The Structural and Functional Study of the Human Mitochondrial Hsp60 Chaperonin in Neurodegenerative Diseases

University of Texas at El Paso DigitalCommons@UTEP

Open Access Theses & Dissertations

2018-01-01 The trS uctural And Functional Study Of The Human Mitochondrial Hsp60 Chaperonin In Neurodegenerative Diseases Jinliang Wang University of Texas at El Paso, [email protected]

Follow this and additional works at: https://digitalcommons.utep.edu/open_etd Part of the Biochemistry Commons

Recommended Citation Wang, Jinliang, "The trS uctural And Functional Study Of The umH an Mitochondrial Hsp60 Chaperonin In Neurodegenerative Diseases" (2018). Open Access Theses & Dissertations. 20. https://digitalcommons.utep.edu/open_etd/20

This is brought to you for free and open access by DigitalCommons@UTEP. It has been accepted for inclusion in Open Access Theses & Dissertations by an authorized administrator of DigitalCommons@UTEP. For more information, please contact [email protected]. THE STRUCTURAL AND FUNCTIONAL STUDY OF THE HUMAN MITOCHONDRIAL HSP60 CHAPERONIN IN NEURODEGENERATIVE DISEASES

JINLIANG WANG Doctoral Program in Chemistry

APPROVED:

Ricardo A Bernal, Ph.D., Chair

Chu Young Kim, Ph.D.

Xiujun Li, Ph.D.

Jianying Zhang, Ph.D.

Sudheer Molugu, Ph.D.

Jay M. Bhatt, Ph.D.

Charles Ambler, Ph.D. Dean of the Graduate School

by Jinliang Wang 2018

Dedication

This dissertation is dedicated to my teachers and my family. All my achievements would not have been reached without their support. THE STRUCTURAL AND FUNCTIONAL STUDY OF THE HUMAN MITOCHONDRIAL HSP60 CHAPERONIN IN NEURODEGENERATIVE DISEASES

JINLIANG WANG, MS

DISSERTATION

Presented to the Faculty of the Graduate School of The University of Texas at El Paso in Partial Fulfillment of the Requirements

for the Degree of

DOCTOR OF PHILOSOPHY

Department of Chemistry and Biochemistry THE UNIVERSITY OF TEXAS AT EL PASO

December 2018 Acknowledgements

I would like to express my sincere gratitude to my advisor Dr. Ricardo Bernal for providing me a chance to do the structural research and for the continuous support during my PhD studies at the University of Texas at El Paso (UTEP). It has been a tremendous honor to work with Dr. Bernal. His motivation, enthusiasm, immense knowledge, and humor impressed me and encouraged me during my PhD study. He shared his time, patience, and wisdom to support me for the structural biology study. I still remembered that he spent a lot of time helping me to correct my poster. His enthusiasm and dedication for research will inspire me in my postdoc training. I would also like to extend my deepest gratitude to my committee members; Dr. Chu Young

Kim, Dr. Xiujun (James) Li, Dr. Jianying Zhang, Dr. Sudheer Molugu, and Dr. Jay Bhatt for investing their time and patience to ensure my growth in academia.

I also would like to thank my colleagues in Bernal group, past and present, for their encouragement and support. I still remembered all the days with them. I like to thank Bianka for always encouraging me, Alex for sharing the soccer games together,

Adrian for teaching me Eman2 software, Jay for correcting my dissertation, Janelly for correcting my proposals, and Humberto, Karen, Jihui, Maria, Daniel and all the undergraduates.

Finally, I would like to thank my family and friends who have supported me throughout my academic career. Without my parents’ financial support and encouragement, I would not have made it through my PhD tenure. Special thanks to my wife, Yuxin Wen for understanding my unavailability and sharing happiness and sorrow all through my life.

v Abstract

The biologically active structure of a protein is referred to the native-state of the protein with biological activity. The process of protein folding is one of the most important and challenging research topics of contemporary biochemistry, especially for its central role in life. The folding of polypeptide chains into their unique three-dimensional structure is of fundamental importance in biology. Chaperonins are a class of proteins that assemble into barrel-shaped chamber to renature the misfolded, non-functional proteins to the folded, functional state.

The human mitochondrial heat shock protein 60 (hsp60) functions as a chaperonin, folding proteins in the human mitochondrial matrix. D3G and V72I point mutations in Hsp60 have been shown to lead to the neurodegenerative disorders

MitCHAP-60 and SPG13, respectively. A D3G mutation in hsp60 leads to MitCHAP-60, an early onset neurodegenerative disease characterized by muscle weakness, limb spasticity and involuntary eye movement. Another hsp60 mutation, V72I, has been linked with SPG13, a form of hereditary spastic paraplegia, characterized by progressive weakness, spasticity in the lower limbs, impaired vision, deafness, and cognitive impairment. There are no specific treatments to prevent, slow, or reverse these two diseases. The detailed mechanism of the two diseases are also unknown.

vi The -subunit of the human mitochondrial ATP synthase has been co- immunoprecipitated together with the Hsp60 indicating that the β-subunit is likely being folded by the chaperonin. The biological effects of the interaction have not been studied but we hypothesize that the lack of active β-subunit is the cause of the neurological disorders. We expressed and purified recombinant wild type and mutant hsp60 complexes and analyzed them via electron microscopy, dynamic light scattering (DLS), and in-vitro protein-folding assays. We characterized the wild type hsp60 conformational changes upon nucleotide binding and postulate a likely catalytic cycle with the various conformational intermediates. Negative-stain electron microscopy along with DLS suggest that the D3G and V72I complexes fall apart when treated with ATP or ADP and are therefore unable to fold denatured substrates such as α-lactalbumin, malate dehydrogenase (MDH), and the -subunit of ATP synthase. Our data suggests that hsp60 plays a crucial role in folding important players in aerobic respiration such as the

-subunit of the ATP synthase and MDH. D3G and V72I mutations in hsp60 impair its ability to fold these substrates leading to abnormal ATP synthesis and the MitCHAP-60 and SPG13 neurodegenerative disorders. These studies indicate that that hsp60 is important for folding members of mitochondrial energy producing pathways such as the

ATP synthase -subunit or malate dehydrogenase. Mutations that lead to inactive

Hsp60 complexes indirectly lead to MitCHAP-60 and SPG13.

The hydrophobic flexible C-terminal end of each subunit in the hsp60 chaperonin, protrudes inside the central cavity. The central cavity is the place where the protein folding cycle happens. We generated and characterized E. coli strains expressing

Hsp60 C-terminus deletion chaperonin protein to study the hsp60 protein folding cycle.

vii If the C-terminus deletion of hsp60 chaperonin impaired the interaction between neighboring subunits, the yeast strains will dead. Researchers have showed that the C- terminus deletion hsp60 chaperonin remained capable of the binding activity with the cochaperonin hsp10 in the nucleotide-dependent manner. By generating the C-terminus

26 amino acid deletion (CTD) hsp60, we try to explain the mechanism of the hsp60 chaperonin protein folding cycle with the unfolded substrates or the folded, unreleased substrates by the protein reconstruction analyze. We found that the protein folding activity of the hsp60-MDH is much lower than the hsp60 wildtype, even hsp60-CTD can still form the complex. We also found the hsp60-CTD binds the denatured malate dehydrogenase (MDH) by using the native gel and dynamic light scattering.

Keywords: MitCHAP-60, Hereditary Spastic Paraplegia, SPG-13, Hsp60, Chaperonin,

Protein folding, ATP Synthase β-Subunit, Neurodegeneration.

viii Table of Contents

Acknowledgements ...... v

Abstract ...... vi

Table of Contents ...... ix

List of Figures ...... xii

Chapter 1: Background and Introduction ...... 1 1.1 Protein folding ...... 1 1.2 Chaperonin ...... 3 1.2.1 GroEL Chaperonin ...... 4 1.2.2 Mitochondrial Heat Shock Protein Hsp60 ...... 8 1.2.2.1 Structure and Function ...... 8 1.2.2.2 Mitochondrial Hsp60 in Neuroprotection ...... 11 1.2.2.3 Mitochondrial Hsp60 Mutations and Neurological Disease ...... 11 1.3 Hereditary spastic paraplegia ...... 13 1.3.1 The study history and classification of hereditary spastic paraplegia (HSP) ...... 13 1.3.2 The inheritance of hereditary spastic paraplegia (HSP) ...... 15 1.3.3 The symptoms, mechanism, and treatment of Hereditary spastic paraplegia ...... 16 1.3.4 Mitochondrial hsp60 chaperonin and neurological disorder ...... 20

Chapter 2: Materials and Methods ...... 22 2.1 The introduction of protein structural determination methods...... 22 2.2 The introduction of Electron Microscopy (EM) ...... 24 2.3 Cryo-EM ...... 27 2.4 Negative staining ...... 30 2.5 Expression and Purification of Recombinant hsp60 and relative proteins ...... 32 2.5.1 Cloning ...... 33 2.5.2 Protein expression and purification ...... 35 2.6 Negative stain electron microscopy for the mitochondrial hsp60 chaperonin and its mutants ...... 36 2.7 Particle Picking ...... 37 2.8 Contrast Transfer Function (CTF) correction ...... 39 ix 2.9 Sorting and 2-D Class Averaging of Picked-Particles...... 41 2.10 Reconstruction of an Initial 3-D Structure from 2-D averages ...... 43 2.11 Iterative Refinement of a 3-D Reconstruction and Resolution Determination ...... 45 2.12 ATPase activity assay ...... 48 2.13 MDH refolding assay ...... 50 2.14 Dynamic light scattering (DLS) ...... 51

Chapter 3: Results...... 52 3.1 Protein purification results ...... 52 3.2 Negative staining results of mitochondrial hsp60 wildtype ...... 53 3.3 Negative staining results of mitochondrial hsp60 mutants...... 54 3.4 Hsp60 mutant structure determination ...... 55 3.5 Architecture of the wild type hsp60/10 complex in the absence of substrate .. 59 3.6 Architecture of the mutant hsp60/10 complexes ...... 60 3.7 Dynamic light scatting (DLS) validation of structure reconstruction ...... 61 3.8 The ability of the mitochondrial hsp60 chaperonin to refold unspecific denatured protein ...... 63 3.9 The ability of the mitochondrial hsp60 chaperonin to refold specific disease related denatured protein ...... 64 3.10 The study of topologies of a Substrate Protein (MDH) Bound to the Human Chaperonin Hsp60 ...... 68

Chapter 4: Discussion ...... 75

Chapter 5: Conclusions and Future Direction ...... 84 5.1 Major conclusions...... 84 5.2 Future direction ...... 84 References ...... 86

Abbreviation and Notations ...... 104

Appendix 1 ...... 106

Appendix 2 The Gene Sequence of HSD1 ...... 109

Appendix 3 The Map of pET-22b (+) ...... 110

Vita..……………………………………………………………………………………111

x List of Tables Table.1: The comparison of the three macromolecular complex structure determination methods ...... 23 Table 2.1: hsp60 PCR component ...... 34 Table 2.2: Thermocycling Conditions for hsp60 PCR ...... 35

List of Figures

Figure 1.1 General Architecture of GroEL Chaperonin...... 5 Figure 2.1 Schematic diagram of a transmission electron microscope...... 27 Figure 2.2 Cryo-EM timeline...... 29 Figure 2.3 Negative stain and cryo-EM sample preparation[138]...... 31 Figure 2.4 The comparison of Cryo-EM images and Negative Staining images ...... 32 Figure 2.5 Particle picking of hsp60 V72I mutant chaperonin by using e2boxer software ...... 39 Figure 2.7 Reference-free 2D class average of hsp60 V72I mutant chaperonin ...... 43 Figure 2.8 The initial model of hsp60 V72I mutant generated by Eman2 software ...... 45 Figure 2.9 Schematic of single-particle reconstruction Protein purification[163]...... 47 Figure 2.10 Reaction Scheme of conversion of substrate MESG to ribose 1-phosphate and 2-amino-6-mercapto-7-methylpurine by purine nucleoside phosphorylase by reacting with inorganic phosphate which released by the chaperonin protein human mtHsp60 ...... 50 Figure 3.1 Purified chaperonin, mutants, and substrates...... 52 Figure 3.2 Negative staining images of mitochondrial hsp60 wildtype chaperonin and cochaperonin hsp10 in different Nucleotide conformation...... 53 Figure 3.3 EM Negative staining images of mitochondrial hsp60 V72I mutant chaperonin were collected under three conditions...... 54 Figure 3.4 The process of generating three-dimensional structure of mitochondrial hsp60 V72I mutant ...... 56 Figure 3.5. Negative stain reconstruction of mutant hsp60...... 58 Figure 3.6. Dynamic light scattering reveals mutant hsp60 disassembly...... 62 Figure 3.7 α-lactalbumin protein folding assay...... 63 Figure 3.8 Malate Dehydrogenase Protein Folding Assay...... 65 Figure 3.9 ATP synthase F1 β-Subunit Protein Folding Assay...... 67 Figure 3.10 The purification of hsp60 C-terminus deletion chaperonin via the ion exchange chromatography and Size-exclusion chromatography ...... 70 Figure 3.11 The comparison of hsp60 wildtype APO with hsp60 CTD mutant APO by using Dynamic light scattering (DLS) ...... 71 Figure 3.12 The hydrodynamic size of hsp60 CTD mutant in different conditions (APO, ATP, ADP) ...... 71

xii Figure 3.13 The Topologies of denatured MDH bound to the Chaperonin hsp60 C- terminus mutant...... 72 Figure 3.14 The hydrodynamic size determinization of CTD-MDH complex ...... 73 Figure 3.15 Malate Dehydrogenase Protein Folding Assay of hsp60-CTD...... 74 Figure 4.1 The location of three position amino acid Aspartic Acid in the hsp60 chaperonin ATP conformation X-ray structure ...... 79 Figure 4.2 The location of position 72 amino acid Valine in the hsp60 chaperonin ATP conformation X-ray structure ...... 80 Figure 4.3 The GroEL chaperonin protein folding machine with pistons driven by ATP binding and hydrolysis[195] ...... 83

xiii Chapter 1: Background and Introduction

1.1 Protein folding

Proteins are essential elements that are responsible for a variety of cellular activities within organisms, including catalyzing metabolic reactions, DNA replication, responding to stimuli, providing structure to cells and organisms, and transporting molecules.[1] After protein synthesis in the ribosome, they need to fold into their unique compact structures so that they can perform their full biological functions.[2] The native- state structure of a protein is the protein that can perform full biological functions. In some instances, multiple proteins can interact with each other to form larger quaternary structural complexes to get a fully biologically active conformation.[3] The process of protein folding is one of the important, challenging, most studied research topics of contemporary biochemistry, especially for its central role in life. [4]

The folding of polypeptide chains into their unique three-dimensional structures is of fundamental importance in biology. Understanding the protein folding process will provide a unique insight into the way in which evolutionary selection has influenced the properties of a molecular system for functional advantage.[5] The mechanism of protein folding cycle is also one of the most challenging ,and the least understood biophysical research topics. The major milestone of protein folding research was the thermodynamic hypothesis by Christian Anfinsen.[6] Protein folding mechanisms were first studied in vitro using purified, chemically denatured polypeptides as unfolded substrates in 1973 by Christian Anfinsen. According to Anfinsen’s famous experiments on ribonuclease study, he demonstrated that the native structure of a protein depends on the amino acid sequence, and the solution conditions instead of the kinetic folding pathway.[5] According to Anfinsen, the resulting three-dimensional protein structure is determined by the amino acid sequence (the primary structure of the protein), which is also called Anfinsen's dogma. The importance of the primary structure for defining the

1 native structure of protein was discovered when the sequence of hemoglobin gene was subjected to point mutation.[7] This point mutation in the hemoglobin led to devastating consequences in folding and functions in the fundamental metabolism inside cells, leading to sickle-cell anemia disease (SCD) which is a group of blood disorders[8]. Moreover, cystic fibrosis[9], the prion diseases[10], Huntington’s disease[11],

Parkinson’s disease[12], and Amyotrophic lateral sclerosis (ALS)[13] are also known to be associated with mutations in amino acid sequence of other proteins. Based on Anfinsen’s work, researchers have come to understand native structures by using test tubes in vitro rather than the inside cells in vivo, which makes protein folding research study much easier. However, the concept of the spontaneous protein folding cannot be extrapolated to living cells in-vivo, which is a huge difference from the process in-vitro. The big difference between the ideal circumstances used in- vitro refolding studies and those encountered in-vivo is that the intracellular environment is highly crowded because of the presence of high concentrations of soluble and insoluble macromolecules, which was estimated at 170-400 mg/ml within the cell nucleus.[14]

The correct three-dimensional protein structure is essential to the protein function properly, for that case, protein conformation dynamics is very important for the life. [15] Failure to fold into native functional protein structure generally can generate inactive protein conformation, which may cause many serious diseases. The misfolded proteins can form the accumulation of amyloid fibrils which may cause several neurodegenerative disorder diseases and other diseases.[16] Many allergies are also caused by incorrect folding of correct protein structures, because of the immune system does not produce antibodies for certain correct protein structures.[17] Many intracellular factors including biophysical phenomena induced by the polar solvent, molecular chaperones, and specialized macromolecular complexes termed chaperonins have contribution to the protein folding process into a native correct three-dimensional 2 structure.[18] In fact, not all the proteins need the assistance of chaperonins to generate the correct functional 3D structure. It is estimated that about 10%-30% of all cellular proteins require the assistance of a chaperonin to fold properly into their correct functional 3D structure.[6, 11, 18-20]

1.2 Chaperonin

Living organisms have developed mature systems of preventing the misfolding and aggregation of newly synthesized proteins and for controlling the folding status of polypeptides.[21] These functions are fulfilled by molecular chaperonins. Chaperonins prevent inappropriate inter- and intra-molecular interactions by binding to hydrophobic patches of non-native proteins, thereby influencing the partitioning between productive and unproductive folding pathways.[22] Importantly, chaperonins usually do not form part of the final confirmation of the folded proteins.[23] The folded substrates are released from the chaperonins chamber, thereby providing non-native proteins with a new opportunity for productive folding cycle. Some chaperonins perform an ATP- dependent mode of substrate interaction (Hsp100, Hsp90, Hsp70, Hsp60), while others

(TF, sHsps) do not need ATP nucleotides to perform the protein folding cycle.[24] Finally, depending on their abilities to either prevent protein aggregation or to support proper protein (re)folding, chaperonins can be classified into two groups: ‘holder’ chaperonin and ‘folder’ chaperonins.[25] Holder chaperonins and folder chaperonins may also functionally cooperate to perform the chaperonin folding activities. Based on the requirement of a co-chaperonin and subunit heterogeneity, chaperonins are usually categorized into two groups, group I chaperonin and group II chaperonin.[26, 27] Group I chaperonins (Figure.1.1), which need a co-chaperonin to perform the protein folding activity, are homo-oligomers with seven subunits in each of two rings arranged back to back.[26-28]. Group I chaperonin is the most studied chaperonin group (e.g., Escherichia coli GroEL/ES) for which the general mechanism of

3 chaperonin-mediated protein folding cycle was first described[26-28]. The group II chaperonins, which do not need the co-chaperonin for the catalytic cycle, are homo- or hetero-oligomers with eight or nine subunits per ring.[29] [30] The classic group II chaperonins are the thermosome, Mm-cpn, TF55, and TriC. Unlike group I chaperonins, the apical domains in group II chaperonins are rearranged to form protrusions that extend to form an iris-like structure that closes the cavity entrance after the hydrolysis of ATP, for that case, group II chaperonins do not need the co-chaperonin to perform the chaperonin activities [31].

The protein folding mechanism of the molecular chaperones is that the chaperonin firstly specifically binds non-native unfolded states of proteins through exposed hydrophobic subunits that eventually become buried to the interior in the native functional state, effectively forestalling the aggregation. [32] The chaperonin protein folding catalytic cycle need the ATP hydrolysis as the energy source to release the bound folded substrates for another attempt protein folding cycle.[32, 33] For some chaperonin, the change of the chaperonin conformation needs the step of binding and/or release, either nucleotides or unfolded substrates, while in some chaperonin, the chaperonin conformation change does not need the binding/releasing step. The whole purpose of the protein folding cycle is protecting the protein from misfolding and aggregation, to keep the biological activity. The different chaperonins have different topologies of binding different substrates with or without nucleotides.[34] Hsp70 chaperonin system binds to the extended peptide segments of proteins as well as partially folded proteins whose exposed hydrophobic side-chains to prevent aggregation, remodel folding pathways, and regulate activity.[35]

1.2.1 GroEL Chaperonin

GroEL chaperonin ,the most studied classic group I chaperonin, is a tetradecamer of identical 57 kDa subunits, arranged in two heptameric subunits stacked

4 back-to-back with a central cavity in each ring [36](Figure. 1.1). Each subunit of the GroEL chaperonin comprises three domains: equatorial domain, apical domain, and intermediate domain.[36] The equatorial domain, which contains the ATP nucleotides binding pocket ,can bind ADP or ATP nucleotides and provide the inter-ring contacts to hold the two ring subunits together. The apical domain has the hydrophobic surface at the entrance to the cavity that interacts with the unfolded polypeptide as well as the co- chaperonin, GroES. The intermediate domain has flexible hinges at each end that permit the large -scale domain movements during protein folding cycle. The GroES, the co-chaperonin of GroEL, is a single-ring heptamer of identical 10 KDa molecular weight subunits that binds to GroEL in the presence of nucleotides[37], capping one cavity of the GroEL to form an asymmetric bullet complex, or capping two cavities of the GroEL to form a symmetric American football complex. The binding and releasing step of

GroES is a dynamic step during the protein folding reaction cycle.

