Articles https://doi.org/10.1038/s41564-018-0159-x

Corrected: Publisher Correction Human CD45 is an F-component-specific receptor for the staphylococcal toxin Panton–Valentine leukocidin

Angelino T. Tromp1,7, Michiel Van Gent 1,7, Pauline Abrial3, Amandine Martin3, Joris P. Jansen1, Carla J. C. De Haas1, Kok P. M. Van Kessel1, Bart W. Bardoel 1, Elisabeth Kruse1, Emilie Bourdonnay3, Michael Boettcher4, Michael T. McManus4, Christopher J. Day5, Michael P. Jennings 5, Gérard Lina3, François Vandenesch 3, Jos A. G. Van Strijp1, Robert Jan Lebbink1, Pieter-Jan A. Haas1, Thomas Henry 3,8* and András N. Spaan 1,6,8*

The staphylococcal bi-component leukocidins Panton–Valentine leukocidin (PVL) and γ-haemolysin CB (HlgCB) target human phagocytes. Binding of the toxins’ S-components to human complement C5a receptor 1 (C5aR1) contributes to cellular tropism and human specificity of PVL and HlgCB. To investigate the role of both leukocidins during infection, we developed a human C5aR1 knock-in (hC5aR1KI) mouse model. HlgCB, but unexpectedly not PVL, contributed to increased bacterial loads in tissues of hC5aR1KI mice. Compared to humans, murine hC5aR1KI neutrophils showed a reduced sensitivity to PVL, which was mediated by the toxin’s F-component LukF-PV. By performing a genome-wide CRISPR–Cas9 screen, we identified CD45 as a receptor for LukF-PV. The human-specific interaction between LukF-PV and CD45 provides a molecular explanation for resistance of hC5aR1KI mouse neutrophils to PVL and probably contributes to the lack of a PVL-mediated phenotype during infection in these mice. This study demonstrates an unsuspected role of the F-component in driving the sensitivity of human phagocytes to PVL.

taphylococcus aureus is a major bacterial pathogen in humans the single-component pore-forming toxin of S. aureus, α​-toxin and is responsible for a diverse disease spectrum, ranging from (haemolysin-α​ (Hla))8, but the biological rationale for a bi-compo- superficial skin and soft tissue infections to severe invasive nent system remains unresolved. Functional interactions by forma- S 1 disease. Severe infections with S. aureus have a poor prognosis . tion of non-canonical combinations of S- and F-components that Treatment is further complicated by the emergence of methicillin- are active (as for PVL and HlgCB9–11) or inactive (as for PVL and resistant S. aureus (MRSA) strains2 and by a lack of advancements in LukED12) suggest that the contribution of leukocidins to pathogen- vaccine development3. A better understanding of the host–pathogen esis differs when expressed simultaneously. However, the contribu- interaction during infection with S. aureus is essential to develop tion of the leukocidins to infection is incompletely understood5,7. new therapeutic approaches. Specificity for human phagocytes and resistance of murine Phagocytes have a pivotal role in the containment of S. aureus phagocytes to the majority of leukocidins hinder investigation dur- early after infection4. To counteract elimination by phagocytes, ing infection7. Recently, proteinaceous receptors have been iden- S. aureus secretes an arsenal of virulence factors. Among these are tified for all leukocidins7,13–20. These receptors are targeted by the the leukocidins, a family of bi-component pore-forming toxins that S-components in a species-specific manner. For the S-components target and kill phagocytes5,6. Human S. aureus isolates secrete up of PVL and HlgCB, LukS-PV and HlgC, respectively, the human to five different leukocidins7: Panton–Valentine leukocidin (PVL; complement C5a receptor 1 (hC5aR1) was identified as the major also known as LukSF-PV), γ​-haemolysin AB and CB (HlgAB and receptor14,16. The identification of hC5aR1 as a shared receptor for HlgCB, respectively), leukocidin ED (LukED) and leukocidin AB LukS-PV and HlgC explains the specificity for human phagocytes (LukAB; also known as LukGH). Chromatography elution profiles as both toxins are incompatible with the murine C5aR1 ortho- differentiate the leukocidin protein components into S-migrating logue14,16. Although differences exist in the interaction between (slow) and F-migrating (fast) components, which are, with the LukS-PV and HlgC with hC5aR1 (refs 21,22), the necessity for exception of LukAB, secreted as inactive monomers5. Each canoni- S. aureus to secrete apparently redundant toxins is incompletely cal leukocidin combination consists of S- and F-components that appreciated7. Even though receptors have been identified for all hetero-oligomerize into an octameric membrane-spanning pore5,7. leukocidin S-components, it remains to be established whether The leukocidins show structural and functional resemblance to the F-components also have host receptors. A recent study on the

1Department of Medical Microbiology, University Medical Center Utrecht, Utrecht, The Netherlands. 2Department of Microbiology, University of Chicago, Chicago, IL, USA. 3CIRI, Centre International de Recherche en Infectiologie, Inserm, U1111, Université Claude Bernard Lyon 1, CNRS UMR5308, Ecole Normale Supérieure de Lyon, Université Lyon, Hospices Civils de Lyon, Lyon, France. 4Department of Microbiology and Immunology, UCSF Diabetes Center, Keck Center for Noncoding RNA, University of California, San Francisco, San Francisco, CA, USA. 5Institute for Glycomics, Griffith University, Gold Coast, Queensland, Australia. 6St. Giles Laboratory of Human Genetics of Infectious Diseases, Rockefeller Branch, The Rockefeller University, New York, NY, USA. 7These authors contributed equally: Angelino T. Tromp, Michiel Van Gent. 8These authors jointly supervised this work: Thomas Henry, András N. Spaan. *e-mail: [email protected]; [email protected]

708 Nature Microbiology | VOL 3 | JUNE 2018 | 708–717 | www.nature.com/naturemicrobiology © 2018 Macmillan Publishers Limited, part of Springer Nature. All rights reserved. © 2018 Macmillan Publishers Limited, part of Springer Nature. All rights reserved. NaTuRe MICRoBIoLogy Articles

equine-specific leukocidin of S. aureus (LukPQ) suggests that the mice were challenged with WT and isogenic single mutant S. aureus F-component might be involved in determining host tropism17. strains lacking either hlgACB (∆​hlgACB) or lukSF-PV (∆​lukSF-PV). Owing to the human specificity of both toxins, studies address- Infection of hC5aR1KI mice with ∆​lukSF-PV or WT bacteria ing the role of PVL and HlgCB during infection have proven to resulted in similar bacterial loads in the spleen and the kidneys be challenging in mice6,23,24. In rabbits, PVL contributes to necro- when compared to animals infected with WT bacteria (Fig. 1c). tizing pneumonia25, osteomyelitis26 and modestly enhances early However, hC5aR1KI mice infected with S. aureus ∆​hlgACB showed stages of bacteraemic spread in a bloodstream infection model27. decreased bacterial loads in the spleen and the kidneys com- The contribution of PVL to skin infections in rabbits remains con- pared to WT bacteria (Fig. 1c). These results demonstrate that the troversial28,29, although the presence of the genes encoding PVL is increased susceptibility of hC5aR1KI mice to WT S. aureus is medi- epidemiologically linked to severe skin and soft tissue infections ated by hlgACB. in humans30. More recently, non-obese diabetic (NOD)/severe The hlgACB gene cluster encodes two functional pore-forming combined immune deficiency (SCID)/IL2R-γ​-null (NSG) mice toxins (HlgAB and HlgCB), of which HlgCB but not HlgAB targets engrafted with primary human haematopoietic cells were found to hC5aR1 (refs 7,16). To confirm that the differences in bacterial loads be more susceptible to skin lesions31 and pneumonia32 than con- recovered from hC5aR1KI mice infected with WT versus ∆​hlgACB trol mice in a PVL-dependent manner. These reports have focused bacteria are mediated by HlgCB and not by HlgAB, hC5aR1KI mice on PVL exclusively. To the best of our knowledge, no studies have were challenged with ∆​hlgACB bacteria complemented with a reported on the role of HlgCB during infection in vivo5. To under- plasmid encoding hlgAB or hlgCB (Fig. 1d). Infection of hC5aR1KI stand the mechanisms of pore formation during infection and to mice with S. aureus ∆​hlgACB reconstituted with hlgCB but not assess both the contribution of each individual hC5aR1-targeting hlgAB showed an increased number of colony-forming units leukocidin and the contribution of the leukocidins as a group, a (c.f.u.) in the spleen and the kidneys (Fig. 1d), demonstrating that humanized in vivo model is needed. HlgCB promotes S. aureus pathogenicity in hC5aR1KI mice during Here, we report on the development of a hC5aR1 knock-in systemic infection. (hC5aR1KI) mouse to investigate the role of PVL and HlgCB dur- To further assess the role of HlgCB and PVL, we infected ing infection with S. aureus and on the subsequent identification of hC5aR1KI and WT mice subcutaneously. Similar to the systemic CD45 as a receptor for LukF-PV, the F-component of PVL. infection model, mice expressing hC5aR1 displayed increased bac- terial loads in the skin after infection with an S. aureus strain that Results produces both PVL and HlgCB (Fig. 1e). Furthermore, susceptibil- hC5aR1 increases bacterial loads during S. aureus infection. ity of hC5aR1KI mice for WT S. aureus was again mediated by at To investigate the contribution of HlgCB and PVL to infection, we least one of the two hC5aR1-targeting leukocidins as infection with developed a hC5aR1KI mouse. Quantification of hC5aR1 expression the double mutant completely annulled the phenotype (Fig. 1e). in hC5aR1KI mice recapitulated expression levels on human leuko- In addition, infection of hC5aR1KI mice with S. aureus ∆​lukSF-PV cytes33 (Fig. 1a). Compared to wild-type (WT) murine phagocytes, did not affect the bacterial loads, whereas hC5aR1KI mice infected hC5aR1KI phagocytes signalled normally in response to murine and with S. aureus ∆​hlgACB showed a 100-fold decrease in the bacterial human C5a (Supplementary Fig. 1). loads recovered from the skin compared to WT bacteria (Fig. 1f). Next, a WT MRSA strain (ST80, which harbours the genes Taken together, our investigations demonstrate a hC5aR1- encoding PVL, and HlgAB and HlgCB34) was injected intraperi- dependent contribution of HlgCB during infection with S. aureus. toneally into hC5aR1KI and WT mice (Fig. 1b). Twenty-four hours However, the absence of a role for PVL was unexpected25–28,31,32 and after infection, hC5aR1KI mice displayed 10–100-fold higher bac- prompted us to investigate whether leukocytes of hC5aR1KI mice terial loads in the spleen and the kidneys than WT mice infected lack another factor that may be involved in the human-specific with the same WT S. aureus strain (Fig. 1b). The hC5aR1-depen- cytotoxicity of PVL. dent increase in bacterial burden was also observed in the perito- neal cavity. Bacterial loads in the peripheral blood showed a similar PVL and HlgCB differentially target hC5aR1KI murine neutro- trend. These data demonstrate that hC5aR1 expression on phago- phils in an F-component-specific manner. Bone-marrow-derived cytes results in increased bacterial loads during infection with an hC5aR1KI murine neutrophils were isolated and compared to human S. aureus strain producing both PVL and HlgCB. neutrophils for susceptibility to HlgCB and PVL at concentrations for which neutrophils of WT mice are fully resistant14,16. No differ- Leukocidins promote susceptibility of hC5aR1KI mice to S. aureus ences in susceptibility to HlgCB-induced pore formation between infection. To investigate whether the observed differences between human neutrophils and hC5aR1KI murine neutrophils were observed WT and hC5aR1KI mice are due to hC5aR1-targeting leukocidins, (Fig. 2a). However, hC5aR1KI murine neutrophils showed a decreased we infected hC5aR1KI and WT mice with an isogenic ∆lukSF-​ sensitivity to PVL compared to human neutrophils (Fig. 2a). PV ∆​hlgACB double mutant S. aureus strain. No differences were As hC5aR1 expression on hC5aR1KI murine neutrophils observed between hC5aR1KI or WT mice in any of the cultured com- reflected that of human neutrophils (Fig. 1a), we questioned partments after infection with the double mutant S. aureus strain whether reduced susceptibility of hC5aR1KI murine neutrophils for (Fig. 1b). However, compared to the WT S. aureus strain, infection PVL was due to a species-specific interaction of the cells with the in hC5aR1KI mice with the double mutant S. aureus strain resulted in toxin’s S-component or F-component. Non-canonical pairing of a 10–100-fold reduction in bacterial burdens in the spleen and the the S- and F-components of PVL and HlgCB enables the forma- kidneys, with a similar trend in the peritoneal cavity and peripheral tion of functional pores in human phagocytes9–11. hC5aR1KI murine blood (Fig. 1b). In WT mice, no differences were observed in any of neutrophils were as susceptible to LukS-PV/HlgB as human neutro- the cultured compartments after infection with the WT or double phils (Fig. 2a), indicating that reduced susceptibility of hC5aR1KI mutant S. aureus strain (Fig. 1b). Thus, these results confirm that murine neutrophils to PVL is not due to a compromised interac- the increased susceptibility of hC5aR1KI mice for WT S. aureus is tion of LukS-PV with the cells. Correspondingly, we observed mediated by at least one of the two hC5aR1-targeting leukocidins. comparable binding of LukS-PV to hC5aR1KI murine and human neutrophils (Supplementary Fig. 2). However, hC5aR1KI murine HlgCB, but not PVL, contributes to S. aureus pathophysiology neutrophils were less susceptible to HlgC/LukF-PV than human in hC5aR1KI mice. To assess the individual involvement of HlgCB neutrophils (Fig. 2a). This finding indicates that the species-specific and PVL in hC5aR1-dependent S. aureus pathogenesis, hC5aR1KI phenotype of PVL on hC5aR1KI murine neutrophils is mediated by

