Duplex Real-Time PCR Assay Using SYBR Green to Detect and Quantify

Food Additives & Contaminants: Part A

ISSN: 1944-0049 (Print) 1944-0057 (Online) Journal homepage: http://www.tandfonline.com/loi/tfac20

Duplex real-time PCR assay using SYBR Green to detect and quantify Malayan box turtle (Cuora amboinensis) materials in meatballs, burgers, frankfurters and traditional Chinese herbal jelly powder

Asing, Eaqub Ali Md., Sharifah Bee Abd Hamid, Motalib Hossain Md., Mohammad Nasir Uddin Ahamad, S. M. Azad Hossain, Nina Naquiah & I. S. M. Zaidul

To cite this article: Asing, Eaqub Ali Md., Sharifah Bee Abd Hamid, Motalib Hossain Md., Mohammad Nasir Uddin Ahamad, S. M. Azad Hossain, Nina Naquiah & I. S. M. Zaidul (2016) Duplex real-time PCR assay using SYBR Green to detect and quantify Malayan box turtle (Cuora amboinensis) materials in meatballs, burgers, frankfurters and traditional Chinese herbal jelly powder, Food Additives & Contaminants: Part A, 33:11, 1643-1659, DOI: 10.1080/19440049.2016.1236403

To link to this article: http://dx.doi.org/10.1080/19440049.2016.1236403

Accepted author version posted online: 19 Submit your article to this journal Sep 2016. Published online: 17 Oct 2016.

Article views: 31 View related articles

View Crossmark data

Full Terms & Conditions of access and use can be found at http://www.tandfonline.com/action/journalInformation?journalCode=tfac20

Download by: [Jordan Univ. of Science & Tech] Date: 19 November 2016, At: 18:46 FOOD ADDITIVES & CONTAMINANTS: PART A, 2016 VOL. 33, NO. 11, 1643–1659 http://dx.doi.org/10.1080/19440049.2016.1236403

Duplex real-time PCR assay using SYBR Green to detect and quantify Malayan box turtle (Cuora amboinensis) materials in meatballs, burgers, frankfurters and traditional Chinese herbal jelly powder Asinga, Md. Eaqub Alia,b, Sharifah Bee Abd Hamida, Md. Motalib Hossaina, Mohammad Nasir Uddin Ahamada, S. M. Azad Hossaina, Nina Naquiaha and I. S. M. Zaidulc aNanotechnology and Catalysis Research Center (NANOCAT), University of Malaya, Kuala Lumpur, Malaysia; bCentre for Research in Biotechnology for Agriculture (CEBAR), University of Malaya, Kuala Lumpur, Malaysia; cDepartment of Pharmaceutical Technology, Faculty of Pharmacy, International Islamic University, Kuantan, Malaysia

ABSTRACT ARTICLE HISTORY The Malayan box turtle (Cuora amboinensis) (MBT) is a vulnerable and protected species widely Received 12 July 2016 used in exotic foods and traditional medicines. Currently available polymerase chain reaction Accepted 2 September 2016 (PCR) assays to identify MBT lack automation and involve long targets which break down in KEYWORDS processed or denatured tissue. This SYBR Green duplex real-time PCR assay has addressed this Malayan box turtle; SYBR research gap for the first time through the combination of 120- and 141-bp targets from MBT and Green real-time PCR; limits eukaryotes for the quantitative detection of MBT DNA in food chain and herbal medicinal of detection and preparations. This authentication ensures better security through automation, internal control quantification; protected and short targets that were stable under the processing treatments of foods and medicines. A species; herbal jelly powder melting curve clearly demonstrated two peaks at 74.63 ± 0.22 and 78.40 ± 0.31°C for the MBT and eukaryotic products, respectively, under pure, admixed and commercial food matrices. Analysis of 125 reference samples reflected a target recovery of 93.25–153.00%, PCR efficiency of 99–100% and limit of detection of 0.001% under various matrices. The quantification limits were 0.00001, 0.00170 ± 0.00012, 0.00228 ± 0.00029, 0.00198 ± 0.00036 and 0.00191 ± 0.00043 ng DNA for the pure meat, binary mixtures, meatball, burger and frankfurter products, respectively. The assay was used to screen 100 commercial samples of traditional Chinese herbal jelly powder from eight

different brands; 22% of them were found to be MBT-positive (5.37 ± 0.50–7.00 ± 0.34% w/w), which was reflected through the Ct values (26.37 ± 0.32–28.90 ± 0.42) and melting curves (74.63– 78.65 ± 0.22°C) of the amplified MBT target (120 bp), confirming the speculation that MBT materials are widely used in Chinese herbal desserts, exotic dishes consumed with the hope of prolonging life and youth.

Introduction invigorating elements for the long-term restoration of youth and sexual life (Hempen & Fischer 2009; Regulatory laws, analytical tests and public awareness Graham-Rowe 2011). They fall under the reptile work side by side to ensure safety and quality in foods umbrella. There are approximately 460 varieties of and pharmaceutical products from farm to fork freshwater turtles and tortoises around the world (Shackell 2008). Recent market survey and media (Fund 2002); currently, all are enlisted under the reports reflect that adulteration and mislabelling of most vulnerable clades of vertebrates (Spinks et al. animal products, such as sausages, ground meat, meat- 2012), and out of 293 International Union for balls, deli meat, dried meat, game meat, bush meat and Conservation of Nature and Natural Resources burgers, are widespread across the globe (20–70% in (IUCN) Red-Listed freshwater turtles and tortoises, 88 Mexico, Turkey and Africa; 8% in the UK, and 19.4% species are found in Asia. According to Fund (2002), in the USA) (Brodmann et al. 2001; Ayaz et al. 2006; 3% of the world’s turtle species are already extinct, 9% Fajardo et al. 2010; Brown 2013; Cawthorn et al. 2013; are critically threatened, 18% are threatened and 2% D’Amato et al. 2013; Özpınar et al. 2013). The bones, are at high risk in various habitats. About 1% of the shells, skins and eggs of turtle and tortoise species are Asian turtles are already extinct, 20% are critically believed to have active healing attributes and