Figure 1.1 General Architecture of GroEL Chaperonin A. Side view of the bacterial groEL cylindrical cochaperonin complex without co-chaperonin groES; Cis: The active folding ring with substrate proteins bound into it. Trans: the opposite ring without client proteins binding into it; B: three domains that construct the groEL subunit was labeled with three different colors, equatorial domain (cyan,) intermediate domain (yellow), apical domain (pink).[38]

5 The GroEL chaperonin folding cycle is starting with the binding of the ATP nucleotides to the nucleotides binding pocket of an open GroEL chaperonin ring which will make the shape slightly changed to get ready for the binding step of a non-native unfolded substrates as well as the cochaperonin GroES. After ATP nucleotides binding, the non-native unfolded substrates will get into the GroEL chamber. The cochaperonin

GroES will bind to the same ring which will switch the chaperonin ring from open state to a closed, folding-active state. At the meantime, the surface of the GroEL chaperonin will convert by rigid-body movements from hydrophobic state to hydrophilic state. There are three major features of the cis GroEL-GroES protein complex (double ring, symmetric American football conformation, asymmetric bullet conformation) in the GroEL chaperonin protein folding cycle. GroEL chaperonin bind only one unfolded substrate molecular at a time.[39] Therefore, an unfolded polypeptide folding is this encapsulated environment simply has no other species with which to form a multimolecular aggregate. The hydrophilicity of the cavity lining is the second feature. The switch to hydrophilic character upon ATP/GroES binding is involved in the ejection of substrate off the cavity wall. The presence of a hydrophilic cavity can also assist the protein productive folding since it favors burial of hydrophobic surfaces and exposure of hydrophilic ones, properties of the native state, in the properties of the native state, in the folding substrate protein. [32]Finally, the situation of confinement within a cavity may limit the range of conformations that a non-native protein can explore. Fully extended conformations would be excluded from forming inside a cavity. These latter properties may serve to provide a novel and smoother environment to the energy landscape for a polypeptide folding inside a GroEL-GroES cis complex.[40]

Figure 1.2 The Protein folding cycle of groEL/ES chaperonin complex. [38] The protein folding cycle is initiated by ATP binding to the cis-ring in groEL that causes an elevation of the apical domains. After the rise of the apical domains, substrate protein and groES co-chaperonin protein can now associate with groEL through hydrophobic interactions. The net effect is the encapsulation of substrate inside an isolated chamber with a hydrophilic lining. Substrate folding, and ATP hydrolysis presumably happen simultaneously. Upon ATP hydrolysis to ADP releases inorganic phosphate (Pi), the trans-ring is ready for the binding of ATP, substrate and co-chaperonin. The subsequent binding of ATP to the trans-ring triggers dissociation and ejection of groES and native-substrate from the cis-ring. The binding of ATP to the opposite ring (trans) triggers the release of co-chaperonin groES and discharging of folded substrate and the new cycle starts.

Given the assistance provided by the GroEL-GroES chaperonin system through both the binding and the cis-folding steps, it is understandable that the outcome of folding of its normal substrate proteins in the absence of chaperonin is not a productive one. For example, in yeast systems with conditional deficiency of the mitochondrial Hsp60 chaperonin, the GroEL homologue, the imported mitochondrial proteins will not fold correctly, fail to reach the native functional state and result to insoluble aggregates, which will make the yeast hard to survive[41, 42]. Without the aid of the chaperonin, the diluted protein will aggregate and lose their biological functions in vitro. However, the chaperonin will rescue the aggregation processing of the diluted protein. The unfolded protein will be quantitatively transformed into the native folded functional conformation with the help of the chaperonin, cochaperonin as well as the nucleotides. The

7 chaperonin knockout experiments in-vivo indicated that the action of chaperonins kinetic assistance is essential for the cell viability under all temperature stress conditions.[37,

41] . With the help of the development of the structural biology, researchers have been able to partly explain the detailed mechanism of the GroEL-GroES chaperonin folding cycle by analyzing the different conformational states. We will review here both what is currently known about conformational states of substrates during the chaperonin reaction and what the prospects are for a better understanding of the action of the machine on them.

The bacterial chaperonin GroEL and its cochaperonin, GroES, form a nano- chamber (symmetric American football, asymmetric bullet) for a single molecule of unfolded substrate to fold into folded functional protein. GroEL and its co-chaperonin

GroES undergo an ATP-drive interaction rotation to close and open the folding chamber to perform its protein folding activity. GroEL chaperonin consists of two heptameric rings (tetradecamer) stacked back to back. Recently, a research group found that GroEL undergoes transient ring separation, resulting in ring exchange between complexes.

Ring separation occurs upon ATP-binding to the trans ring of the asymmetric GroEL:7ADP: GroES complex in the presence or absence of substrate protein and is a consequence of inter-ring negative allostery. transient ring separation is an integral part of the chaperonin mechanism.[43]

1.2.2 Mitochondrial Heat Shock Protein Hsp60

1.2.2.1 Structure and Function

Mitochondrial heat shock protein Hsp60 is a class of chaperone protein whose primary function is the folding and assembly of unfolded polypeptide chains imported into the mitochondrial matrix into the folded functional protein. Therefore, mitochondrial

8 hsp60 chaperonin is highly important in mitochondrial protein folding cycle and quality control function , especially when the cells are under the cellular stress conditions, such as heat shock stress and hypoxia stress.[44] Mitochondrial hsp60 chaperonin protein is encoded in the nucleus by a gene named HSPD1 and bears a 26 amino acid N-terminal mitochondrial localization sequence (mitochondrial targeting sequence).[45] In order to form mature mitochondrial hsp60 chaperonin which is mainly localized to the mitochondrial matrix and outer membrane, the N-terminal mitochondrial localization sequence (mitochondrial targeting sequence) is cleaved after transported into the mitochondria from the cytoplasm.[46, 47]. The majority hsp60 chaperonin

(approximately 80%) is scattered throughout the mitochondria where it catalyzes the protein folding cycle destined for the mitochondrial matrix. About 15-20% of hsp60 chaperonin is extramitochondrial, distributed among the cytosol, plasma membrane, peroxisomes, and endoplasmic reticulum[48]. Mitochondrial hsp60 chaperonin is constitutively expressed in both neuronal and non-neuronal tissues and up-regulated by the cellular stress condition to rescue the cell survive.[49]. Hsp60 folding activity needs the hydrolysis of ATP nucleotides as the energy source to perform the catalytic cycle

[44]. If the mitochondrial dysfunction and cannot generate enough ATP nucleotides, the chaperonin hsp60 protein folding activity can be impaired, resulting in continuous mitochondrial damage and eventually causing serious diseases, especially the neurological disorder diseases. Hsp10, the co-chaperonin of the mitochondrial hsp60 chaperonin, is required to control the ATPase cycle for Hsp60-mediated folding of some unfolded substrates[50]. Current researches have showed evidence that the hsp60 mitochondrial chaperonin uses both single (asymmetric bullet conformation) and double-ring conformations (symmetric American football conformation) in the hsp60 protein folding cycle [51]. Researchers try to purify individual monomers to reassemble into oligomeric

9 complexes upon the addition of ATP nucleotides , but due to the instability of mitochondrional hsp60 chaperonin in-vitro, it is very difficult to get the three-dimensional oligomeric complex structure.[52] In 2015, a research group in Israel mutated the amino acid glutamine into glutamic acid in 321 position of hsp60 ( Q321E position ) to stabilize the hsp60/hsp10 mitochondrial complex in ATP conformation. Finally, they got the X-ray structure of the hsp60/10 mitochondrial complex in ATP conformation (Figure 1.3).[53]

However, by comparing to the hsp60/10 wildtype chaperonin, this hsp60/10 mutant chaperonin complex has no protein folding biological activities.

Figure 1.3. Crystal structure of the mtHsp60/mHsp10 American football complex with two mHsp10 bound to both end of the mtHsp60 cylinder; A. Side view of the football complex and their respective dimensions, seven subunits were labeled with seven different colors. B. Top views from the north and south pole of the football complex[53]

10 1.2.2.2 Mitochondrial Hsp60 in Neuroprotection

Scientists have strong interest in the hsp60 chaperonin study of the protection of the central nervous system, especially in the context of neurodegenerative disease and other cellular insults that cause neuronal death. Many experimental evidences reveal ways in which hsp60 chaperonin is a class of neuroprotective chaperonin.[54] When the rat brain stem is induced by exposure to the pesticide, hsp60 chaperonin exerted its neuroprotective effects by inhibiting the mitochondrial apoptotic cascade to rescue the pesticide exposure condition.[55] Following pesticide exposure, hsp60 chaperonin expression level was significantly increased, and it formed complexes with mitochondrial and cytosolic Bax and mitochondrial Bcl-2, while dissociating from cytosolic Bcl-2, therefore blocking pro-apoptotic signaling.[56] When the hsp60 chaperonin ceases to function by using antisense oligonucleotides or anti-hsp60 antiserum to silence , cell apoptosis increased [57]. Research on the neuroprotective mechanisms of Parkinson’s disease found that L-DOPA administration was associated with increased expression of chaperon hsp70 as well as mitochondrial hsp60.[58] What is more, overexpression of the HSPs protein was associated with higher expression and activity of complex I of the mitochondrial respiratory chain. Increased hsp60 protein in the mitochondrion is an early protective mechanism against neuronal damage caused by reactive oxygen and nitrogen species, known contributors to side-effects that limit the long-term effectiveness of L-DOPA treatment in Parkinson’s patients.[59] For the Alzheimer’s disease, overexpression of hsp60 chaperonin protected complex IV of the respiratory chain against β-amyloid stress and reduced the production of ROS, thus limiting apoptosis[60].

1.2.2.3 Mitochondrial Hsp60 Mutations and Neurological Disease

Four different mitochondrial hsp60 chaperonin mutations (D29G, Q461E, V98I and V72I) have been found in several inherited families with neurodegenerative

11 diseases.[61] The mitochondrial hsp60 Q461E polymorphism was identified in a hereditary spastic paraplegia patient in a Danish cohort. E. coli expressing this polymorphism showed impaired growth across a variety of temperatures compared to wild-type Hsp60 (Hsp60WT).[62] The Hsp60 D29G mutation causes mitCHAP-60 disease, an autosomal recessive disorder involving brain hypomyelination and leukodystrophy.[63] Both Hsp60 V98I and Hsp60 V72I mutations have been linked to autosomal dominant hereditary spastic paraplegia type SPG13 [64-66]. E. coli transfected with plasmids which can express that the Hsp60 V98I mutation chaperonin had impaired mitochondrial protein folding capacity, reduced ATPase activity, and limited cell growth across a range of temperatures by comparing to those expressing hsp60 wildtype [65]. A similar growth impairment was seen by using the hsp60 V72I mutation in the same E. coli system.[64] In addition to the alleged disease-causing hsp60 mutations described above, there are some evidence that hsp60 polymorphism might act as a genetic modifier, lowering the age of onset of disease in patients harboring spastin mutation[67].

Neurodegenerative disease is a range of conditions that will lead to the progressive loss of structure or function of neurons (the building blocks of the nervous system, the brain and spinal cord), including death of neurons in the human brain.[68]

The neurons cannot be replaced themselves even if they are in damaged condition without any reproduction and renewal, which may lead to some serve neurodegenerative disorders, such as Parkinson’s, Alzheimer’s, Huntington’s and amyotrophic lateral sclerosis et al.[69] Neurodegenerative diseases are devastating and irredeemable conditions that result in progressive degeneration and / or death of nerve cells. The symptom of the neurodegenerative diseases are problems with movement

(ataxias), or decreased ability to think and remember (dementias). Unfortunately, there

12 are no effective treatment to cure the neurodegenerative diseases. What is more, the detailed mechanism of the neurodegenerative disease still needs further investigation and more efforts. However, it still shows that there are some similarities among the neurodegenerative diseases. By investigating these similarities, scientists may get some clues for therapeutic advances that could ameliorate many neurological diseases simultaneously.

1.3 Hereditary spastic paraplegia

Hereditary spastic paraplegia (HSP) is one type of inherited neurodegenerative diseases with the progressive gait disorder feature. [70] The symptoms of this type disease are showing with progressive stiffness (spasticity) and contraction in the lower limbs, which are the result of dysfunction of long axons in the motor and sensory systems in the spinal cord. [71]

1.3.1 The study history and classification of hereditary spastic paraplegia (HSP)

The study of the hereditary spastic paraplegia has long history, more than 100 years. Back to the year of 1876, hereditary spastic paraplegia (HSP) was first introduced by a German neurologist named Adolph Seeligmüller by describing four affected children with this disease.[72] After that, more hereditary spastic paraplegia cases were studied extensively in 1888 by Maurice Lorrain[73], a French physician. The disease is still named Strümpell-Lorrain disease in some French speaking countries to memorial their contribution to study the disease. The well-recognized term hereditary spastic paraplegia was first invented by Anita Elizabeth Harding , an Irish-British neurologist, in 1983.[74] However, even after a lot of studies, the detailed mechanism of this disease is still not well known. 13 Because of the primary motor neurons are affected, the hereditary spastic paraplegia (HSP) is an upper motor neuron disease [71]. HSP disease is caused by defects in the transportation of proteins, such as structural proteins, cell maintaining proteins, lipids, and other substances in the cell. Long nerve processes (axons) are affected because long distances make nerve cells particularly sensitive to defects in these mentioned mechanisms. [75]. Even though it physically appears and behaves similarly to the spastic diplegia, HSP is not a group of cerebral, for the different origin.[76] Even though knowing about that, the medication for the HSP disease is far away for the treatment.

There are many classification criteria for the hereditary spastic paraplegia. In the past, based on the patient's age at the onset of symptoms and on the amount of spasticity versus weakness, HSP disease was usually classified as either type I HSP or type II HSP.[77] Since both type I HSP and type II HSP can appear in the same community ,besides that the age of onset has no clear relation to the genotype, researchers try to use the other classification terms to validate the HSP disease more accurate. Based on the mode of inheritance and genetic linkage, HSP disease can be classified into several groups: autosomal dominant HSP type, autosomal recessive HSP type, or X-linked, following the location of the gene, each type has several subtypes.[78]

Since symptoms of each type vary differently, the mode of inheritance cannot be used to predict the severity of the inherit disorder. To date, the locations of several genes associated with HSP disease have been identified. Eighteen types of dominantly inherited pure or complicated HSP are known, along with 17 types of recessively inherited HSP and 3 types of X-linked HSP.[71]

14 1.3.2 The inheritance of hereditary spastic paraplegia (HSP)

HSP disease is a group of genetic disorders, following general inheritance rules it can be inherited in an autosomal dominant, autosomal recessive or X-linked recessive manner. The mode of inheritance involved has a direct effect on the chances of inheriting the hereditary spastic paraplegia. Over 70 genotypes of the HSP diseases had been defined, and more than 50 genetic loci have been linked to the HSP diseases.[79] Among them, ten genes have been recognized in autosomal dominant inheritance HSP diseases. Hereditary spastic paraplegia SPG4 disease is one type of

HSP disease, accounts for ~50% of all genetically solved cases, or approximately 25% of all HSP cases. [80] Twelve genes have been identified to be inherited in an autosomal recessive mode.[81] Collectively this latter group account for ~1/3 cases.

Most altered genes related to the HSP disease have been recognized their function, but for some the function of the altered genes have not been identified yet. All of them are summarized in the gene list (Appendix 1), including their mode of inheritance. Some examples of the HSP diseases are spastin (SPG4) and paraplegin (SPG7), which are both AAA ATPases.[82] Back in 2002 and 2007, researchers found that two mutations

(V72I , D3G)on the gene encoded for mitochondrial chaperonin hsp60 are related to spastic paraplegia. It is been reported that purified mutant proteins exhibit reduced

ATPase activities and compromised ability to promote the folding of substrate proteins in vitro. Moreover, E. coli complementation experiments revealed that expression of hsp60 mutations inside the cells impaired the normal growth of the E. coli cells. Gain of function study of gene microarray analysis also provided evidence that bacterial cells holding hsp60 gene overexpression plasmid will upregulate the essential genes for the

E. coli cells growth. Given the essential role of the mitochondrial chaperonin hsp60 in 15 mitochondrial protein folding activity, we can draw the conclusion that the dysfunction of the mitochondrial hsp60 chaperonin by gene point mutation may result in the neurodegenerative diseases. However, the detailed mechanism of the neurodegenerative disease to understand the pathology is still unknown. Since N- terminal ends of long axons on these motoneurons are more vulnerable to ATP shortages caused by malfunction of mitochondria or ATP synthase on the inner membrane of the mitochondria, the dysfunctional mitochondrial hsp60 chaperonin proteins typically have greater influence on the motoneurons in the lower limbs.[83] In other words, mitochondrial chaperonin hsp60 plays a vital role in meditating the folding activity.

Hereditary spastic paraplegia refers to a group of neurodegenerative diseases characterized by weakness and spasticity (rigidity) in the lower limbs, which then slowly progresses. These patients ultimately develop problems walking require a cane or a wheelchair. What is worse, patients who suffered with advanced hereditary spastic paraplegia also have additional symptoms including impaired vision, deafness, cognitive impairment and others. All these conditions arise because of degradation of longest axons in the motor and sensory systems in the spinal cord. To date, 72 spastic gait disease-loci and 55 spastic paraplegia genes (SPG) have been identified in humans.

Mutations in these 15 genes result in malfunctioning gene products and defective cellular processes.

1.3.3 The symptoms, mechanism, and treatment of Hereditary spastic paraplegia

Hereditary spastic paraplegia (HSP) is a group of inherited disorders whose major character is progressive weakness and spasticity (stiffness) of the legs.[70] Early stage 16 of the hereditary spastic paraplegia may be mild gait difficulties and stiffness.[84] These symptoms of the disease typically slowly progress , and eventually individuals with HSP disease may require the assistance of a cane, walker, or wheelchair. Even though the primary features of HSP disease are progressive lower limb spasticity and weakness, complicated forms may be also accompanied by other serious symptoms. These additional symptoms include impaired vision, ataxia (lack of muscle coordination), epilepsy, cognitive impairment, peripheral neuropathy, and deafness.[85] The diagnosis of HSP disease is mainly by neurological examination . Brain MRI is the most used neurological examination methods to detect the complicated forms of HSP. Several genetic mutations have been identified which involved in the HSP disease by specialized genetic DNA sequencing and diagnosis. Not all people in a hereditary family will inevitably develop the HSP disease, although they may be the dysfunction gene carriers.[86] HSP symptoms can appear in either childhood or adulthood, depending on the HSP related gene .[87]

There are various prognosis methods based on the severity of patients who suffered with HSP symptoms. Some individuals are very disabled, while others have only mild disability. Most individuals with uncomplicated HSP disease have the same life expectancy as normal people.[88] Even though there are no specific treatments to prevent, slow, or reverse HSP disease, symptomatic treatments can be used for spasticity, such as muscle relaxants.[89] Regular physical therapy is also used for muscle strength and to preserve range of motion.[90]

17 The mechanism of Hereditary Spastic Paraplegia (HSP) is still not well known.

The symptoms are a result of the dysfunction of long axons in the spinal cord.[91] The ends of the longest fibers, which supply the lower extremities, are affected to the fibers.[92] Therefore, HSP is an upper motor neuron disease[71]. HSP causes degeneration of the ends of the corticospinal tracts within the spinal cord. Even though most HSP patients do not have symptoms in the hands or arms, some degeneration of the fibers supplying the arms commonly take place.[93]

HSP may physically appear and behave the same as spastic diplegia, but it is not a form of cerebral palsy because of the origin of HSP disease is different from cerebral palsy.[94] Since HSP physically behaves like spastic diplegia, several of the same anti- spasticity medications used in spastic cerebral palsy are also used to release HSP symptoms.[95] Many symptoms that are common in patients who suffered with HSP are caused indirectly by muscle spasticity, weakness, or hyperactive reflexes.[89] Even though there are no effective treatments for the HSP disease, some anti-spastic drugs can be used to release or reduce the HSP disease.[89] Baclofen is widely used as a skeletal muscle relaxant and a central nervous system depressant to induce the hyperpolarization of afferent terminals and to inhibit monosynaptic and polysynaptic reflexes at the spinal level.[96] Tizanidine is a centrally acting α2 adrenergic agonist used as a muscle relaxant that is metabolized in the liver and excreted in urine and feces to treat the spasms, cramping, and tightness of muscles caused by HSP disease.[70, 97] Dantrolene is a postsynaptic muscle relaxant that stimulates muscle relaxation by modulating skeletal muscle contractions at the site beyond the myoneural junction and acting directly on the muscle itself.[98] Botulinum toxin (BTX) or Botox is a

18 neurotoxic protein that binds to receptor sites on motor nerve terminals and inhibits the release of acetylcholine, which in turn inhibits the transmission of impulse in neuromuscular tissue.[99] Botulinum toxin can cause flaccid paralysis by preventing the release of the neurotransmitter acetylcholine from axon endings at the neuromuscular junction.[100] Anxiolytics and Benzodiazepines agents can be also used to induce muscle relaxation by acting in the spinal cord.[101] Diazepam (Valium) is commonly used to treat a range of conditions in all levels of the central nervous system by increasing the activity of Gamma-Aminobutyric acid (GABA). [102] Even though these agents can be used to release the HSP symptoms, they cannot cure the HSP disease effectively. Also, there are lots of side effects caused by using those agents. One of the drawbacks is that when patients are medicated to reduce stiffness, walking may become more difficult.[103] Overall, the medicine for this disease is far away from having a cure. Besides the medication treatment, the physical therapy can be also used to release the HSP symptom.[104] Strengthening, stretching, and aerobic exercises can be used as the regular Physical Therapy (PT) to maintain and improve Range of Motion

(ROM) and muscle strength, as well as to maintain aerobic conditioning of the cardiovascular system to release the HSP symptom.[105] Although PT does not reduce the degenerative process within the spinal cord and cure the HSP disease, it can help the patient to improve muscle strength, minimize atrophy of the muscles, increase endurance, reduce fatigue, prevent spasms and cramps.[106] Exercise also has a positive psychological effect, helping the patient who suffered with HSP disease to reduce stress.