Nature Microbiology | VOL 3 | JUNE 2018 | 708–717 | www.nature.com/naturemicrobiology 709 © 2018 Macmillan Publishers Limited, part of Springer Nature. All rights reserved. © 2018 Macmillan Publishers Limited, part of Springer Nature. All rights reserved. Articles NaTuRe MICRoBIoLogy abS. aureus ST80 WT c S. aureus ST80 WT S. aureus ST80 lukSF-PV S. aureus ST80 ∆lukSF-PV ∆hlgACB ∆ S. aureus ST80 ∆hlgACB Spleen Kidney Lavage Blood ** * NS Spleen Kidney KI *** hC5aR1 Human NS NS NS NS * NS ** NS mice 5 9 NSS NSS NS NSS NS NSS NS NS NS NS 10 10 *** * 109 8 10 108 7 10 7 4 10 10 6 10 106 5 10 105 4

(c.f.u. per ml) 4 Bacterial load 10

3 (c.f.u. per ml) Bacterial load 10 Anti-hC5aR1 10 3 10 103 antibody-binding capacity

mice KI KI mice KI mice KI mice KI mice KI mice NeutrophilsMonocytesNeutrophilsMonocytes WT mice WT mice WT mice WT mice WT mice WT mice Lymphocytes Lymphocytes hC5aR1 hC5aR1 hC5aR1 hC5aR1 hC5aR1 hC5aR1

S. aureus ST80 WT deS. aureus USA300 ∆hlgACB f S. aureus ST80 WT S. aureus ST80 lukSF-PV S. aureus USA300 ∆hlgACBpAB ∆ S. aureus ST80 hlgACB S. aureus USA300 ∆hlgACBpCB S. aureus ST80 ∆lukSF-PV ∆hlgACB ∆ ** NS Spleen Kidney NS * NS NS NS * ** ** 8 8 10 NS NS 10 9 7 10 7 10 10 106 108 106 5 5 10 7 10 10 104 104 6 Bacterial load 3 Bacterial load 10 10 103 (c.f.u. per ml) Bacterial load 2 2 (c.f.u. per skin sample) 10 105 (c.f.u. per skin sample) 10

KI KI hC5aR1KI mice WT mice hC5aR1mice WT mice hC5aR1mice

Fig. 1 | hC5aR1 and HlgCB, but not PVL, contribute to increased bacterial loads in hC5aR1KI mice. a, The expression of hC5aR1 on leukocytes from humans and hC5aR1KI mice shown as the antibody-binding capacity of an anti-hC5aR1 monoclonal antibody. The mean is shown, with n =​ 2 biologically independent samples. b, Bacterial loads after intraperitoneal infection with S. aureus WT or an isogenic ∆lukSF-PV​ ∆​hlgACB-mutant strain in hC5aR1KI and WT mice. Sample sizes for hC5aR1KI and WT mice, respectively: n =​ 25 and n =​ 23 for S. aureus WT; n =​ 11 and n =​ 5 for S. aureus ∆​lukSF-PV ∆​hlgACB. c, Bacterial loads in the spleen and the kidneys after infection with S. aureus WT ST80 or an isogenic ∆lukSF-PV​ - or ∆hlgACB​ -mutant strain. Sample sizes for hC5aR1KI and WT mice, respectively: n =​ 25 and n =​ 23 for S. aureus WT; n =​ 6 and n =​ 6 for S. aureus ∆​lukSF-PV; n =​ 6 and n =​ 6 for S. aureus ∆​hlgACB. d, Bacterial loads in the spleen and the kidneys after infection of hC5aR1KI mice with S. aureus ∆hlgACB​ complemented with a plasmid encoding hlgAB (pAB) or hlgCB (pCB). Sample sizes: n =​ 9 for S. aureus ∆​hlgACB; n =​ 10 for S. aureus ∆​hlgACBpAB; n =​ 11 for S. aureus ∆​hlgACBpCB. e, Bacterial loads in the skin recovered after subcutaneous infection with S. aureus WT or an isogenic ∆​lukSF-PV ∆​hlgACB strain. Sample sizes: n =​ 12 for all groups. f, Bacterial loads in the skin after infection with S. aureus WT ST80 or an isogenic ∆​lukSF-PV- or ∆hlgACB​ -mutant strain. Sample sizes for hC5aR1KI and WT mice, respectively: n =​ 12 and n =​ 12 for S. aureus WT; n =​ 14 and n =​ 14 for S. aureus ∆​lukSF; n =​ 12 and n =​ 12 for S. aureus ∆​hlgACB. For panels b–f, mice were distributed over independent experiments. The solid horizontal lines express the geometric means; the horizontal dashed lines indicate the detection threshold. Significance is displayed: *P <​ 0.05, **P <​ 0.01, ***P <​ 0.001 and NS for not significant, and was calculated using ANOVA with Bonferroni post-test correction for multiple comparison. Exact P values are provided in Supplementary Table 3. See also Supplementary Fig. 1. the F-component, LukF-PV. Indeed, reduced binding of LukF-PV hit, ­illustrating the validity of the screening method (Fig. 3a and to hC5aR1KI murine neutrophils was observed when compared to Supplementary Tables 1 and 2). The other most enriched gene, human neutrophils (Fig. 2b). which encodes a predicted surface protein, was PTPRC (Fig. 3a These observations demonstrate that the observed reduced sus- and Supplementary Tables 1 and 2). PTPRC encodes protein ceptibility of hC5aR1KI murine neutrophils to PVL is mediated by tyrosine phosphatase receptor type C (PTPRC; also known as its F-component and imply the involvement of a host factor that CD45). Expression levels of C5aR1 and CD45 on the surface of displays human-specific interaction with LukF-PV. U937-hC5aR1-SpCas9 cells (Fig. 3b) were in the same order of magnitude as on human neutrophils (Supplementary Fig. 3a). PVL targets CD45. To identify additional host factors involved To validate the involvement of CD45 in PVL susceptibility, sin- in PVL-mediated cytotoxicity, a genome-wide clustered regu- gle knockout cells were generated. Mutant cells specifically lacked larly interspaced short palindromic repeats (CRISPR)–CRISPR- expression of C5aR1 or CD45 (Fig. 3b). Subsequently, cells were chal- associated protein 9 (Cas9) screen for PVL resistance was set up lenged with PVL or HlgCB at approximately half-maximum effec- − + in human U937-hC5aR1-SpCas9 cells. Focusing on cell surface tive concentration (EC50) of toxin. As expected, C5aR1 CD45 cells proteins, the gene encoding C5aR1, C5AR1, was identified as a top were resistant to both PVL and HlgCB (Fig. 3c). C5aR1+ CD45− cells

710 Nature Microbiology | VOL 3 | JUNE 2018 | 708–717 | www.nature.com/naturemicrobiology © 2018 Macmillan Publishers Limited, part of Springer Nature. All rights reserved. © 2018 Macmillan Publishers Limited, part of Springer Nature. All rights reserved. NaTuRe MICRoBIoLogy Articles

a To test whether the resistance of CD45− cells to PVL, but not 120 120 20 ** *** HlgCB, results from a disturbed interaction with the toxin’s 100 100 15 NS S-component or F-component, non-canonical toxin combinations 80 80 of PVL and HlgCB were subsequently tested. A comparable EC for 60 60 (nM) 10 NS 50

50 − + 40 40 LukS-PV/HlgB was observed for CD45 and CD45 cells (Fig. 4a). EC 5 − 20 20 However, an increase of the EC50 in CD45 cells, similar to that for Permeable cells (%) 0 0 0 PVL, was observed for HlgC/LukF-PV (Fig. 4a). These findings 0 1 2 3 0 1 2 3 –3 –2 –1 –3 –2 –1 − B demonstrate that the resistance of CD45 cells to PVL depends on 10 10 10 10 10 10 10 10 10 10 10 10 10 10 PVL HlgCB HlgCB (nM) PVL (nM) LukF-PV, suggesting that CD45 acts as a receptor for LukF-PV. (HlgC/HlgB) (LukS-PV/LukF-PV) To study the interaction between CD45 and LukF-PV, we tested LukS-PV/HlgHlgC/LukF-PV the binding of LukF-PV to the cell surface. In CD45− cells, LukF-PV 120 120 binding was reduced compared to CD45+ cells irrespective of 100 100 co-expression of C5aR1 (Fig. 4b and Supplementary Fig. 4b,c). 80 80 Human hC5aR1KI Despite non-specific background binding in CD45− cells, CD45- 60 60 dependent binding sites of LukF-PV could be saturated, indicat- 40 40 20 20 ing a specific interaction between CD45 and LukF-PV (Fig. 4b and

Permeable cells (%) 0 0 Supplementary Fig. 4b,c). Pre-incubation of cells with LukF-PV fol- 0 1 2 3 0 1 2 3 –3 –2 –1 –3 –2 –1 lowed by a washing step and the subsequent addition of LukS-PV 10 10 10 10 10 10 10 10 10 10 10 10 10 10 showed a CD45-dependent susceptibility of cells to pore formation LukS-PV/HlgB (nM) HlgC/LukF-PV (nM) (Fig. 4c), demonstrating that CD45-dependent binding of LukF-PV b 30,000 specifically contributes to pore formation. *** *** If CD45 is a receptor for LukF-PV, CD45 neutralization could 20,000 *** Human interfere with LukF-PV binding and PVL cytotoxicity. Pre-treatment hC5aR1KI

(AU) *** of human neutrophils with a monoclonal antibody against CD45 10,000 ** (clone 4B2) reduced the binding of LukF-PV (Fig. 4d). A small shift Fluorescenc e was observed for the EC50 of PVL in cells pre-treated with the anti- 0 10 100 body against CD45 (Fig. 4e and Supplementary Fig. 4d), providing LukF-PV (nM) further evidence for the interaction between LukF-PV and CD45.