CONTACT Md. Eaqub Ali [email protected] Nanotechnology and Catalysis Research Center (NANOCAT), University of Malaya, Kuala Lumpur, Malaysia © 2016 Informa UK Limited, trading as Taylor & Francis Group 1644 ASING ET AL. endangered, 31% are endangered and 25% are represents a great threat to nesting resources (WWF vulnerable. 2015). The enormous illegal trade cannot be sustained The Malayan box turtle (MBT) is the most common and its negative impact has already been reflected hard-shelled chelonian turtle species in Asia, with through a series of collapses in regional turtle stocks extensive habitats across Malaysia, Indonesia, India, in several countries (Fund 2002). Furthermore, the Bangladesh, Thailand, Myanmar, Vietnam, turtle materials in food chains and medicines involve Philippines, Singapore, Laos and Cambodia (Schoppe both health and social risks because these animals are 2008; Schoppe & Das 2011). It belongs to the Cuora natural scavengers of waste materials and hosts of genus, which encompasses a total of 12 turtle species, several microbes and heavy metals (Aguirre et al. all of which have habitats across the Asian peninsulas 2006; Magnino et al. 2009), and they are also prohib- (Spinks et al. 2012). Unfortunately, all the Cuora spe- ited from consumption for Muslims (Ali et al. 2015a). cies are enlisted in the most vulnerable category by the The Malaysian government is also highly committed to IUCN and Appendix II of the CITES database ensure halal ingredients in foods and medicines. (Schoppe 2008). Each year, more than 10 million live Therefore, this study focused on the development of Asian box turtles (Cuora) (ABT) are imported into an automated PCR method to determine the low levels southern China from Southeast Asian countries (Fund of MBT tissue expected in foods and traditional 2002), and the Taiwan statistical report revealed that medicines. more than 120 metric tons of turtle shells were Animal materials in the food chain may be authen- imported between 1992 and 1998 from mainland ticated using protein- (Ayaz et al. 2006; Karabasanavar China (Lo et al. 2006), indicating overhunting of et al. 2014), lipid- (Ghovvati et al. 2009) and DNA- Cuora species is rampant across Asia. (McKenna et al. 2010) based analytical techniques; but Since 2005, the Malaysian government and DNA-based molecular schemes have evolved as the Department of Wildlife and National Parks method of choice because of the exceptional stability, (PERHILITAN) of Malaysia have jointly banned the uniformity and polymorphic features of the DNA export of MBT and other turtle species to other coun- molecule itself. The short-length mitochondrial DNA tries. However, the MBT species is extensively captured biomarkers are especially important because of DNA’s by local hunters for the meat, shells and bones for stability attributes, maternal origin, abundance in mul- trades in local and international markets. The burgeon- tiple copies per cells and additional protection given by ing demands in local and international markets also the specialised mitochondrial membranes (Ali et al. might encourage illegal trafficking of MBT and other 2014). Several DNA-based approaches such as spe- turtles and could be used in meat products and tradi- cies-specific PCR (Hsieh et al. 2003; Yan et al. 2005; tional medicines (Schoppe 2008; Rashid et al. 2015; Ali Karabasanavar et al. 2014; Davy et al. 2015), multiplex et al. 2015a). Recently, a huge amount of illegal fresh PCR (Ghovvati et al. 2009; Ali et al. 2015b), PCR water turtle meats was seized at Karachi seaport by the product sequencing (Lo et al. 2006; McKenna et al. Pakistani customs department while being trafficked as 2010), PCR-restriction fragment length polymorphism fish meat for Hong Kong (Woodhouse 2015). (PCR-RFLP) (Rashid et al. 2015), randomly amplified Concomitantly, Malaysian police and customs depart- polymorphic DNA (RAPD) (Saez et al. 2004), real-time ments seized 10,000 turtle eggs in Sabah in 2008 and PCR (Rojas et al. 2011; Davy et al. 2015; Safdar & 4.3 metric tons of reptiles including lizards, snakes, Junejo 2015) and DNA barcoding (Ardura et al. 2010; freshwater turtles and tortoises at the Thailand– Liu et al. 2013) have been proposed for both forensic Malaysia border area in 2010 (Anonymous 2008). It and archaeological studies. However, conventional provided a strong piece of evidence about the black PCR-based molecular techniques have several limita- market trades of turtle and other reptile species in tions, such as poor sensitivity, short dynamic range, Malaysia and other Asian countries (Bk 2010). An low resolution, poor precision, lack of automation and experimental study in an Australian university revealed quantitative results. In contrast, real-time PCR techni- that 92% of the examined traditional Chinese medicine ques offer speed, automation, greater resolution, repro- (TCM) samples are contaminated with heavy metals, ducibility, target quantification, extraordinary leopard and others endangered species (Coghlan et al. sensitivity and real-time monitoring (Rojas et al. 2015). Another study in Taiwan reported that plastrons 2011; Soares et al. 2013; Safdar & Junejo 2015). of MBT are used in traditional Chinese medicines Mainly two types of fluorescence chemistries are (Schoppe 2008; Chen et al. 2009). Furthermore, the adopted in real-time PCR identification; firstly, a recent newspaper report of turtle egg consumption by probe-based approach such as TaqMan (Druml et al. a Malaysian minister is particularly alarming because it 2015a) and molecular bacon (Hadjinicolaou et al. 2009) FOOD ADDITIVES & CONTAMINANTS: PART A 1645 probes; and secondly, double-stranded DNA intercalat- sequencing. All samples were transported under ice- ing dye chemistry such as Eva Green (Safdar & Junejo chilled and stored at –20°C until DNA extraction. 2015) and SYBR Green (Soares et al. 2013). The use of For the determination of LOD and LOQ in pro- DNA intercalating dyes such as SYBR Green has found cessed meat products, approximately 50–60 g of favour over probe-based techniques because of their MBT, chicken and beef muscle tissues were sterilised low cost, simplified design and easier operation at 120°C under 45 psi pressure for 2.5 h on three (Kubista et al. 2006). To the best of our knowledge, different days. The autoclaved samples were cooled to no real-time or SYBR Green PCR assays have been RT and stored at –20°C until DNA was extracted. documented for MBT identification and quantification To simulate commercial matrices, two types of binary in the food chain and TCMs. Therefore, the objective mixtures, namely, MBT–chicken and MBT–beef, were of this study was to develop a SYBR Green duplex real- made into a 100 g specimen by spiking MBT muscle tissue time PCR system consisting of an MBT target and an at a 10%, 1%, 0.1%, 0.01% and 0.001% portion into the internal positive control for all eukaryotes, wherein the adjusted amount of ground chicken and beef following Ali internal control would eliminate any false-negative et al. (2012) and Rashid et al. (2015). Sufficient (50– detection and the species-specific target would perform 100 ml) sterile PBS (136 mM NaCl, 1.4 mM KH2PO4, authentic MBT identification and quantification. 8.09 mM Na2HPO4.12H2O and 2.6 mM KCl, pH 7.2) was added into the admixtures and briskly grounded with a blender to obtain a homogenous semi-solid slurry. Only Materials and methods one mixture was made at a time to avoid contamination. A total of 50–60 g of each admix were sterilised at 120°C Sample collection and processing under 45 psi pressure for 2.5 h to check the thermal effect To trace MBT materials in the food chain, ethical on the target DNA fragmentation. Finally, DNA was clearance was received from the University of extracted from all raw and heat-processed binary admix- Malaya’s Ethical Committee for animal uses and the tures and stored at –20°C until further use. Department of Wildlife and National Park Malaysia (PERHILITAN). Permission was sought to study 22 Collection and preparation of meat products turtle and tortoise species, but approval was given for five species which were Malayan box turtle (Cuora A total of 189 commercial meat products (21 × 9) of 21 amboinensis) (MBT), pond slider turtle (Trachemys different brands (Table 1) including chicken and beef scripta) (PST), Malayan soft-shell turtle (Dogonia meatballs, burgers, and frankfurters were collected and suplana) (MST), yellow-headed temple turtle cross-tested against the MBT-specific primers. Reference (Heosemys annandalii) (YTT) and elongated tortoise samples for each of chicken and beef meatballs, burgers, (Indotestudo elongate) (ET). However, only MBT and and frankfurters were prepared following Rahman et al. PST specimens were obtained from a commercial mar- (2015) and Ali et al. (2012). The negative controls were ket (Pasar Borong, Pudu Raya, Kuala Lumpur, prepared using pure deboned chicken and beef meat Malaysia). Raw muscle tissues of chicken (Gallus gal- along with fats and other culinary ingredients. Positive lus), cow (Bos taurus), goat (Capra hircus), pig (Sus controls were made by spiking 10%, 1%, 0.1%, 0.01% and scrofa domestica), pigeon (Columba livia), sheep (Ovis 0.001% of MBT ground meat into different dummy meat aries), duck (Anas platyrhychos), buffalo (Bubalus products (Table 1). Culinary salt, garlic and other ingre- bubalis), giant river prawn (Macrobrachium rosenber- dients (Table 2) were added, vigorously blended into a gii), Atlantic cod (Gadus morhua), salmon (Salmo homogenous mesh and used to make meatball, burger salar) and carp (Cyprinus carpio) were procured from and frankfurter products (Razzak et al. 2015). All sam- Pasar Borong, Pudu Raya, Kuala Lumpur, and Selangor, ples were prepared in triplicate on three different days Malaysia, on three different days to increase the genetic with a change of operators. Finally, the reference meat diversity in collected specimens. Dog (Canis lupus famil- products of each mixture were autoclaved at 120°C iaris), cat (Felis catus), rat (Rattus rattus) and venison under 45 psi pressure for 2.5 h. All raw and heat-treated (Odocoileus virginianus) samples were donated by meat products were stored at –20°C until DNA extrac- Dewan Bandaraya Kuala Lumpur (DBKL), Malaysia. tion was accomplished. Monkey (Macaca fascicularis) meat was a gift from PERHILITAN. Wheat (Triticum aestivum)andcucum- DNA extraction ber (Cucumis sativus) samples were purchased from local groceries. The species identities were authenticated Total genomic DNA was extracted from 30 mg of pure, by veterinary and fisheries experts and confirmed by processed and admixed meat, meat product and fish 1646 ASING ET AL.

Table 1. Analysis of reference and commercial meat products using the Malayan box turtle (MBT)-specific PCR assay. Items Day 1 Day 2 Day 3 Malayan box turtle DNA detection Detection accuracy (%) Meat products Pure chicken meatball 3 3 3 0/9 100 Pure beef meatball 3 3 3 0/9 100 MBT spiked with chicken meatball 9 9 9 27/27 100 MBT spiked with beef meatball 9 9 9 27/27 100 Pure chicken burger 3 3 3 0/9 100 Pure beef burger 3 3 3 0/9 100 MBT spiked chicken burger 9 9 9 27/27 100 MBT spiked beef burger 9 9 9 27/27 100 Pure chicken frankfurter 3 3 3 0/9 100 Pure beef frankfurter 3 3 3 0/9 100 MBT spiked with chicken frankfurter 9 9 9 27/27 100 MBT spiked with beef frankfurter 9 9 9 27/27 100 Commercial chicken meatball A 3 3 3 0/9 100 B 3 3 3 0/9 100 C 3 3 3 0/9 100 D 3 3 3 0/9 100 Commercial beef meatball E 3 3 3 0/9 100 F 3 3 3 0/9 100 G 3 3 3 0/9 100 H 3 3 3 0/9 100 Commercial chicken burger I 3 3 3 0/9 100 J 3 3 3 0/9 100 K 3 3 3 0/9 100 L 3 3 3 0/9 100 Commercial beef burger M 3 3 3 0/9 100 N 3 3 3 0/9 100 O 3 3 3 0/9 100 Commercial chicken frankfurter P 3 3 3 0/9 100 Q 3 3 3 0/9 100 R 3 3 3 0/9 100 Commercial beef frankfurter S 3 3 3 0/9 100 T 3 3 3 0/9 100 U 3 3 3 0/9 100