19 1.3.4 Mitochondrial hsp60 chaperonin and neurological disorder

The protein-folding machinery in the human mitochondria consists of a human mitochondrial heat shock protein (hsp60) and its co-chaperonin, human mitochondrial heat shock protein 10 (hsp10). They (hsp60/10 hereon) predominantly fold proteins in the mitochondrial matrix but have also been found in extra-mitochondrial locations [13,

14] Misfolded proteins are associated with many well-known human diseases such as

Alzheimer’s disease, Parkinson’s disease, cancer, cystic fibrosis, and other neuropathies, highlighting the importance of protein folding in human health [107-109].

Protein folding is an important cellular process that depends on proteins reaching their native and fully functional three-dimensional structure. Cells have evolved macromolecular machines called chaperonins that specialize in maintaining cellular homeostasis by assisting proteins that have become misfolded. Protection provided by chaperonins is critical to support life since deletion of chaperonin genes from bacteria and yeast prove lethal [110-112]. Our studies focus on two neurodegenerative disorders termed SPG13 and MitCHAP-60 that have been linked to mutations in the human chaperonin hsp60. Although both disorders are neurodegenerative, they differ in the clinical symptoms presented and mode of inheritance.

SPG13 is a member of Hereditary Spastic Paraplegia (HSP) group of neurodegenerative diseases that are characterized by progressive weakness and spasticity (rigidity) in the lower extremities [113, 114]. Patients with advanced HSP diseases show additional symptoms including impaired vision, deafness, and cognitive impairment. HSP diseases are neuropathologically characterized by degradation of the longest axons in the motor and sensory systems in the spinal cord. To date, 72 spastic gait disease-loci and 55 Spastic Paraplegia genes (SPG) have been identified in 20 humans [114]. Our study focuses on the HSP disease SPG13, which is a dominantly inherited form that presents at any age and is characterized by gait disturbances owing to progressive spasticity and weakness of the lower limbs.

MitCHAP-60 is an early-onset neurodegenerative disease inherited in an autosomal-recessive pattern characterized by neuronal hypomyelination and leukodystrophy (brain white matter degradation) [115]. Patients show symptoms of nystagmus (involuntary eye movement) and psychomotor developmental delays during the first months of life that later progress to muscle weakness and limb spasticity

(rigidity). MitCHAP-60 usually leads to death within the first two decades of life [115].

Both SPG13 and MitCHAP-60 have been linked to point mutations in the heat shock protein 60 (hsp60). A D3G hsp60 mutation is a missense mutation that has been linked to MitCHAP-60 while a V72I mutation results in SPG13 [115-118]. Previous studies have demonstrated that the disease-causing D3G and V72I mutations reduce the chaperonin ATP hydrolysis activity and subsequently the protein folding ability of the resultant hsp60 complexes both in-vitro and in-vivo [116, 118]. In this study, we investigated the molecular mechanism by which the hsp60 mutations lead to the

MitCHAP-60 and SPG13.

21 Chapter 2: Materials and Methods

2.1 The introduction of protein structural determination methods Understanding how protein complexes accomplish their complicated function in- vivo is a central topic in molecular biology. Structural biology is a branch of the biochemistry sciences that combines several disciplines, such as biology, physics, and chemistry, to define in molecular terms the structures, mechanisms, and chemical processes during the life-sustaining metabolism. The target of structural biology is to try to understand how protein complexes function in-vivo by determining the 3D arrangement of their atoms. X-ray crystallography, Cryo-EM and Nuclear Magnetic Resonance (NMR) are the most common used techniques to determine macromolecular complex structures.[119] Each structure determination method has advantages as well as limitations. X-ray crystallography technique can generate atomic resolution with no limitation of the complex size. However, the macromolecular complex should be crystallized to get the structure which is sometimes impossible for the macromolecular complex. Nuclear Magnetic Resonance (NMR) is also a useful tool to generate the dynamic information of the small complex with Molecular Weights (MWs) below 40-50

KDa without the crystallization.[120] It is almost impossible to generate the structural details of the macromolecular complex larger than 100 KDa. Another limitation of these two methods that they typically require large amounts of relatively pure sample. For many years, the determination of protein structure by cryo-electron microscopy (cryo-EM) was limited to large complexes or low-resolution models. With recent advances in electron detection methods and image processing software, the resolution by using cryo-EM is now beginning to rival X-ray crystallography with fewer restrictions on sample size, and

22 without requiring crystallization. Table.1 lists the comparison of the three macromolecular complex structure determination methods.

Table.1: The comparison of the three macromolecular complex structure determination methods

Advantages Disadvantages Resolution

X-ray 1.Well developed 1.Need pure protein High

Crystallography 2.High resolution 2.Need crystallization

3.No limitation for 3.Difficult for

the molecular weight diffraction

NMR 1. High resolution 1. High sample purity High

2.Dynamic 3D 2. Difficult sample

structure preparation

3. MWs below 40-50

kDa

Cryo-EM 1.Easy sample 1. Costive for the High

preparation Cryo-EM

2.Purity is not problem 2. Need specialists to

collect data

23 2.2 The introduction of Electron Microscopy (EM)

A microscope is an instrument used to investigate the small objects which are beyond the human naked eyes.[121] The development of the microscope has a long history. Numerous talented scientists brought the advent of the microscope to the public and made it possible for the higher and better biological imaging resolution.

Microscopes can be categorized into many types based on different ways. Based on the energy source usage, a beam of light or electrons, microscopy can be divided into optical microscope, which uses visible light to pass through the object to generate an image, and electron microscopy which uses electrons instead of light as the source of illumination.[122]

Optical microscope, which is also called light microscope because of using the light as the energy source, has the long history. The design of basic optical microscopes is relatively simple, with sharing the basic components of the light path, such as ocular lens, objective turret, objective lenses, focus knobs, stage, light source, diaphragm and condenser, mechanical stage et al. [123]Based on using as single lens for magnification or several lenses to enhance the magnification, the optical microscopy can be classified into simple microscope and compound microscope.[124] In order to achieve the better and higher resolution, researchers preferred the compound microscope as the most used microscope in the contemporary research. Typically, photosensitive cameras can be used to capture the images, such as traditional photographic film, charge-coupled device (CCD).[125] Because of numerous advantages, optical microscope is the most used microscope in both academia and industry. Comparing to other types microscopes, optical microscope is affordable and portable, allows researchers to

24 observe living organisms, such as bacterium, human cells, and even viruses. Optical microscope uses the visible natural light as the energy source without any special aid necessary and excessive components for the operation. Since the spectrum of light is also cognizable to the human, the observation of the specimen is natural without any artificial affected modification and damage. However, there are still lots of limitations on the optical microscope. The wavelength of the light is the major boundary, which has huge impact on the resolution. In terms of wavelengths, a typical human naked eye will respond to wavelengths from about 390 to 700 nanometers.[126] Because of the wavelength issue, there is an obvious boundary of an optical microscope to generate adjacent structural details in high resolution. It is almost impossible to view the specimens that are smaller than 0.275 microns or smaller than half the wavelength of visible light by using the optical microscope. In addition to the wavelength, high magnifications can also distort the image of point objects which may be surrounded by diffraction rings.[127] What is worse, optical microscopy have limitations in the low contrast uncolored biological specimens. Adding staining buffer can easily fix the contrast problem, while makes the live biological specimens dead which may lose some biological activities.

The development of the electron microscope with the first demonstration of the principles by the physicist Ernst Ruska who won the Nobel Prize in Physics in 1986 and the electrical engineer Max Knoll in 1931 to figure out the barrier of reaching higher resolution, to achieve atomic resolution.[128] More scientists are joined to make contribution to develop the powerful electron microscope afterward. As technology progressed, developments on all the components, such as better vacuum systems,

25 powerful electron guns, of the electron microscope made a big contribution to reach the better resolving capabilities of electron microscopes. The major working principle of an electron microscope is using a beam of accelerated electrons instead of light as a source of illumination to generate the image of the object.[129] The wavelength of an electron is around 100,000 times shorter than the visible light photos. Due to the character of the wavelength, electron microscopes can determine the structure of smaller objects in higher and better resolution. Without the invention of the electron microscope, we cannot get such a huge achievement in almost all the natural science, especially biological science. With the development of electron microscope, we can achieve the atomic resolution of a wide range of biological and inorganic specimens including the detailed architecture of the cell and the organelles as well as the structure of viruses which are beyond the limitation of detection of the traditional optical microscope. However, there are still many disadvantages and limitations of the electron microscope. For the electron microscope, the main disadvantage is the price. It costs more money than the traditional optical microscope. Besides, the huge size, extremely sensitive maintenance, researcher training, and specimen preparation are also the limitations. Unlike optical microscope, electron microscope cannot observe the live specimen. Due to the penetration power of electron beam is relatively low, the specimen should be cut into ultra-thin sections before the final observation. Figure 2.1 shows the schematic diagram of a typical transmission electron microscope.

Figure 2.1 Schematic diagram of a transmission electron microscope. Adapted from a drawing provided by Roger C. Wagner, University of Delaware (Web site: www.udel.edu/Biology/Wags/b617/b617.htm).

2.3 Cryo-EM

Cryogenic electron microscopy (Cryo-EM) is one type of electron microscopy

(EM) where the specimen must be cooled to cryogenic temperatures by using liquid nitrogen or even liquid helium.[130] By far, the principal application of Cryo-EM to biochemistry is concerned with visualizing biological complexity, such as protein complex and virus complex, followed by interpretation of the image on a qualitative descriptive level to understand the fundamental biological activities.[131] Since the first

27 protein structure by using the three-dimensional Cryo-EM technology was deposited with the Protein Data Bank (PDB) in 1997[132], the number of released protein structures as well as the virus structures based on the Cryo-EM reconstruction has increased exponentially. The invention of Cryo-EM made a huge contribution to the structure determination of macromolecular complex, especially to the large, complex and flexible structures such as membrane proteins, which are too difficult to be crystallized for X-ray crystallography (XRD) or are too large for nuclear magnetic resonance (NMR) spectroscopy.

Many talented researchers in the structural biology community have made contributions to the evolution and revolution of cryo-EM in different ways for more than eight decades. Without their dedicated work to the development of the technological advancements including detectors, automation, software and specimen preparation, it is almost impossible to achieve the advanced cryo-EM as well as the further application for visualizing the structure. In 2017 Nobel Prize in Chemistry was awarded to three outstanding researchers, Joachim Frank who developed the algorithms to analyze 2D images and reconstruct them into the 3D structures, Jacques Dubochet who succeeded in water vitrification to allow the specimen to stay the native state in the vacuum,

Richard Henderson who was first to utilize cryo-EM to achieve the 3D structure of bacteriorhodopsin at atomic resolution.[133] With the aid of cryo-EM techniques, researchers can now break the 3Å barrier to allow for high-resolution solving of difficult crystallize macromolecular complex structures with large molecular weight that are impossible by using the traditional techniques of XRD and NMR, along with an unprecedented sharp rise in associated publications, which led to Nature Methods

28 journal naming cryo-EM as its Method of the Year in 2015. [134]There are 230 EMDB structures which solved by Cryo-EM which resolution is below 5 Å, among them there are 18 EMDB structures with the resolution below 3 Å in less than five months of 2018.

Figure 2.2 shows Selected key events in the development of single-particle electron microscopy (EM).

Figure 2.2 Cryo-EM timeline. Selected key events in the development of single-particle electron microscopy (EM) are shown, with milestones in techniques shown in the upper part and structures solved shown on the lower part.[135]

Thanks to the outstanding work made by the talented researchers, cryo-EM is becoming more and more portable. It starts with the vitrification process, in which the protein solution is cooled too rapid to avoid the water molecules to form the crystals, following by data collection using the cryo-EM to generate the particles in random

29 distribution and orientations. The collected images are computationally extracted to generate the two-dimensional class-averages. The reconstruction software is used to process the 2D class-average to generate the accurate, detailed three-dimensional biological structures at atomic resolution. The most common used reconstruction software is RELION and Eman2.

2.4 Negative staining

The negative staining method is an easy, rapid, qualitative means for determining the structure of the organelles, individual macromolecules and viruses at the EM level.

The negative staining method was first introduced by Brenner and Horne in 1959 to obtain images of macromolecules for the high contrast. Negative staining method utilizes heavy atom stains, typically 1 to 2% uranyl acetate to apply to the carbon-coated sample grid for increasing the contrast between the specimen and its background.[136]

The heavy metal ions will replace the water molecules that hydrate the protein and protect it from the radiation and vacuum damaging effects, causing the observed image is of the dried “cast” instead of the real specimen [137]. Besides the distortion of the molecule shape caused by air-drying process, negative staining has been achieved great success in the large regular macromolecular reconstructions and virus reconstructions which utilize symmetries to be avoided affecting by the distortion. Due to high-contrast micrographs, longevity of the sample for re-imaging, minimal grid preparation time, even in the cryo-EM era, the negative staining methods is still broadly used in high-resolution EM of macromolecules as the initial stage in identifying

30 characteristic sights, initial model for the further cryo-EM reconstruction. Figure 2.3a shows the processing of the negative staining.

Figure 2.3 Negative stain and cryo-EM sample preparation[138]. (a) Schematic view of sample deposition, staining, and drying, with an example negative stain image. (b) Schematic of plunge freezing and of a vitrified layer, and an example cryo-EM image.

Comparing to the cryo-EM reconstruction, the major limitation of the negative stain-EM reconstruction is relatively lower resolution around 20 Å [139, 140]. However, with the recent advances in both data collection and image processing methods, negative stain-EM reconstructions have reached substantially higher-resolutions with

31 recent reported 11.5 Å membrane protein resolution [141]. Negative staining images always has higher contrast than the cryo-EM images which makes it easier to select the particles (Figure 2.4 shows the comparison of Cryo-EM images with low contrast and

Negative images with high contrast). Researchers use the negative stain images to build the model which can use for the cryo-EM processing as the initial reference. Also, compare to cryo-EM, Negative staining processing is easier to handle.

Figure 2.4 The comparison of Cryo-EM images and Negative Staining images A) Cryo-EM micrograph of the human mitochondrial hsp60 in APO conformation with low contrast. B) Negative stain-EM micrograph of the human mitochondrial hsp60 in APO conformation with high contrast.

2.5 Expression and Purification of Recombinant hsp60 and relative proteins

The bacterial expression and high-resolution purification of fully assembled recombinant hsp60, hsp60 V72I mutant chaperonin, hsp60 D3G mutant protein, and co- chaperonin hsp10 proteins will be presented in this section. Successful bacterial expression of fully assembled and functional hsp60/10 chaperonin complex is likely due to the evolutionary relationship and similarity of mitochondria to bacteria.[142] Hsp60

32 forms a stable tetradecameric double-ring conformation in the absence of co- chaperonin and nucleotide. Evidence of the stable double-ring conformation is illustrated by the negative stain electron microscopy reconstruction presented here. Although Hsp60 has been previously expressed in bacteria [143], the reported protein was in a dynamic equilibrium between double and single ring conformations. Our bacterial purification yields mostly the tetradecameric conformation of hsp60 with very few monomers or single-ring conformations. Thus, our technique serves as a reliable method for the large-scale production of homogenous hsp60 and hsp10 recombinant proteins.

2.5.1 Cloning

The genes encoding the full-length wild type hsp60 (HspD1) and Hsp10 (HspE1) with the mitochondrial targeting sequence were cloned into the pET-30a expression vector system (EMD Millipore). Mature wild type hsp60 and the D3G and V72I mutations were cloned into pET-22b plasmid. We designate the mutations as D3G and V72I since that is the position in which they appear in the mature hsp60 protein that lacks the mitochondrial signaling peptide. All the primers were synthesized by IDT company. All the constructs were sequence verified by the Genomic Analysis Core Facility at the University of Texas at El Paso. The following primers were used for cloning and mutagenesis:

HspD1 Forward: 5’-GGAATTCCATATGAGGAGGTATGGCCAAAGATGTAAAATTTG GTGC -3’ and Reverse: 5’-CCGCTCGAGTTAGAACATGCCACCTCCCATA-3’. HspE1 Forward: 5’-GTCGGGGCATATGGCAGGACAAGCGTTTAGAAAGTTTCTT -3’ and

Reverse: 5’-CCGGAATTCTCAGTCTACGTACTTTCCAAGAATGTCA-3’. HSPD1 D3G mutagenesis: Forward: 5’-GCGCGCCATATGGCCAAAGTTGTAAAATTTGGTGCAGAT GCCCG-3’ and Reverse: 5’-GGGGCTCGAGTTAGAACATGCCACCTCCCATAC CACC

-3’. HspD1 V72I mutagenesis: Forward: 5’-ACAAAAACATTGGAGCTAAACTTATT-3’

33 and Reverse: 5’-TAAGTTTAGCTCCAATGTTTTTGT-3’. All the primers were synthesized by IDT company. All the constructs were sequence verified by the Genomic

Analysis Core Facility at the University of Texas at El Paso. pET-26b vectors encoding the human ATP synthase F1 subunit alpha (ATP5F1A) and human ATP synthase F1 subunit beta (ATP5F1B) were ordered from GenScript.

Table 2.1: hsp60 PCR component component 50 µl REACTION Final concentration

5X Q5 Reaction Buffer 10 µl 1X

10 mM dNTPs 1 µl 200 µM

10 µM Forward Primer 2.5 µl 0.5 µM

10 µM Reverse Primer 2.5 µl 0.5 µM

Template DNA 200ng < 1,000 ng

Q5 High-Fidelity DNA 0.5 µl 0.02 U/µl Polymerase

5X Q5 High GC Enhancer (10 µl) (1X)

(optional)

Nuclease-Free Water to 50 µl

34 Table 2.2: Thermocycling Conditions for hsp60 PCR

TEP TEMP TIME

Initial 98°C 30 seconds Denaturation

35Cycles 98°C 10 seconds 72°C 30 seconds 72°C 30 seconds

Final 72°C 2 minutes

Extension

Hold 4–10°C

2.5.2 Protein expression and purification

Unless otherwise stated, all chemicals, antibiotics, and growth media were purchased from Sigma-Aldrich. E. coli BL21 (DE3) cells were purchased from New England Biolabs. Hsp60 and hsp10 were expressed and purified as described in

Enriquez et al 2017 [142]. Briefly, the proteins were expressed in E. coli BL21 (DE3) cells cultured in 2xTY medium at 37 ℃. Cells were induced with IPTG at 30 ℃ for 4 hours and were subsequently harvested by centrifugation at 5000 x g for 30 minutes and lysed in a buffer containing 50 mM HEPES pH 7.5, 50 mM EDTA, 0.02% NaN3. The cells were then lysed by treatment with hen egg white lysozyme and multiple freeze/thaw cycles. The viscous lysate was treated with porcine liver DNase and 100 mM MgCl2 to degrade DNA. Crude lysates were then treated with saturated ammonium sulfate to a final concentration of 50% (v/v) to precipitate the recombinant protein. Recombinant hsp60 and hsp10 were subsequently purified independently using anion- exchange and size-exclusion column chromatography (NGC Chromatography Systems,

35 Bio-Rad) using chromatography buffer containing 50 mM HEPES, pH 7.5, 5 mM EDTA,

150 mM NaCl, and 0.02% NaN3. The ATPase synthase subunits α and  were purified as described in Miwa and Yoshida, 1989 [144]. The proteins were expressed in E. coli BL21 (DE3) cells cultured in 2xTY medium at 37C and induced with IPTG for four hours at 30℃. Cells were spun as described above, lysed, and crude lysates were purified with saturated ammonium sulfate added to a final concentration of 75% (v/v). Proteins were purified by ion- exchange and size-exclusion chromatography using chromatography buffer containing

50 mM HEPES buffer, pH 7.0, 5 mM EDTA, 200 mM Na2SO4. SDS-PAGE and bicinchoninic acid (BCA) protein assay were utilized to estimate sample homogeneity and the concentrations of all purified proteins, respectively.

2.6 Negative stain electron microscopy for the mitochondrial hsp60 chaperonin and its mutants

Purified chaperonin samples at a concentration of 0.2 mg/ml were applied to continuous carbon film with 400-mesh copper grids that were previously glow discharged for 30 seconds. Excess protein solution was wicked off with Whatman-1 filter paper and grids were stained with 2% methylamine tungstate and 2% uranyl acetate. The negative stain imaging was performed using a JEOL 3200FS transmission electron microscope operated at 300 kV and the images were collected between 0.3–

2.5 m under-focus and at a magnification of 138,000X using a Gatan UltraScan CCD camera. The pixel size calculated for the data set was 1.09 Å/pixel.

Structure determination is a procedure by which the three-dimensional atomic coordinates of a molecule or biomolecule complex are solved using an analytical

36 technique. Here we will present how to use negative staining technique and structure determination software to generate three-dimensional structure of mitochondrial hsp60 chaperonin and its mutants.