Fig. 2 | PVL and HlgCB differentially target hC5aR1KI murine neutrophils CD45 is a receptor for LukF-PV. CD45 has multiple isoforms due in an F-component-specific manner. a, Susceptibility of bone-marrow- to alternative splicing of exons encoding the distal part of the extra- 35 derived neutrophils from hC5aR1KI mice (n =​ 4) and human neutrophils cellular domain (Supplementary Fig. 5a). To investigate whether isolated from healthy donors (n =​ 3) after exposure to canonical and non- the isotype affects the susceptibility to PVL, the PVL–CD45 inter- canonical toxin combinations at the indicated concentrations. action was further investigated by expression of the shortest and Cell permeability was determined by flow cytometry using propidium longest CD45 isoforms (R0 and RABC, respectively) in C5aR1+ iodide at 30 minutes of post-toxin treatment. Dashed horizontal lines CD45− U937 cells (Fig. 5a and Supplementary Fig. 5). The expres-

indicate the EC50, which is also expressed as a separate graph for statistical sion of both CD45 isoforms restored PVL susceptibility, indicating comparison. For all graphs, the mean ±​ s.d. is shown. Significance was that the distal extracellular domain of the receptor is not required calculated using a two-sided Student’s t-test. b, Bone-marrow-derived for interaction with LukF-PV (Fig. 5a). To confirm that LukF-PV neutrophils from hC5aR1KI mice and human neutrophils were treated directly binds to CD45, surface plasmon resonance (SPR) was per- with LukF-PV at the indicated concentrations. Binding was subsequently formed using recombinant CD45 or C5aR1+ U937 cells expressing determined by flow cytometry. The mean ±​ s.d. is shown, with n =​ 3. human CD45 (hCD45). LukF-PV bound to the recombinant recep- Significance was calculated using ANOVA with Bonferroni post-test tor and cells with a dissociation constant (Kd) of 1.2 µ​M and 1.4 µ​M, correction for multiple comparison. For all panels, significance is displayed: respectively (Table 1). **P <​ 0.01, ***P < 0.001​ and NS for not significant. Exact P values are Thus, these data not only identify CD45 as a receptor for PVL provided in Supplementary Table 3. See also Supplementary Fig. 2. but also highlight CD45 as an F-component-specific leukocidin receptor.

were resistant to pore formation induced by PVL (Fig. 3c). Lactate PVL targets CD45 in a human-specific manner. As neutrophils dehydrogenase release confirmed that PVL induces actual cell lysis express CD45 (ref. 35) but hC5aR1KI murine neutrophils showed a in a CD45-dependent manner (Supplementary Fig. 3b). Notably, the reduced F-component-dependent sensitivity to PVL, we hypoth- absence of CD45 on the cellular surface did not affect susceptibility esized that LukF-PV interacts with CD45 in a species-specific to HlgCB toxicity (Fig. 3c). These findings show that PVL, but not manner and expressed the murine CD45 isoforms R0 or RABC HlgCB, targets CD45 to induce cell lysis, thereby providing evidence in C5aR1+ CD45− U937 cells (Fig. 5b and Supplementary Fig. 5). that PVL and HlgCB are functionally different toxins. Neither murine CD45 isoforms were capable of restoring PVL sus- ceptibility (Fig. 5b). Next, we expressed hCD45 in hC5aR1KI murine PVL targets CD45 in an F-component-specific manner. To fur- macrophages. The expression of hCD45 in hC5aR1KI murine mac- ther investigate the role of CD45 in cellular susceptibility to PVL, rophages enhanced the susceptibility to PVL-induced pore forma- mutant cells were incubated with different concentrations of PVL tion (Supplementary Fig. 6), mirroring the phenotype observed

and HlgCB. The absence of CD45 resulted in an increased EC50 for in U937 cells (Fig. 5a). SPR using recombinant murine CD45 or + PVL, but not for HlgCB (Fig. 4a). Activation of C5aR1 by its ligand C5aR1 U937 cells expressing murine CD45 revealed a Kd for bind- C5a was not affected by knocking out PTPRC, indicating that the ing of LukF-PV of 14.9 µ​M and 14.2 µ​M, respectively (Table 1). reduced susceptibility of C5aR1+ CD45− cells to PVL toxicity is Thus, the affinity of LukF-PV for murine CD45 is ±​10-fold lower not due to an interplay between C5aR1 and CD45 (Supplementary than the human receptor. Fig. 4a). These results indicate that CD45 is directly involved in cell These results provide a molecular explanation for the species- susceptibility to PVL but not HlgCB. specific interaction between LukF-PV and its receptor CD45.

Nature Microbiology | VOL 3 | JUNE 2018 | 708–717 | www.nature.com/naturemicrobiology 711 © 2018 Macmillan Publishers Limited, part of Springer Nature. All rights reserved. © 2018 Macmillan Publishers Limited, part of Springer Nature. All rights reserved. Articles NaTuRe MICRoBIoLogy

abAnti-hC5aR1 Anti-hCD45 c *** NS NS *** *** –50 CD45 120 –45 ** * 25,000 * 40,000 100 –40 PVL 7.5 nM C5aR1 ** –35 20,000 HlgCB 2.5 nM 30,000 80 –30 NS –25 15,000 60 –20 20,000

log-positive –15 10,000 40 NS enrichment score –10 10,000 –5 5,000 20 DAPI internalization (%) 0

Antibody-binding capacity 0 0 Genomic WT position NTC WT NTC NTC

sgRNA CD45_2 sgRNAsgRNA CD45_1 CD45_2 sgRNA CD45_1sgRNA CD45_2 sgRNAsgRNA C5aR1_1sgRNA C5aR1_2 CD45_1 sgRNAsgRNA C5aR1_1 C5aR1_2 sgRNA sgRNAC5aR1_1 C5aR1_2

Fig. 3 | PVL targets CD45. a, Cellular components that are crucial for PVL-mediated killing identified by the introduction of a genome-wide sgRNA library in U937-hC5aR1-SpCas9 cells coupled to deep sequencing. The top 20 most significantly enriched genes, as calculated by the MaGeCK ‘positive enrichment score’, are visualized, with the two surface proteins C5aR1 and CD45 highlighted. b, Validation of receptor expression in U937-hC5aR1-SpCas9 cell lines transduced with two different sgRNAs for C5aR1 (hC5aR1− CD45+) or CD45 (hC5aR1+ CD45−) to generate single-gene knockout cell lines. Receptor expression is demonstrated as the antibody-binding capacity of an anti-hC5aR1 or anti-hCD45 monoclonal antibody. As a control, WT U937 cells (WT; hC5aR1− CD45+) and U937-hC5aR1-SpCas9 cells transduced with a non-targeting control (NTC; hC5aR1+ CD45+) were used. The dashed horizontal line indicates the detection threshold. The mean ±​ s.d. is shown, with n =​ 3. Significance was calculated using ANOVA with Bonferroni post-test correction for multiple comparison. c, Validation of the genome-wide CRISPR–Cas9 screen for PVL resistance in U937-hC5aR1-SpCas9 cells. Cells were exposed to PVL (7.5 nM) or HlgCB (2.5 nM). As a readout for cell permeability, internalization of DAPI was tested at 30 minutes post-toxin treatment on a monochromator-based microplate reader and expressed in relation to the maximal area under the curve for U937-hC5aR1-SpCas9 cells transduced with a NTC. Two guide RNAs were tested for C5aR1 and CD45. The mean ±​ s.d. is shown, with n =​ 3. Significance was calculated using a two-sided Student’s t-test. For all panels, significance is displayed: *P <​ 0.05, **P <​ 0.01, ***P <​ 0.001 and NS for not significant. Exact P values are provided in Supplementary Table 3. See also Supplementary Tables 1 and 2 and Supplementary Figs 3 and 4.

Incompatibility of PVL with murine CD45 probably explains the The effects of CD45 expression on the susceptibility of C5aR1+