tissue samples using Yeastern Genomic DNA Mini Kit (Yeastern Biotech Co., Ltd, Taipei, Taiwan). DNA from Table 2. Formulation of reference samples. Meatball Burger Frankfurter plant sources was extracted following Ma et al. (2000). (≥ 50 g/piece) (≥ 100 g/piece) (≥ 80 g/piece) The concentration and purity of all extracted DNA Ingredients Beef Chicken Beef Chicken Beef Chicken were determined with a NanoDrop ND-100 spectro- Minced meat 33 ga 33 ga 70 ga 70 ga 55 ga 55 ga photometer (NanoDrop Technologies Inc., Soy protein 5 g 5 g 10 g 10. g 10 g 10 g Starch/breadcrumb 6 g 6 g 8 g 8 g 7 g 7 g Montchanin, DE, USA) based on absorbance at Chopped onionb 2g 2g 4g 4g 2g 2g 260 nm and purity ratio (A260/280). The purified b Chopped ginger 0.2 g 0.2 g 0.4 g 0.4 g 0.2 g 0.2 g genomic DNA was kept at –20°C until further used. Cumin powderb 1g 1g 1g 1g 1g 1g Garlic powderb 0.5 g 0.5 g 1 g 1 g 0.5 g 0.5 g In contrast to the meat and meat products, the Black pepperb 0.15 g 0.15 g 0.3 g 0.3 g 0.2 g 0.2 g concentration of the extracted DNA from herbal jelly Tomato paste 1.5 g 1.5 g 2.5 g 2.5 g 2 g 2 g – –1 Butter 1.5 g 1.5 g 2.5 g 2.5 g 2.5 g 2.5 g powder samples (30 mg) was 20 25 ng µl and the Egg 1 g 1 g purity of the genomic DNA was 1.80–1.90% (data not Salt SA SA SA SA SA SA Othersc SA SA SA SA SA SA shown); this might relate to the presence of multiple Notes: a10%, 1%, 0.1%, 0.01% and 0.001% of MBT meat was added with a components such as polysaccharides that may not con- balanced amount of minced chicken and beef to make ≥ 50, 100 and tain DNA. Furthermore, the various plant and animal 80 g specimen of each meatball, burger and frankfurter, respectively. bAmounts are in approximate values and some items were taken in materials might contain inhibitors; also, processing teaspoon measurements. procedures such as drying and stewing definitely cEnhancers and flavouring agents. SA, suitable amounts. degrade DNA to variable extents. We also encountered difficulties in dissolving herbal jelly powder samples FOOD ADDITIVES & CONTAMINANTS: PART A 1647 that frequently precipitated during DNA extraction with 18.2 Ω Millipore water). The PCR reaction was process. This was not a surprise since TCM prepara- run on a QuantStudio® 12 K Flex Real-Time PCR tions often involve decoction methods that extensively System (Applied Biosystems, Thermo Fisher modify the natural composition and textures of the Scientific). Cycling conditions were 10 min initial source ingredients, bringing in many excipient species. denaturation at 95°C and 40 cycles were as 95°C for Therefore, the DNA extraction method was modified 15 s, 58°C for 1 min and 72°C for 30 s. The melting by increasing lysis time in GT buffer and prolonging curve analysis was programmed to form a slope binding time to the nitrocellulose membrane in a GD between 70 and 94°C by raising 1°C at each step. The column using GBT buffer (Yeastern); using this mod- program waits for 118 s of pre-melt conditioning on ified protocol, 100 of 120 jelly powder samples were the first step and 5 s for each step afterwards. Each dissolved and DNA was extracted successfully. reaction was performed in triplicate using two different instruments, reagents and operators.

Design of oligonucleotide primers MBT-specific PCR primers were designed and Melting curve analysis described as in an earlier report (Ali et al. 2015a) and The melting temperatures (Tm) of the amplified DNA specificity was ensured by three different tools. Firstly, targets of pure, binary admixture, laboratory-made selected primer pairs were tested in the NCBI basic references and commercial meat products were deter- local alignment algorithm search tool (BLAST) and mined by melting curve analysis using ExpressionSuite similarity and dissimilarity indexes were carefully eval- software (version 1.0.4., Life Technologies, Thermo uated. Secondly, they were multiple-aligned against 28 Fisher Scientific). The specific location of the Tm different species, including eight species of Cuora was obtained by plotting the variation in fluorescence genus using clustalW and MEGA 5 software to com- (dF/dT) against the temperature of the reaction pare the number of mismatches in the primer anneal- products. ing regions. The designed primers were purchased from the 1st Base Laboratories Sdn. Bhd. (Selangor, Malaysia). Lastly, the final MBT specificity was confirmed by a practical PCR run in the presence of the Construction of a standard curve and target target and 20 different non-target species, as cited quantification above. The chances of any false-negative detection Two standard curves were constructed with 10-fold were eliminated by using an endogenous positive con- serially diluted DNA obtained from a binary admixture trol which amplified a 141-bp site of a eukaryotic 18S of 50% pre-heat-treated MBT spiked into beef and rRNA gene (Rojas et al. 2010; Ali et al. 2012). Primer chicken, respectively. Initially the extracted total DNA – sequences and target product sizes are given in Table 3. of the binary mixtures was made into 100 ng µl 1 and then serially diluted using nuclease-free water in ratios of 1:10, i.e., 1:101, 1:102, 1:103, 1:104, 1:105 and 1:106. PCR optimisation The calibration curves for MBT and total meat of the The real-time PCR assay was optimised and executed binary admixture (MBT–beef and MBT–chicken) were in a 20 μl reaction mixture (20 µl per reaction) contain- obtained by plotting the respective Ct values against the ing 10 µl Power SYBR Green PCR Master Mix (Applied logarithmic concentration of MBT DNA (duplex real- Biosystems, Foster, CA, USA; Thermo Fisher Scientific, time PCR assay) and total meat DNA, respectively. The Foster, CA, USA), 1.5 µl forward primer (150 nM), 1.5 concentration of MBT DNA and total meat DNA was µl reverse primer (150 µM) and 3 µl template DNA (10 calculated using equations (1) and (2) and the MBT ng) and 4 µl of nuclease-free water. Negative template contribution in an unknown specimen was calculated control was made by using nuclease-free water (PCR using equation (3) following the modified method of reaction mixture without template DNA and replaced Druml et al. (2015b):

Table 3. Oligonucleotide primers used in the assay. Target gene Primer Sequence (5´–3´) Amplicon (bp) Reference Cyt b MBT-F AGCCCTTCTAACATCTCTGCTC 120 bp MBT-R CTCACCAGACATCTCACTAGCA 18S rRNA Euk-F GGTAGTGACGAAAAATAACAATACAGGAC 141 bp Rojas et al. (2011) Euk-R ATACGCTATTGGAGCTGGAATTACC 1648 ASING ET AL.

½ðÞ = ð Þ DNAðÞ MBT ðÞ¼ng=μL 10 Ctspec dspec slope spec (1) chicken), and various percentages of MBT tissues (10%, 1%, 0.1% and 0.001% (w/w)) contaminated in ðÞðÞ¼=μ ½ðÞCeukdeuk =slopeðeukÞ DNA Totalmeat ng L 10 laboratory-made references and commercial meat pro- (2) ducts (chicken and beef meatballs, burgers, and frankfurters) (Table 1). The LOD was defined as the lowest where Ctspec and Ceuk are Ct values obtained with MBT concentration that resulted in an increase in fluores- specific and eukaryotic(18S rRNA gene) systems real- cence signal by at least seven out of eight replicates time PCR assay, respectively; dspec and deuk are inter- within 38 cycles of the PCR. Quantification was per- cepts from the standard curves; and slopespec and slo- formed based on an MBT target and eukaryotic control peeuk are the slopes of the standard curves for the system corresponding to the MBT and total meat. MBT-specific and eukaryotic PCR systems, In other words, the quantity of the target DNA in respectively. samples (binary admixture and reference meat pro- ng ducts) was determined using the normalised Ct value MBT DNA μL MBT meat contentðÞ¼% X 100 fitted into a calibration curve followed by statistical ng total meat DNA μL analysis. Data obtained from an SYBR Green duplex real-time PCR assay was analysed by Expression Suite (3) software (version 1.0.4., Applied Biosystems, Thermo Fisher Scientific, USA) and Microsoft Office Excel Amplification efficiency 2007. One-way analysis of variance (ANOVA) using SPSS software (version 16.0, IBM, Chicago, IL, USA) The amplification efficiency (E) of the real-time PCR was performed to assess the significant differences in assay was determined by analysing the DNA extract the mean values of different samples. Comparisons – obtained from MBT at various concentration (100 ng between mean values were made using Tukey’s com- –1 1.0 pg µl ). Amplification efficiency was extrapolated parison test (p < 0.05). Under experimental conditions, from the slope of the best fitted line in the standard the LOQ reflected the lowest concentration of the curve and also calculated using equation (4). The targets in complex matrices (Table 4) (FAO CAC/GL accepted benchmark of the efficiency was 99–100%, 74-2010). The assay reproducibility was confirmed by – – which corresponded to a slope between 3.31 and analysing 125 reference samples using two different 3.34 and correlation ≥ 0.997: hi DNA extraction kits (Yeastern Genomic kit), and ½ = NucleoSpin® Extraction Kit (Macherey-Nagel, Düren, E%½¼10 1 Slop 1 x 100 (4) Germany), two different PCR master mix (SYBR Green PCR Master Mix (Applied Biosystems, Thermo Fisher Scientific, USA) and GoTaq® qPCR Master Mix Limits of detection (LOD) and quantification (LOQ) (Promega Corporation, Madison, WI, USA)), two dif- and reproducibility ferent PCR instruments (QuantStudio® 12 K Flex Real- The lower LOD of the assay was determined using Time PCR System (Applied Biosystems, Thermo Fisher serially diluted DNA (100, 10, 1, 0.1, 0.01, 0.001, Scientific, USA) and CFX96 TouchTM, Hercules, CA, 0.0001 and 0.00001 ng) extracted from pure meat tis- USA, Bio-Rad, Hercules, CA, USA) with two different sues, a binary admixture (MBT–beef and MBT– analysts on three different days.