2.7 Particle Picking

After we got the EM images form the microscopy, the first step in the computational pipeline of single-particle electron microscopy (EM) termed “particle- picking” that determine the central position (coordinates) of the particles in the images and then subsequently merging the particles into a single computer file [145]. The coordinates are identified by putting “boxes” around the particles with the center of the box placed as closely to the center of the particles as possible to extract the whole particle. As high-resolution reconstruction of the macromolecular complex typically requires hundreds of thousands of particles, manually picking for that processing is a time-consuming work.[146] The particle-picking process can be performed with the help of auto-picking algorithms that significantly save the user time. Auto-picking has its drawbacks as it requires manual template of the auto-picked particles. While semiautomated particle picking is currently a popular approach, it also has drawbacks by introducing manual bias into the selection process.[147] Proper box size and particle centering are the two important parameters in the particle picking processing for generating high-resolution reconstructions of the macromolecular complex. [145]. Since the high contrast in the negative staining micrographs, it is more readily observed in the particle picking process and much easier to pick the particles than the cryo-EM images because of the low contrast. Figure 2.4 shows the comparison of Cryo-EM images and

37 Negative Staining images. Figure 2.4 A) shows the cryo-EM micrographs of human mitochondrial hsp60 in APO conformation with low contrast while figure 2.4 B) shows the negative stain-EM micrograph of the human mitochondrial hsp60 in APO conformation with high contrast.

Here we use e2boxer software for the particle picking processing. The Figure

2.5 showed the e2boxer particle picking processing for the hsp60 V72I mutant APO micrographs. The semi-automated particle picking methods is used to choose the good particles over micrographs of different defocus range, and the particles are centered.

Then the good particles are used as the template for the auto particle picking. In some software, such as RELION software, the two-dimensional model will be built by the manual picked particles. Then the good two-dimensional class average will be chosen as the template for the auto particle picking. In order to get good template, the processing of 2D class average will run several times. In our project, we also run the 2D class average processing several times.

Figure 2.5 Particle picking of hsp60 V72I mutant chaperonin by using e2boxer software

2.8 Contrast Transfer Function (CTF) correction

The contrast transfer function (CTF) mathematically describes how aberrations in a transmission electron microscopy (TEM) modify the micrographs of a sample in

Fourier space. Due to the imperfect imaging conditions in TEM, the observed particles contain distortions caused by the aberrations that need to be corrected before high- resolution single particle analysis.[148] The distortions are increased when the TEM is defocused to impose contrast in the particles, as in cryo-EM, but the effects are

39 contained in all TEM images and the corrections are a fundamental part of the 3-D EM- reconstruction process.[149] The contrast transfer function (CTF) of the microscope is the mathematical representation of the contrast inducing events.[136] Comparing to the ideal images, the main degrading effects of the under-focus CTF on the image can be describe as a combined low-pass and high pass filtration. The CTF is a sinusoidal function that varies with defocus and spatial frequency (resolution).[150] The resolution of the images is limited by the aperture function. Due to the increasingly rapid oscillations of the CTF, it is very difficult to exploit the images information. Ideally, the information is transferred out to high spatial frequencies in the absence of aperture.

However, the illumination has finite source size and finite energy spread. If we go toward higher spatial frequencies, the partial coherence dampens the CTF and ultimately limits the resolution.

Without CTF correction the desired 3-D reconstruction will contain imaging artifacts that ultimately limit the obtainable resolution for the reconstruction [136]. Some software is developed to do the CTF correction, the most common used are the GCTF and CTFFIND 4. To make CTF conforms more closely with the ideal behaviors, researchers made numerous attempts, such as changing the wave aberration function through intervention in the back focal plane, designing zone plates to block out the waves may have destructive interference for a particular defocus setting.

Fig.2.6 The influence of different Defocus Value on the Contrast Transfer Function

(CTF).

(figure from https://spider.wadsworth.org/spider_doc/spider/docs/techs/ctf/ctf.html.)

2.9 Sorting and 2-D Class Averaging of Picked-Particles

The next step in the reconstruction process is to classify the orientations of the CTF corrected particles in relation to one another. 2-D class averaging is initially understood as an operation that is performed on two or more images with the aim of bringing a homogeneity contained in those images into register. The introduction of heterogeneous image set need to generalize the term alignment to minimize a given functional. There are several obstacles should be faced in the 2-D class averaging of picked-particles,

41 such as lacking clarity and definition images, limited resolution, fidelity to the objective by instrument distortions. In a word, all the problem arises from the fact that EM- micrographs are inherently noisy resulting in a low signal to noise ratio (SNR) for the observed particles [151]. To increase the SNR numerous particles are averaged together to boost the signal resulting in a particle with more discernable features [152].

To further complicate matters, the 2-D particles assume random orientations on the EM- grid that need to be sorted and placed into classes based on their correlation to each other [145, 153]. The single particle reconstruction methodology is completely dependent on the power of averaging and requires that large numbers of particles be obtained; in some cases hundreds of thousands to millions of particles are required for high-resolution structures [151, 154]. For that case, powerful computers or computer clusters are required for the processing of these large image data sets and even optimal averaging can be a computationally expensive process. The high-contrast of negative stain particles gives a higher SNR than cryo-EM and results in the need for smaller particle sets to increase the SNR to otain accurate particle classification.

Figure 2.7 Reference-free 2D class average of hsp60 V72I mutant chaperonin

The reference-free 2D class average will categorize particles based on the different orientations or conformations into different groups. Because of this, bias induced by 3D structure can be avoided and structural details can also be preserved.

2.10 Reconstruction of an Initial 3-D Structure from 2-D averages

Once 2-D class averages have been generated, the bad class averages should be removed for the further processing. The 2-D class averages which are structural heterogeneity should be selected to combine them to reconstruct the original 3-D molecule. The projection slice theorem interprets the 2-D particles as projections of the starting 3-D initial model [153]. The theorem states that the Fourier-transform of the 2-D particle represents a central slice through the volume of the 3-D molecule in Fourier- space [153]. The combination of these central slices over a large angular range enables

43 the reconstruction of the 3-D molecule in Fourier space [154]. The inverse Fourier- transform brings the reconstructed Fourier 3-D volume back into real space rendering the 3-D structure of the original molecule [154].

The 3-D reconstruction initially generated (initial model) is usually relatively low resolution due to the inaccurate placement of particles in their respective classes upon initial sorting and inadequate processing rounds. The inaccuracy of the structural projection arises from the de-novo building of the class averages that is referred to as reference-free class averaging [155]. The lack of a reference ensures that bias from another model is not introduced into the initial model and subsequently unaffected the final 3-D reconstruction. Reference based particle picking and class averaging is a very powerful and time-saving technique; however, it can lead to biasing of the data since it only picks particles that match the reference and leaves out any novel conformations of the protein that mismatch the reference [145]. Class averaging has multiple advantages; it not only allows for the sorting of particles but also results in the enhancement of the constant features of the particles and subsequently a substantial reduction noise [151].

Reference-free class averaging was used for all the presented negative stain-EM reconstructions of the human mitochondrial chaperonin in the subsequent chapters.

Figure 2.8 The initial model of hsp60 V72I mutant generated by Eman2 software

2.11 Iterative Refinement of a 3-D Reconstruction and Resolution Determination

The refinement of 3-D reconstructions is an iterative process and can take numerous rounds to properly classify the particles and generate a structural model in high resolution level [156]. The initial model is used to generate a set of 2-D projections over a sufficient angular range that act as references for re-classification of the particle- set [153]. The new classes are then utilized to reconstruct a second model that is better in quality than the initial reference model. The convergence of the data is monitored both visually and through analysis of the Fourier shell correlation curve (FSC) [157].

The FSC is a function that when plotted versus resolution provides a means of quality evaluation and resolution assessment [158]. The FSC is based on the computing by randomly splitting the data in half and generating a reconstruction from each half-set; in EMAN2 reconstruction software and the RELION reconstruction software, the half- sets are the even and odd numbered particles [145]. The correlation between the

Fourier transforms of the even and odd reconstructions is then measured as a function

45 of resolution [159]. The FSC curve starts out at 1 for low resolutions and then sharply declines towards 0 in a sigmoidal fashion [152]. This indicates that structural agreement of the data at low resolutions is quite good while at higher (desired) resolutions the correlation is generally poor [152]. There are two criterions that are generally accepted; the 0.5 cut-off that is used for low resolution reconstructions and the 0.143 cut-off that is generally for reconstructions higher than 10 Å in resolution [159]. In our study, since we use the negative stain as the method to generate the protein reconstruction, the resolution is relatively low by comparing to the cryo-EM methods, we use the 0.5 cut-off instead of 0.143 cut-off to get the accurate resolution value.

When the final model reconstruction has been gained, the next movement is to validate the final reconstruction. High-resolution reconstruction such as those model higher than 5 Å in resolution will provide enough detail that they can have their C-α protein backbone traced in Gorgon and SSEHunter software [145, 160, 161]. If there is the X-ray crystal structure in the PDB (protein data bank), we can also use the X-ray crystal structure as the mode for the fitting and further validation of the final EM- reconstruction. Even though the fitting process is generally performed on high-resolution structures, it can still provide valuable analysis on the structural features in lower resolution cryo- and negative stain-reconstructions to get the general information [162].

Figure 2.9 Schematic of single-particle reconstruction Protein purification[163].

Besides generate the initial model for the cryo-EM reconstruction, negative stain is also useful to clearly visualize the sample and check the homogeneity of the macromolecular complex, especially for small particles. Particles are boxed from the micrographs, centered and aligned. [163]Classification and averaging can give improved SNR, and class averages can be used to obtain a relatively low-resolution initial model by common lines or tilt methods. Figure 2.9 shows the processing how to generate the high-resolution structure form the EM images. In cryo-EM, the vitrified sample is imaged by collecting movie frames that are aligned for motion correction and then averaged (Figure 2.9). Defocus determination and CTF correction are done on motion-corrected averaged images. [164]After alignment, classification and cleaning of the dataset, particles are assigned orientations by projection matching to the initial model which may generate by the negative stain reconstruction. Orientation refinement is performed iteratively until the structure converges. 47 2.12 ATPase activity assay

The ATPase activity assay was performed using the EnzChek Phosphatase

Assay Kit (Molecular Probes, Leiden, The Netherlands) which measures the inorganic phosphate released from ATP hydrolysis during protein folding enzymatic reactions.

The substrate -lactalbumin was denatured with the addition of 0.5 mM EDTA and 50 mM DTT. The resultant mixture was heated to 98C for 5 minutes and allowed to cool before a 10-minute incubation period with 200 M MESG, 0.2 units Purine Nucleoside

Phosphorylase (PNPase) and the kit reaction buffer. Next, 200 M ATP and 200 M

MgCl2 were added to a 100 L reaction followed by addition of 1 M hsp60 and 2 M

Hsp10. A continuous colorimetric measurement at 360 nm was initiated immediately after the addition of hsp60 and Hsp10. 2-amino-6-mercapto-7-methylpurine has maximum absorbance at 360nm, spectroscopy can be used to monitor the generation of reaction product, the inorganic phosphate generated from the ATPase activity of chaperonin protein mtHsp60 can be quantified.

Assays to refold the β subunit of the ATP synthase were performed as follows.

The purified  subunit was thermally denatured by incubating at 55℃ for 20 min [165]. A reaction was set up with 200 M MESG, 0.2 U PNPase, 200 M ATP, 200 M MgCl2, 1

M hsp60, 2 M Hsp10, 1 M subunit α, and 1 M denatured subunit β. Next, the reaction buffer was added to yield a final volume of 100 L. A continuous colorimetric read at 360 nm was initiated to monitor the rate of ATP hydrolysis.

Human mtHsp60 protein requires hydrolysis of ATP to perform the chaperonin protein folding cycle, resulting the release of inorganic phosphate and ADP molecule.

48 By measuring the amount of the released inorganic phosphate, we can get the hsp60 protein folding activity. Purine nucleoside phosphorylase (PNPase) is an enzyme that enzymatically converts a substrate 2-amino-6-mercapto-7-methylpurine riboside

(MESG) to ribose 1-phosphate and 2-amino-6-mercapto-7-methylpurine by reacting with inorganic phosphate (Pi) (Figure 2.10). Maximum absorbance for the substrate MESG is at 330nm whereas the maximum absorbance of the purine product is at 360nm. Upon the ATPase activity of the chaperonin is present, the enzymatic conversion of MESG to the purine product will be happened, resulting a spectrophotometric wavelength shift from 330nm to 360nm. The rate at which absorbance at 360nm increases can be related back to a calibrated amount of purine product through Beers’ Law. The relationship between production of the purine product by PNPase to the ATP hydrolyzed by the chaperonin ATPase activity is stoichiometric. There is exactly one purine product produced for ATP molecule hydrolyzed.

Figure 2.10 Reaction Scheme of conversion of substrate MESG to ribose 1-phosphate and

2-amino-6-mercapto-7-methylpurine by purine nucleoside phosphorylase by reacting with inorganic phosphate which released by the chaperonin protein human mtHsp60

2.13 MDH refolding assay

Malate dehydrogenase (MDH; EC 1.1.1.37) is an NAD oxidoreductase that catalyzes the NAD/NADH-dependent interconversion of malate and oxaloacetate. This reaction is critical to maintain the malate/aspartate shuttle across the mitochondrial membrane and Krebs tricarboxylic acid cycle in the mitochondrial matrix.[166] Increased

MDH activity has been observed in neurodegenerative diseases such as Alzheimer′s disease. We used the malate dehydrogenase as the substrate to detect the protein folding activity of the mitochondrial hsp60 chaperonin and its mutants.

50 Malate dehydrogenase (MDH) at a concentration of 62.5 nM porcine was denatured in 10mM HCl for 1 hour at room temperature and diluted 1:50 into a buffer containing 0.1 M Tris-HCl pH 7.4, 7 mM KCl, 7 mM MgCl2, 10 mM DTT, along with 1.3

μM hsp60, 2.6 μM Hsp10, and 0.5 mM ATP. After 5 mins of incubation at 37°C, the

Malate Dehydrogenase Assay Kit (Sigma, MAK196) was used to measure the renatured malate dehydrogenase activity. The MDH enzymatic activity was determined by measuring the absorbance at 450 nm.

2.14 Dynamic light scattering (DLS)

All experiments were performed on a Malvern Zetasizer Nano ZS instrument. For the ATP-bound conformation, 1 µM hsp60 (wild type or mutant) was added to 2 µM hsp10, 100 mM ATP, and 100 mM MgCl2. For the ADP-bound conformation, 1 µM hsp60 (wild type or mutant) was added to 2 µM hsp10, 2 mM ADP. The samples were incubated for 5 minutes at 37°C upon addition of nucleotides. The excess unbound nucleotides were removed with desalting spin columns (Thermo Scientific). All the data are reported as percent volume to normalize the measurement with the amount of protein at each size. 180 measurements were averaged together to give a statistically significant size distribution that describes the hydrodynamic diameter of the complexes.

51 Chapter 3: Results

3.1 Protein purification results

Figure 3.1 Purified chaperonin, mutants, and substrates. a) SDS-PAGE of all the expressed and purified recombinant proteins used in our studies. The α and β subunits of the Human F1 ATP synthase appear to be the same size as the hsp60. Hsp10 runs anomalously as a 12 kDa protein. b) A negative stain electron micrograph of hsp60 illustrating the formation of tetradecamers. The red arrow highlights a side-view of a tetradecamer and the white arrow points to an end view.

Human heat shock proteins (wild type hsp60/10 & mutants) and human F1 ATP synthase subunits (α and β) were expressed in E. coli and each purified to near homogeneity as described in the methods section. After each round of purification, the purity of all the proteins was estimated by SDS page analysis and determined to be near homogeneity (Figure 3.1). Negative stain electron microscopy was done on freshly

52 purified wild type hsp60/10 protein without nucleotide to make sure complexes were formed correctly (Figure 3.1b).

3.2 Negative staining results of mitochondrial hsp60 wildtype

Figure 3.2 Negative staining images of mitochondrial hsp60 wildtype chaperonin and cochaperonin hsp10 in different Nucleotide conformation.

A) mitochondrial hsp60 in APO conformation (no nucleotides) B) mitochondrial hsp60 with cochaperonin hsp10 in ATP conformation C) mitochondrial hsp60 with cochaperonin hsp10 in

ADP conformation

From the Figure 3.2, we can easily get the conclusion that mitochondrial hsp60 wildtype has different configurations during different stage of protein folding cycle. The hsp60 APO is a tetradecamer complex that does not bind to the cochaperonin hsp10 without the nucleotides. The hsp60 chaperonin protein folding cycle is initiated by ATP binding to one ring in the APO-hsp60 tetradecamer followed by cochaperonin hsp10 binding to form the bullet complex. Binding of ATP and hsp10 to the cis-ring is ready for the trans-ring for acceptance of ATP and hsp10 to form the American football structure.

53 Upon the hydrolysis of ATP, the football complex dissociates into two single ring complexes. After the release of folded substrates and the cochaperonin hsp10, the two single rings will transform into the tetradecamer complex again. The protein folding cycle happens instantaneous.

3.3 Negative staining results of mitochondrial hsp60 mutants

Figure 3.3 EM Negative staining images of mitochondrial hsp60 V72I mutant chaperonin were collected under three conditions.

A) APO; B) ATP; C) ADP. For ATP and ADP conformation (B and C), the mutant hsp60s fall apart with nucleotide. We also treat the hsp60 V72I and D3G mutant chaperonin for the same condition that we used for the hsp60 wildtype chaperonin. Both the V72I hsp60 mutant and the D3G hsp60 mutant still form the tetradecamer complex that behaves the same characters as the hsp60 wildtype chaperonin. The two mutant hsp60 chaperonins also do not bind the cochaperonin hsp10 without the nucleotide. For the nucleotide conformation, 100 mM is used for both ATP and ADP conformation of the hsp60-V72I mutation and hsp60-D3G mutation study which is more than 20 times than the concertation in-vivo (2-10 mM). All the two mutations will fall apart into the monomer

54 configuration in the nucleotide conformation, either ATP conformation or ADP conformation. At the very beginning, we thought that higher concertation nucleotide would be the reason for the mutation protein falling apart. However, we use the same concertation nucleotide for the wild-type hsp60 as the control. Interestingly, for the ATP conformation, the “bullet” and “America football” configuration was formed; for ADP conformation, the single ring configuration was formed. (unpublished data) We also tried normal nucleotide concertation (2 mM) for both wild-type and mutation, the protein always stayed in double-ring configuration which is the same configuration as APO conformation (without nucleotides). We do not know the exact mechanism that why the hsp60 protein need much higher nucleotides in vitro than in-vivo. We assumed that the higher nucleotides concertation is also needed, since the protein folding is fast step, the nucleotides concertation is also high during the folding step which is difficult to capture.

The average nucleotide is normal. However, much research should do for this hypothesis.

3.4 Hsp60 mutant structure determination

We collected data under the following conditions to capture the major nucleotide- dependent conformations within the hsp60/10 protein folding cycle. For the ATP-bound conformation (without hsp10), 2 mM ATP was added to hsp60. For the ATP-bound conformations in the presence of hsp10, 100 mM ATP was added to Hsp60 and Hsp10

(2:1 molar ratio). To obtain the ADP conformation, 2 mM Mg-ADP was mixed with hsp60 and hsp10 (1:1 molar ratio). The purified proteins with incubated with the nucleotides at room temperature for approximately five minutes before they were applied to the grids. A total of 583 particles were picked from the negative stained

55 micrographs using EMAN2 [155]. CTF correction, reference-free class averaging, initial model building, and single particle reconstruction were all performed in EMAN2 [145].

Visualization and figures were generated using UCSF’s Chimera [167].

Figure 3.4 The process of generating three-dimensional structure of mitochondrial hsp60

V72I mutant

Due to the heterogeneity in the hsp60/10 ATP-conformation dataset, a slightly different approach was utilized to separate the particles corresponding to the bullet and football complexes. The reference-free class averages that corresponded to the side- views of the two complexes were separated and individually used to generate two low

56 resolution initial models. The two models were then used as references for the EMAN2 version of multi-refine to separate the particles into two sub-sets. The total data-set contained 3203 particles that were split into sub-sets containing 1654 (bullet) and 1536

(football) particles. Once the particles were split, single refinements were performed for both data-sets. C7 symmetry was used for the bullet refinement due to the different conformational states of the two rings. The bullet reconstruction converged to a resolution of approximately 17 Å. D7 symmetry was used for the refinement of the football complex that converged to approximately 20 Å. The football complex generated in EMAN2 served as an initial model for additional refinements in RELION2 to reduce the amount of noise in the 3-D reconstruction [155, 168]. For the hsp60 D3G and V72I

APO conformations, 3144 and 2491 particles were picked form the negative stained micrographs, respectively. CTF correction, reference-free class averaging, initial model building, and single particle reconstruction were all performed in EMAN2. D7 symmetry was applied for the refinement using Eman2.

Figure 3.5. Negative stain reconstruction of mutant hsp60. a) The V72I mutant resulted in an APO reconstruction that has a square appearance when viewed from the side. Upon the addition of nucleotide (either ATP or ADP), most of the chaperonin complexes fell apart. Consequently, no reconstruction was possible. b) The D3G mutant also resulted in an APO reconstruction but it had a more rounded appearance when compared with the V72I mutant reconstruction. Just as with the V72I mutation, the addition of 58 nucleotide caused most of the mutant chaperonin to fall apart. c) The inability to undergo conformational changes upon nucleotide addition results in both mutant chaperonins to fall apart.

3.5 Architecture of the wild type hsp60/10 complex in the absence of substrate

The wild type mitochondrial hsp60/10 chaperonin utilizes the energy derived from ATP hydrolysis to undergo conformational changes that drive the protein-folding reaction. In the absence of substrate, the chaperonin complex stalls and does not progress along the protein-folding pathway until substrate is added. We exploited this behavior to obtain near homogeneous conformations after the addition of nucleotide.

Negative-stain electron microscopy on purified wild type protein without the addition of nucleotide resulted in double-rings that did not bind to hsp10 (Figure 1b and Figure 3a).