LukF-PV-dependent reduced sensitivity to PVL that was observed cells to PVL pore formation are moderate in terms of EC50. This in hC5aR1KI murine neutrophils. moderate effect is reflected in the micromolar affinity of LukF-PV for CD45, which is significantly lower than the affinity of LukS-PV Discussion for C5aR1 (ref. 14). Murine CD45 could not restore the suscepti- The S-components of PVL and HlgCB target C5aR1 in a human- bility of C5aR1+ CD45− cells to PVL, and the affinity of LukF-PV specific manner14,16. Human specificity has hindered in vivo stud- to murine CD45 is lower than the affinity to hCD45, suggesting ies of the role of these leukocidins. We developed a hC5aR1KI a critical threshold that allows engagement of the toxin–receptor mouse to investigate the role of PVL and HlgCB during infection complex during pore formation. The extracellular domain shared with S. aureus. Although HlgCB contributed to increased bacte- by all CD45 isoforms is heavily glycosylated and contains a cysteine- rial loads in hC5aRKI mice, no contribution of PVL was observed. rich region and three fibronectin type III repeats35 (Supplementary The unexpected lack of a PVL-dependent phenotype during infec- Fig. 5a). Although the overall organization of the extracellular tion in these mice urged us to screen for additional host factors domain is conserved, it is only 39% homologous between humans targeted by PVL. We show that PVL targets CD45 in a human- and mice35 (Supplementary Fig. 5c). Incompatibility of LukF-PV specific and LukF-PV-dependent manner, thereby demonstrating with murine CD45 may be dictated by multiple residues or post- that LukF-PV and CD45 are specifically involved in pore forma- translational modifications (Supplementary Fig. 5d). tion. CD45 is expressed on all nucleated haematopoietic cells The specificity of LukF-PV for hCD45 offers a molecular expla- and is an abundant cell surface protein35. Our data indicate that nation for the observed F-component-dependent resistance of reduced susceptibility of C5aR1+ CD45− cells to PVL toxicity is not hC5aR1KI mouse neutrophils to PVL in vitro, which is supported by due to affected signalling of C5aR1, but by a decreased binding of enhanced susceptibility of hC5aR1KI mouse macrophages express- LukF-PV to CD45− cells. ing hCD45. The relative resistance of hC5aR1KI murine neutrophils The current model for leukocidin targeting of host cells pro- to PVL probably contributes to the unexpected lack of a PVL- poses initial S-component binding followed by subsequent recruit- mediated phenotype during infection with S. aureus in these mice. ment of the F-component5. We demonstrate that specific binding As a result, functional interactions between PVL and HlgCB dur- of LukF-PV is CD45 dependent and occurs independent of the ing infection in hC5aR1KI mice could not be investigated. Future S-component, indicating that the established model needs to be options to assess the contribution of the leukocidins as a group revised. The identification of a receptor for the F-component sup- are engineering of advanced genetically modified animal models7 ports our understanding of the biological importance of two- or engrafting mice with primary human haematopoietic cells31,32. component pore-forming systems. By targeting CD45 via its Owing to the small protective effects of monoclonal antibodies in F-component in addition to C5aR1 via its S-component, PVL vitro and the heterogeneity associated with human haematopoietic deploys a two-step control mechanism over phagocyte tropism and cells engraftment in mice31,32, we were unable to use this strategy in host species specificity. Furthermore, identification of CD45 as a vivo to investigate the CD45–LukF-PV interaction during infection. receptor for LukF-PV supports the notion that PVL and HlgCB are The mechanisms for the predisposition of otherwise healthy non-redundant toxins on both a molecular and a functional level. individuals to severe infections with S. aureus are poorly under- Future investigations will have to identify putative receptors for stood36,37. Human genetic factors might account for an unfavour- F-components of other leukocidins. able outcome38,39. CD45 deficiency was described in patients with

712 Nature Microbiology | VOL 3 | JUNE 2018 | 708–717 | www.nature.com/naturemicrobiology © 2018 Macmillan Publishers Limited, part of Springer Nature. All rights reserved. © 2018 Macmillan Publishers Limited, part of Springer Nature. All rights reserved. NaTuRe MICRoBIoLogy Articles

a 80 *** 120 120 *** 100 100 60 80 80

60 60 (nM) 40 hC5aR1+ CD45+ (NTC) 50 40 40 hC5aR1+ CD45– (sgRNA CD45_1) EC 20 20 20 NS NS 0 0 0 –20 0.1 110 100 –20 0.1 110 100 DAPI internalization (%) HlgCB (nM) PVL (nM) PVL (HlgC/HlgB) (LukS-PV/LukF-PV) HlgCB

LukS-PV/HlgBHlgC/LukF-PV 120 120 100 100 80 80 hC5aR1– CD45+ (WT) 60 60 hC5aR1+ CD45+ (NTC) 40 40 hC5aR1– CD45+ (sgRNA C5aR1_2) 20 20 hC5aR1+ CD45– (sgRNA CD45_1) 0 0 –20 0.1 110 100 0.1 111100 100 DAPI internalization (%) –20 LukS-PV/HlgB (nM) HlgC/LukF-PV (nM)

b c 2.4 120 *** *** 2.0 *** 100 + + hC5aR1 CD45 (NTC) hC5aR1+ CD45+ (NTC) 1.6 80 + – hC5aR1+ CD45– (sgRNA CD45_1) *** hC5aR1 CD45 (sgRNA CD45_1) + – 60 1.2 hC5aR1 CD45 (sgRNA CD45_2) hC5aR1+ CD45– (sgRNA CD45_2)

Fold binding 40 hC5aR1– CD45+ (WT) 0.8 20 0

10 20 30 40 DAPI internalization (%) –20 10 20 30 40 Concentration of Concentration of –1 –1 LukF-PV (μg ml ) LukF-PV (μg ml )

de 120 3 ** * *** *** ** NS ** *** 100 100 Buffer 80 2 Isotype control 60 80 mah-CD45 clone 2D1 Buffer

60 mah-CD45 clone F10-89-4 40 Anti-CD45 clone 4B2 for PVL (nM) 1 50 mah-CD45 clone 4B2 20 Isotype control

40 EC Permeable cells (% ) 0 0 20 0.1 110 100 Maximal binding (%) 0 Concentration of Buffer 30.00 10.00 3.33 PVL (nM)

Concentration of Isotype control –1 LukF-PV (μg ml ) mah-CD45 clone 4B2

Fig. 4 | PVL targets CD45 in an F-component-specific manner. a, Susceptibility of WT U937 cells (WT; hC5aR1− CD45+), U937-hC5aR1-SpCas9 cells transduced with a NTC (hC5aR1+ CD45+), a sgRNA for C5AR1 (hC5aR1− CD45+) or a sgRNA for PTPRC (hC5aR1+ CD45−) to canonical and non-canonical toxin combinations. As a readout for cell permeability, internalization of DAPI was tested at 30 minutes post-toxin treatment on a monochromator-based microplate reader and expressed in relation to the maximal area under the curve for NTC U937-hC5aR1-SpCas9 cells. b, Binding of LukF-PV to cells as detected by flow cytometry, expressed as the fold increased binding related to the background binding. In addition to WT U937 and NTC U937-hC5aR1- SpCas9 cells, two U937-hC5aR1-SpCas9 cell lines transduced with a vector containing a sgRNA for PTPRC (both hC5aR1+ CD45−) were tested. c, Pore formation of cells after pre-incubation with LukF-PV, followed by a washing step and the subsequent addition of LukS-PV (0.64 µ​g ml−1). Internalization of DAPI was tested at 30 minutes after the addition of LukS-PV on a monochromator-based microplate reader and expressed in relation to the maximal area under the curve for NTC U937-hC5aR1-SpCas9. d, Binding of LukF-PV to human neutrophils after pre-incubation with monoclonal anti-CD45 antibodies (10 µ​g ml−1). Binding is expressed in relation to buffer-only treated cells, as detected by flow cytometry. e, Pore formation of human neutrophils after pre-incubation with monoclonal antibodies (10 µ​g ml−1). Cell permeability was determined by flow cytometry using DAPI at 30 minutes post-toxin

treatment. For panels a and e, the dashed horizontal lines indicate the EC50, which is also expressed as a separate graph for statistical comparison. For all panels, the mean ±​ s.d. is shown, with n =​ 3. Significance was calculated using a two-sided Student’s t-test for panel a and using ANOVA with Bonferroni post-test correction for multiple comparison for panels b–e. Significance is displayed: *P <​ 0.05, **P <​ 0.01, ***P < 0.001​ and NS for not significant. Exact P values are provided in Supplementary Table 3. See also Supplementary Fig. 4b.

SCID40,41, and abnormal splicing of PTPRC frequently occurs42. cytotoxicity by blocking the interaction between toxin and receptor Variations in the PTPRC gene are probable candidates to explore offer avenues for therapeutic intervention. Receptor competition by the genetic predisposition to severe infections. means of monoclonal antibodies or small-molecule receptor antag- By taking advantage of the conserved susceptibility of hC5aR1KI onists confers protection against toxin-mediated pore formation in mouse neutrophils to HlgCB, we show that HlgCB contributes to vitro18,20,21. The establishment of the role of hC5aR1 during infection increased bacterial loads by using hC5aR1. Our data support the and the identification of CD45 as a receptor for LukF-PV provide a notion that leukocidins have an essential role in the pathogenicity rationale to further investigate the leukocidin receptors as candidate of S. aureus15,16,20,27. Strategies aimed at protecting phagocytes from drug targets for severe S. aureus infections.

Nature Microbiology | VOL 3 | JUNE 2018 | 708–717 | www.nature.com/naturemicrobiology 713 © 2018 Macmillan Publishers Limited, part of Springer Nature. All rights reserved. © 2018 Macmillan Publishers Limited, part of Springer Nature. All rights reserved. Articles NaTuRe MICRoBIoLogy

a NS NS 140 80 *** 120 *** 100 60 hC5aR1+ CD45– phcd45-R0 80 + – hC5aR1 CD45 phcd45-RABC 40 60 + –

hC5aR1 CD45 pEmpty for PVL (nM)

40 50 hC5aR1+ CD45+ (NTC) 20 20 EC DAPI internalization (%) 0 0 0.11 10 100 R0 BC Concentration of PVL (nM) + (NTC)pEmpty phcd45- + CD45 phcd45-RA

hC5aR1 hC5aR1+ CD45–

b *** *** 140 80 NS NS 120 100 60 hC5aR1+ CD45– pmcd45-R0 80 + – hC5aR1 CD45 pmcd45-RABC 40 60 + –

hC5aR1 CD45 pEmpty for PVL (nM )

40 50 hC5aR1+ CD45+ (NTC) 20 20 EC DAPI internalization (%) 0 0 0.11 10 100 Concentration of PVL (nM) + (NTC)pEmpty -RABC pmcd45-R0 mcd45 + CD45 p

hC5aR1 hC5aR1+ CD45–

Fig. 5 | PVL targets CD45 in a human-specific manner. Susceptibility to PVL of U937-hC5aR1-SpCas9 cells transduced with a sgRNA targeting PTPRC (hC5aR1+ CD45−) and subsequently transduced with a plasmid containing either the hCD45 isoform R0 (phCD45-R0) or RABC (phCD45-RABC) (a), the murine CD45 isoform R0 (pmCD45-R0) or RABC (pmCD45-RABC) (b), or an empty plasmid (pEmpty). As a readout for cell permeability, internalization of DAPI was tested at 30 minutes post-toxin treatment on a monochromator-based microplate reader and expressed in relation to the maximal area under + + the curve for U937-hC5aR1-SpCas9 cells transduced with a NTC (hC5aR1 CD45 ). Dashed horizontal lines indicate the EC50, which is also expressed as a separate graph for statistical comparison. For all panels, the mean ±​ s.d. is shown, with n =​ 3. Significance is displayed: ***P <​ 0.001 and NS for not significant, and was calculated using ANOVA with Bonferroni post-test correction for multiple comparison. Exact P values are provided in Supplementary Table 3. See also Supplementary Figs 5 and 6.