Table 4. PCR efficiency and limits of detection (LOD) and quantification (LOQ) of Malayan box turtle (MBT)-specific SYBR Green PCR for the admixed and reference meat products of chicken and beef origins. Samples Efficiency (%) Slope R2 LOD (spiking level,%) LOQ (ng µl–1) Mean LOQ (ng µl–1) Binary (MBT–chicken) 99 –3.33 0.998 0.001 0.00158 0.0017 Binary (MBT–beef) 100 –3.32 0.998 0.001 0.00183 Chicken meatball 99 –3.33 0.998 0.001 0.00257 0.0022 Beef meatball 99 –3.34 0.998 0.001 0.00200 Chicken burger 100 –3.34 0.997 0.001 0.00162 0.0019 Beef burger 99 –3.34 0.988 0.001 0.00234 Chicken frankfurter 100 –3.32 0.998 0.001 0.00148 0.0019 Beef frankfurter 100 –3.31 0.998 0.001 0.00234 FOOD ADDITIVES & CONTAMINANTS: PART A 1649

Results and discussion through the specific Tm for each target. Two different peaks at 74.63 ± 0.22 and 78.40 ± 0.31°C in a Optimisation of the duplex PCR system single melting curve were the obvious representation A novel SYBR Green duplex real-time PCR system of MBT and eukaryotic positive control, respectively for MBT detection was developed by combining two (Ririe et al. 1997; Varga & James 2006)(Figure 1). sets of primers specific for MBT cytb (120 bp) and universal eukaryotic 18S rRNA (141 bp). Initially a Selectivity of the real-time PCR assay singleplex PCR system was optimised and Ct values were recorded using DNA templates extracted from Cross-reactivities of the deigned primers were checked meat, skin, shell and bone tissues of MBT and cross- using the duplex PCR system wherein the MBT primers tested against 20 non-target species (Table 5). were challenged against the DNA templates of 20 different Subsequently, the duplex system was established by species including the PST (Trachemys scripta accession: primers for the internal control. However, no signifi- NC_011573.1), chicken (Gallus gallus accession: cant differences in Ct values were observed between KP269069.1), cow (Bos taurus accession: GU947021.1), the two systems. In order to eliminate any non-spe- goat (Capra hircus accession: KR059217.1), pig (Sus scrofa cific detection of SYBR Green PCR signal that might domestica accession: AP003428.1), pigeon (Columba livia come from the formation of primer dimers and any accession: KP168712.1), sheep (Ovis aries accession: other non-specific products (Kubista et al. 2006), NC_001941.1), duck (Anas platyrhychos accession: melting curve analysis of the post-PCR samples was EU755253.1), buffalo (Bubalus bubalis accession: executed by plotting the variation in fluorescence as a NC_006295.1), giant river prawn (Macrobrachium rosen- function of time (dF/dT) against the melting (Tm) bergii accession: NC_006880.1), dog (Canis lupus familiaris temperature of the reaction products. Since Tm accession: KF907307.1), cat (Felis catus accession: depends on the length, base composition (GC/AT NC_001700.1), rat (Rattus rattus accession: ration) and concentration of the target sequences, NC_012374.1), monkey (Macaca fascicularis accession: the amplified PCR products for MBT (120 bp) and NC_012670.1), venison (Odocoileus virginianus accession: eukaryotic target (141 bp) were clearly differentiated KM612279.1), Atlantic cod (Gadus morhua accession:

NC_002081.1), salmon (Salmo salar accession: NC_001960.1), carp (Cyprinus carpio accession: Table 5. Specificity and Ct values of the SYBR Green duplex KU050703.1), wheat (Triticum aestivum accession: real-time PCR assay. NC_007579.1) and cucumber (Cucumis sativus accession: Malayan box Eukaryotic (18S NC_016005.1); but no cross-reactivities were observed turtle-specific rRNA)-positive (Table 5). While the amplification signals (Ct values) of PCR system control system the MBT-specific PCR for the MBT-containing samples Ct value and standard deviation – ≥ Samples (±) were 17 21, Ct values of the other species were 38 in a Malayan box turtle raw meat 17.40 ± 0.27 18.20 ± 0.23 40-cycle PCR reaction (Table 5 and Figure 1). On the other Malayan box turtle sterilised meat 20.56 ± 0.34 20.01 ± 0.23 hand, the endogenous Ct values for all samples were found Malayan box turtle raw skin 18.40 ± 0.29 18.30 ± 0.40 Malayan box turtle raw shell 20.12 ± 0.29 19.20 ± 0.29 to be 18–22; this reflected the presence of good-quality Malayan box turtle sterilised skin 21.61 ± 034 20.50 ± 0.38 DNA in all specimens but eliminated the possibilities of Malayan box turtle bone 20.20 ± 0.38 20.09 ± 0.50 Pond slider turtle meat 38.34 ± 0.11 18.02 ± 0.20 potential false-negative detection. The slight variation Chicken 38.20 ± 0.23 19.30 ± 0.34 found for of Ct values (17–21) for the meat, skin, bone Goat 40.00 21.03 ± 0.24 Pig 38.02 ± 0.23 18.40 ± 0.38 and shell tissues of the MBT could be attributed to heat, Pigeon 40.00 20.04 ± 0.28 pressure, physical stresses, variable copies of mitochondrial Sheep 39.02 ± 0.27 18.30 ± 0.36 DNA and presence of various inhibitors in different tis- Venison 39.05 ± 0.34 24.04 ± 0.49 Rat 40.00 23.40 ± 0.21 sues. In some instances, negative controls yielded a positive Cat 40.00 17.90 ± 0.31 signal at 38.5 cycles and, thus, it was inferred that any Ct ≥ Dog 38.98 ± 0.23 22.60 ± 0.31 Duck 38.90 ± 0.40 19.20 ± 0.22 38 was non-specific for the MBT targets (Table 5). Cow 39.50 ± 0.23 20.50 ± 0.23 The specificity of the duplex assay was further con- Monkey 39.50 ± 0.21 19.20 ± 0.23 Buffalo 38.92 ± 0.32 18.30 ± 0.21 firmed by the melting curve wherein two distinctive Prawn 39.04 ± 0.02 19.11 ± 0.14 peaks at 74.63 ± 0.22 and 78.40 ± 0.31°C were the clear Salmon fish 39.50 ± 0.23 25.30 ± 0.23 Cod fish 39.02 ± 0.42 19.42 ± 0.22 signatures for MBT (120 bp) and endogenous positive Carp fish 40.00 23.20 ± 0.15 control (141 bp), respectively (Ririe et al. 1997; Varga Cucumber 39.97 ± 0.31 22.41 ± 0.31 & James 2006)(Figure 1). Several factors such as dye Wheat 40.00 21.02 ± 0.11 types and concentrations, primer dimers, unpredicted 1650 ASING ET AL.

Figure 1. Specificity of Malayan box turtle (MBT) specific primers against 20 different species. Shown are lane L = ladder DNA; and lanes 1–21 = PCR products from MBT target (120 bp) and eukaryotic endogenous control (141 bp). MBT-specific product was amplified only from MBT (lane 1), but endogenous control was amplified from all species (lanes 1–21): MBT, pond slider turtle, chicken, sheep, goat, cow, water buffalo, deer, pig, duck, pigeon, dog, monkey, cat, rat, salmon fish, carp fish, cod fish, prawn, wheat and cucumber, respectively. The inset is the melting curve of the SYBR Green PCR for MBT and endogenous control. amplicons, inhibitors and variations in melting pro- Secondly, the validation was performed with mixed grams might result in false-positive outcomes DNAs of MBT using six types of heat-treated (severely (Hennenfent & Herrmann 2006; Varga & James autoclaved) binary admixtures (Figure 2) and reference 2006). Thus, the duplex PCR products were detected meat products (chicken and beef meatballs, burgers in 2% agarose gel which clearly reflected MBT (120 bp) and frankfurters) (Figure 3), and clear signals were and universal eukaryotic product (141 bp), eliminating detected until 0.001% (w/w) MBT contamination. The the doubts of any false-negative detection (Figure 1). amplification signals (Ct values) were in the range of 31.80 ± 0.20 to 33.12 ± 0.12 for 0.001% of MBT in various specimens (Tables 6 and 7). The melting curves

reflected target products from MBT and internal con- LOD and LOQ trol at 74.63 ± 0.22 and 78.40 ± 0.31°C, respectively. The LOD of an assay plays critical roles in the deter- Since the Ct for the 0.001% MBT mix was 33.10 ± 0.12 mination of marginal-level targets in adulterated food- or far below the LOD (≥ 38.5), the assay could be used stuffs. Thus, the LOD of this study was confirmed by to detect MBT materials in food items at levels much two different indices. Firstly, the concentration of the lower than 0.001% (Figures 2 and 3). – pure meat DNA was measured at ≥ 100 ng µl 1 The lower LOQ was determined from the linear (Biochrom Libra S70, Biochrom Ltd, Cambridge, UK) correlation of the logarithm of DNA concentration and then various concentrations such as 100 (100%), and the Ct value obtained from binary admixtures 10, 1, 0.1, 0.01, 0.001, 0.0001 and 0.00001 ng and laboratory-made reference meat products (0.00001%) were made by a 10-fold serial dilution (Figures 2(a) and 3(a)). The contents of MBT and using nuclease-free deionised distilled water, because total DNA in unknown food samples were calculated inaccuracies and inconsistencies were observed in spec- from the standard curve for MBT (cytb) and reference trophotometric readings when low concentrations (≤ eukaryotic (18S rRNA gene) control. The Ct values of – 10 ng µl 1) were used. Ct (threshold cycle) responses of the analysed samples were normalised against the these series of diluted DNA were measured using the admixture standard curve and plotted against the loga- duplex real-time PCR system and signal (Ct) was rithmic concentrations of the spiked MBT in binary detected with as low as 0.00001 ng DNA template at admixtures and laboratory-made reference meat pro- 38 ± 0.12 cycles (data not shown). This amplification ducts. This resulted in a linear standard curve in the signal was close to that of the negative control range of 10% to 0.001% (Figures 2(a) and 3(a)) with (≥ 38.50 ± 0.35 cycles) in the 40-cycle PCR system. slopes that ranged between –3.31 and –3.34, which Furthermore, several researchers concluded that the resulted in PCR efficiencies (E%) between 99% and highest limit should be set at 38 cycles in the Applied 101%; these were very close to the ideal value (100%) Biosystems SYBR Green PCR Master Mix in order to that comes from a slope of –3.32. These were further eliminate the possibility of any false-positive detection reflected by a correlation coefficient (R2 ≥ 0.998), that may come from the cross-reactivity or primer which was close to unity (Table 4 and Figures 2(a) dimer formation (Druml et al. 2015a). and 3(a)). Finally, the lowest concentrations that were FOOD ADDITIVES & CONTAMINANTS: PART A 1651