This was termed the APO conformation. Upon addition of 2mM ATP to the same sample, the conformation changes to a double-ring structure with hsp10 bound to one of the rings (“bullet” structure). Addition of a higher concentration of ATP (100mM) results in a conformation that is shifted from hsp10 binding to only one ring to binding on both rings (“American Football”). The addition of ADP mimics the ATP hydrolyzed state that produces a conformational state that induces ring separation resulting in single-rings of hsp60 with hsp10 bound. Negative-stain single-particle image processing resulted in low resolution reconstructions that better illustrate the conformational states as dictated by the nucleotide binding pocket. The X-ray structure of a chimeric complex of the mutant human mitochondrial Hsp60E321K with mouse mitochondrial Hsp10 (PDB 4PJ1) was fit into the reconstructions for structural validation. No fitting of the single ring was

59 performed because there is no X-ray structure of the single-ring. Based on the reconstructions of different conformations, we postulate a likely protein-folding cycle with the various intermediates along the catalytic pathway.

3.6 Architecture of the mutant hsp60/10 complexes

A similar approach as the wild type chaperonin was taken for the D3G and V72I mutant complexes. Negative stain raw micrographs of the two mutants show that just like the wild type chaperonin, each of the mutants can form double-ring complexes that do not bind hsp10 in the absence of substrate and nucleotide (Figure 5a, APO conformation). Addition of either ATP or ADP resulted in mutant chaperonin complexes that fell apart (Figure 5C).

After the structure generated by the software, the dynamic light scattering (DLS) bio-chemical techniques will be used to confirm the generated structure to avoid the biased structure.[142] Dynamic light scattering (DLS) is a non-invasive technique to determine the size distribution profile of small particles including proteins, polymers, micelles, vesicles in suspension or polymers in solution.[169] The theory of the DLS is light emitted from a laser source interacts with protein particles in solution that scatter the incoming light. The fluctuations in the intensity of light indicate the determination of a proteins size distribution in the solution.[169] The size distribution of the protein (the polydispersity index) indicates the degree of conformational heterogeneity of the protein complex. DLS measurements can be used to characterize chaperonin complexes to confirm with the cryo-EM structure [170]. In this section, DLS was used in this study to determine the sizes of the various complexes formed by the human mitochondrial

60 chaperonin hsp60 and its mutants in different Nucleotide conformations to study the mechanism of the protein folding cycle. Negative-stain electron microscope data for low resolution three-dimensional reconstructions was only obtained from the APO conformation. A reconstruction of the mutants in the presence of nucleotide was not possible due to the heterogeneity and low numbers of individual mutant chaperonin complexes.

3.7 Dynamic light scatting (DLS) validation of structure reconstruction

To validate the negative-stain EM reconstructions, we performed dynamic light scattering (DLS) experiments on the wild type and mutant complexes to determine if the complexes were disassembling into monomers, Wild type hsp60/10 complexes remained in a tetradecameric conformation when nucleotide was added (Figure 8 a).

The structure was slightly larger in the presence of ATP due to hsp10 binding at both ends of the complex. The D3G and V72I mutants on the other hand reveal an abrupt change in size upon the addition of nucleotide indicating a catastrophic event that led to the disassembly of the complex into monomers (Figure 8 b & c). The tetradecameric complex is about 16 nm in size while the monomer is expected to be about 9 nm based on the X-ray structure of one hsp60 subunit

Figure 3.6. Dynamic light scattering reveals mutant hsp60 disassembly.

a). Dynamic light scattering (DLS) analysis of the hsp60 wildtype conformations in absence and presence of nucleotides. b). Dynamic light scattering (DLS) analysis of the hsp60 V72I mutant conformations in absence and presence of nucleotides. c). Dynamic light scattering

(DLS) analysis of the hsp60 D3G conformations in absence and presence of nucleotides. Each curve reveals a different hydrodynamic diameter of the hsp60 chaperonin in the ATP bound

(blue curve), ADP bound (cyan curve) and APO conformation (red curve).

62 3.8 The ability of the mitochondrial hsp60 chaperonin to refold unspecific denatured protein

We used the denatured α-lactalbumin as the substrate for the hsp60 chaperonin protein folding activity. From figure 3.8, we can see the maximum absorbance of wildtype mtHsp60 is around 1.0 whereas D3G mutant is around 0.1, V72I mutant is around

0.2 indicating that D3G mutant and V72I mutant mtHsp60 only have 10-20% of ATPase activity compared to hsp60 wild-type counterpart. We can get the conclusion that the hsp60 wildtype which we used in our study still have the biological activity, while the mutants had significantly diminished activity.

Figure 3.7 α-lactalbumin protein folding assay.

63 ATPase activity of Recombinant Human Mitochondrial wild-type hsp60/hsp10 (yellow), V72I mutant/hsp10 (red) and D3G mutant/hsp10 (blue) in the presence of denatured α-lactalbumin substrate was measured by EnzChek Phosphate Assay. The assay measures released inorganic phosphate (Pi) in the absorbance at 360 nm as a result of ATP hydrolysis by the chaperonin. The phosphate assay is generated using the monosodium phosphate (cyan) as the positive control. The negative control measures the ATPase activity of the denatured α- lactalbumin (green) in the absence of chaperonin.

3.9 The ability of the mitochondrial hsp60 chaperonin to refold specific disease related denatured protein

Figure 3.9 shows the ability of the various chaperonin complexes to refold denatured malate dehydrogenase. The protein refolding activity for wild-type Hsp60/Hsp10 resulted in 70–80% refolding by comparing to the native malate dehydrogenase. In contrast, Hsp60-V72I/Hsp10 and Hsp60-(D3G) displayed severely decreased refolding activity. Comparing to the hsp60 wildtype, it was 100-fold lower for Hsp60-V72I/Hsp10 and Hsp60-D3G/Hsp10.

Figure 3.8 Malate Dehydrogenase Protein Folding Assay.

This assay involves the refolding of acid-denatured malate dehydrogenase by wildtype hsp60/hsp10 (cyan), V72I mutant/hsp10 (red), D3G mutant/hsp10 (yellow). The assay conditions are described in “Methods” section. The positive control is native malate dehydrogenase (MDH, blue) and its activity is determined by generating a product with absorbance at 450 nm that is proportional to the enzymatic activity present.

The negative control consists of denatured malate dehydrogenase (green) in the absence of chaperonin.

Besides malate dehydrogenase protein, we also use the ATP synthase -subunit as substrate for the protein folding activity. From Figure 3.10, we can get the conclusion that the protein refolding activity of hsp60 mutant chaperonin for the denatured ATP synthase β-subunit significantly decrease by comparing to the hsp60 wildtype. The

65 single point mutation in the mitochondrial hsp60/10 chaperonin system is an indirect cause of the neurological disorder. The two mutates are not folding the ATP synthase - subunit, which in turn results in low ATP levels in-vivo.

Figure 3.9 ATP synthase F1 β-Subunit Protein Folding Assay.

The activity of native, thermally denatured, and refolded F1 ATP synthase β-subunit by chaperonin was detected using the EnzChek phosphate assay. The denatured β-Subunit (green) in the absence of chaperonin served as a negative control, while the native β-Subunit (cyan) in the absence of chaperonin served as a positive control. In the presence of α-Subunit, refolding of denatured β-Subunit by wild-type hsp60/hsp10 (yellow), V72I mutant/hsp10 (blue), D3G mutant/hsp10 (red) was measured as described in the Methods section.

67 3.10 The study of topologies of a Substrate Protein (MDH) Bound to the Human Chaperonin Hsp60

The hydrophobic flexible C-terminal end of each subunit in the hsp60 chaperonin, protrudes inside the central cavity.[171] The central cavity is the place where the protein folding cycle happens.[172] We generated and characterized E. coli strains expressing

Hsp60 C-terminus deletion chaperonin protein to study the hsp60 protein folding cycle. If the C-terminus deletion of hsp60 chaperonin impaired the interaction between neighboring subunits, the yeast strains will dead. Researchers have showed that the C- terminus deletion hsp60 still remained capable of the binding activity with the cochaperonin hsp10 in the nucleotide-dependent manner.[173] However, the C-terminus hsp60 mutant cannot refold the denatured rhodanese enzyme.[174] The hydrophobic flexible C-terminus in the hsp60 chaperonin plays an important role in the protein folding cycle. In previous studies, the C-terminus of yeast Hsp60 chaperonin that contains predominantly hydrophobic amino acid residues (Glycine-Glycine- Methionine repeat) have been shown to be important for protein folding.[175]

The hsp60 homologue GroEL has been well studied for the protein folding cycle. Researchers found that the unfolded, non-functional protein will bind to the central cavity of the complexes via the flexible hydrophobic C-terminus end interaction.[176]

Since the high flexibility, the final 23 residues in the C-terminal region of GroEL chaperonin are invisible in the crystal structure.[177] Machida and his colleague reported that the KNDAAD hydrophilic residues of the final 23 residues in the C-terminus of the

GroEL within the central cavity plays a critical role in the protein folding cycle.[174] In their study, they found that the flexible C-terminal region of GroEL chaperonin maintains a

68 hydrophilic environment at the bottom of the chamber for productive protein folding. They demonstrated an active involvement of specific hydrophilic residues within the GroEL flexible C-terminus for the productive protein folding. During chaperonin-mediated folding, the unfolded substrates fold spontaneously in the hydrophilic chaperonin cavity. The flexible C-terminus of GroEL communicate between the two rings in the equatorial domain, maintain an optimum environment for the central cavity and may control the unfolded protein encapsulation and release.

Protein folding kinetics is a fast (microseconds) and simple process.[178] The whole protein folding cycle may take microseconds to guarantee the cell metabolism properly.

Protein folding is driven by hydrophobic interactions through a collapse of hydrophobic residues and then form the folded, functional structure.[179] Since protein folding process is too fast to catch all the intermediates chaperonin structure during the kinetics cycle, it is very challenge to achieve a high occupancy of chaperonin with unfolded substrates.

Thus, researcher mutant the amino acid to get the relative stable chaperonin complex conformation within the substrates. Elad and his colleague mutant the amino acid D to C in 473 position of GroEL to get the topologies of a substrate protein bound to the chaperonin GroEL.[180]

We try to explain the mechanism of the hsp60 chaperonin protein folding cycle with the unfolded substrates or the folded, unreleased substrates. Fang reported that the deletion of 27 amino acid (IVDAPEP PAAAGAGGMPGGMPG MPGMM) in the C- terminus of yeast hsp60 chaperonin will cause the death of the yeast, however, with 26 amino acid deletion of C-terminus (VDAPEP PAAAGAGGMPGGMPG MPGMM) of hsp60 will not cause the death.[173] We generate the 26 amino acid deletion in the C-terminus

69 of human hsp60 (Figure 3.10) to get the intermediate hsp60 chaperonin with the unreleased substrates to explain the mechanism of the protein folding cycle in vitro. We also used the Dynamic light scattering (DLS) to determine the size of the hsp60-CTD.

From Figure 3.11, we can see the hydrodynamic size of hsp60-CTD mutant is smaller than the hsp60 wildtype. The reason of this is the hsp60-CTD mutant lacks 26 amino acid in the C-terminus. We also determined the hydrodynamic size of hsp60-CTD mutant in different condition (APO, ATP, ADP). The hydrodynamic size of hsp60-CTD mutant stays same even with nucleotides treatment. (Figure 3.12) From that, we can draw the conclusion that the hsp60-CTD mutant does not bind to any nucleotides. To detect whether the hsp60 C-terminus deletion mutant has protein folding activity, we also performed the protein folding activity of hsp60-CTD by using denatured MDH as the substrate. (Figure 3.15) The hsp60-CTD mutant cannot renature the MDH enzyme.

Figure 3.10 The purification of hsp60 C-terminus deletion chaperonin via the ion exchange chromatography and Size-exclusion chromatography

Figure 3.11 The comparison of hsp60 wildtype APO with hsp60 CTD mutant APO by using

Dynamic light scattering (DLS)

Figure 3.12 The hydrodynamic size of hsp60 CTD mutant in different conditions (APO, ATP,

ADP)

Figure 3.13 The Topologies of denatured MDH bound to the Chaperonin hsp60 C-terminus mutant.

A) The native gel of hsp60, hsp60-CTD mutant, MDH, denatured MDH, hsp60-CTD-hsp10-MDH complex. B) The SDS-PAGE of hsp60-CTD-MDH complex

After we got the purified hsp60-CTD mutant protein, cochaperonin hsp10 protein, and the MDH protein, the native gel PAGE was performed to determine the size of the hsp60-CTD-MDH complex. The size of hsp60-CTD-MDH complex is larger than the size of hsp60-CTD without binding the substrates. (Figure 3.13 A). The DLS results also confirmed that the size of hsp60-CTD-MDH complex is larger than the hsp60-CTD without the substrate. (Figure 3.14) From Figure3.14, we can also get the conclusion that nucleotide will not bind to the hsp60-CTD mutant.

72 To confirm the hsp60-CTD-MDH complex, we extract the hsp60-CTD-MDH band from the native gel, dissolve the native gel band, and run the SDS-PAGE. From the Figure

3.13 B, we can get the conclusion that the hsp60-CTD-MDH complex band that we extracted from the native gel contains hsp60-CTD and substrate MDH.

Figure 3.14 The hydrodynamic size determinization of CTD-MDH complex

Figure 3.15 Malate Dehydrogenase Protein Folding Assay of hsp60-CTD.

This assay involves the refolding of acid-denatured malate dehydrogenase by wildtype hsp60/hsp10 (gray), hsp60-CTD mutant/hsp10 (yellow). The assay conditions are described in “Methods” section. The positive control is native malate dehydrogenase

(MDH, blue) and its activity is determined by generating a product with absorbance at

450 nm that is proportional to the enzymatic activity present. The negative control consists of denatured malate dehydrogenase (carroty) in the absence of chaperonin.

74 Chapter 4: Discussion

Failure to acquire proper protein-folding to create normal tertiary or quaternary structure leads to impaired physiological functions and numerous disease conditions

[181, 182]. The working hypothesis during the studies presented here assumed that the diseases MitCHAP-60 and SPG13 were not directly related to the hsp60 mutations but instead were the consequence of an inactive hsp60/10 where protein folding is diminished. To study the effects of the D3G and V72I mutations and the underlying cause of MitCHAP-60 and SPG13, we first characterized the wild type chaperonin in terms of conformational changes that take place during the catalytic cycle.

None of the proteins in this study were tagged to keep the proteins as close to wild type conditions as possible. Wild type human mitochondrial hsp60 and human mitochondrial hsp10 were expressed in E. coli and purified to near homogeneity

(Figure 1). Before any biophysical experiments were to be performed, we verified that the proteins that were isolated were biologically active. To this end, purified hsp60 was mixed with its co-chaperonin hsp10 in a 1:1 molar ratio before checking its ability to refold denatured α-lactalbumin in the presence of ATP. Enzymatic activity was detected as the release of inorganic phosphate from the hydrolysis of ATP (ATP → ADP + Pi) as noted in the methods section. Once we established that the purified proteins were biologically active, samples of the proteins were placed onto carbon coated grids for negative-stain electron microscopy. The APO conformation was determined previously in our lab and so we focused on the ATP and ADP conformations [142]. Negative stain datasets were collected for low resolution reconstructions so that we could establish the various conformational states of the wild type hsp60/10 chaperonin in the presence and

75 absence of ATP and ADP. In previous studies in our lab, we were able to determine that the bacteriophage chaperonin φEL will not proceed along the protein-folding pathway in the absence of substrate and will instead stall at a conformation that is induced by either

ATP, ADP or the absence of nucleotide (APO) [183]. When we tried to use non- hydrolyzable nucleotide analogues such as AMP-PNP or ATP-γ-S to prevent conformational heterogeneity, we found that the resulting conformational structures were in fact different compared to the natural nucleotides ATP and ADP. For example, the use of ATP resulted in a φEL conformation that was tetradecameric with D7 symmetry, while AMP-PNP gave a φEL conformation that was heptameric and C7

(unpublished data). It appeared the analogue mimics the ADP structure rather than the

ATP structure since the C7 heptameric conformation resulted from the addition of ADP.

We therefore determined that the nucleotide analogues were not to be trusted and were in fact not needed since the complex was stalled in the absence of substrate anyway.

Processing of the negative stain data provided low resolution reconstructions that reveal dramatic conformational changes that take place after ATP binding, ATP hydrolysis, and after the removal of the ADP from the nucleotide binding pocket. The addition of 2mM ATP to hsp60/hsp10 resulted in a reconstruction of a tetradecameric hsp60 structure with the hsp10 co-chaperonin capping only one of the chaperonin protein-folding chambers resulting in a so-called “bullet” conformation. The addition of

100mM ATP prompted the formation of the “American football” conformation where the hsp10 co-chaperonin is bound to both openings to the protein-folding chambers. Just like what was seen with the φEL chaperonin, the addition of 2mM ADP to mimic the hydrolyzed ATP conformation resulted in a single-ring conformation where the

76 chaperonin separates at the equatorial domain to produce two C7 single-rings [184]. It was shown that the φEL separated into to single-rings to allow for the folding of viral proteins that could not be accommodated by the host chaperonin when the bacteriophage EL infected Pseudomonas aeruginosa. This was demonstrated to be true the φEL chaperonin was able to refold the 116 kDa denatured β-galactosidase, restoring its activity to normal levels [183]. It is unclear why the human hsp60/10 chaperonin utilizes the single-ring conformational intermediate since it is not able to refold β-galactosidase (data not shown). Perhaps, it is required for the refolding of proteins not quite as large as β-galactosidase and may utilize a mechanism similar to the cytosolic TriC chaperonin where parts of the denatured substrate are folded sequentially [185].

The resulting reconstructions have allowed us to postulate a likely catalytic pathway with various conformational intermediates. The double-ring APO conformation is unable to bind hsp10 and therefore has accessible protein-folding chambers where a protein might be able to bind initially. Upon ATP binding, there is a conformational change that allows not only the internalization of the substrate but the simultaneous binding of the co-chaperonin hsp10. It is conceivable that after the binding of the first substrate and co-chaperonin, a conformational change may trigger the binding of substrate and co-chaperonin on the opposite hsp60 ring to form the double ring

“American football” conformation. ATP hydrolysis then triggers the separation of the two rings at the equatorial domain and the formation of the closed single-ring hsp60/10 conformation. Subsequent removal of the ADP from the nucleotide binding site triggers

77 two single-rings to come back together to form the APO conformation and the re-initiation of the cycle.

The negative-stain reconstructions allowed for a baseline model for how the human mitochondrial hsp60/10 chaperonin undergoes conformational changes during the protein-folding catalytic pathway. Next, we proceeded with the characterization of the hsp60 D3G and V72I mutants by first purifying the mutant proteins and checking for protein folding activity using denatured α-lactalbumin as a substrate. Figure 2 illustrates how the V72I mutant had about a third of the activity of the wild type hsp-60 protein while the D3G mutant had only about one tenth the activity. Given these point mutations lead to neurodegenerative disorders, it was expected that the activity be at least partly altered.

The purified mutant proteins were then applied to carbon coated electron microscopy grids for negative-stain data collection. Each sample was treated like the wild type with ATP, ADP and no nucleotide to produce the APO conformation. The results were very surprising in that only the untreated APO samples resulted in useable data. D3G and V72I mutant hsp60 samples treated with either ATP or ADP appeared to fall apart into monomers. The experiment was repeated an exhaustive number of times but yielded the same results consistently. Attempts at optimizing the conditions to favor a more stable structure all failed. We arrived at the conclusion that the mutant hsp60 tetradecameric complexes can be readily formed by self-assembly but then likely fail to undergo the requisite conformational changes required by either ATP or ADP binding and the complexes instead fall apart. This would also explain the loss of activity seen in the denatured α-lactalbumin refolding experiment. These results were confirmed in

78 dynamic light scattering experiments where the tetradecameric complex is detected by the instrument at a hydrodynamic size of about 16nm. In the presence of nucleotide

(ATP or ADP), the complex at 16nm disappears and a peak appears at about 9nm. We also analyzed the mutant amino acid positions in the hsp60 chaperonin X-ray structure.

The position three aspartic acid is in the interface of the two rings which are relatively unstable. (Figure 4.1) This can explain why the D3G mutant will fall apart by adding nucleotides. The position 72 amino acid valine is very close to the ATP binding pocket.

(Figure 4.2) The valine mutant into the isoleucine may cause the structure changed due to the ATP binding pocket dysfunction, which may lead to the SPG13. The X-ray structure analyze results are also consistent with our results that the point mutation destabilizes the hsp60 complex.

Figure 4.1 The location of three position amino acid Aspartic Acid in the hsp60 chaperonin

ATP conformation X-ray structure

Figure 4.2 The location of position 72 amino acid Valine in the hsp60 chaperonin ATP conformation X-ray structure

The loss of hsp60/10 activity leads to neurodegeneration but this loss of activity cannot be a direct cause of the symptoms displayed in the patients of these disorders. A more likely scenario is that a mitochondrial protein that is a substrate for hsp60/10 is no longer folded correctly and this in turn leads to neurodegeneration. In fact, hsp60/10 has been shown to be involved in assembly of the mitochondrial ATP synthase complex

[186-188]. It is not surprising that if hsp60/10 activity is decreased resulting in an altered ATP synthase activity, mitochondrial function would decrease, affecting muscle and nerve tissues the most because that is where ATP is in highest demand.