electroporated into C57BL/6 N embryonic stem cells. Embryonic stem cells Table 1 | SPR analysis of LukF-PV and CD45 from human and containing the correctly targeted human C5AR1, as verifed by Southern blot, were mouse analysed by karyotyping before injection into blastocytes. Following verifcation of germline transmission, the LoxP-fanked neomycin selection cassette was deleted Species Recombinant CD45 U937 cells CD45+ using deleter mice as previously described44. Mice homozygous for the hC5aR1 were generated and validated by genotyping PCR. Human 1.2 ±​ 0.2 µ​M 1.4 ±​ 0.4 µ​M Mouse 14.9 ±​ 1.9 µ​M 14.2 ±​ 4.0 µ​M Construction of the CRISPR–Cas9 library. A genome-scale single guide RNA (sgRNA) library was designed, consisting of ±260,000​ sgRNAs targeting every K was measured for recombinant human and murine CD45-R0 and for U937 cells expressing d unique Refseq annotated (hg19) protein-coding isoform with up to 12 sgRNAs, human or murine CD45 isotype R0 (U937-hC5aR1-SpCas9 cells transduced with a sgRNA plus 7,700 non-targeting control sequences. Where possible, the earliest possible targeting PTPRC (hC5aR1+ CD45−), and subsequently transduced with a plasmid containing either coding exon of each transcript variant was targeted. All sgRNAs were designed hCD45 isoform R0 or murine CD45 isoform R0). Mean affinities ±​ s.e.m. are shown, with n =​ 3. to target the spCas9 recognition sequence (N)20NGG and must have passed the following off-targeting criteria: (1) the 11-base pair seed may not have an exact match to any other region in the human genome, and (2) if there is an exact Methods off-target seed match, the remainder of the sgRNA sequence must have at least Construction and generation of hC5aR1KI mice. hC5aR1KI mice were 7 mismatches with the potential off-target site. We selected up to 12 sgRNAs/ generated as previously described43 at the Institut Clinique de la souris (Ilkirch- transcripts for which the sequences are presented in Supplementary Table 2. Grafenstaden, France) using standard knock-in techniques. Briefy, the targeting The designed 20-nucleotide target-specific sgRNA sequences were flanked vector comprised a 4.5-kb region of mouse C57BL/6 genomic DNA upstream of by overhangs compatible with Gibson Assembly and synthesized as a pool the C5ar gene (gene ID: ENSMUSG00000049130) exon 2 (and ending with the on microarray surfaces (CustomArray). The synthesised sgRNA template murine ATG), exon 2 from human C5AR1 (gene ID: ENSMUST00000050770) sequences were of the format: 5′​-GGAGAACCACCTTGTTGG-(N)20- encoding the full-length hC5aR1 from amino acid 2 to the stop codon of the GTTTAAGAGCTATGCTGGAAAC-3′​. Template pools were PCR amplified by protein in frame with ATG from the murine C5ar1 gene and a 3.5-kb region using Phusion Flash High-Fidelity PCR Master Mix (Thermo Fisher Scientific) of the mouse C57BL/6 C5ar1 3′​ untranslated region. Te obtained vector was according to the manufacturers protocol, with 1 ng µ​l−1 sgRNA template DNA,

714 Nature Microbiology | VOL 3 | JUNE 2018 | 708–717 | www.nature.com/naturemicrobiology © 2018 Macmillan Publishers Limited, part of Springer Nature. All rights reserved. © 2018 Macmillan Publishers Limited, part of Springer Nature. All rights reserved. NaTuRe MICRoBIoLogy Articles

1 µ​M forward primer (5′​-GGAGAACCACCTTGTTGG-3′​), 1 µ​M reverse primer hC5aR1KI bone-marrow-derived macrophages were immortalized, as (5′​-GTTTCCAGCATAGCTCTTAAAC-3′​) and the following cycle numbers: 1 previously described, by transducing primary bone marrow cells with J2 virus at cycle (98 °C for 3 min), 15 cycles (98 °C for 1 s, 55 °C for 15 s and 72 °C for 20 s) day 3 post-isolation47. and 1 cycle (72 °C for 5 min). PCR products were purified using Minelute columns (Qiagen). The library vector sgLenti (MP-783) was prepared by restriction digest Genome-wide CRISPR–Cas9 library screen with PVL in U937-hC5aR1 cells. with AarI (Thermo Fisher) at 37 °C overnight, followed by extraction from Approximately 600 ×​ 106 U937-hC5aR1-SpCas9 cells were transduced with the 1% agarose gel of the digested band and purification via NucleoSpin columns genome-wide sgRNA expression library by spin infection at 1,000g for 90 min (Macherey-Nagel). Using Gibson Assembly Master Mix (NEB), 1,000 ng digested at 33 °C in the presence of 4 μ​g ml−1 polybrene. Approximately 15% of the cells sgLenti and 100 ng amplified sgRNA library insert were assembled in a total were transduced, resulting in a ~350-fold overrepresentation of the library. reaction volume of 200 µ​l. The reaction was purified using P-30 buffer exchange Transduced cells were selected to purity with 2.0 μ​g ml−1 puromycin initiated 8 columns (Bio-Rad) that were equilibrated five times with H2O, and the total eluted at 2 days post-transduction. Twelve days post-transduction, 2 ×​ 10 cells were volume was transformed into three vials of Electromax DH5-α​ (Thermo Fisher). incubated with 31 nM PVL for 30 min at 37 °C, which resulted in depletion of Bacteria were recovered, cultured overnight in 500 ml LB (100 µ​g ml−1 ampicillin) >​99.5% of the cells. Cells were washed to remove the toxin and allowed to recover and used for Maxiprep (Qiagen). In parallel, a fraction of the transformation in complete RPMI for 15 days to enrich for viable cells. In parallel, an untreated reaction was plated and used to determine the total number of transformed control sample of sgRNA-tranduced cells was maintained at high complexity clones. The library cloning coverage (that is, the number of bacteria colonies per (>​2 ×​ 108 cells) throughout this time period. Genomic DNA was isolated from sgRNA plasmid) was determined to be >​100×​ to ensure even representation of 5 ×​ 107 outgrowing cells and 1 ×​ 108 untreated control cells by standard phenol– the sgRNA sequences. chloroform extraction. sgRNA inserts were subsequently PCR amplified for 16 cycles with primers 5′​- GGCTTGGATTTCTATAACTTCGTATAGCA-3′ ​ and Cell lines and constructs. U937 human monocytic cells were obtained from 5′-CGGGGACTGTGGGCGATGTG-3​ ′​ using the Titanium Taq PCR kit (Clontech). the ATCC (American Type Culture Collection), cultured in RPMI medium The PCR products were pooled and amplified using primers containing Illumina supplemented with penicillin/streptomycin and 10% FCS, and tested for adapter sequences and a unique index for 15 cycles using the forward primer 5′​-AA mycoplasma contamination. U937 cells were not authenticated. To sensitize the TGATACGGCGACCACCGAGATCCACAAAAGG-AAACTCACCCTAAC-3′ ​ cells to PVL and HlgCB, hC5aR1 (CD88; NM_001736) was first stably expressed and the reverse primer 5′-CAAGCAGAAGACGGCATACGAGAT-​ in U937 cells using a lentiviral expression system (U937-hC5aR1 cells). We cloned AGTCTCGTGACTGGAGTTCAGACGTG-3′​ (RO-1479) for the treated sample the C5AR1 cDNA in a dual promoter lentiviral vector (BIC-PGK-Zeo-T2a- or 5′-​ ­ CAAGCAGAAGACGGCATACGAGATTGTCAGGTGACTGGAGTTCA­ mAmetrine; RP172), derived from no.2025.pCCLsin.PPT.pA.CTE.4 ×​ -scrT.eGFP. GACGTG-3′​ (RO-1478) for the untreated control sample. The 344-base pair PCR mCMV.hPGK.NG-FR.pre (kindly provided by L. Naldini, San Raffaele Scientific products were purified from 2% agarose gel using a PCR purification kit (Qiagen), Institute, Milan, Italy) as described elsewhere45. This lentiviral vector contains a and the DNA yield and quality were assessed by Bioanalyzer and Qubit analysis. human EF1A promoter to facilitate potent expression of the downstream cloned PCR products were subsequently pooled in equimolar ratios and subjected to deep gene and expresses the fluorescent protein mAmetrine and the selection marker sequencing using the Illumina NextSeq500 platform. Sequences were aligned to ZeoR from a different promoter (PGK). the virus was produced in 24-well the sgRNA library by using Bowtie2 (PMID: 22388286) and the counts per sgRNA plates using standard lentiviral production protocols and the third-generation were calculated. We used the MaGeCk package (PMID: 25476604) (available from packaging vectors pMD2G-VSVg, pRSV-REV and pMDL/RRE. Briefly, 0.25 µ​g https://sourceforge.net/projects/mageck/) as a computational tool to identify genes lentiviral vector and 0.25 µ​g packaging vectors were co-transfected in 293T cells that were significantly enriched in the screens by comparing sgRNA read counts by using 1.5 µ​l Mirus LT1 tranfection reagent (Sopachem, Ochten). After 72 h, of control cells to PVL-incubated cells. The genes, including the significance for 100 µ​l unconcentrated viral supernatant adjusted to 8 mg ml−1 polybrene was used enrichment as calculated by the MaGeCK ‘positive enrichment score’, are presented to infect ~50,000 U937 cells by spin infection at 1,000g for 2 h at 33 °C. U937- in Supplementary Table 1. hC5aR1-expressing cells were selected by culturing in 400 µ​g ml−1 Zeocin. To allow screening in U937-C5aR1 cells by using the genome-wide sgRNA Complementation of hC5aR1KI murine macrophages. Primary hC5aR1KI library described below, the pSicoR-CRISPR-PuroR vector46 was altered to replace bone marrow cells were transduced with lentiviruses at day 3 post-isolation. the PuroR for BlastR and remove the U6 promoter. This vector (pSicoR-SpCas9- Lentiviruses were added onto hC5aR1KI bone marrow cells (2 ×​ 106 cells per well BlastR; RP-613) expresses a human codon-optimized nuclear-localized Streptococcus of a 6-well plate) at a multiplicity of infection of 100:1, as determined by titration pyogenes cas9 gene in the absence of a U6 promoter–sgRNA cassette. U937-hC5aR1 on 293T human embryonic kidney cells. Transduction was promoted by a 2,000g cells were transduced with the pSicoR-SpCas9-BlastR vector and were selected to spinoculation during 2 h at room temperature. After 6 h of incubation at 37 °C, purify with 20 µg​ ml−1 blasticidin, to generate U937-hC5aR1-SpCas9 cells. 2 ml of fresh medium were added. Cells were carefully washed the next day and U937-hC5aR1-SpCas9 cells were transduced by sgRNA-expressing vectors further incubated for 3 days before analysis. Adherent macrophages were collected to generate knockout cell lines to enable genome-wide CRISPR–Cas9 library by washing the plate once with PBS and incubating it with Versene (Thermo Fisher screening (described below) or to generate single-gene knockout cell lines. For this, Scientific) for 5 min at room temperature. a lentiviral vector was generated consisting of the pSicoR vector expressing PuroR- T2A-mCherry expressed from the EF1A promoter and a U6 promoter driving the Isolation of human and murine leukocytes. Cells were isolated as described expression of a sgRNA sequence (sgLenti, MP-783). To generate knockout cells for elsewhere14,16. Briefly, the bone marrow of mice was harvested and immune C5AR1 or PTPRC, the following sgRNA sequences were cloned in sgLenti: C5aR1_1 cells were collected. Human leukocytes were isolated by Ficoll/Histopaque TCATCATAGTGCCCATAATC; C5aR1_2 GATGGCATTGATGGTCCGCT; centrifugation. When required, hypotonic lysis of residual erythrocytes was CD45_1 TCACACTTATACTCATGTTC; CD45_2 ATTCTGTGTATCACAAGTAA. performed by a 30-s incubation in sterile water followed by the addition of a large Upon virus production, as described above, U937-hC5aR1-SpCas9 cells were volume of PBS. All in vitro experiments with cells were performed with RPMI transduced with the sgRNA expression viruses and selected for purification by (Invitrogen) supplemented with 0.05% HSA (Sanquin) unless specified otherwise. puromycin treatment (2 µ​g ml−1) to enrich for CD45− cells. For cDNA rescue experiments, we cloned an anti-CD45 sgRNA Bacterial strains and culture conditions. S. aureus strains used for this study (GAAACTTGCTGAACACCCGC) in the pSicoR-CRISPR-PuroR vector46, are as follows: S. aureus strain USA300 clone SF8300 is a minimally passed which co-expresses SpCas9 and puroR. Upon knock-out of PTPRC from representative PVL-positive community-associated MRSA isolate from the United U937-C5aR1 cells, cDNA expression vectors were introduced to express the States27, of which the isogenic ∆​hlgACB mutant and the complemented strains human and mouse CD45-R0 and CD45-RABC genes. For this, the coding regions were described elsewhere16,48. The S. aureus strain ST80 is a European community- of hCD45-R0 (NM_080921.3), hCD45-RABC (NM_002838.4) and mouse associated MRSA isolate49, of which the isogenic ∆​lukSF-PV mutant was previously CD45-R0 (NM_011210.3) were amplified from cDNA vectors purchased from Sino reported on48. The ST80 isogenic ∆​hlgACB mutant and the ∆​lukSF-PV ∆hlgACB​ Biologicals and cloned in a dual promoter lentiviral vector derived from no.2025. double mutant strains were generated as described elsewhere16. All strains were pCCLsin.PPT.pA.CTE.4 ×​ -scrT.eGFP.mCMV.hPGK.NGFR.pre (kindly provided cultured in brain heart infusion. For in vivo experiments, mid-exponential by L. Naldini, San Raffaele Scientific Institute, Milan, Italy). This vector was altered subcultures were washed extensively in PBS. to express the BlastR gene downstream of the PGK promoter and the PTPRC genes downstream of the EF1A promoter (RP-138). To prevent targeting of the Recombinant protein production and purification. LukS-PV, LukF-PV, HlgC and hCD45 isoforms by the anti-hCD45 sgRNA present in the U937-hC5aR1-SpCas9 HlgB used for this study were cloned and expressed as described elsewhere14,16,48. CD45-knockout cells, silent mutations were engineered in the sgRNA target Fluorescein isothiocyanate (FITC)-labelled LukS-PV and LukF-PV, used for sequence in the coding region of both hCD45-R0 and hCD45-RABC. binding studies in murine and human neutrophils, were previously described50,51. The ABC region of mCD45-RABC (NM_001111316) was ordered as a human For binding studies in U937 cells, random Alexa Fluor-647-labelled LukF-PV was codon-optimized sequence as a gBlock (Integrated DNA Technologies) and cloned used. Alexa Fluor-647 NHS ester (also known as succinimidyl ester) was acquired in between the codons that code for amino acids 30 and 31 in the mCD45-R0 from Molecular Probes/Thermo Fisher Scientific. The reactive dyes were dissolved vector (described above) by overlapping extension PCR. Human and mouse in dimethylsulfoxide to a concentration of 10 mg ml−1. An amount of 100 µ​g CD45-R0 and CD45-RABC were transduced in U937-hC5aR1-SpCas9 purified toxin was labelled with 10 µ​g reactive dye in a total volume of CD45-knockout cells and were selected to purity by blasticidin selection. 100 µ​l PBS containing 0.1 M sodium carbonate pH 8.4 for 90 min at room

