Thermodynamic Characteristization of Di-, Tri-, and Tetranucleotide Loci in Parthenogenetic Lizards Darevskia Unisexualis

See discussions, stats, and author profiles for this publication at: https://www.researchgate.net/publication/226621786

Thermodynamic characteristization of Di-, Tri-, and tetranucleotide loci in parthenogenetic lizards Darevskia unisexualis

Article in Russian Journal of Genetics · August 2009 DOI: 10.1134/S102279540908016X

CITATIONS READS 3 9

2 authors:

Andrey Omelchenko Vitaly I Korchagin Severtsov Institute of Ecology and Evolution Russian Academy of Sciences

15 PUBLICATIONS 54 CITATIONS 43 PUBLICATIONS 168 CITATIONS

SEE PROFILE SEE PROFILE

Some of the authors of this publication are also working on these related projects:

Origin and evolution of parthenogenesis in Squamata View project

Darevskia View project

All content following this page was uploaded by Vitaly I Korchagin on 13 May 2016.

The user has requested enhancement of the downloaded file.

ISSN 1022-7954, Russian Journal of Genetics, 2009, Vol. 45, No. 8, pp. 1004Ð1008. © Pleiades Publishing, Inc., 2009. Original Russian Text © A.V. Omelchenko, V.I. Korchagin, 2009, published in Genetika, 2009, Vol. 45, No. 8, pp. 1143Ð1147.

SHORT COMMUNICATIONS

Thermodynamic Characteristization of Di-, Tri-, and Tetranucleotide Loci in Parthenogenetic Lizards Darevskia unisexualis A. V. Omelchenkoa, b and V. I. Korchagina aInstitute of Gene Biology, Russian Academy of Sciences, Moscow, 119334 Russia e-mail: [email protected] bFilippovich Teaching and Scientiﬁc Center for Biochemistry and Molecular Biology, Moscow Pedagogical State University, Moscow, 119882 Russia e-mail: [email protected] Received October 10, 2008

Abstract—Allelic polymorphism of three microsatellite loci from the genome of parthenogenetic lizard Darevskia unisexualis was characterized using analysis of free energy (Gibbs energy) of the DNA/DNA duplex formation within the stepwise mutational model. It was demonstrated that the number of microsatellite cluster monomericic units would change to decrease the mean free energy of the locus. In addition, based on the analysis of nucleotide composition, the GC content of each locus was evaluated, and belonging of the loci examined to certain isochore families was suggested. DOI: 10.1134/S102279540908016X

Genome instability and microsatellite loci variation structures (cause DNA polymerase lagging), and the remain poorly studied in the organisms with clonal type so-called toroids (special double-stranded DNA struc- of inheritance. It should be noted in this context that tures with 81 bp per turn. The latter structures are actu- microsatellite loci are poorly studied with regard to elu- ally the DNA/DNA duplexes and/or are stabilized at the cidation of quantitative regularities at the level of pri- expense of the formation of given duplexes in the loop- mary and secondary DNA structure. In the present flanking DNA regions [2]. Calculation of thermody- study, using numerical methods of applied informatics, namic characteristics (changes of entropy (∆S), we analyzed the nucleotide composition of individual enthalpy (∆H), Gibbs energy (∆G), of DNA/DNA microsatellite loci, containing microsatellite clusters duplex formation is widely used for different nucle- differing in the repeat unit composition and the struc- otide sequences [3]. However, there is a significant lack ture of the cluster. Furthermore, for allelic variants of of data for microsatellites. these loci, calculation of such thermodynamic charac- Investigation of the microsatellite loci nucleotide teristic as free energy (Gibbs energy) was evaluated at composition is also important because there is a distinct the moment of the secondary structure (DNA/DNA association between the primary structure of DNA mol- duplexes) formation. Molecular genetic interpretation ecule, structural genome organization, and functional of microsatellite expansion dynamics at certain genome compartmentalization of interphase nuclei [4]. This regions of clonally reproduced (parthenogenetic) liz- association most clearly manifests in thermodynamic ards Darevskia unisexualis was performed. classification of the genome regions for the so-called Microsatellite sequences belonging to tandemly isochore families, i.e., discrete, extended, highly organized moderately repeated DNA of eukaryotic homogenous relative to the G + C content DNA genomes attracts considerable attention as factors of regions. The isochors can be classified into a number of genome instability. Microsatellite sequences vary in the “light” and “heavy” (depending on the G + C content) cluster length and the size of the repetitive unit. They families. These include the isochors of L1 and L2 fam- are characterized by high mutation rates ranging from ilies (< 40%), H1 family (~47%), H2 family (~52%), 10–2 to 10–5 depending on the type of microsatellite [1]. and H3 family (>52%) [5]. One of the main mechanisms leading to the appearance, In this study, analysis of thermodynamic character- and providing the development of microsatellite, is the istics was performed using three genomic loci of par- replication fork slippage. This process is based on the thenogenetic species Darevskia unisexualis, containing ability of microsatellite-containing sequences to form microsatellites of different types. Molecular genetic conformational DNA structures, like single-strand analysis of two of these loci, Du214 (GenBank acces- DNA hairpins, loops, i.e., double-strand DNA slippage sion number EU252542) and Du281 (accession number

