regions. 27. 26. 162(1):131 SSUrDNA barcodes for assessingthe diversity and phylogenetic relationships of cyphod 25. reference database for the18SrRNA gene 24.

Lax,&Simpson,G. AGB. 2013. Combining moleculardata with classicalmorphology uncultured for phago Medlin,Elwood,L., H.J., Stickel,S. &Sogin, M Pawlowski,J.& Lecroq, 2010. B. Short rDNAbarcodes for species identification in foraminifera. Heger, T.,Pawlowski, J., Lara, E., Leander, B.S., Todorov,M., Golemansky,&V. Mitchell, 2011.E.A.D. Comparing potential C Mordret,S., Piredda, R., Vaulot,D., Montresor, M., Kooistra, W. - cellapproach. - 141. Gene

71(2):491

J .

Eukaryot - 499. .

Microbiol Doi 10.1016/0378 .

MolEcol Resour . . s reserved.

60(6):615 .L. 1988..L. Thecharacterization ofenzymatically eukaryoticamplified 16S - -

1119(88)90066 25.doi:10.1111/jeu.12068. .20 18;1 – 14. H.C.F.& - 2.

DOI:10.1111/1755

Sarno.

D. eriid (Rhizaria: Euglyphida).

DINOREF:A curateddinoflagellate (Dinophyceae) - 0998.12781 J. Euk

aryot. trophic euglenidstrophic (Excavata):

Microbiol .

- 57(2) like rRNA : 197 OI andOI Protist - - 205 .

This article isprotected right by All copyright. Accepted Article s reserved.