Nature Microbiology | VOL 3 | JUNE 2018 | 708–717 | www.nature.com/naturemicrobiology 715 © 2018 Macmillan Publishers Limited, part of Springer Nature. All rights reserved. © 2018 Macmillan Publishers Limited, part of Springer Nature. All rights reserved. Articles NaTuRe MICRoBIoLogy temperature protected from light. Subsequently, the labelled protein was separated calibration to the defined antibody-binding capacity unites, using QIFIkit (Dako). from free non-reacted dye using a protein desalting spin column. Protein For validation of receptor expression after complementation, cells were incubated concentration was determined with Nanodrop One (Thermo Fisher), and labelling with phycoerythrin (PE)-labelled mouse anti-hC5aR1 (clone S5/1, AbD Serotec), was verified by SDS–PAGE and fluorescence imaging. allophycocyanin (APC)-labelled mouse anti-hCD45 (clone 2D1, BD Biosciences) or Cy-Chrome-labelled rat anti-mouse CD45 (clone 30-F11, BD Biosciences). In vivo infection. hC5aR1KI or C57BL6/N (WT, Charles River) mice, aged between Samples were subsequently measured using flow cytometry. 6 and 12 weeks and matched for weight and sex, were injected intraperitoneally with 5 ×​ 107 c.f.u. Mice were killed 24-h post-infection and the relevant SPR analyses. The recombinant human and mouse CD45 isoform R0 protein compartments were harvested as described elsewhere16. Briefly, peripheral blood, (R&D Systems) was purchased and immobilized onto a Series S CM5 chip using a peritoneal lavage fluid and homogenized organs were serially diluted and plated Biacore S200 system (GE Healthcare) using methods previously described13. Whole on Tryptic Soy Agar for incubation at 37 °C overnight, followed by c.f.u. counting. U937 cells expressing the human or murine CD45 isoform R0 (U937-hC5aR1- For the skin infection model, mice were shaved on their back and hair removal SpCas9 cells transduced with a sgRNA targeting PTPRC (hC5aR1+ CD45−) and cream was applied for 1 min before being extensively washed. Three days later, subsequently transduced with a plasmid containing either the hCD45 isoform R0 mice were injected subcutaneously on both sides of their back with 2 ×​ 106 c.f.u. (phCD45-R0) or the murine CD45 isoform R0 (pmCD45-R0)), were fixed using in 100 μ​l PBS. At day 5 post-inoculation, mice were euthanized and the skin lesion 4% formaldehyde and washed three times with PBS and resuspended at 107 cells and the underneath tissue were collected in 1 ml PBS. Tissue was grinded using per ml. Cells were immobilized onto Series S C1 sensor chips using the C1 wizard the Precellys homogenizer (Bertin Instruments). The homogenate was diluted and methodology on the Biacore T200 control system as previously described52. Cells plated on blood agar plates (BioMérieux) using the easySpiral Dilute (Interscience). were flowed at 5 µ​l per min for 900 s to load the chip to saturation. Whole U937 The c.f.u. were automatically counted in a blinded manner using the Scan300 cells not expressing CD45 (U937-hC5aR1-SpCas9 cells transduced with a sgRNA counter with a manual correction to remove non-haemolytic c.f.u. Sample sizes targeting PTPRC (hC5aR1+ CD45−)) were loaded using the same methodology were determined following previous16,18 and preliminary experiments showing onto flow cell one to allow for double reference subtraction. For both the whole- sufficient power. cell and the recombinant protein assays, LukF-PV was flowed over the immobilized CD45 in two concentration ranges (1.6 nM to 1.0 µ​M and 16.0 nM to 10.0 µ​M). Calcium mobilization assays. Murine neutrophils or immortalized murine Data for mouse CD45 were obtained from only the higher concentration series. hC5aR1KI bone-marrow-derived macrophages were loaded with Fluo-4-AM (Molecular Probes/Thermo Fisher) for 30 min at 37 °C in the dark following the Statistical analyses. Calculations of the area under the curves, calculations of the manufacturer’s instructions. Cells were then washed twice in Hanks’ Balanced EC50 using linear regression analyses and all statistical analyses were performed using Salt Solution (HBSS) supplemented with 2.5 mM probenicid, 0.1% (w/v) BSA Prism 7.0 (GraphPad Software). Flow cytometric analyses were performed with and HEPES 25 mM. Cells were incubated for 5 min at 37 °C before FACS analysis FlowJo (Tree Star Software). Significance was calculated using analysis of variance (Accuri C6). Cells were analysed for 20 s to obtain the baseline fluorescence before (ANOVA) and Student’s t-test with post-test correction for multiple comparison, the addition of murine C5a (Prospec) or human C5a (Prospec or Peprotech), after where appropriate. Exact P values are provided in Supplementary Table 3. which acquisition was further continued. U937 cells were loaded with 2 mM Fluo-3AM (Molecular Probes/Thermo Ethics statement. Human leukocytes were isolated after informed consent was Fisher) in RPMI/HSA for 20 min at room temperature under constant agitation, obtained from all subjects in accordance with the Declaration of Helsinki. In the washed with buffer and suspended to 106 cells per ml in RPMI/HSA. Each sample of Netherlands, approval was obtained from the medical ethics committee of the cells was first measured for approximately 10 s to determine the basal fluorescence UMC Utrecht, the Netherlands (protocol METC 07-125/C). In France, blood was level. Next, a titrated range of C5a (Sigma) was added and rapidly placed back in the obtained from healthy donors from the Etablissement Français du Sang Auvergne sample holder to continue the measurement. Cells were analysed by flow cytometry, Rhône Alpes, France, under the convention EFS 16-2066. Ethical approval was gated on forward and side scatter to exclude dead cells and debris. obtained from the Comité de Protection des Personnes Sud Méditerranée I. All experiments involving animals were reviewed and approved by the animal Cell permeability assays. All human and murine primary cells were pre-stained ethics committees of Lyon, France (CECCAPP, protocol number ENS2012_033, before toxin treatment. Human peripheral blood mononuclear cells were stained ENS2013_033, ENS2014_035 and ENS2017_022). for CD14 expression (clone M5E2, BD Biosciences). Bone-marrow-derived murine cells were stained in the presence of a Fcγ​-receptor block (TruStain fcX, Reporting Summary. Further information on experimental design is available in BioLegend) with Ly6G (clone 1A8, BD) and Ly6C (clone AL-21, BD) antibodies for the Nature Research Reporting Summary linked to this article. 20 min at 4 °C. Cells were washed once in PBS 3% FCS and exposed to recombinant proteins in 100 μ​l of PBS with 3% FCS at room temperature. Cells were Data availability. The authors declare that the data supporting the findings of this subsequently analysed by flow cytometry using propidium iodide at 10 μ​g ml−1. For study are available within the paper and the supplementary information, or from competition experiments, human neutrophils were pre-incubated with 10 μ​g ml−1 the corresponding authors upon request. Relevant accession codes are provided mouse anti-hCD45 (clone 4B2, obtained from the ATCC) or isotype control for within the specific Methods sections. 15 min at room temperature. Thirty minutes after subsequent addition of the toxin, cells were analysed by flow cytometry using intracellular staining by 1 μ​g ml−​1 4′​, Received: 23 August 2017; Accepted: 13 April 2018; 6-diamidino-2-phenylindole (DAPI; Molecular Probes/Thermo Fisher). Published online: 7 May 2018 U937 cells were exposed to canonical or non-canonical recombinant proteins and measured for 30 min at 37 °C in a monochromator-based microplate reader −1 References (FLUOstar Omega, BMG Labtech) using 2.5 μ​g ml DAPI. As PVL and HlgCB are 1. Twaites, G. E. et al. Clinical management of Staphylococcus aureus two-component toxins, equimolar concentrations of polyhistidine-tagged LukS-PV, bacteraemia. Lancet Infect. Dis. 11, 208–222 (2011). LukF-PV, HlgC and HlgB were used. Pore formation was defined as a collective 2. Deleo, F. R., Otto, M., Kreiswirth, B. N. & Chambers, H. F. Community- positive DAPI signal and the area under the curve was calculated for comparison. associated meticillin-resistant Staphylococcus aureus. Lancet 375, 1557–1568 (2010). Binding assays. Binding of proteins was measured by incubating cells with directly 3. Fowler, V. G. et al. Efect of an investigational vaccine for preventing labelled proteins for 30 min at room temperature. After washing, binding was Staphylococcus aureus infections afer cardiothoracic surgery: a randomized detected by flow cytometry. For competition experiments, human neutrophils trial. JAMA 309, 1368–1378 (2013). −1 were pre-incubated with 10 μ​g ml of different mouse anti-hCD45 monoclonal 4. Spaan, A. N., Surewaard, B. G., Nijland, R. & van Strijp, J. A. Neutrophils antibodies (clone 4B2, obtained from the ATCC; clone 2D1, BD Biosciences; clone versus Staphylococcus aureus: a biological tug of war. Annu. Rev. Microbiol. F10-89-4, Bio-Rad) or isotype control for 15 min at room temperature. 67, 629–650 (2013). 5. Alonzo, F. III. & Torres, V. J. Te bicomponent pore-forming leucocidins of Lysis assays. U937 cells were exposed to PVL for 1 h followed by a short spin Staphylococcus aureus. Microbiol. Mol. Biol. Rev. 78, 199–230 (2014). down. Supernatants were collected and the presence of lactate dehydrogenase was 6. Vandenesch, F., Lina, G. & Henry, T. Staphylococcus aureus hemolysins, detected using the Cytotox-96 Non-Radioactive Cytotoxicity Assay (Promega), bi-component leukocidins, and cytolytic peptides: a redundant arsenal of following the manufacturer’s instruction. Optical density was measured at 490 nm membrane-damaging virulence factors? Front. Cell Infect. Microbiol. 2, 12 (2012). on a microplate reader (Bio-Rad). Results were normalized to the manufacturer’s 7. Spaan, A. N., van Strijp, J. A. G. & Torres, V. J. Leukocidins: staphylococcal lysis solution (9% v/v Triton X-100). bi-component pore-forming toxins fnd their receptors. Nat. Rev. Microbiol. 15, 435–447 2017). Determination of receptor expression levels. Receptor expression levels were 8. Peraro, M. D. & van der Goot, F. G. Pore-forming toxins: ancient, but never determined as described elsewhere16. For quantification, single-cell suspensions really out of fashion. Nat. Rev. Microbiol. 14, 77–92 (2016). were stained with mouse anti-hC5aR1 (clone S5/1, AbD Serotec), mouse anti- 9. Ferreras, M. et al. Te interaction of Staphylococcus aureus bi-component hCD45 (clone 2D1, BD Biosciences) or isotype controls, followed by FITC- γ​-hemolysins and leucocidins with cells and lipid membranes. Biochim. conjugated goat anti-mouse antibody (Dako). Antibody binding was quantified by Biophys. Acta 1414, 108–126 (1998).