(a) (b)

(c)

Figure 2. Standard (a) and melting (b, c) curves for binary admixtures. In standard curve (a) are shown the recovery of MBT DNA from MBT–beef (1) and MBT–chicken (2) binary admixtures containing 10, 1, 0.1, 0.01 and 0.001% (w/w) MBT tissues with the balanced amount of beef and chicken, respectively. (b, c) The melting curves for (1) and (2) showing the distinctive peaks at 75.20 ± 0.22 and 80.02 ± 0.31°C for MBT (120 bp) and endogenous (141 bp) targets.

recovered from the admixtures and reference meat reference meatball, burger, and frankfurter products, products were between 0.00148 and 0.00257 ng, which does not cause a systematic error in MBT quan- which arose from 0.001% MBT spiked into the samples tification. Furthermore, the repeatability of this assay (Table 4). While recoveries in reference meat products was investigated with two different DNA-extraction containing 10% to 1% MBT meat were 93.25–111.51%, kits, PCR master mixes and PCR machines along with they were 140.25–153.00% for 0.001% MBT contami- a change of analyst on three independent days (Tables nation, suggesting some degrees of inaccuracies at 6–8). The results indicated that these external variables lower concentrations (Tables 6 and 7). Earlier studies such as operator, DNA extraction kit, PCR master mix also reflect a higher percentage (158%) of recovery at and PCR instrument do not influence the final results; lower concentration (Druml et al. 2015b). However, instead, all these indicate the assay reliability and when real-time PCR-recovered values (y-axis) robustness under various circumstances. (Table 8) were plotted against the reference value (x- axis), a calibration model was found with a very high correlation coefficient (R2 = 0.999) (Figure 4). The Product analysis deviation from the reference values at lower concentrations most probably resulted from the unequal distri- In order to validate the real-time technique for screen- butions of the trace amount of contaminated meat or ing meat adulteration in food products, deliberately higher error in the preparation of reference samples adulterated reference meat products (chicken and beef (Druml et al. 2015b). However, since most of the frau- meatballs, frankfurters and burgers) were prepared (Ali dulent mixing takes place at higher concentrations in et al. 2012, 2015a; Razzak et al. 2015) having 10%, 1%, order that companies may make extra profit, a little 0.1%, 0.01% and 0.001% contribution from ground inaccuracy at lower level contamination does not prac- MBT meat. All meat products were autoclaved at 120° tically hinder assay applicability since detection was C under 45 psi pressure for 2.5 h on three different performed at all concentrations (Moore et al. 2012). days to address the stability issues when denaturated Tables 6 and 7 reflect a high content of MBT (10%) in (Figures 3(b)–(f)) since this thermal treatment was 1652 ASING ET AL.

(a) (b)

(e) (f)

(g)

Figure 3. Standard (a) and melting (b–g) curves for chicken (b–d) and beef (e–g) meat products. In standard curve (a) are shown the recovery of MBT DNA from chicken (1–3) and beef (4–6) meatball (1, 4), burger (2, 5) and frankfurter (3, 6) products containing 10, 1, 0.1, 0.01 and 0.001% (w/w) MBT tissues, respectively. (b–g) The melting curves for (1) to (6). previously used in food forensic investigations to Ct and Tm values were in the range of 20.60 ± 0.42 to benchmark target biomarker stability (Arslan et al. 33.12 ± 0.32 (Tables 6 and 7) and 74.60–74.65 ± 0.22°C 2006; Ilhak & Arslan 2007; Haunshi et al. 2009). The (Figures 3(b)–(g)), respectively, for all the reference

Table 6. Repeatability and recovery of Malayan box turtle (MBT) targets in reference meat products using an Yeastern Genomic DNA Mini Kit. Spike level: 10% Spike level: 1% Spike level: 0.1% Spike level: 0.01% Spike level: 0.001`% Mean Mean Mean Mean Mean Ct Ct RSD Recovery Systematic Ct Ct RSD Recovery Systematic Ct Ct RSD Recovery Systematic Ct Ct RSD Recovery Systematic Ct Ct RSD Recovery Systematic Meat product value value (%) (%) error (%) value value (%) (%) error (%) value value (%) (%) error (%) value value (%) (%) error (%) value value (%) (%) error (%) Chicken 22.80 22.38 0.52 101.00 1.10 24.60 24.70 0.56 111.51 11.51 26.90 27.70 1.69 123.10 23.10 30.00 30.38 0.69 132.80 32.80 32.50 32.38 0.45 140.25 40.25 meatball 23.10 24.70 27.50 30.30 32.80 22.10 24.80 28.30 30.50 33.20 21.90 24.50 27.90 30.60 32.40 22.00 24.90 27.90 30.50 31.00 Chicken 20.30 21.16 1.5 95.8 –4.20 23.30 23.32 0.51 105.30 5.30 27.00 26.76 1.50 119.11 19.11 29.00 28.62 0.80 125.00 25.00 32.00 32.56 1.40 141.11 41.11 burger 20.30 23.20 26.00 28.50 32.40 22.10 23.50 26.70 28.60 32.80 21.70 23.40 27.10 28.30 32.40 21.40 23.20 27.00 28.70 33.20 Chicken 20.10 20.60 0.76 93.25 –6.75 24.00 24.06 1.00 108.62 8.62 27.80 27.56 0.80 122.66 22.66 29.60 29.58 0.74 130.00 30.00 33.20 32.60 0.90 141.12 41.12 frankfurter 20.40 24.50 27.50 30.00 32.40 21.30 23.80 27.80 29.40 32.00 20.10 23.90 27.20 29.40 32.40 21.10 24.10 27.50 29.50 33.00 Beef meatball 23.10 22.62 0.714 107.71 7.71 24.20 24.18 0.53 110 10 28.00 27.18 2.53 122.00 22.00 30.20 30.08 3.65 140.00 40.00 33.00 33.12 1.43 150.00 50.00 22.50 24.40 26.90 29.00 34.00 22.60 24.20 26.00 30.20 33.50

22.30 24.10 27.40 32.00 32.10 A PART CONTAMINANTS: & ADDITIVES FOOD 22.60 24.00 27.60 29.00 33.00 Beef 20.20 20.20 1.43 96.20 –3.80 24.00 23.82 1.05 108.27 8.27 27.00 27.08 1.50 121.52 21.52 30.00 29.08 1.30 135.34 35.34 32.50 31.80 1.54 144.00 44.00 burger 20.20 23.00 27.50 29.60 32.40 20.20 23.50 26.80 27.90 31.60 20.10 24.30 27.30 29.00 31.30 20.30 24.30 26.80 28.90 31.20 Beef 20.20 21.08 1.7 100.00 0.00 23.50 23.76 1.56 108.00 8.00 27.00 26.50 2.23 119.00 19.00 29.50 30.08 0.81 140.00 40.00 31.30 32.10 1.37 145.24 45.24 frankfurter 21.00 23.50 24.50 30.00 32.50 23.70 23.60 26.90 30.20 32.50 20.20 24.20 26.70 30.50 32.20 20.30 24.00 27.40 30.20 32.00 Note: RSD, relative standard deviation. 1653

1654 SN TAL. ET ASING

Table 7. Repeatability and recovery of Malayan box turtle (MBT) targets in reference meat products using a NucleoSpin® extraction kit. Spike level: 10% Spike level: 1% Spike level: 0.1% Spike level: 0.01% Spike level: 0.001`% Mean Mean Mean Mean Mean Ct Ct RSD Recovery Systematic Ct Ct RSD Recovery Systematic Ct Ct RSD Recovery Systematic Ct Ct RSD Recovery Systematic Ct Ct RSD Recovery Systematic Meat product value value (%) (%) error (%) value value (%) (%) error (%) value value (%) (%) error (%) value value (%) (%) error (%) value value (%) (%) error (%) Chicken 22.00 22.4 0.52 100.00 0.00 24.60 24.3 0.56 106.60 6.60 27.00 27.60 1.69 120.00 20.00 31.00 30.80 0.69 132.00 32.00 32.80 32.54 0.45 140.25 40.25 meatball 21.80 24.00 26.90 31.40 33.10 23.30 23.00 28.30 30.30 31.60 22.40 24.90 28.00 30.90 33.00 22.70 25.00 27.80 30.20 32.20 Chicken 22.00 21.90 1.50 97.33 –2.66 24.00 23.50 0.51 103.07 3.07 27.30 27.02 1.50 117.47 17.47 30.00 31.10 0.80 133.00 33.00 32.60 32.89 1.40 141.37 41.37 burger 21.80 23.8 27.10 39.30 32.70 22.50 23.5 26.80 28.50 32.60 21.70 23.4 26.60 27.90 32.10 21.60 22.9 27.30 29.90 34.00 Chicken 21.60 22.00 0.76 97.80 –2.20 24.00 24.30 1.00 106.60 6.60 27.80 28.20 0.80 122.60 22.60 29.60 30.52 0.74 130.42 30.42 34.10 32.60 0.90 140.51 40.51 frankfurter 22.70 25.00 28.50 29.70 32.40 22.10 24.30 28.90 31.90 31.60 21.50 23.90 27.80 29.50 32.40 21.90 24.50 28.00 31.90 32.50 Beef meatball 23.00 22.82 0.71 105.16 5.16 23.00 24.14 0.53 104.50 4.50 28.50 28.02 2.53 120.25 20.25 31.40 31.34 3.65 146.44 46.44 32.70 33.06 1.43 153.00 53.00 22.30 25.20 27.00 31.00 34.00 23.20 24.40 27.80 30.20 32.10 22.60 23.90 28.30 32.10 33.50 23.00 24.20 28.50 32.00 33.00 Beef 20.60 20.76 1.43 96.00 –4.00 25.30 24.9 1.05 108.00 8.00 28.10 27.80 1.50 119.31 19.31 29.30 29.42 1.30 137.50 37.50 32.50 31.66 1.54 146.57 46.57 burger 21.20 25.50 27.50 29.10 31.00 21.00 25.00 28.00 29.40 31.60 20.40 24.30 28.30 30.30 32.00 20.60 24.50 27.10 29.00 31.20 Beef 22.50 23.10 1.70 106.45 6.45 23.50 23.62 1.56 102.25 2.25 27.00 26.78 2.23 115.30 15.30 29.60 29.60 0.81 138.31 38.31 32.00 32.34 1.37 150.00 50.00 frankfurter 23.00 24.00 25.60 29.60 32.50 23.70 23.60 26.90 30.00 32.00 23.00 23.00 27.20 29.40 32.20 23.30 24.00 27.20 29.30 33.00 Note: RSD, relative standard deviation. FOOD ADDITIVES & CONTAMINANTS: PART A 1655