1004

THERMODYNAMIC CHARACTERISTIZATION OF DI-, TRI-, AND TETRANUCLEOTIDE LOCI 1005

AY442143), was carried out earlier [6, 7]. The Du183 D. unisexualis, each of the loci mentioned is repre- locus (accession number EU252539) was cloned and sented by several alleles, differing in the number of sequenced in the present study. The Du183 polymor- microsatellite units and in the presence stable single phism was typed with the help of PCR followed by nucleotide substitutions within the cluster or in the electrophoresis of amplification products in native and immediately flanking regions. Du183 is represented by denaturing gels (6% PAAG (40% PAA (acrylamide : three allelic variants, while Du214 and Du281 are rep- bisacrylamide, 19 : 1) 50% urea, 37% formamide) for resented by six alleles each. The G+C content for 4 h at 60°ë using the lizard population sample (N = 65), Du183 48.8%, for Du214, 40.9%, and for Du281, ∆ as described earlier [7]. Sequencing of amplification 40.7%. The change of the mean Gibbs energy ( Gm) for products was performed according to the method of these loci showed that microsatellite expansion had Sanger with the ABI PRISM®BigDyeTM Terminator higher effect on this thermodynamic characteristic for v.3.1 reagent kit and subsequent analysis of the reaction Du183, compared to Du214 and Du281. For instance, ∆ products on the automated sequencer DNA ABI for Du183 the Gm of the DNA/DNA duplex formation PRISM 3100-Avant. Nucleotide sequences were was Ð1672 cal/mol, while according to the calculation aligned using the MegAlign 4.05 software program. data without considering the effect of microsatellite ∆ Quantitative data on nucleotide composition and ther- cluster, Gm = Ð1658 cal/mol. For Du214 the values of modynamic characteristics were obtained using self- this index were Ð1629 and Ð1621 cal/mol, and for elaborated OMIKO-MCS v1.1 software program. The Du281, Ð1623 and Ð1635 cal/mol. Note that for Du183 program is based on the algorithm suggested in [8] and and Du214 the increase of the number of microsatellite implying summation of free energy values for all pairs units brings nucleotide sequences of these loci to less of nucleotides along the DNA chain, while free energy energy intensive state, while microsatellite expansion values for nucleotide pairs are taken from [9]. In this in case of the Du281 locus results in the increase of the ∆ case, the free energy of DNA/DNA duplex formation is Gm value. Taking into consideration the data dis- calculated considering the energy of hydrogen bounds cussed, it should be noted that the effects displayed by formation upon WatsonÐCrick interaction of comple- different clusters of complex microsatellite of the mentary nucleotide pairs, as well as considering the Du183 locus were different. Specifically, expansion of energy of stacking interaction of neighboring nucle- (TG)n dinucleotide cluster resulted in the decrease of the ∆ ∆ otides. Since the algorithm is used for nucleotides, pos- Gm value ( Gm = Ð1652 cal/mol). At the same time, the sible nucleotide pairs, discussed in [8] are generated in (ÄG)n dinucleotide expansion led to the increase of the ∆ ∆ random order. In our program, free energy is calculated Gm value up to Gm = Ð1647 cal/mol. Enlargement of for each extended DNA linear chain. Because of this, mono- and trinucleotide cluster led to substantial ∆ ∆ we suggested