716 Nature Microbiology | VOL 3 | JUNE 2018 | 708–717 | www.nature.com/naturemicrobiology © 2018 Macmillan Publishers Limited, part of Springer Nature. All rights reserved. © 2018 Macmillan Publishers Limited, part of Springer Nature. All rights reserved. NaTuRe MICRoBIoLogy Articles

10. Dalla Serra, M. et al. Staphylococcus aureus bicomponent γ​-hemolysins, HlgA, 38. Alcais, A., Abel, L. & Casanova, J. L. Human genetics of infectious diseases: HlgB, and HlgC, can form mixed pores containing all components. between proof of principle and paradigm. J. Clin. Invest. 119, 2506–2514 (2009). J. Chem. Inf. Model. 45, 1539–1545 (2005). 39. Casanova, J. L. Severe infectious diseases of childhood as monogenic inborn 11. Konig, B., Prevost, G. & Konig, W. Composition of staphylococcal bi- errors of immunity. Proc. Natl Acad. Sci. USA 112, E7128–E7137 (2015). component toxins determines pathophysiological reactions. J. Med. Microbiol. 40. Kung, C. et al. Mutations in the tyrosine phosphatase CD45 gene in 46, 479–485 (1997). a child with severe combined immunodefciency disease. Nat. Med. 6, 12. Yoong, P. & Torres, V. J. Counter inhibition between leukotoxins attenuates 343–345 (2000). Staphylococcus aureus virulence. Nat. Commun. 6, 8125 (2015). 41. Tchilian, E. Z. et al. A deletion in the gene encoding the CD45 antigen in a 13. DuMont, A. L. et al. Staphylococcus aureus LukAB cytotoxin kills human patient with SCID. J. Immunol. 166, 1308–1313 (2001). neutrophils by targeting the CD11b subunit of the integrin Mac-1. Proc. Natl 42. Tchilian, E. Z. et al. Te exon A (C77G) mutation is a common cause of Acad. Sci. USA 110, 10794–10799 (2013). abnormal CD45 splicing in humans. J. Immunol. 166, 6144–6148 (2001). 14. Spaan, A. N. et al. Te staphylococcal toxin Panton–Valentine leukocidin 43. Lee, H. et al. Human C5aR knock-in mice facilitate the production and targets human C5a receptors. Cell Host Microbe 13, 584–594 2013). assessment of anti-infammatory monoclonal antibodies. Nat. Biotechnol. 24, 15. Reyes-Robles, T. et al. Staphylococcus aureus leukotoxin ED targets the 1279–1284 (2006). chemokine receptors CXCR1 and CXCR2 to kill leukocytes and promote 44. Birling, M. C., Dierich, A., Jacquot, S., Herault, Y. & Pavlovic, G. Highly- infection. Cell Host Microbe 14, 453–459 (2013). efcient, fuorescent, locus directed cre and FlpO deleter mice on a pure 16. Spaan, A. N. et al. Te staphylococcal toxins γ​-haemolysin AB and CB C57BL/6N genetic background. Genesis 50, 482–489 (2012). diferentially target phagocytes by employing specifc chemokine receptors. 45. van de Weijer, M. L. et al. A high-coverage shRNA screen identifes Nat. Commun. 5, 5438 (2014). TMEM129 as an E3 ligase involved in ER-associated protein degradation. 17. Koop, G. et al. Identifcation of LukPQ, a novel, equid-adapted leukocidin of Nat. Commun. 5, 3832 (2014). Staphylococcus aureus. Sci. Rep. 7, 40660 (2017). 46. van Diemen, F. R. et al. CRISPR/Cas9-mediated genome editing of 18. Spaan, A. N. et al. Staphylococcus aureus targets the Duffy antigen herpesviruses limits productive and latent infections. PLoS Pathog. 12, receptor for chemokines (DARC) to lyse erythrocytes. Cell Host Microbe e1005701 (2016). 18, 363–370 2015). 47. Blasi, E. et al. Selective immortalization of murine macrophages from fresh 19. Vrieling, M. et al. Bovine Staphylococcus aureus secretes the leukocidin bone marrow by a raf/myc recombinant murine retrovirus. Nature 318, LukMF’ to kill migrating neutrophils through CCR1. mBio 6, e00335 (2015). 667–670 (1985). 20. Alonzo, F. III. et al. CCR5 is a receptor for Staphylococcus aureus leukotoxin 48. Perret, M. et al. Cross-talk between S. aureus leukocidins-intoxicated ED. Nature 493, 51–55 (2013). macrophages and lung epithelial cells triggers chemokine secretion in an 21. Spaan, A. N. et al. Diferential interaction of the staphylococcal toxins infammasome-dependent manner. Cell. Microbiol. 14, 1019–1036 (2012). Panton–Valentine leukocidin and γ​-hemolysin CB with human C5a receptors. 49. Garnier, F. et al. Pneumonia and new methicillin-resistant Staphylococcus J. Immunol. 195, 1034–1043 (2015). aureus clone. Emerg. Infect. Dis. 12, 498–500 (2006). 22. Tawk, M. Y. et al. Internalization of staphylococcal leukotoxins that bind and 50. Gauduchon, V., Werner, S., Prevost, G., Monteil, H. & Colin, D. A. Flow divert the C5a receptor is required for intracellular Ca2+ mobilization by cytometric determination of Panton–Valentine leucocidin S component human neutrophils. Cell. Microbiol. 17, 1241–1257 (2015). binding. Infect. Immun. 69, 2390–2395 (2001). 23. Labandeira-Rey, M. et al. Staphylococcus aureus Panton–Valentine leukocidin 51. Meyer, F., Girardot, R., Piemont, Y., Prevost, G. & Colin, D. A. Analysis of the causes necrotizing pneumonia. Science 315, 1130–1133 (2007). specifcity of Panton–Valentine leucocidin and gamma-hemolysin F 24. Bubeck Wardenburg, J., Bae, T., Otto, M., Deleo, F. R. & Schneewind, O. component binding. Infect. Immun. 77, 266–273 (2009). Poring over pores: α-hemolysin​ and Panton–Valentine leukocidin in 52. Mubaiwa, T. D. et al. Te glycointeractome of serogroup B Neisseria Staphylococcus aureus pneumonia. Nat. Med. 13, 1405–1406 (2007). meningitidis strain MC58. Sci. Rep. 7, 5693 (2017). 25. Diep, B. A. et al. Polymorphonuclear leukocytes mediate Staphylococcus aureus Panton–Valentine leukocidin-induced lung infammation and injury. Acknowledgements Proc. Natl Acad. Sci. USA 107, 5587–5592 (2010). We thank L. Scheepmaker and P. C. Aerts (University Medical Center Utrecht, Utrecht, 26. Cremieux, A. C. et al. Panton–Valentine leukocidin enhances the severity of The Netherlands) for technical support, C. Badiou (CIRI Inserm U111, Lyon, France) community-associated methicillin-resistant Staphylococcus aureus rabbit and G. Prevost (Strasbourg University, Strasbourg, France) for providing toxins and osteomyelitis. PLoS ONE 4, e7204 (2009). Y. Benito (CIRI Inserm U111) for providing S. aureus strains; PBES (J. F. Henry), 27. Diep, B. A. et al. Contribution of Panton–Valentine leukocidin in lentivectors production facility (C. Costa) and flow cytometry platforms of SFR community-associated methicillin-resistant Staphylococcus aureus Biosciences Gerland—Lyon Sud. This work is supported by grants from the Agence pathogenesis. PLoS ONE 3, e3198 (2008). Nationale de la Recherche (ANR-12-BSV3-0003 to F.V. and T.H.), the Finovi foundation 28. Lipinska, U. et al. Panton–Valentine leukocidin does play a role in the early (to T.H.), the Australian National Health and Medical Research Council (1071659 and stage of Staphylococcus aureus skin infections: a rabbit model. PLoS ONE 6, 1138466 to M.P.J. and 1108124 to M.P.J. and C.J.D.) and the Dutch Cancer Society e22864 (2011). (UU 2012-5667 to R.J.L.). This work was performed within the framework of LABEX 29. Kobayashi, S. D. et al. Comparative analysis of USA300 virulence ECOFECT (ANR-11−​LABX-0048) of Université de Lyon and ANR ‘Investissements determinants in a rabbit model of skin and sof tissue infection. J. Infect. Dis. d’Avenir’ (ANR-11-IDEX-0007). 204, 937–941 (2011). 30. Shallcross, L. J., Fragaszy, E., Johnson, A. M., & Hayward, A. C. Te role of the Panton-Valentine leucocidin toxin in staphylococcal disease: a systematic Author contributions review and meta-analysis. Lancet Infect. Dis. 13, 43–54 (2013). A.T.T., M.V.G., B.W.B., F.V., T.H. and A.N.S. conceptualized the study. A.T.T., M.V.G., 31. Tseng, C. W. et al. Increased susceptibility of humanized NSG mice to R.J.L., P.-J.A.H., K.P.M.V.K., C.J.D., M.P.J., T.H. and A.N.S. designed the methodology. Panton–Valentine leukocidin and Staphylococcus aureus skin infection. PLoS A.T.T., M.V.G., P.A., A.M., J.P.J., C.J.C.D.H., E.B., C.J.D., T.H. and A.N.S. conducted the Pathog. 11, e1005292 (2015). investigation. E.K., C.J.C.D.H., M.B., C.J.D., M.P.J. and M.T.M. provided resources. G.L., 32. Prince, A., Wang, H., Kitur, K. & Parker, D. Humanized mice exhibit F.V., J.A.G.V.S., P.-J.A.H. and T.H. provided funding. A.T.T., M.V.G., T.H. and A.N.S. increased susceptibility to Staphylococcus aureus pneumonia. J. Infect. Dis. wrote the paper. R.J.L., P.-J.A.H., T.H. and A.N.S. provided supervision. 215, 1386–1395 (2017). 33. Monk, P. N., Scola, A. M., Madala, P. & Fairlie, D. P. Function, structure and Competing interests therapeutic potential of complement C5a receptors. Br. J. Pharmacol. 152, The authors declare no competing interests. 429–448 (2007). 34. Otter, J. A. & French, G. L. Molecular epidemiology of community-associated meticillin-resistant Staphylococcus aureus in Europe. Lancet Infect. Dis. 10, Additional information 227–239 (2010). Supplementary information is available for this paper at https://doi.org/10.1038/ 35. Hermiston, M. L., Xu, Z. & Weiss, A. CD45: a critical regulator of signaling s41564-018-0159-x. thresholds in immune cells. Annu. Rev. Immunol. 21, 107–137 (2003). Reprints and permissions information is available at www.nature.com/reprints. 36. Lowy, F. D. Staphylococcus aureus infections. N. Engl. J. Med. 339, 520–532 1998). 37. Gillet, Y. et al. Association between Staphylococcus aureus strains carrying gene Correspondence and requests for materials should be addressed to T.H. or A.N.S. for Panton–Valentine leukocidin and highly lethal necrotising pneumonia in Publisher’s note: Springer Nature remains neutral with regard to jurisdictional claims in young immunocompetent patients. Lancet 359, 753–759 (2002). published maps and institutional affiliations.