Table 8. Average recovery of the real-time PCR using 125 reference meat products samples. Spike level: 10% Spike level: 1% Spike level: 0.1% Spike level: 0.01% Spike level: 0.001% Recovery Mean RSD Recovery Mean RSD Recovery Mean RSD Recovery Mean RSD Recovery Mean RSD (%) (%) (%) (%) (%) (%) (%) (%) (%) (%) (%) (%) (%) (%) (%) Yeastern Genomic DNA Mini Kit 101.00 99.00 5.15 111.51 108.61 1.91 123.10 120.00 3.12 132.80 134.56 4.37 140.25 143.62 2.55 95.80 105.30 119.11 125.00 141.11 93.25 108.62 112.66 130.00 141.12 107.71 110.00 122.00 140.00 150.00 96.20 108.27 121.52 135.34 144.00 100.00 108.00 119.00 140.00 145.24

NucleoSpin® DNA Extraction Kit 100.00 100.45 4.33 106.60 105.28 2.03 120.00 119.16 2.10 132.00 136.28 4.30 140.25 145.28 3.77 97.33 103.70 117.47 133.00 141.37 97.80 106.60 122.60 130.42 140.51 105.16 104.50 120.25 146.44 153.00 96.00 108.00 119.31 137.50 146.57 106.45 102.25 115.30 138.31 150.00 Note: RSD, relative standard deviation.

DNA in all specimens (Fajardo et al. 2008). Thus, the experimental as well as the theoretical specificity, stability and sensitivity of this novel assay show it as a reliable and rapid technique for the authentication of MBT materials in the food chain. Malaysia has shown a strong commitment towards the development of halal hub industries and as a competitive partner in the global halal food business. Therefore, the absence of MBT materials in the Malaysian halal food chain was

not a surprise (Ali et al. 2012).

Figure 4. Relationship between the reference and recovery (%). The MBT tissues were determined by SYBR Green duplex PCR Analysis of traditional Chinese herbal jelly powder from various meat products (meatballs, burgers, frankfurters from chicken beef, respectively) and plotted against the refer- The widespread trade in various TCMs, which are ence values. claimed to provide multi-cure and natural remedies to common ailments, has become a disastrous threat to the existence of several wild species, including MBT. meat products, demonstrating that the fluctuations in Although most of them are claimed to be plant pro- assay outcomes were insignificant in response to ducts, several highly endangered species, such as rhi- changes in the extraction kit or other variables. nos, crocodiles, turtles, tigers and elephants, which are Furthermore, 33.12 ± 0.32 Ct for 0.001% MBT in meat- enlisted in the CITES Appendix I and II, have contin- ball, burger and frankfurter products showed that this ued to be killed to supply the raw materials of these novel technique could be used to trace MBT meat in medicines which have a huge market in Southeast Asia the food chain to detect even less than 0.001% (w/w) and Chinese communities around the world (Lee et al. adulteration. 2014). In many cases, enforcement of regulation Finally, a total of 189 samples including eight halal- becomes impossible because the endangered animals branded meatballs (A–H), seven burgers (I–O) and six are sold in forms, such as powder and jellies made frankfurters (P–U) from each of chicken and beef ori- from ground bones, shells and skins, which are difficult gins were screened with the duplex SYBR Green real- to detect by customs officials (Alves & Rosa 2005; Lee time PCR assay (Table 1), but none of the commercial et al. 2014). Herbal jelly powder is a jelly-like Chinese meat products yielded a positive amplification signal medicine traditionally sold and consumed as ‘guiling- for MBT, reflecting the respect for halal products in gao’ or ‘turtle jelly’ or ‘turtle dessert’ among the vast Malaysia. On the other hand, the Ct and Tm values for Chinese communities around the world. In traditional the eukaryotic controls were 17.20 ± 0.32 to belief, herbal jelly is thought to be good for the skin, 23.42 ± 0.25 and 78.40 ± 0.31 to 78.50 ± 0.28°C (data promoting a healthier complexion upon repeated con- not shown), demonstrating the presence of amplifiable sumption. Other positive effects include the 1656 ASING ET AL. improvement in circulation, muscle growth, kidney wherein only the total DNA of the source materials and liver functions, relief of itching and dermatitis was considered and other materials like polysacchar- (Dharmananda 2005; Chen et al. 2009). Herbal jelly is ides and non-DNA biomaterials were not measured made from powdered plastron, which is the bottom (Table 9 and Figure 5). Since herbal products are shell of the turtle Cuora trifasciata, which is commonly regarded as low risk and natural sources for the cure known as ‘three-lined box turtle’ or ‘golden coin turtle’, for many diseases, traditional medicines are not under along with a variety of herbal products such as China stringent regulation. In this regard, the herbal products roots, Smilax glabra, known to contain natural reme- studied here clearly reflect that such declarations are dies for many diseases (Carr 1991; Dharmananda 2005; not correct at all times; the grave concern is that MBT Chen et al. 2009). Despite commercial farming across ingredients were not declared in the labels and that China, the golden coin turtle is extremely expensive most of these preparations were claimed to be plant (Haitao et al. 2008), encouraging the use of more products and hence there were no religious obligations commonly available turtle species in guilinggao or her- since plant products are permitted in all religions. bal jelly powder (Dharmananda 2005; Da Nóbrega Recently, an Australian study found that high rates of et al. 2008; Chen et al. 2009). adulteration (90%), substitution and mislabelling are Considering this, we attempted to screen MBT widespread in herbal TCMs; the undeclared ingredients materials in 100 traditional Chinese jelly powder of were either illegal or potentially hazardous to consu- eight different brands sold in various Chinese medi- mers (Ernst & Coon 2001; Alves et al. 2013; Coghlan cines shops across Malaysia (Table 9). About 22% of et al. 2015). Thus the 22% herbal jelly powder samples the 100 tested products were found to be MBT-posi- tested in our laboratory provided a 100% matching of tive, reflecting the widespread consumption and uses of DNA materials with Cuora amboinensis species, reflect- MBT materials in these medicines, but the information ing a clear breach of wildlife conservation law in the was hidden in the product labels (Table 9). This was preparation and selling of traditional Chinese herbal reflected through the Ct values and melting curves at products (Adeola 1992; Angeletti et al. 1992 ; Alves & 26.37 ± 0.32–28.90 ± 0.42 (data not shown) and 74.63– Rosa 2005). This is also contrary to the regulation of 78.65 ± 0.22°C, respectively. The amount of the con- the United States (USFDA), UK (MHRA) and taminating MBT target in the tested samples was cal- Australia (TGA) (Robinson & Bennett 2000, 2002; culated by plotting the Ct values in the standard curve Bennett et al. 2002), which demand the mandatory and using equations (1) to (3) and it was found in the declaration of product ingredients. Published reports range of 5.37 ± 0.50% to 7.00 ± 0.34% (Table 9), show that wild and domestic animals and their by-

Table 9. Analysis of traditional Chinese herbal jelly powder using a Malayan box turtle (MBT)-specific PCR assay. Code of Number Number of medicinal Information on of detection Contamination items product labelling Product applications samples samples (%) of MBT A Chinese herbal jelly Nocturnal enuresis, anti-inflammation, dessert soup, muscle growth, 15 3/15 5.87–6.37 powder relieving itching, reducing acne and kidney restoration, blood circulation, appetiser B Chinese herbal jelly Nocturnal enuresis, anti-inflammation, dessert soup, muscle growth, 15 2/15 5.48–5.70 powder relieving itching, reducing acne and kidney restoration, blood circulation, appetiser C Herbal jelly powder Nocturnal enuresis, muscle growth, relieving itching, reducing acne and 15 4/15 5.50–7.00 kidney restoration, blood circulation, anti-inflammation, appetiser D Herbal jelly powder Nocturnal enuresis, anti-inflammation, dessert soup, muscle growth, 15 5/15 5.32–7.00 relieving itching, reducing acne and kidney restoration, blood circulation, anti-inflammation, appetiser E Guilinggao powder Pimples, blood circulation, male fertility, strength of knees, nocturnal 15 0/15 0.00 (Chinese herbal jelly enuresis, anti-inflammation, dessert soup, muscle growth, relieving powder) itching, reducing acne and kidney restoration, blood circulation, appetiser F Chinese herbal jelly Gall bladder, hepatitis, herpes, shingles, hyperthyroidism, migraines and 15 6/15 5.90–6.60 powder (guilinggao) jaundice, nocturnal enuresis, anti-inflammation, dessert soup, muscle growth, relieving itching, reducing acne and kidney restoration, blood circulation, appetiser G Guilinggao powder Nocturnal enuresis, anti-inflammation, dessert soup, muscle growth, 15 2/15 6.00 (herbal jelly relieving itching, reducing acne and kidney restoration, blood powder) circulation, appetiser H Chinese herbal jelly Nocturnal enuresis, anti-inflammation, dessert soup, muscle growth, 15 0/15 0.00 powder relieving itching, reducing acne and kidney restoration, blood circulation, appetiser FOOD ADDITIVES & CONTAMINANTS: PART A 1657

endangered species in its natural habitats, preserving the biodiversity and ecological balances.