The mitochondrial ATP synthase is a multi-subunit enzyme composed of two domains, FO and F1, which together with other proteins function as a rotational motor to allow for ATP production during respiration. The F1 domain of the ATP synthase is responsible for the synthesis of ATP, where the - and -subunits form a catalytically active hexameric 33 complex. The 33 complex in isolation results in a complex that

80 hydrolyzes ATP instead of synthesizing it. The D3G mutation near the hsp60 amino terminus is thought to result in the loss of function where the D3G-hsp60 disassembles by entropic destabilization [116]. Our work now builds on this idea by adding that the entropic destabilization occurs through the inability to undergo normal conformational changes and instead result in disassembly of the chaperonin. This suggests that non- functional hsp60/10 complexes would be unable to assemble the ATP synthase, resulting in abnormal production of ATP inside the mitochondria. In addition, hsp60/10 and the ATP synthase -subunit, together, have been shown to be differentially expressed in breast cancer, null cell pituitary adenoma, Barrett’s esophagus

(premalignant condition to esophageal adenocarcinoma), and head and neck squamous cell carcinomas [189-192]. This concomitant regulation suggests that hsp60/10 and the ATP synthase -subunit work closely together in maintaining the cellular oxidative phosphorylation. Defects that result in functional impairment of the mitochondrial ATP synthase have been shown to cause a variety of neuromuscular disorders (reviewed in

[193]). Likewise, defects in mitochondrial function have also been linked to various neurodegenerative diseases (reviewed in [194]). This led us to posit that mutations in hsp60 lead to SPG13 and MitCHAP-60 via an inability to fold the ATP synthase - subunit and other mitochondrial proteins such as malate dehydrogenase that are part of the reactions of aerobic respiration that culminate in ATP synthesis.

The purified and reconstituted α and β subunits of the ATPase synthase self- assemble into a α33 complex that possess ATPase activity in-vitro. To investigate the chaperonin activity of the hsp60/10 complexes, we denatured the β subunit, and measured the ability of the hsp60/10 complexes to refold the β subunit. Renatured

81 β-subunit will form a complex with the native α-subunit leading to functional complexes with ATPase activity that can be measured via the EnzChek phosphatase assay kit. The assay measures inorganic phosphate released from two sources, the hsp60/10 complexes catalyzing the refolding of ATP synthase -subunit and the functional α-

ATPase synthase complexes themselves (after renaturation of the β subunit). The α-

ATPase synthase complexes however hydrolyze an excess of ATP that outcompetes that of the chaperonin. The assays in described in figures 6 and 7 confirm that the wildtype hsp60/10 can refold mitochondrial proteins involved in aerobic respiration including malate dehydrogenase and the β-subunit of the ATP synthase. SPG13 (V72I) doesn’t result in death because there is some residual activity as seen in Figure 7 where activity is approximately 40% of the wild-type chaperonin activity when refolding the ATP synthase β-subunit. MitChap60 (D3G) on the other hand has about 20% of the wild-type chaperonin activity and results in symptoms that are more severe. This trend is consistent with data obtained with denatured α-lactalbumin as substrate as seen in the results section where SPG13 had 35% of wild-type activity and MitChap60 had 12% of wild-type activity.

We also generated hsp60 C-terminus deletion mutant to study the detailed mechanism of hsp60 protein folding cycle. We did see the hsp60-CTD and the denatured MDH will form the hsp60-CTD-MDH complex with the ATP binding. Since hsp60 loses the 26 amino acid C-terminus, it cannot fold the MDH properly. Our results also showed the denatured MDH will not renatured with the help of the hsp60-CTD mutant. However, there are still lots of unknows for the hsp60-CTD protein folding cycle.

Firstly, we have no idea whether the denatured MDH is inside the hsp60 chamber or

82 just bind to the hsp60 out of the chamber. To answer this question, we will visualize the hsp60-CTD-MDH complex by using the microscope. Secondly, the detailed substrate binding site in the hsp60 chaperonin is also unknown. Lorimer and his colleague reported that in GroEL chaperonin, the carbonyl oxygen of Ala109 at the C-terminus of helix D possesses a partial negative charge that forms an electrostatic interaction across the twofold axis with the 1-amino group of Lys105.[195] Since GroEL is the hsp60 homolog, we hypothesis that hsp60 may perform the same substrate binding pocket as the GroEL. However, we should get the structure of the hsp60-CTD-MDH complex to confirm that hypothesis.

Figure 4.3 The GroEL chaperonin protein folding machine with pistons driven by ATP binding and hydrolysis[195]

(a) A sagittal section through apo-GroEL revealing how two nucleotide-binding sites of the different rings communicate allosterically. (b) the mechanism of how ATP binding pocket hydrolysis ATP (c) the C-terminus salt bridge

83 Chapter 5: Conclusions and Future Direction

5.1 Major conclusions

Our data suggests that hsp60/10 plays a crucial role in folding important mitochondrial proteins involved in aerobic respiration including the -subunit of the ATP synthase, Malate Dehydrogenase and probably several others. D3G and V72I point mutations in hsp60 impairs the chaperonins ability to fold these substrates which in turn leads to abnormal ATP synthesis resulting in diminished ATP levels. Minimal amounts of ATP resulting from glycolysis and diminished ATP synthase activity can keep most cells alive but cells with high ATP demands such as muscle and neuronal cells are impacted more severely and explain the symptoms exhibited in the MitCHAP-60 and

SPG13 neurodegenerative disorders.

5.2 Future direction

The negative stain-EM methodology and the biological assay allowed us for the elucidation of the human mitochondrial chaperonin in its various conformational intermediates in the whole protein folding cycle. We could also explain the mechanism termed MitChap60 disease and spastic paraplegia 13 by the biological assay. However, since the limitation of resolution, we cannot get the detailed structure information of the point mutant chaperonin hsp60 protein. For that case, crystallographic structure and high-resolution cryo-EM structure will be the target in the future study to get the atomic resolution structure. The atomic resolution structure of the human mitochondrional hsp60 and its mutants will elucidate the detailed structural information to guide the design of the drug for the neurodegenerative diseases.

84 Meanwhile, we will collaborate with another research group to study the detailed mechanism for the two neurodegenerative diseases by using fruit flies’ model in-vivo.

It seems that the mitochondrial hsp60 chaperonin is involved in the neurological disorder indirectly. We have already found that hsp60 can fold the denature MDH and

ATPase- β subunit which involved in the ATP hydrolysis. One of our future direction will focus on finding more substrate that involved in the neurological disorder to explain the mechanism of the disease.

For the hsp60-CTD mutant, our future direction will focus on getting the intermediate of the CTD-MDH complex to explain the details of hsp60 protein folding cycle.

85 References

[1] B. Alberts, K. Roberts, J. Lewis, D. Bray, K. Hopkin, A. D. Johnson, P. Walter, and M. Raff, Essential cell biology: Garland Science, 2015.

[2] C. M. Dobson, "Principles of protein folding, misfolding and aggregation," in Seminars in cell & developmental biology, 2004, pp. 3-16.

[3] I. M. Nooren and J. M. Thornton, "Diversity of protein–protein interactions," The EMBO journal, vol. 22, pp. 3486-3492, 2003.

[4] D. L. Nelson, A. L. Lehninger, and M. M. Cox, Lehninger principles of biochemistry: Macmillan, 2008.

[5] C. B. Anfinsen, "Principles that govern the folding of protein chains," Science, vol. 181, pp. 223-230, 1973.

[6] J.-E. Shea and C. L. Brooks III, "From folding theories to folding proteins: a review and assessment of simulation studies of protein folding and unfolding," Annual review of physical chemistry, vol. 52, pp. 499-535, 2001.

[7] M. Berry, F. Grosveld, and N. Dillon, "A single point mutation is the cause of the Greek form of hereditary persistence of fetal haemoglobin," Nature, vol. 358, p. 499, 1992.

[8] G. R. Serjeant and B. E. Serjeant, Sickle cell disease vol. 3: Oxford university press New York, 1992.

[9] J. R. Riordan, J. M. Rommens, B.-s. Kerem, N. Alon, R. Rozmahel, Z. Grzelczak, J. Zielenski, S. Lok, N. Plavsic, and J.-L. Chou, "Identification of the cystic fibrosis gene: cloning and characterization of complementary DNA," Science, vol. 245, pp. 1066-1073, 1989.

[10] K. Brown and J. A. Mastrianni, "The prion diseases," Journal of geriatric psychiatry and neurology, vol. 23, pp. 277-298, 2010.

[11] J.-P. Vonsattel, R. H. Myers, T. J. Stevens, R. J. Ferrante, E. D. Bird, and E. P. Richardson, "Neuropathological classification of Huntington's disease," Journal of Neuropathology & Experimental Neurology, vol. 44, pp. 559-577, 1985.

[12] M. H. Polymeropoulos, C. Lavedan, E. Leroy, S. E. Ide, A. Dehejia, A. Dutra, B. Pike, H. Root, J. Rubenstein, and R. Boyer, "Mutation in the α-synuclein gene identified in families with Parkinson's disease," science, vol. 276, pp. 2045-2047, 1997.

86 [13] D. R. Rosen, T. Siddique, D. Patterson, D. A. Figlewicz, P. Sapp, A. Hentati, D. Donaldson, J. Goto, J. P. O'Regan, and H.-X. Deng, "Mutations in Cu/Zn superoxide dismutase gene are associated with familial amyotrophic lateral sclerosis," Nature, vol. 362, p. 59, 1993.

[14] R. J. Ellis, "Macromolecular crowding: an important but neglected aspect of the intracellular environment," Current opinion in structural biology, vol. 11, pp. 114- 119, 2001.

[15] T. E. Creighton, Proteins: structures and molecular properties: Macmillan, 1993.

[16] C. A. Ross and M. A. Poirier, "Protein aggregation and neurodegenerative disease," Nature medicine, vol. 10, p. S10, 2004.

[17] J. Drews, "Drug discovery: a historical perspective," Science, vol. 287, pp. 1960- 1964, 2000.

[18] M. Stefani and C. M. Dobson, "Protein aggregation and aggregate toxicity: new insights into protein folding, misfolding diseases and biological evolution," Journal of molecular medicine, vol. 81, pp. 678-699, 2003.

[19] C. Spiess, A. S. Meyer, S. Reissmann, and J. Frydman, "Mechanism of the eukaryotic chaperonin: protein folding in the chamber of secrets," Trends in cell biology, vol. 14, pp. 598-604, 2004.

[20] S. K. Molugu, Z. L. Hildenbrand, D. G. Morgan, M. B. Sherman, L. He, C. Georgopoulos, N. V. Sernova, L. P. Kurochkina, V. V. Mesyanzhinov, and K. A. Miroshnikov, "Ring separation highlights the protein-folding mechanism used by the phage EL-encoded chaperonin," Structure, vol. 24, pp. 537-546, 2016.

[21] K. Liberek, A. Lewandowska, and S. Zietkiewicz, "Chaperones in control of protein disaggregation," EMBO J, vol. 27, pp. 328-35, Jan 23 2008.

[22] E. Deuerling and B. Bukau, "Chaperone-assisted folding of newly synthesized proteins in the cytosol," Critical reviews in biochemistry and molecular biology, vol. 39, pp. 261-277, 2004.

[23] M.-J. Gething and J. Sambrook, "Protein folding in the cell," Nature, vol. 355, p. 33, 1992.

[24] M. P. Mayer, "Gymnastics of molecular chaperones," Molecular cell, vol. 39, pp. 321-331, 2010.

[25] M. Banach, K. Stąpor, and I. Roterman, "Chaperonin Structure-The Large Multi- Subunit Protein Complex," International journal of molecular sciences, vol. 10, pp. 844-861, 2009.

[26] B. Bukau, J. Weissman, and A. Horwich, "Molecular chaperones and protein quality control," Cell, vol. 125, pp. 443-451, 2006.

[27] S. Reissmann, C. Parnot, C. R. Booth, W. Chiu, and J. Frydman, "Essential function of the built-in lid in the allosteric regulation of eukaryotic and archaeal chaperonins," Nature Structural and Molecular Biology, vol. 14, p. 432, 2007.

[28] A. Horovitz and K. R. Willison, "Allosteric regulation of chaperonins," Current opinion in structural biology, vol. 15, pp. 646-651, 2005.

[29] M. Klumpp, W. Baumeister, and L.-O. Essen, "Structure of the substrate binding domain of the thermosome, an archaeal group II chaperonin," Cell, vol. 91, pp. 263-270, 1997.

[30] H. Saibil, "Chaperone machines for protein folding, unfolding and disaggregation," Nature reviews Molecular cell biology, vol. 14, p. 630, 2013.

[31] M. A. Kabir, W. Uddin, A. Narayanan, P. K. Reddy, M. A. Jairajpuri, F. Sherman, and Z. Ahmad, "Functional subunits of eukaryotic chaperonin CCT/TRiC in protein folding," Journal of amino acids, vol. 2011, 2011.

[32] W. A. Fenton and A. L. Horwich, "Chaperonin-mediated protein folding: fate of substrate polypeptide," Quarterly reviews of biophysics, vol. 36, pp. 229-256, 2003.

[33] M. J. Todd, P. V. Viitanen, and G. H. Lorimer, "Dynamics of the chaperonin ATPase cycle: implications for facilitated protein folding," Science, vol. 265, pp. 659-666, 1994. [34] F. U. Hartl and M. Hayer-Hartl, "Molecular chaperones in the cytosol: from nascent chain to folded protein," Science, vol. 295, pp. 1852-1858, 2002.

[35] R. Sousa and E. M. Lafer, "Keep the traffic moving: mechanism of the Hsp70 motor," Traffic, vol. 7, pp. 1596-1603, 2006.

[36] K. Braig, Z. Otwinowski, R. Hegde, D. C. Boisvert, A. Joachimiak, A. L. Horwich, and P. B. Sigler, "The crystal structure of the bacterial chaperonln GroEL at 2.8 Å," Nature, vol. 371, p. 578, 1994.

[37] O. Fayet, T. Ziegelhoffer, and C. Georgopoulos, "The groES and groEL heat shock gene products of Escherichia coli are essential for bacterial growth at all temperatures," Journal of bacteriology, vol. 171, pp. 1379-1385, 1989.

[38] Z. L. Hildenbrand and R. A. Bernal, "Chaperonin-mediated folding of viral proteins," in Viral Molecular Machines, ed: Springer, 2012, pp. 307-324.

88 [39] J. S. Weissman, Y. Kashi, W. A. Fenton, and A. L. Horwich, "GroEL-mediated protein folding proceeds by multiple rounds of binding and release of nonnative forms," Cell, vol. 78, pp. 693-702, 1994.

[40] F. U. Hartl and M. Hayer-Hartl, "Converging concepts of protein folding in vitro and in vivo," Nature structural & molecular biology, vol. 16, p. 574, 2009.

[41] M. Y. Cheng, F.-U. Hartl, J. Martin, R. A. Pollock, F. Kalousek, W. Neuper, E. M. Hallberg, R. L. Hallberg, and A. L. Horwich, "Mitochondrial heat-shock protein hsp60 is essential for assembly of proteins imported into yeast mitochondria," Nature, vol. 337, p. 620, 1989.

[42] Y. Dubaquié, R. Looser, U. Fünfschilling, P. Jenö, and S. Rospert, "Identification of in vivo substrates of the yeast mitochondrial chaperonins reveals overlapping but non‐identical requirement for hsp60 and hsp10," The EMBO journal, vol. 17, pp. 5868-5876, 1998.

[43] X. Yan, Q. Shi, A. Bracher, G. Miličić, A. K. Singh, F. U. Hartl, and M. Hayer- Hartl, "GroEL ring separation and exchange in the chaperonin reaction," Cell, vol. 172, pp. 605-617. e11, 2018.

[44] J. Martin, A. L. Horwich, and F. U. Hartl, "Prevention of protein denaturation under heat stress by the chaperonin Hsp60," Science, vol. 258, pp. 995-998, 1992.

[45] D. S. Reading, R. L. Hallberg, and A. M. Myers, "Characterization of the yeast HSP60 gene coding for a mitochondrial assembly factor," Nature, vol. 337, p. 655, 1989.

[46] B. SINGH and R. S. GUPTA, "Expression of human 60-kD heat shock protein (HSP60 or P1) in Escherichia coli and the development and characterization of corresponding monoclonal antibodies," DNA and cell biology, vol. 11, pp. 489- 496, 1992.

[47] B. J. Soltys and R. S. Gupta, "Immunoelectron microscopic localization of the 60- kDa heat shock chaperonin protein (Hsp60) in mammalian cells," Experimental cell research, vol. 222, pp. 16-27, 1996.

[48] B. J. Soltys and R. S. Gupta, "Mitochondrial-matrix proteins at unexpected locations: are they exported?," Trends in biochemical sciences, vol. 24, pp. 174- 177, 1999.

[49] C. Georgopoulos and W. Welch, "Role of the major heat shock proteins as molecular chaperones," Annual review of cell biology, vol. 9, pp. 601-634, 1993.

89 [50] J. Frydman, "Folding of newly translated proteins in vivo: the role of molecular chaperones," Annual review of biochemistry, vol. 70, pp. 603-647, 2001.

[51] G. Levy-Rimler, P. Viitanen, C. Weiss, R. Sharkia, A. Greenberg, A. Niv, A. Lustig, Y. Delarea, and A. Azem, "The effect of nucleotides and mitochondrial chaperonin 10 on the structure and chaperone activity of mitochondrial chaperonin 60," Eur J Biochem, vol. 268, pp. 3465-72, Jun 2001.

[52] M. Y. Cheng, F.-U. Hartl, and A. L. Norwich, "The mitochondrial chaperonin hsp60 is required for its own assembly," Nature, vol. 348, p. 455, 1990.

[53] S. Nisemblat, O. Yaniv, A. Parnas, F. Frolow, and A. Azem, "Crystal structure of the human mitochondrial chaperonin symmetrical football complex," Proceedings of the National Academy of Sciences, p. 201411718, 2015.

[54] I. Gozes and D. E. Brenneman, "A new concept in the pharmacology of neuroprotection," Journal of Molecular Neuroscience, vol. 14, pp. 61-68, 2000.

[55] J. Y. Chan, H.-L. Cheng, J. L. Chou, F. C. Li, K.-Y. Dai, S. H. Chan, and A. Y. Chang, "Heat shock protein 60 or 70 activates nitric-oxide synthase (NOS) I-and inhibits NOS II-associated signaling and depresses the mitochondrial apoptotic cascade during brain stem death," Journal of Biological Chemistry, vol. 282, pp. 4585-4600, 2007.

[56] A. Samali, J. Cai, B. Zhivotovsky, D. P. Jones, and S. Orrenius, "Presence of a pre‐apoptotic complex of pro‐caspase‐3, Hsp60 and Hsp10 in the mitochondrial fraction of Jurkat cells," The EMBO journal, vol. 18, pp. 2040-2048, 1999.

[57] C. Zhou, H. Sun, C. Zheng, J. Gao, Q. Fu, N. Hu, X. Shao, Y. Zhou, J. Xiong, and K. Nie, "Oncogenic HSP60 regulates mitochondrial oxidative phosphorylation to support Erk1/2 activation during pancreatic cancer cell growth," Cell death & disease, vol. 9, p. 161, 2018.

[58] V. Calabrese, C. Mancuso, A. Ravagna, M. Perluigi, C. Cini, C. D. Marco, D. Allan Butterfield, and A. M. G. Stella, "In vivo induction of heat shock proteins in the substantia nigra following L‐DOPA administration is associated with increased activity of mitochondrial complex I and nitrosative stress in rats: regulation by glutathione redox state," Journal of neurochemistry, vol. 101, pp. 709-717, 2007.

[59] V. Calabrese, C. Mancuso, M. Sapienza, E. Puleo, S. Calafato, C. Cornelius, M. Finocchiaro, A. Mangiameli, M. Di Mauro, and A. M. G. Stella, "Oxidative stress and cellular stress response in diabetic nephropathy," Cell stress & chaperones, vol. 12, p. 299, 2007.

90 [60] V. Veereshwarayya, P. Kumar, K. M. Rosen, R. Mestril, and H. W. Querfurth, "Differential effects of mitochondrial heat shock protein 60 and related molecular chaperones to prevent intracellular β-amyloid-induced inhibition of complex IV and limit apoptosis," Journal of Biological Chemistry, vol. 281, pp. 29468-29478, 2006.

[61] A. J. Macario, E. C. de Macario, and F. Cappello, "Structural and Hereditary Chaperonopathies: Mutation," in The Chaperonopathies, ed: Springer, 2013, pp. 43-62.

[62] P. Bross, Z. Li, J. Hansen, J. J. Hansen, M. N. Nielsen, T. J. Corydon, C. Georgopoulos, D. Ang, J. B. Lundemose, and K. Niezen-Koning, "Single- nucleotide variations in the genes encoding the mitochondrial Hsp60/Hsp10 chaperone system and their disease-causing potential," Journal of human genetics, vol. 52, p. 56, 2007.

[63] D. Magen, C. Georgopoulos, P. Bross, D. Ang, Y. Segev, D. Goldsher, A. Nemirovski, E. Shahar, S. Ravid, and A. Luder, "Mitochondrial hsp60 chaperonopathy causes an autosomal-recessive neurodegenerative disorder linked to brain hypomyelination and leukodystrophy," The American Journal of Human Genetics, vol. 83, pp. 30-42, 2008.

[64] J. J. Hansen, A. Dürr, I. Cournu-Rebeix, C. Georgopoulos, D. Ang, M. N. Nielsen, C.-S. Davoine, A. Brice, B. Fontaine, and N. Gregersen, "Hereditary spastic paraplegia SPG13 is associated with a mutation in the gene encoding the mitochondrial chaperonin Hsp60," The American Journal of Human Genetics, vol. 70, pp. 1328-1332, 2002.