Nature Microbiology | VOL 3 | JUNE 2018 | 708–717 | www.nature.com/naturemicrobiology 717 © 2018 Macmillan Publishers Limited, part of Springer Nature. All rights reserved. © 2018 Macmillan Publishers Limited, part of Springer Nature. All rights reserved. nature research | reporting summary

Andras N Spaan Corresponding author(s): NMICROBIOL-17081692

Reporting Summary Nature Research wishes to improve the reproducibility of the work that we publish. This form provides structure for consistency and transparency in reporting. For further information on Nature Research policies, see Authors & Referees and the Editorial Policy Checklist.

Statistical parameters When statistical analyses are reported, confirm that the following items are present in the relevant location (e.g. figure legend, table legend, main text, or Methods section). n/a Confirmed The exact sample size (n) for each experimental group/condition, given as a discrete number and unit of measurement An indication of whether measurements were taken from distinct samples or whether the same sample was measured repeatedly The statistical test(s) used AND whether they are one- or two-sided Only common tests should be described solely by name; describe more complex techniques in the Methods section. A description of all covariates tested A description of any assumptions or corrections, such as tests of normality and adjustment for multiple comparisons A full description of the statistics including central tendency (e.g. means) or other basic estimates (e.g. regression coefficient) AND variation (e.g. standard deviation) or associated estimates of uncertainty (e.g. confidence intervals)

For null hypothesis testing, the test statistic (e.g. F, t, r) with confidence intervals, effect sizes, degrees of freedom and P value noted Give P values as exact values whenever suitable.

For Bayesian analysis, information on the choice of priors and Markov chain Monte Carlo settings For hierarchical and complex designs, identification of the appropriate level for tests and full reporting of outcomes Estimates of effect sizes (e.g. Cohen's d, Pearson's r), indicating how they were calculated

Clearly defined error bars State explicitly what error bars represent (e.g. SD, SE, CI)

Our web collection on statistics for biologists may be useful.

Software and code Policy information about availability of computer code Data collection Microsoft Excel and Graphpad Prism

Data analysis Graphpad Prism

For manuscripts utilizing custom algorithms or software that are central to the research but not yet described in published literature, software must be made available to editors/reviewers upon request. We strongly encourage code deposition in a community repository (e.g. GitHub). See the Nature Research guidelines for submitting code & software for further information.

Data

Policy information about availability of data March 2018 All manuscripts must include a data availability statement. This statement should provide the following information, where applicable: - Accession codes, unique identifiers, or web links for publicly available datasets - A list of figures that have associated raw data - A description of any restrictions on data availability

Where applicable, accession codes are provided. No restrictions on data availability apply.

1 nature research | reporting summary Field-specific reporting Please select the best fit for your research. If you are not sure, read the appropriate sections before making your selection. Life sciences Behavioural & social sciences For a reference copy of the document with all sections, see nature.com/authors/policies/ReportingSummary-flat.pdf

Life sciences

Study design All studies must disclose on these points even when the disclosure is negative. Sample size Sample size was determined following preliminary experiments in order to limit mice number in agreement with the rules of the local ethic committee on animal experimentations. Experimental size numbers were based on previous experiments showing that the size sample used for the reported infection models are sufficient (Spaan, Nat Commun 2014; Spaan, Cell Host Microbe 2015).

Data exclusions No data were excluded from the analyses.

Replication Data from in vivo experiments were generated using multiple independent experiments. Data from primary human or murine cells were generated using at least three independent individual donors. Data from cell lines were generated using at least three independent biological replicates.

Randomization For in vivo experiments, 6-12 weeks old mice were randomized matching for weight and sex.

Blinding No blinding was performed for in vivo experiments. CFU counts were counted in an unbiased and automated manner using easy spiral.

Materials & experimental systems Policy information about availability of materials n/a Involved in the study Unique materials Antibodies Eukaryotic cell lines Research animals Human research participants

Unique materials Obtaining unique materials Human C5aR1-knock in mice, cell lines, and toxins are readily available from the authors for non profit research under material transfer agreement.

Antibodies Antibodies used All monoclonal antibodies used are supplied in the Materials and Methods section of the study, including manufacturer and clone numbers.

Validation Validation was based on technical data sheets provided by the manufacturer. Where necessary, specific controls were used as specified in the figures and figure legends.

Eukaryotic cell lines Policy information about cell lines Cell line source(s) U937 human monocytic cells (ATCC). March 2018 Authentication None of the cell lines used have been authenticated.

Mycoplasma contamination All cell lines were tested negative for mycoplasma contamination.

Commonly misidentified lines No commonly misidentified cell lines were used. (See ICLAC register)

2 Research animals nature research | reporting summary Policy information about studies involving animals; ARRIVE guidelines recommended for reporting animal research Animals/animal-derived materials hC5aR1KI mice were generated as previously described (Lee, Nat Biotechnol 2006) at the Institut Clinique de la souris (Ilkirch-Graffenstaden, France) using standard knock-in techniques. hC5aR1KI or C57BL6/N (WT, Charles River) mice, aged between 6 and 12 weeks and matched for weight and sex were used for obtaining bone marrow derived leukocytes, or for infection experiments. Human research participants Policy information about studies involving human research participants Population characteristics This study involves the use of human neutrophils and peripheral blood mononuclear cells (PBMC) isolated from peripheral blood from healthy volunteers. This was performed in accordance with the METC (local University Medical Center Utrecht) ethical committee approved procedure (Protocol #METC-17-125/C), which is compliant with Dutch and EU legislation. The UMCU has a donor system with the specific purpose to obtain blood for research purposes. The blood was drawn by UMCU employees, then transported to the laboratory in unlabelled tubes. The total amount did not exceed 50 ml of blood per donation. To ensure the protection of privacy, the blood samples were anonymously processed and used in the research project at hand. The blood was pooled and subsequently added to a Ficoll-paque gradient. Neutrophils and PBMC were isolated from the gradient, and stored in refrigeration for one day maximum. In this way, personal information was never linked to the original donors. Method-specific reporting n/a Involved in the study ChIP-seq Flow cytometry Magnetic resonance imaging

Flow Cytometry Plots Confirm that: The axis labels state the marker and fluorochrome used (e.g. CD4-FITC). The axis scales are clearly visible. Include numbers along axes only for bottom left plot of group (a 'group' is an analysis of identical markers). All plots are contour plots with outliers or pseudocolor plots. A numerical value for number of cells or percentage (with statistics) is provided. Methodology Sample preparation Bone marrow of mice was harvested and immune cells collected. For analysis of complemented murine macrophages, adherent macrophages were collected by washing the plate once with PBS and incubating it with Versene (ThermoFisher Scientific) for 5 min at room temperature. Human leukocytes were isolated by Ficoll/Histopaque centrifugation. When required, hypotonic lysis of residual erythrocytes was performed by a 30 second incubation in sterile water followed by addition of a large volume of PBS.

Instrument BD FACS Verse / BD FACS Canto II

Software FlowJo

Cell population abundance Human neutrophils isolated by Ficoll/Histopaque centrifugation: >99% pure cell population (De Haas, J Exp Med 2004). Murine bone marrow derived leukocytes: >99% neutrophils after gating and specific staining; >90% monocytes after gating and specific staining; >95% lymphocytes after gating and specific staining.

Gating strategy Human PBMC were stained for CD14 expression (clone M5E2, BD-Bioscience). Bone marrow derived murine cells were stained in the presence of Fcγ-receptor block (TruStain fcX, BioLegend) with Ly6G (clone 1A8, BD) and Ly6C (clone AL-21, BD) antibodies. Cells were subsequently analyzed by flow cytometry using propidium iodide (PI) at 10 μg/ml. Tick this box to confirm that a figure exemplifying the gating strategy is provided in the Supplementary Information. March 2018

3