Acknowledgments

The authors acknowledge the kind gifts of Malayan box turtle, monkey, cat and rat meat samples from the Department of Wildlife and National Parks of Malaysia (PERHILITAN) and Dewan Bandaraya Kuala Lumpur (DBKL).

Disclosure statement No potential conflict of interest was reported by the authors. Figure 5. Melting curve and temperature (Tm) values of traditional Chinese herbal jelly powder. Funding

Asing was paid and the research materials were supported by products, such as hooves, skins, bones, feathers and the University of Malaya [grant number GC001A-14SBS] tusks, are used in the preparation of curative, protec- awarded to M. E. Ali. tive and preventive medicines (Anyinam 1995), causing over-hunting and massive threats to wildlife (Robinson & Bennett 2000, 2002; Bennett et al. 2002). Moreover, References some organs and animal by-products, such as bones Adeola MO. 1992. Importance of wild animals and their and bile, can be a source of Salmonella infection that parts in the culture, religious festivals, and traditional causes chronic diarrhoea and endotoxic shock. In this medicine of Nigeria. Environ Conserv. 19:125–134. context, the possibility of transmitting infections or Aguirre AA, Gardner SC, Marsh JC, Delgado SG, Limpus CJ, ailments from animal preparations should be seriously Nichols WJ. 2006. Hazards associated with the consump- considered (Still 2003). tion of sea turtle meat and eggs: a review for health care workers and the general public. EcoHealth. 3:141–153. Ali ME, Asing, Hamid SBA, Razzak MA, Rashid NRA, Al Amin M, Mustafa S. 2015a. A suitable method to detect potential fraud of bringing Malayan box turtle (Cuora Conclusions amboinensis) meat into the food chain. Food Addit – The duplex SYBR Green real-time PCR system for Contam A. 32:1223 1233. Ali ME, Razzak MA, Hamid SB, Rahman MM, Amin MA, the detection and quantification of MBT materials Rashid NR, Asing. 2015b. Multiplex PCR assay for the in the food chain is a significant contribution to detection of five meat species forbidden in Islamic foods. forensic science and conservation biology. Food Chem. 177:214–224. Distinctive Ct values and melting curves for MBT Ali ME, Razzak MA, Abd Hamid SB. 2014. Multiplex PCR in (120 bp) and eukaryotic control (141 bp) even at species authentication: probability and prospects – A – lower concentrations (0.00001 ng pure DNA or review. Food Anal Method. 7:1933 1949. Ali ME, Hashim U, Mustafa S, Man YB. 2012. Swine-specific 0.001% (w/w) MBT meat) have made it effective PCR-RFLP assay targeting mitochondrial cytochrome B for the unambiguous tracing of MBT materials in gene for semiquantitative detection of pork in commercial the food chain, traditional herbal medicines, or any meat products. Food Anal Method. 5:613–623. forensic or archaeological investigations. Alves RR, Rosa IL. 2005. Why study the use of animal Furthermore, a high correlation coefficient products in traditional medicines? J Ethnobiol Ethnomed. 1:1. (R2 = 0.999) between the recovered and reference Alves RRN, Rosa IL, Albuquerque UP, Cunningham AB. values for 10% to 0.001% MBT adulteration is a 2013. Medicine from the wild: an overview of the use strong piece of evidence that this automated real- and trade of animal products in traditional medicines. time PCR assay has sufficient merit to be used for Heidelberg: Springer-Verlag; p. 25–42. doi:10.1007/978-3- the confirmation of MBT in any forensic studies. 642-29026-8_3 We hope the assay will help regulatory bodies, Angeletti LR, Agrimi U, French D, Curia C, Mariani- Costantini R. 1992. Healing rituals and sacred serpents. archaeologists and wildlife protection agencies to The Lancet. 340:223–225. prevent or reduce the illegal trades of MBT materi- Anonymous. 2008. Record haul of 10,000 endangered turtle als in all possible routes and safeguard this eggs seized in Malaysia. The Telegraph. [Downloaded on 1658 ASING ET AL.

2015 Jul 20].Available from: http://www.telegraph.co.uk/ (OR):Institute for Traditional Medicine. http://www.itmon news/worldnews/asia/malaysia/3378665/Record-haul-of- line.org/arts/turtles.htm 10000-endangered-turtle-eggs-seized-in-Malaysia.html Druml B, Mayer W, Cichna-Markl M, Hochegger R. 2015a. Anyinam C. 1995. Ecology and ethnomedicine: exploring Development and validation of a TaqMan real-time PCR links between current environmental crisis and indigenous assay for the identification and quantification of roe deer medical practices. Soc Sci Med. 40:321–329. (Capreolus capreolus) in food to detect food adulteration. Ardura A, Linde AR, Moreira JC, Garcia-Vazquez E. 2010. Food Chem. 178:319–326. DNA barcoding for conservation and management of Druml B, Hochegger R, Cichna-Markl M. 2015b. Duplex Amazonian commercial fish. Biol Conserv. 143:1438– real-time PCR assay for the simultaneous determination 1443. of the roe deer (Capreolus capreolus) and deer (sum of Arslan A, Ilhak OI, Calicioglu M. 2006. Effect of method of fallow deer, red deer and sika deer) content in game meat cooking on identification of heat processed beef using products. Food Cont. 57:370–376. polymerase chain reaction (PCR) technique. Meat Sci. Ernst E, Coon JT. 2001. Heavy metals in traditional Chinese 72:326–330. medicines: a systematic review. Clin Pharmacol Ther. Ayaz Y, Ayaz N, Erol I. 2006. Detection of species in meat 70:497–504. and meat products using enzyme- linked immunosorbent Fajardo V, González I, Martín I, Rojas M, Hernández PE, Assay. J Muscle Foods. 17:214–220. García T, Martín R. 2008. Real-time PCR for detection and Bennett EL, Milner-Gulland E, Bakarr M, Eves HE, Robinson quantification of red deer (Cervus elaphus), fallow deer JG, Wilkie DS. 2002. Hunting the world’s wildlife to (Dama dama), and roe deer (Capreolus capreolus)in extinction. Oryx. 36:328–329. meat mixtures. Meat Sci. 79:289–298. Bk H. 2010. Customs seize tonnes of reptiles in Malaysia. Fajardo V, González I, Rojas M, García T, Martín R. 2010.A Traffic. [Downloaded on 2015 Jun 24]. Available from: review of current PCR-based methodologies for the www.traffic.org/home/2010/12/24/customs-seize-tonnes- authentication of meats from game animal species. of-reptiles-in-malaysia.html Trends Food Sci Tech. 21:408–421. Brodmann P, Nicholas G, Schaltenbrand P, Ilg E. 2001. FAO. CAC/GL 74-2010. Guidelines on performance criteria and Identifying unknown game species: experience with validation of methods of specific DNA sequences and specific nucleotide sequencing of the mitochondrial cytochrome proteins in foods. [Download on 2016 Jun 12].Available from: b gene and a subsequent basic local alignment search http://files.foodmate.com/2013/files_1810.html tool search. Eur Food Res Technol. 212:491–496. Fund TC. 2002. A global action plan for conservation of Brown B. 2013. Findus beef lasagne contained up to 100% tortoises and freshwater turtles. Strategy and Funding horsemeat, FSA says. BBC News. [Downloaded on 2015 Prospectus. 2007:30. Jun 10. Available from: http://www.bbc.com/news/uk- Ghovvati S, Nassiri MR, Mirhoseini SZ, Moussavi AH, 21375594 Javadmanesh A. 2009. Fraud identification in industrial Carr HS. 1991. The Maya medicinal turtle, Xkokak, and a meat products by multiplex PCR assay. Food Cont. suggested alternate reading of two yucatec ethnomedical 20:696–699. texts. J Ethnob. 11:187–192. Graham-Rowe D. 2011. Biodiversity: Endangered and in Cawthorn D-M, Steinman HA, Hoffman LC. 2013.Ahigh demand. Nature. 480:S101–S103. incidence of species substitution and mislabelling detected in Hadjinicolaou AV, Demetriou VL, Emmanuel MA, meat products sold in South Africa. Food Cont. 32:440–449. Kakoyiannis CK, Kostrikis LG. 2009. Molecular beacon- Chen T-H, Chang H-C, Lue K-Y. 2009. Unregulated trade in based real-time PCR detection of primary isolates of turtle shells for Chinese traditional medicine in East and Salmonella typhimurium and Salmonella enteritidis in Southeast Asia: the case of Taiwan. Chelonian Conserv environmental and clinical samples. BMC Microbiol. 9:1. Biol. 8:11–18. Haitao S, Parham JF, Zhiyong F, Meiling H, Feng Y. 2008. Coghlan ML, Maker G, Crighton E, Haile J, Murray DC, Evidence for the massive scale of turtle farming in China. White NE, Byard RW, Bellgard MI, Mullaney I, Trengove Oryx. 42:147–150. R. 2015. Combined DNA, toxicological and heavy metal Haunshi S, Basumatary R, Girish P, Doley S, Bardoloi R, analyses provides an auditing toolkit to improve pharma- Kumar A. 2009. Identification of chicken, duck, pigeon covigilance of traditional Chinese medicine (TCM). Sci and pig meat by species-specific markers of mitochondrial Rep. 5. doi:10.1038/srep17475 origin. Meat Sci. 83:454–459. D’Amato ME, Alechine E, Cloete KW, Davison S, Corach D. Hempen C-H, Fischer T. 2009. A materia medica for Chinese 2013. Where is the game? Wild meat products authentica- medicine: plants, minerals, and animal products. Els tion in South Africa: a case study. Investig Genet. 4:1. Health Sci. Chapter XV, p. 812. Da Nóbrega Alves RR, Da Silva Vieira WL, Santana GG. Hennenfent G, Herrmann FJ. 2006. Application of stable 2008. Reptiles used in traditional folk medicine: conserva- signal recovery to seismic data interpolation. In: tion implications. Biodiversity and Conservation. 17:2037– Proceedings of the SEG Tech Prog Expanded Abstracts. 2049. Society of Exploration Geophysicists. 25:2797–2801. Davy CM, Kidd AG, Wilson CC. 2015. Development and doi:10.1190/1.2370105. validation of environmental DNA (eDNA) markers for Hsieh H-M, Huang L-H, Tsai L-C, Kuo Y-C, Meng -H-H, detection of freshwater turtles. Plos One. 10:0130965. Linacre A, Lee JC-I. 2003. Species identification of rhino- Dharmananda S. 2005. Endangered species issues affecting ceros horns using the cytochrome b gene. Forensic Sci Int. turtles and tortoises used in chinese medicine. Portland 136:1–11. FOOD ADDITIVES & CONTAMINANTS: PART A 1659