[65] P. Bross, S. Naundrup, J. Hansen, M. N. Nielsen, J. H. Christensen, M. Kruhøffer, J. Palmfeldt, T. J. Corydon, N. Gregersen, and D. Ang, "The Hsp60-(p. V98I) mutation associated with hereditary spastic paraplegia SPG13 compromises chaperonin function both in vitro and in vivo," Journal of Biological Chemistry, vol. 283, pp. 15694-15700, 2008.

[66] J. Hansen, T. Corydon, J. Palmfeldt, A. Dürr, B. Fontaine, M. Nielsen, J. H. Christensen, N. Gregersen, and P. Bross, "Decreased expression of the mitochondrial matrix proteases Lon and ClpP in cells from a patient with hereditary spastic paraplegia (SPG13)," Neuroscience, vol. 153, pp. 474-482, 2008.

[67] C. Hewamadduma, C. McDermott, J. Kirby, A. Grierson, M. Panayi, A. Dalton, Y. Rajabally, and P. Shaw, "New pedigrees and novel mutation expand the phenotype of REEP1-associated hereditary spastic paraplegia (HSP)," Neurogenetics, vol. 10, p. 105, 2009.

91 [68] J. S. Bains and C. A. Shaw, "Neurodegenerative disorders in humans: the role of glutathione in oxidative stress-mediated neuronal death," Brain Research Reviews, vol. 25, pp. 335-358, 1997.

[69] S. K. Vishwakarma, A. Bardia, S. K. Tiwari, S. A. Paspala, and A. A. Khan, "Current concept in neural regeneration research: NSCs isolation, characterization and transplantation in various neurodegenerative diseases and stroke: A review," Journal of advanced research, vol. 5, pp. 277-294, 2014.

[70] J. K. Fink, "Advances in the hereditary spastic paraplegias," Experimental neurology, vol. 184, pp. 106-110, 2003.

[71] C. Depienne, G. Stevanin, A. Brice, and A. Durr, "Hereditary spastic paraplegias: an update," Current opinion in neurology, vol. 20, pp. 674-680, 2007.

[72] A. Seeligmüller, "Sklerose der seitenstrange des ruckenmards bei vier kindern derselben gamilie," Dtsch Med Wochenshnr, vol. 2, pp. 185-186, 1876.

[73] K. Fatema, M. Rahman, S. Akhter, and T. Karim, "Hereditary Spastic Paraplegia- Report of 2 Cases in a Family," Bangladesh Journal of Child Health, vol. 37, pp. 127-129, 2013.

[74] I. Faber, E. R. Pereira, A. R. Martinez, M. França Jr, and H. A. G. Teive, "Hereditary spastic paraplegia from 1880 to 2017: an historical review," Arquivos de neuro-psiquiatria, vol. 75, pp. 813-818, 2017.

[75] C. Blackstone, "Cellular pathways of hereditary spastic paraplegia," Annual review of neuroscience, vol. 35, pp. 25-47, 2012.

[76] E. Conte, K. Ware, R. Marvulli, G. Ianieri, and M. Megna, "Verification of the Validity of the NPT Treatment in Hereditary Spastic Paraplegia: An Investigation Performed by Application of Random Matrix Theory," World Journal of Neuroscience, vol. 6, p. 1, 2015.

[77] A. Harding, "Hereditary" pure" spastic paraplegia: a clinical and genetic study of 22 families," Journal of Neurology, Neurosurgery & Psychiatry, vol. 44, pp. 871- 883, 1981.

[78] J. Finsterer, W. Löscher, S. Quasthoff, J. Wanschitz, M. Auer-Grumbach, and G. Stevanin, "Hereditary spastic paraplegias with autosomal dominant, recessive, X- linked, or maternal trait of inheritance," Journal of the neurological sciences, vol. 318, pp. 1-18, 2012.

[79] R. Schüle and L. Schöls, "Genetics of hereditary spastic paraplegias," in Seminars in neurology, 2011, pp. 484-493.

92 [80] R. Schüle, S. Wiethoff, P. Martus, K. N. Karle, S. Otto, S. Klebe, S. Klimpe, C. Gallenmüller, D. Kurzwelly, and D. Henkel, "Hereditary spastic paraplegia: clinicogenetic lessons from 608 patients," Annals of neurology, vol. 79, pp. 646- 658, 2016.

[81] E. Klopocki, H. Schulze, G. Strauß, C.-E. Ott, J. Hall, F. Trotier, S. Fleischhauer, L. Greenhalgh, R. A. Newbury-Ecob, and L. M. Neumann, "Complex inheritance pattern resembling autosomal recessive inheritance involving a microdeletion in thrombocytopenia–absent radius syndrome," The American Journal of Human Genetics, vol. 80, pp. 232-240, 2007.

[82] S. Züchner and J. M. Vance, "Emerging pathways for hereditary axonopathies," Journal of molecular medicine, vol. 83, pp. 935-943, 2005.

[83] P. Bross, The Hsp60 Chaperonin: Springer, 2015.

[84] J. Jankovic, M. McDermott, J. Carter, S. Gauthier, C. Goetz, L. Golbe, S. Huber, W. Koller, C. Olanow, and I. Shoulson, "Variable expression of Parkinson's disease A base‐line analysis of the DAT ATOP cohort," Neurology, vol. 40, pp. 1529-1529, 1990.

[85] F. Burté, V. Carelli, P. F. Chinnery, and P. Yu-Wai-Man, "Disturbed mitochondrial dynamics and neurodegenerative disorders," Nature reviews neurology, vol. 11, p. 11, 2015.

[86] C. Blackstone, "Hereditary spastic paraplegia," Handbook of clinical neurology, vol. 148, pp. 633-652, 2018.

[87] P. V. S. de Souza, W. B. V. de Rezende Pinto, G. N. de Rezende Batistella, T. Bortholin, and A. S. B. Oliveira, "Hereditary spastic paraplegia: clinical and genetic hallmarks," The Cerebellum, vol. 16, pp. 525-551, 2017.

[88] J. Ring, P. Rockenfeller, C. Abraham, J. Tadic, M. Poglitsch, K. Schimmel, J. Westermayer, S. Schauer, B. Achleitner, and C. Schimpel, "Mitochondrial energy metabolism is required for lifespan extension by the spastic paraplegia- associated protein spartin," Microbial Cell, vol. 4, p. 411, 2017.

[89] M. Kita and D. E. Goodkin, "Drugs used to treat spasticity," Drugs, vol. 59, pp. 487-495, 2000.

[90] A. Thompson, L. Jarrett, L. Lockley, J. Marsden, and V. Stevenson, "Clinical management of spasticity," ed: BMJ Publishing Group Ltd, 2005.

[91] T. L. Giudice, F. Lombardi, F. M. Santorelli, T. Kawarai, and A. Orlacchio, "Hereditary spastic paraplegia: clinical-genetic characteristics and evolving molecular mechanisms," Experimental neurology, vol. 261, pp. 518-539, 2014.

[92] J. C. Masdeu and J. Biller, Localization in clinical neurology: Lippincott Williams & Wilkins, 2011.

[93] C. M. Rossi and G. Di Comite, "The clinical spectrum of the neurological involvement in vasculitides," Journal of the neurological sciences, vol. 285, pp. 13-21, 2009.

[94] S. I. Wolf, F. Braatz, D. Metaxiotis, P. Armbrust, T. Dreher, L. Döderlein, and R. Mikut, "Gait analysis may help to distinguish hereditary spastic paraplegia from cerebral palsy," Gait & posture, vol. 33, pp. 556-561, 2011.

[95] J. Marsden, L. Bunn, A. Denton, and K. P. S. Nair, "Hereditary spastic paraparesis and other hereditary myelopathies," in Neurological Rehabilitation, ed: CRC Press, 2018, pp. 245-298.

[96] R. Ade-Hall and A. P. Moore, "Botulinum toxin type A in the treatment of lower limb spasticity in cerebral palsy," Cochrane Database Syst Rev, vol. 2, p. CD001408, 2000.

[97] K. Seidel, R. De Vos, L. Derksen, P. Bauer, O. Riess, W. den Dunnen, T. Deller, G. Hageman, and U. Rüb, "Widespread thalamic and cerebellar degeneration in a patient with a complicated hereditary spastic paraplegia (HSP)," Annals of Anatomy-Anatomischer Anzeiger, vol. 191, pp. 203-211, 2009.

[98] T. M. Drake, "Unfolding the promise of translational targeting in neurodegenerative disease," Neuromolecular medicine, vol. 17, pp. 147-157, 2015.

[99] M. Rousseaux, M. Launay, O. Kozlowski, and W. Daveluy, "Botulinum toxin injection in patients with hereditary spastic paraparesis," European journal of neurology, vol. 14, pp. 206-212, 2007.

[100] S. S. Arnon, R. Schechter, T. V. Inglesby, D. A. Henderson, J. G. Bartlett, M. S. Ascher, E. Eitzen, A. D. Fine, J. Hauer, and M. Layton, "Botulinum toxin as a biological weapon: medical and public health management," Jama, vol. 285, pp. 1059-1070, 2001.

[101] V. P. Kramp and P. Herrling, "List of drugs in development for neurodegenerative diseases: update June 2010," Neuro-degenerative diseases, vol. 8, p. 44, 2010.

[102] E. A. André, P. A. Forcelli, and D. T. Pak, "What goes up must come down: homeostatic synaptic plasticity strategies in neurological disease," Future neurology, vol. 13, pp. 13-21, 2018.

94 [103] M. S. Baron, J. L. Vitek, J. Green, Y. Kaneoke, T. Hashimoto, R. S. Turner, J. L. Woodard, M. R. Delong, R. A. Bakay, and S. A. Cole, "Treatment of advanced Parkinson's disease by posterior GPi pallidotomy: 1‐year results of a pilot study," Annals of Neurology: Official Journal of the American Neurological Association and the Child Neurology Society, vol. 40, pp. 355-366, 1996.

[104] M. E. Morris, "Movement disorders in people with Parkinson disease: a model for physical therapy," Physical therapy, vol. 80, pp. 578-597, 2000.

[105] P. Page, "Current concepts in muscle stretching for exercise and rehabilitation," International journal of sports physical therapy, vol. 7, p. 109, 2012.

[106] N. Stergiou, R. T. Harbourne, and J. T. Cavanaugh, "Optimal movement variability: a new theoretical perspective for neurologic physical therapy," Journal of Neurologic Physical Therapy, vol. 30, pp. 120-129, 2006.

[107] P. Sweeney, H. Park, M. Baumann, J. Dunlop, J. Frydman, R. Kopito, A. McCampbell, G. Leblanc, A. Venkateswaran, A. Nurmi, and R. Hodgson, "Protein misfolding in neurodegenerative diseases: implications and strategies," Transl Neurodegener, vol. 6, p. 6, 2017.

[108] T. K. Chaudhuri and S. Paul, "Protein-misfolding diseases and chaperone-based therapeutic approaches," FEBS J, vol. 273, pp. 1331-49, Apr 2006.

[109] M. Wang and R. J. Kaufman, "The impact of the endoplasmic reticulum protein- folding environment on cancer development," Nat Rev Cancer, vol. 14, pp. 581- 97, Sep 2014.

[110] O. Fayet, T. Ziegelhoffer, and C. Georgopoulos, "The groES and groEL heat shock gene products of Escherichia coli are essential for bacterial growth at all temperatures," Journal of bacteriology, vol. 171, pp. 1379-85, Mar 1989.

[111] S. Rospert, T. Junne, B. S. Glick, and G. Schatz, "Cloning and disruption of the gene encoding yeast mitochondrial chaperonin 10, the homolog of E. coli groES," FEBS Lett, vol. 335, pp. 358-60, Dec 13 1993.

[112] D. S. Reading, R. L. Hallberg, and A. M. Myers, "Characterization of the yeast HSP60 gene coding for a mitochondrial assembly factor," Nature, vol. 337, pp. 655-9, Feb 16 1989.

[113] S. Salinas, C. Proukakis, A. Crosby, and T. T. Warner, "Hereditary spastic paraplegia: clinical features and pathogenetic mechanisms," Lancet Neurol, vol. 7, pp. 1127-38, Dec 2008.

95 [114] T. Lo Giudice, F. Lombardi, F. M. Santorelli, T. Kawarai, and A. Orlacchio, "Hereditary spastic paraplegia: clinical-genetic characteristics and evolving molecular mechanisms," Exp Neurol, vol. 261, pp. 518-39, Nov 2014.

[115] D. Magen, C. Georgopoulos, P. Bross, D. Ang, Y. Segev, D. Goldsher, A. Nemirovski, E. Shahar, S. Ravid, A. Luder, B. Heno, R. Gershoni-Baruch, K. Skorecki, and H. Mandel, "Mitochondrial hsp60 chaperonopathy causes an autosomal-recessive neurodegenerative disorder linked to brain hypomyelination and leukodystrophy," Am J Hum Genet, vol. 83, pp. 30-42, Jul 2008.

[116] A. Parnas, M. Nadler, S. Nisemblat, A. Horovitz, H. Mandel, and A. Azem, "The MitCHAP-60 disease is due to entropic destabilization of the human mitochondrial Hsp60 oligomer," J Biol Chem, vol. 284, pp. 28198-203, Oct 9 2009.

[117] J. J. Hansen, A. Durr, I. Cournu-Rebeix, C. Georgopoulos, D. Ang, M. N. Nielsen, C. S. Davoine, A. Brice, B. Fontaine, N. Gregersen, and P. Bross, "Hereditary spastic paraplegia SPG13 is associated with a mutation in the gene encoding the mitochondrial chaperonin Hsp60," Am J Hum Genet, vol. 70, pp. 1328-32, May 2002.

[118] P. Bross, S. Naundrup, J. Hansen, M. N. Nielsen, J. H. Christensen, M. Kruhoffer, J. Palmfeldt, T. J. Corydon, N. Gregersen, D. Ang, C. Georgopoulos, and K. L. Nielsen, "The Hsp60-(p.V98I) mutation associated with hereditary spastic paraplegia SPG13 compromises chaperonin function both in vitro and in vivo," J Biol Chem, vol. 283, pp. 15694-700, Jun 6 2008.

[119] P. Aloy and R. B. Russell, "Structural systems biology: modelling protein interactions," Nature Reviews Molecular Cell Biology, vol. 7, p. 188, 2006.

[120] J. A. Gavira, "Current trends in protein crystallization," Archives of biochemistry and biophysics, vol. 602, pp. 3-11, 2016.

[121] D. B. Williams and C. B. Carter, "The transmission electron microscope," in Transmission electron microscopy, ed: Springer, 1996, pp. 3-17.

[122] R. F. Egerton, Electron energy-loss spectroscopy in the electron microscope: Springer Science & Business Media, 2011.

[123] J. McDonald, "Optical microscopy," Microelectronics Failure Analysis: Desk Reference, p. 472, 2004.

[124] G. S. Dawe, J.-T. Schantz, M. Abramowitz, M. W. Davidson, and D. W. Hutmacher, "Light microscopy," Techniques in Microscopy for Biomedical Applications, vol. 2, p. 9, 2006.

96 [125] W.-C. Chang, "High resolution charge-coupled device (ccd) camera system," ed: Google Patents, 1993.

[126] R. Kerrod, DK Eyewitness Books: Universe: Penguin, 2009.

[127] D. B. Murphy, Fundamentals of light microscopy and electronic imaging: John Wiley & Sons, 2002.

[128] W. J. Croft, Under the microscope: a brief history of microscopy vol. 5: World Scientific, 2006.

[129] J. Humphreys, R. Beanland, and P. J. Goodhew, Electron microscopy and analysis: CRC Press, 2014.

[130] J. L. Milne, M. J. Borgnia, A. Bartesaghi, E. E. Tran, L. A. Earl, D. M. Schauder, J. Lengyel, J. Pierson, A. Patwardhan, and S. Subramaniam, "Cryo‐electron microscopy–a primer for the non‐microscopist," The FEBS journal, vol. 280, pp. 28-45, 2013.

[131] X. Li, P. Mooney, S. Zheng, C. R. Booth, M. B. Braunfeld, S. Gubbens, D. A. Agard, and Y. Cheng, "Electron counting and beam-induced motion correction enable near-atomic-resolution single-particle cryo-EM," Nature methods, vol. 10, p. 584, 2013.

[132] P. L. Stewart, C. Y. Chiu, S. Huang, T. Muir, Y. Zhao, B. Chait, P. Mathias, and G. R. Nemerow, "Cryo‐EM visualization of an exposed RGD epitope on adenovirus that escapes antibody neutralization," The EMBO journal, vol. 16, pp. 1189-1198, 1997.

[133] D. Cressey and E. Callaway, "Cryo-electron microscopy wins chemistry Nobel," Nature News, vol. 550, p. 167, 2017.

[134] M. Eisenstein, "The field that came in from the cold," ed: Nature Publishing Group, 2015.

[135] J.-P. Renaud, A. Chari, C. Ciferri, W.-t. Liu, H.-W. Rémigy, H. Stark, and C. Wiesmann, "Cryo-EM in drug discovery: achievements, limitations and prospects," Nature Reviews Drug Discovery, 2018.

[136] J. Frank, Three-dimensional electron microscopy of macromolecular assemblies: visualization of biological molecules in their native state: Oxford University Press, 2006.

[137] E. Nogales and S. H. Scheres, "Cryo-EM: a unique tool for the visualization of macromolecular complexity," Molecular cell, vol. 58, pp. 677-689, 2015.

97 [138] E. Orlova and H. R. Saibil, "Structural analysis of macromolecular assemblies by electron microscopy," Chemical reviews, vol. 111, pp. 7710-7748, 2011.

[139] L. Fabre, H. Bao, J. Innes, F. Duong, and I. Rouiller, "Negative Stain Single- particle EM of the Maltose Transporter in Nanodiscs Reveals Asymmetric Closure of MalK2 and Catalytic Roles of ATP, MalE, and Maltose," J Biol Chem, vol. 292, pp. 5457-5464, Mar 31 2017.

[140] M. Sawicka, P. H. Wanrooij, V. C. Darbari, E. Tannous, S. Hailemariam, D. Bose, A. V. Makarova, P. M. Burgers, and X. Zhang, "The Dimeric Architecture of Checkpoint Kinases Mec1ATR and Tel1ATM Reveal a Common Structural Organization," J Biol Chem, vol. 291, pp. 13436-47, Jun 24 2016.

[141] E. Durand, V. S. Nguyen, A. Zoued, L. Logger, G. Pehau-Arnaudet, M. S. Aschtgen, S. Spinelli, A. Desmyter, B. Bardiaux, A. Dujeancourt, A. Roussel, C. Cambillau, E. Cascales, and R. Fronzes, "Biogenesis and structure of a type VI secretion membrane core complex," Nature, vol. 523, pp. 555-60, Jul 30 2015.

[142] A. S. Enriquez, H. M. Rojo, J. M. Bhatt, S. K. Molugu, Z. L. Hildenbrand, and R. A. Bernal, "The human mitochondrial Hsp60 in the APO conformation forms a stable tetradecameric complex," Cell Cycle, vol. 16, pp. 1309-1319, Jul 3 2017.

[143] S. Vilasi, R. Carrotta, M. R. Mangione, C. Campanella, F. Librizzi, L. Randazzo, V. Martorana, A. Marino Gammazza, M. G. Ortore, A. Vilasi, G. Pocsfalvi, G. Burgio, D. Corona, A. Palumbo Piccionello, G. Zummo, D. Bulone, E. Conway de Macario, A. J. Macario, P. L. San Biagio, and F. Cappello, "Human Hsp60 with its mitochondrial import signal occurs in solution as heptamers and tetradecamers remarkably stable over a wide range of concentrations," PLoS One, vol. 9, p. e97657, 2014.

[144] K. Miwa and M. Yoshida, "The alpha 3 beta 3 complex, the catalytic core of F1- ATPase," Proc Natl Acad Sci U S A, vol. 86, pp. 6484-7, Sep 1989.

[145] J. M. Bell, M. Chen, P. R. Baldwin, and S. J. Ludtke, "High resolution single particle refinement in EMAN2.1," Methods, vol. 100, pp. 25-34, May 01 2016.

[146] R. Fernandez-Leiro and S. H. Scheres, "Unravelling biological macromolecules with cryo-electron microscopy," Nature, vol. 537, p. 339, 2016.

[147] A. Heimowitz, J. Andén, and A. Singer, "APPLE picker: Automatic particle picking, a low-effort cryo-EM framework," Journal of structural biology, vol. 204, pp. 215-227, 2018.

[148] S. J. Ludtke, P. R. Baldwin, and W. Chiu, "EMAN: semiautomated software for high-resolution single-particle reconstructions," Journal of structural biology, vol. 128, pp. 82-97, 1999.

[149] J. M. Bell, M. Chen, P. R. Baldwin, and S. J. Ludtke, "High resolution single particle refinement in EMAN2. 1," Methods, vol. 100, pp. 25-34, 2016.

[150] J. Zhu, P. A. Penczek, R. Schröder, and J. Frank, "Three-dimensional reconstruction with contrast transfer function correction from energy-filtered cryoelectron micrographs: Procedure and application to the 70sescherichia coliribosome," Journal of structural biology, vol. 118, pp. 197-219, 1997.

[151] E. Nogales and S. H. Scheres, "Cryo-EM: A Unique Tool for the Visualization of Macromolecular Complexity," Mol Cell, vol. 58, pp. 677-89, May 21 2015.

[152] J. Frank, "Single-particle reconstruction of biological macromolecules in electron microscopy--30 years," Q Rev Biophys, vol. 42, pp. 139-58, Aug 2009.

[153] F. J. Sigworth, "Principles of cryo-EM single-particle image processing," Microscopy (Oxf), vol. 65, pp. 57-67, Feb 2016.

[154] J. Frank and I. Ebrary, "Three-dimensional electron microscopy of macromolecular assemblies visualization of biological molecules in their native state," ed. Oxford [u.a.]: Oxford University Press, 2006.

[155] G. Tang, L. Peng, P. R. Baldwin, D. S. Mann, W. Jiang, I. Rees, and S. J. Ludtke, "EMAN2: an extensible image processing suite for electron microscopy," J Struct Biol, vol. 157, pp. 38-46, Jan 2007.

[156] S. Dutta, J. R. Whicher, D. A. Hansen, W. A. Hale, J. A. Chemler, G. R. Congdon, A. R. Narayan, K. Hakansson, D. H. Sherman, J. L. Smith, and G. Skiniotis, "Structure of a modular polyketide synthase," Nature, vol. 510, pp. 512- 7, Jun 26 2014.

[157] S. J. Ludtke, D. H. Chen, J. L. Song, D. T. Chuang, and W. Chiu, "Seeing GroEL at 6 A resolution by single particle electron cryomicroscopy," Structure, vol. 12, pp. 1129-36, Jul 2004.

[158] P. A. Penczek, "Resolution measures in molecular electron microscopy," Methods Enzymol, vol. 482, pp. 73-100, 2010.

[159] M. van Heel and M. Schatz, "Fourier shell correlation threshold criteria," J Struct Biol, vol. 151, pp. 250-62, Sep 2005.

[160] M. L. Baker, J. Zhang, S. J. Ludtke, and W. Chiu, "Cryo-EM of macromolecular assemblies at near-atomic resolution," Nat Protoc, vol. 5, pp. 1697-708, Sep 2010.

99 [161] S. J. Ludtke, M. L. Baker, D. H. Chen, J. L. Song, D. T. Chuang, and W. Chiu, "De novo backbone trace of GroEL from single particle electron cryomicroscopy," Structure, vol. 16, pp. 441-8, Mar 2008.

[162] X. P. Xu and N. Volkmann, "Validation methods for low-resolution fitting of atomic structures to electron microscopy data," Arch Biochem Biophys, vol. 581, pp. 49- 53, Sep 01 2015.

[163] M. Carroni and H. R. Saibil, "Cryo electron microscopy to determine the structure of macromolecular complexes," Methods, vol. 95, pp. 78-85, 2016.

[164] Y. Cheng, N. Grigorieff, P. A. Penczek, and T. Walz, "A primer to single-particle cryo-electron microscopy," Cell, vol. 161, pp. 438-449, 2015.

[165] C. Donnet, E. Arystarkhova, and K. J. Sweadner, "Thermal denaturation of the Na,K-ATPase provides evidence for alpha-alpha oligomeric interaction and gamma subunit association with the C-terminal domain," J Biol Chem, vol. 276, pp. 7357-65, Mar 9 2001.

[166] P. Minarik, N. Tomaskova, M. Kollarova, and M. Antalik, "Malate dehydrogenases-structure and function," General physiology and biophysics, vol. 21, pp. 257-266, 2002.

[167] E. F. Pettersen, T. D. Goddard, C. C. Huang, G. S. Couch, D. M. Greenblatt, E. C. Meng, and T. E. Ferrin, "UCSF chimera - A visualization system for exploratory research and analysis," Journal of Computational Chemistry, vol. 25, pp. 1605-1612, Oct 2004.

[168] S. H. Scheres, "A Bayesian view on cryo-EM structure determination," J Mol Biol, vol. 415, pp. 406-18, Jan 13 2012.

[169] B. Jachimska, M. Wasilewska, and Z. Adamczyk, "Characterization of globular protein solutions by dynamic light scattering, electrophoretic mobility, and viscosity measurements," Langmuir, vol. 24, pp. 6866-6872, 2008.

[170] S. Vilasi, R. Carrotta, M. R. Mangione, C. Campanella, F. Librizzi, L. Randazzo, V. Martorana, A. M. Gammazza, M. G. Ortore, and A. Vilasi, "Human Hsp60 with its mitochondrial import signal occurs in solution as heptamers and tetradecamers remarkably stable over a wide range of concentrations," PloS one, vol. 9, p. e97657, 2014.

[171] J. Zhang, M. L. Baker, G. F. Schröder, N. R. Douglas, S. Reissmann, J. Jakana, M. Dougherty, C. J. Fu, M. Levitt, and S. J. Ludtke, "Mechanism of folding chamber closure in a group II chaperonin," Nature, vol. 463, p. 379, 2010.

100 [172] F. U. Hartl, "Molecular chaperones in cellular protein folding," Nature, vol. 381, p. 571, 1996.

[173] Y.-C. Fang and M. Cheng, "The effect of C-terminal mutations ofHSP60 on protein folding," Journal of biomedical science, vol. 9, pp. 223-233, 2002.

[174] K. Machida, A. Kono-Okada, K. Hongo, T. Mizobata, and Y. Kawata, "Hydrophilic residues 526KNDAAD531 in the flexible C-terminal region of the chaperonin GroEL are critical for substrate protein folding within the central cavity," Journal of Biological Chemistry, 2008.

[175] G. W. Farr, W. A. Fenton, and A. L. Horwich, "Perturbed ATPase activity and not “close confinement” of substrate in the cis cavity affects rates of folding by tail- multiplied GroEL," Proceedings of the National Academy of Sciences, vol. 104, pp. 5342-5347, 2007.

[176] Y.-C. Tang, H.-C. Chang, A. Roeben, D. Wischnewski, N. Wischnewski, M. J. Kerner, F. U. Hartl, and M. Hayer-Hartl, "Structural features of the GroEL-GroES nano-cage required for rapid folding of encapsulated protein," Cell, vol. 125, pp. 903-914, 2006.

[177] J. E. Coyle, J. Jaeger, M. Groß, C. V. Robinson, and S. E. Radford, "Structural and mechanistic consequences of polypeptide binding by GroEL," Folding and Design, vol. 2, pp. R93-R104, 1997.

[178] M. R. Shastry and H. Roder, "Evidence for barrier-limited protein folding kinetics on the microsecond time scale," Nature Structural and Molecular Biology, vol. 5, p. 385, 1998.

[179] C. W. Pratt and K. Cornely, Essential biochemistry: Wiley Hoboken, NJ, 2004.

[180] N. Elad, G. W. Farr, D. K. Clare, E. V. Orlova, A. L. Horwich, and H. R. Saibil, "Topologies of a substrate protein bound to the chaperonin GroEL," Molecular cell, vol. 26, pp. 415-426, 2007. [181] A. Sukhanova, S. Poly, A. Shemetov, I. Bronstein, and I. Nabiev, "Implications of protein structure instability: from physiological to pathological secondary structure," Biopolymers, vol. 97, pp. 577-88, Aug 2012.

[182] E. Tiffany-Castiglioni and Y. Qian, "ER chaperone-metal interactions: links to protein folding disorders," Neurotoxicology, vol. 33, pp. 545-57, Jun 2012.

[183] S. K. Molugu, Z. L. Hildenbrand, D. G. Morgan, M. B. Sherman, L. He, C. Georgopoulos, N. V. Sernova, L. P. Kurochkina, V. V. Mesyanzhinov, K. A. Miroshnikov, and R. A. Bernal, "Ring Separation Highlights the Protein-Folding Mechanism Used by the Phage EL-Encoded Chaperonin," Structure, vol. 24, pp. 537-546, Apr 5 2016.

101

[184] J. M. Bhatt, A. S. Enriquez, J. Wang, H. M. Rojo, S. K. Molugu, Z. L. Hildenbrand, and R. A. Bernal, "Single-Ring Intermediates Are Essential for Some Chaperonins," Front Mol Biosci, vol. 5, p. 42, 2018.

[185] F. Russmann, M. J. Stemp, L. Monkemeyer, S. A. Etchells, A. Bracher, and F. U. Hartl, "Folding of large multidomain proteins by partial encapsulation in the chaperonin TRiC/CCT," Proc Natl Acad Sci U S A, vol. 109, pp. 21208-15, Dec 26 2012.

[186] M. Y. Cheng, F. U. Hartl, J. Martin, R. A. Pollock, F. Kalousek, W. Neupert, E. M. Hallberg, R. L. Hallberg, and A. L. Horwich, "Mitochondrial Heat-Shock Protein Hsp60 Is Essential for Assembly of Proteins Imported into Yeast Mitochondria," Nature, vol. 337, pp. 620-625, Feb 16 1989.

[187] R. E. Gray, D. G. Grasso, R. J. Maxwell, P. M. Finnegan, P. Nagley, and R. J. Devenish, "Identification of a 66 KDa protein associated with yeast mitochondrial ATP synthase as heat shock protein hsp60," FEBS Lett, vol. 268, pp. 265-8, Jul 30 1990.

[188] J. E. Alard, S. Hillion, L. Guillevin, A. Saraux, J. O. Pers, P. Youinou, and C. Jamin, "Autoantibodies to endothelial cell surface ATP synthase, the endogenous receptor for hsp60, might play a pathogenic role in vasculatides," PLoS One, vol. 6, p. e14654, Feb 7 2011.

[189] J. Hu, H. Song, X. Wang, Y. Shen, F. Chen, Y. Liu, S. Li, Y. Wang, X. Shou, Y. Zhang, and R. Hu, "Gene expression profiling in human null cell pituitary adenoma tissue," Pituitary, vol. 10, pp. 47-52, 2007.

[190] A. Isidoro, E. Casado, A. Redondo, P. Acebo, E. Espinosa, A. M. Alonso, P. Cejas, D. Hardisson, J. A. Fresno Vara, C. Belda-Iniesta, M. Gonzalez-Baron, and J. M. Cuezva, "Breast carcinomas fulfill the Warburg hypothesis and provide metabolic markers of cancer prognosis," Carcinogenesis, vol. 26, pp. 2095-104, Dec 2005.

[191] N. Lynam-Lennon, S. G. Maher, A. Maguire, J. Phelan, C. Muldoon, J. V. Reynolds, and J. O'Sullivan, "Altered mitochondrial function and energy metabolism is associated with a radioresistant phenotype in oesophageal adenocarcinoma," PLoS One, vol. 9, p. e100738, 2014.

[192] C. U. Huebbers, A. C. Adam, S. F. Preuss, T. Schiffer, S. Schilder, O. Guntinas- Lichius, M. Schmidt, J. P. Klussmann, and R. J. Wiesner, "High glucose uptake unexpectedly is accompanied by high levels of the mitochondrial ss-F1-ATPase subunit in head and neck squamous cell carcinoma," Oncotarget, vol. 6, pp. 36172-84, Nov 3 2015.

102 [193] R. Kucharczyk, M. Zick, M. Bietenhader, M. Rak, E. Couplan, M. Blondel, S. D. Caubet, and J. P. di Rago, "Mitochondrial ATP synthase disorders: molecular mechanisms and the quest for curative therapeutic approaches," Biochim Biophys Acta, vol. 1793, pp. 186-99, Jan 2009.

[194] M. T. Lin and M. F. Beal, "Mitochondrial dysfunction and oxidative stress in neurodegenerative diseases," Nature, vol. 443, pp. 787-95, Oct 19 2006.

[195] G. H. Lorimer, X. Fei, and X. Ye, "The GroEL chaperonin: a protein machine with pistons driven by ATP binding and hydrolysis," Phil. Trans. R. Soc. B, vol. 373, p. 20170179, 2018.

103 Abbreviation and Notations

ATP adenosine 5’-triphosphate DNA deoxyribonucleic acid

ADP adenosine 5’-diphosphate

F1 soluble domain of ATP synthase

F0 membrane-bound domain of ATP synthase, oligomycin sensitive kDa Kilodalton hsp60 60 kDa heat shock protein

E. coli Escherichia coli Apo nucleotide-free, unbound state in-vivo within the living

EM electron microscopy PCR polymerase chain reaction

T7 bacteriophage T7

T7 lac lactose-induced, T7 RNA polymerase-specific promoter

EDTA ethylenediaminetetraacetic acid

HPLC high-performance liquid chromatography pI isoelectric point

TEM transmission electron microscope

CTF contrast transfer function 2D two-dimensional

3D three-dimensional SDS-PAGE sodium dodecyl sulfate polyacrylamide gel electrophoresis

OD600 optical density, 600 nanometers

DTT dithiothreitol, Cleland’s reagent

104 FSC Fourier shell correlation

PDB protein databank accession code

In vitro outside a living organism

2xTY yeast, tryptone and salt-based growth medium IPTG isopropyl β-D-1-thiogalactoside

HEPES 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid

DNase deoxyribonucleic acid hydrolase AEX anion-exchange chromatography

FF fast flow-through

SEC size-exclusion chromatography

BCA bicinchoninic acid

105 Appendix 1

The information of 68 types of spastic paraplegia (adapted from https://www.omim.org website)

Location Phenotype Phenotype Gene/Locus

MIM number

1p36.13 Spastic paraplegia 78, 617225 ATP13A2

autosomal recessive

1p31.1- Spastic paraplegia 29, 609727 SPG29

p21.1 autosomal dominant

1p13.3 Spastic paraplegia 63 615686 AMPD2

1p13.2 Spastic paraplegia 47, 614066 AP4B1

autosomal recessive

1q32.1 Spastic paraplegia 23 270750 DSTYK

1q42.13 Spastic paraplegia 44, 613206 GJC2

autosomal recessive

1q42.13 Spastic paraplegia 74, 616451 IBA57

autosomal recessive

2p22.3 Spastic paraplegia 4, autosomal 182601 SPAST

dominant

2p11.2 Spastic paraplegia 31, 610250 REEP1

autosomal dominant

2q33.1 Spastic paraplegia 13, 605280 HSPD1

autosomal dominant

2q37.3 Spastic paraplegia 30, 610357 KIF1A

autosomal recessive

3q12.2 Spastic paraplegia 57, 615658 TFG

autosomal recessive

3q25.31 Spastic paraplegia 42, 612539 SLC33A1

autosomal dominant

3q27- Spastic paraplegia 14, 605229 SPG14

q28 autosomal recessive

4p16- Spastic paraplegia 38, 612335 SPG38

p15 autosomal dominant

4p13 Spastic paraplegia 79, 615491 UCHL1

autosomal recessive

4q25 Spastic paraplegia 56, 615030 CYP2U1

autosomal recessive

6p25.1 Spastic paraplegia 77, 617046 FARS2

autosomal recessive

6q23- Spastic paraplegia 25, 608220 SPG25

q24.1 autosomal recessive

7p22.1 Spastic paraplegia 48, 613647 AP5Z1

autosomal recessive

7q22.1 Spastic paraplegia 50, 612936 AP4M1

autosomal recessive

106 8p22 Spastic paraplegia 53, 614898 VPS37A

autosomal recessive

8p21.1- Spastic paraplegia 37, 611945 SPG37

q13.3 autosomal dominant

8p11.23 Spastic paraplegia 18, 611225 ERLIN2

autosomal recessive

8p11.23 Spastic paraplegia 54, 615033 DDHD2

autosomal recessive

8q12.3 Spastic paraplegia 5A, 270800 CYP7B1

autosomal recessive

8q24.13 Spastic paraplegia 8, autosomal 603563 WSHC5

dominant

9p13.3 Spastic paraplegia 46, 614409 GBA2

autosomal recessive

9q Spastic paraplegia 19, 607152 SPG19

autosomal dominant

10q22.1- Spastic paraplegia 27, 609041 SPG27

q24.1 autosomal recessive

10q24.1 Spastic paraplegia 9A, 601162 ALDH18A1

autosomal dominant

10q24.1 Spastic paraplegia 9B, 616586 ALDH18A1

autosomal recessive

10q24.1 Spastic paraplegia 64, 615683 ENTPD1

autosomal recessive

10q24.2 Spastic paraplegia 33, 610244 ZFYVE27

autosomal dominant

10q24.3 Spastic paraplegia 62 615681 ERLIN1

10q24.3 Spastic paraplegia 45, 613162 NT5C2

2-q24.33 autosomal recessive

11p14.1- Spastic paraplegia 41, 613364 SPG41

p11.2 autosomal dominant

11q12.3 Silver spastic paraplegia 270685 BSCL2

syndrome

11q13.1 Spastic paraplegia 76, 616907 CAPN1

autosomal recessive

12q13.3 Spastic paraplegia 10, 604187 KIF5A

autosomal dominant

12q13.3 Spastic paraplegia 26, 609195 B4GALNT1

autosomal recessive

12q23- Spastic paraplegia 36, 613096 SPG36

q24 autosomal dominant

12q24.3 Spastic paraplegia 55, 615035 C12orf65

1 autosomal recessive

13q13.3 Troyer syndrome 275900 SPG20

13q14 Spastic paraplegia 24, 607584 SPG24

autosomal recessive

14q12- Spastic paraplegia 32, 611252 SPG32

q21 autosomal recessive

107 14q12 Spastic paraplegia 52, 614067 AP4S1

autosomal recessive

14q22.1 Spastic paraplegia 3A, 182600 ATL1

autosomal dominant

14q22.1 Spastic paraplegia 28, 609340 DDHD1

autosomal recessive

14q24.1 Spastic paraplegia 15, 270700 ZFYVE26

autosomal recessive

14q32.3 Spastic paraplegia 49, 615031 TECPR2

1 autosomal recessive

15q11.2 Spastic paraplegia 6, autosomal 600363 NIPA1

dominant

15q21.1 Spastic paraplegia 11, 604360 SPG11

autosomal recessive

15q21.2 Spastic paraplegia 51, 613744 AP4E1

autosomal recessive

15q22.3 Mast syndrome 248900 ACP33

16p12.3 Spastic paraplegia 61, 615685 ARL6IP1

autosomal recessive

16q23.1 Spastic paraplegia 35, 612319 FA2H

autosomal recessive

16q24.3 Spastic paraplegia 7, autosomal 607259 PGN

recessive

19p13.2 Spastic paraplegia 39, 612020 PNPLA6

autosomal recessive

19q12 Spastic paraplegia 43, 615043 C19orf12

autosomal recessive

19q13.1 Spastic paraplegia 75, 616680 MAG

2 autosomal recessive

19q13.3 Spastic paraplegia 12, 604805 RTN2

2 autosomal dominant

19q13.3 Spastic paraplegia 73, 616282 CPT1C

3 autosomal dominant

Xq11.2 Spastic paraplegia 16, X-linked, 300266 SPG16

complicated

Xq22.2 Spastic paraplegia 2, X-linked 312920 PLP1

Xq24- Spastic paraplegia 34, X-linked 300750 SPG34

q25

Xq28 MASA syndrome 303350 L1CAM

Xq28 CRASH syndrome 303350 L1CAM

108 Appendix 2. The Gene Sequence of HSD1

ATGgccaaagatgtaaaatttggtgcagatgcccgagccttaatgcttcaaggtgtagaccttttagccgatgctgtggccgttacaat ggggccaaagggaagaacagtgattattgagcagagttggggaagtcccaaagtaacaaaagatggtgtgactgttgcaaagtca attgacttaaaagataaatacaaaaacattggagctaaacttgttcaagatgttgccaataacacaaatgaagaagctggggatggc actaccactgctactgtactggcacgctctatagccaaggaaggcttcgagaagattagcaaaggtgctaatccagtggaaatcagg agaggtgtgatgttagctgttgatgctgtaattgctgaacttaaaaagcagtctaaacctgtgaccacccctgaagaaattgcacaggtt gctacgatttctgcaaacggagacaaagaaattggcaatatcatctctgatgcaatgaaaaaagttggaagaaagggtgtcatcaca gtaaaggatggaaaaacactgaatgatgaattagaaattattgaaggcatgaagtttgatcgaggctatatttctccatactttattaatac atcaaaaggtcagaaatgtgaattccaggatgcctatgttctgttgagtgaaaagaaaatttctagtatccagtccattgtacctgctcttg aaattgccaatgctcaccgtaagcctttggtcataatcgctgaagatgttgatggagaagctctaagtacactcgtcttgaataggctaa aggttggtcttcaggttgtggcagtcaaggctccagggtttggtgacaatagaaagaaccagcttaaagatatggctattgctactggtg gtgcagtgtttggagaagagggattgaccctgaatcttgaagacgttcagcctcatgacttaggaaaagttggagaggtcattgtgacc aaagacgatgccatgctcttaaaaggaaaaggtgacaaggctcaaattgaaaaacgtattcaagaaatcattgagcagttagatgtc acaactagtgaatatgaaaaggaaaaactgaatgaacggcttgcaaaactttcagatggagtggctgtgctgaaggttggtgggaca agtgatgttgaagtgaatgaaaagaaagacagagttacagatgcccttaatgctacaagagctgctgttgaagaaggcattgttttggg agggggttgtgccctccttcgatgcattccagccttggactcattgactccagctaatgaagatcaaaaaattggtatagaaattattaaa agaacactcaaaattccagcaatgaccattgctaagaatgcaggtgttgaaggatctttgatagttgagaaaattatgcaaagttcctca gaagttggttatgatgctatggctggagattttgtgaatatggtggaaaaaggaatcattgacccaacaaaggttgtgagaactgctttat tggatgctgctggtgtggcctctctgttaactacagcagaagttgtagtcacagaaattcctaaagaagagaaggaccctggaatgggt gcaatgggtggaatgggaggtggtatgggaggtggcatgttctaa

109 Appendix 3. The Map of pET-22b (+)

110 Vita

Jinliang Wang was born in Juxian, China, in June 1988, and grew up there until

September 2007, when he went to Hainan University. He was awarded his bachelor’s degree in biology from Hainan University. He finished his master’s degree in University of Science and Technology of China in the cell biology in 2014. After that, he went to industry as a research assistant for one and half years. He came to U.S. in June 2015 to pursue his PhD degree under Dr. Bernal’s guidance.

Contact Information: [email protected]

111