Ilhak OI, Arslan A. 2007. Identification of meat species by Sustainability in Tropical Forests. New York (NY): polymerase chain reaction (PCR) technique. Turk J Vet Columbia University Press. p. 13–30. Anim Sci. 31:159–163. Robinson JG, Bennett EL. 2002. Will alleviating poverty solve Karabasanavar NS, Singh S, Kumar D, Shebannavar SN. the bushmeat crisis? Oryx. 36:332–332. 2014. Detection of pork adulteration by highly-specific Rojas M, González I, Pavón MÁ, Pegels N, Hernández PE, PCR assay of mitochondrial D-loop. Food Chem. García T, Martín R. 2011. Development of a real-time PCR 145:530–534. assay to control the illegal trade of meat from protected Kubista M, Andrade JM, Bengtsson M, Forootan A, Jonák J, capercaillie species (Tetrao urogallus). Forensic Sci Int. Lind K, Sindelka R, Sjöback R, Sjögreen B, Strömbom L. 210:133–138. 2006. The real-time polymerase chain reaction. Mol Rojas M, Gonzalez I, Pavon MA, Pegels N, Lago A, Aspects Med. 27:95–125. Hernandez PE, Garcia T, Martin R. 2010. Novel TaqMan Lee TM, Sigouin A, Pinedo-Vasquez M, Nasi R. 2014. The real-time polymerase chain reaction assay for verifying the harvest of wildlife for bushmeat and traditional medicine authenticity of meat and commercial meat products from in East, South and Southeast Asia: Current knowledge game birds. Food Addit Contam A. 27:749–763. base, challenges, opportunities and areas for future Saez R, Sanz Y, Toldra F. 2004. PCR-based fingerprinting research: Occasional Paper 115. Bogor, Indonesia: Center techniques for rapid detection of animal species in meat for International Forestry Research (CIFOR). products. Meat Sci. 66:659–665. Liu S-YV, Chan C-LC, Lin O, Hu C-S, Chen CA. 2013. DNA Safdar M, Junejo Y. 2015. Development and validation of fast barcoding of shark meats identify species composition and duplex real-time PCR assays based on SYBER Green flor- CITES-listed species from the markets in Taiwan. PLoS escence for detection of bovine and poultry origins in One. 8:e79373. feedstuffs. Food Chem. 173:660–664. Lo C, Lin Y, Chang H, Lin J. 2006. Identification of turtle Schoppe S. 2008. The Southeast Asian box turtle Cuora shell and its preparations by PCR- DNA sequencing amboinensis (Daudin, 1802) in Malaysia. Proceedings of method. Food Drug Anal. 14:153. the NDF Workshop Case Studies, WG-7-reptiles and Ma X, Duan J, Zhu D, Dong T, Tsim K. 2000. Species identifi- amphibians, case studies 6. cation of Radix Astragali (Huangqi) by DNA sequence of its Schoppe S, Das I. 2011. Cuora amboinensis (Riche in Daudin 5S-rRNA spacer domain. Phytochemistry. 54:363–368. 1801)–Southeast Asian box turtle. Chelon Res Monogr. Magnino S, Colin P, Dei-Cas E, Madsen M, McLauchlin J, 5:053.051-053.013. Nöckler K, Maradona MP, Tsigarida E, Vanopdenbosch E, Shackell GH. 2008. Traceability in the meat industry–the Van Peteghem C. 2009. Biological risks associated with farm to plate continuum. Int J Food Sci Tech. 43:2134– consumption of reptile products. Int J Food Microbiol. 2142. 134:163–175. Soares S, Amaral JS, Oliveira MBP, Mafra I. 2013. A SYBR McKenna A, Hanna M, Banks E, Sivachenko A, Cibulskis K, Green real-time PCR assay to detect and quantify pork Kernytsky A, Garimella K, Altshuler D, Gabriel S, Daly M. meat in processed poultry meat products. Meat Sci. 2010. The Genome analysis toolkit: a map reduce frame- 94:115–120. work for analyzing next-generation DNA sequencing data. Spinks PQ, Thomson RC, Zhang Y, Che J, Wu Y, Shaffer HB. Genome Res. 20:1297–1303. 2012. Species boundaries and phylogenetic relationships in Moore JC, Spink J, Lipp M. 2012. Development and applica- the critically endangered Asian box turtle genus Cuora. tion of a database of food ingredient fraud and economic- Mol Phylogenet Evol. 63:656–667. ally motivated adulteration from 1980 to 2010. J Food Sci. Still J. 2003. Use of animal products in traditional Chinese 77:R118–R126. medicine: environmental impact and health hazards. Özpınar H, Tezmen G, Gökçe İ, Tekiner İH. 2013. Detection Complement Ther Med. 11:118–122. of animal species in some meat and meat products by Varga A, James D. 2006. Real-time RT-PCR and SYBR comparatively using DNA microarray and real time PCR Green I melting curve analysis for the identification of methods. Kafkas Univ Vet Fak Derg. 19:245–252. plum pox virus strains C, EA, and W: effect of amplicon Rahman MM, Ali ME, Abd Hamid SB, Bhassu S, Mustafa S, size, melt rate, and dye translocation. J Virol Methods. Al Amin M, Razzak MA. 2015. Lab-on-a-Chip PCR-RFLP 132:146–153. assay for the detection of canine DNA in burger formula- Woodhouse A. 2015.US$6mturtlemeatshipment tions. Food Anal Method. Jul;8:1598–1606. bound for Hong Kong seized in Pakistan, News/Hong Rashid NRA, Ali ME, Hamid SBA, Rahman MM, Razzak Kong/WILDLIFE. South China Morning Post MA, Asing, Amin MA. 2015. A suitable method to detect a (International). [Downloaded on 2015 Sep 1]. potential fraud of bringing Macaque monkey meat into Available from: http://www.scmp.com/news/hong- the food chain. Food Addit Contam A. 32:1013–1022. kong/article/1732213/us6m-turtle-meat-shipment- Razzak A, Hamid SBA, Ali E. 2015. A lab-on-a-chip-based bound-hong-kong-seized-pakistan multiplex platform to detect potential fraud of bringing WWF. 2015.Ban selling and eating of turtle eggs. The Start pig, dog, cat, rat and monkey meat in food chain. Food online news. [Downloaded on 2016 Feb 5]. Available from: Addit Contam A. 32:1902–1913. http://www.thestar.com.my/news/nation/2015/06/30/wwf- Ririe KM, Rasmussen RP, Wittwer CT. 1997. Product differ- ban-selling-and-eating-of-turtle-eggs entiation by analysis of DNA melting curves during the Yan P, Wu X-B, Shi Y, Gu C-M, Wang R-P, Wang C-L. 2005. polymerase chain reaction. Anal Biochem. 245:154–160. Identification of Chinese alligators (Alligator sinensis) Robinson JG, Bennett EL. 2000. Carrying capacity limits to meat by diagnostic PCR of the mitochondrial cytochrome sustainable hunting in tropical forests. In: Hunting for b gene. Biol Conserv. 121:45–51. 本文献由“学霸图书馆-文献云下载”收集自网络，仅供学习交流使用。

学霸图书馆（www.xuebalib.com）是一个“整合众多图书馆数据库资源，

提供一站式文献检索和下载服务”的24 小时在线不限IP 图书馆。图书馆致力于便利、促进学习与科研，提供最强文献下载服务。

图书馆导航：

图书馆首页文献云下载图书馆入口外文数据库大全疑难文献辅助工具