the algorithm of sequential generation of decrease of Gm, to the value of Gm = Ð1675 cal/mol. all possible nucleotide pairs. It was also suggested that Analogous calculation algorithm was applied to all the mean free energy of DNA sequence should be cal- allelic variants of microsatellite loci examined. Ther- culated as the ratio between the summarized free modynamic characteristics of the loci are demonstrated energy of all possible nucleotide pairs and the total in the table, where allelic variants are organized in number of nucleotides. It is known that there is a stan- accordance to the increase of the sequence size for each dard deviation (error) between the calculated free of the loci. It follows from the table that the tendencies energy values and those observed in biophysical exper- described were typical of all allelic variants of the loci iments. Evaluation of this error showed that in many examined. cases deviation from the regression line (on the com- Interpreting the data obtained in terms of molecular parative plot of predicted and observed ∆G) was not genetics, we consider the genome and the DNA mole- greater than 0.12 kcal/mol. In case of the analysis of cule as a system, consisting of interrelated elements different oligonucleotide DNAs, standard deviation (nucleotides). Stability of the system is determined by between the predicted and experimental ∆G values con- free energy, which is responsible for the direction (for- stituted 0.14 kcal/mol [10]. As shown in [10], similar ward or reverse) of chemical reaction. It also deter- pattern is preserved in case of the analysis of extended mines the conformation (bents and joints) of large DNA stretches. Calculations of absolute errors for the free DNA, RNA, and protein molecules [11]. Each system energy of the base pairs formation based on literature data tends to the state with the lowest free energy. The free were also taken into consideration in our computing energy of two complementary nucleotide chains is min- experiment carried out using the OMIKO-MCS v1.1 soft- imum when they form a double helix. The highest the ware program designed. ability of microsatellite sequences to form the loops of According to the data obtained, Du183 has the size one or several microsatellite units, the higher the nega- of 368 bp and incorporates a complex microsatellite tive value of ∆G upon formation of the DNA/DNA consisting of different microsatellite clusters, which are duplex in the loop-flanking regions. The formation of tightly associated with each other, (TG)n, (ÄG)n, (G)n, loops and slippage of DNA strands during replication and (AGG)n. The 558-bp Du214 locus contains perfect are the key moments in the so-called stepwise mutation microsatellite (GT)n. The 566-bp Du281 locus has tet- model, SMM), according to which changes in the ranucleotide microsatellite (GATA)n. In the genome of length of microsatellite cluster occur sequentially due

RUSSIAN JOURNAL OF GENETICS Vol. 45 No. 8 2009

1006 OMELCHENKO, KORCHAGIN G ∆ error for mean formation, cal/mol Absolute calculation of DNA/DNA duplex G ∆ cal/mol Mean of DNA/DNA duplex formation, G ∆ error for total formation, cal/mol Absolute calculation of DNA/DNA duplex G ∆ cal/mol Total of DNA/DNA duplex formation, % G + C, 368 48.8195 Ð615426201 48.9558 50 Ð324799219 16555 40.9221 Ð337120 40.8 Ð909315223 40.8 8737 Ð355436225 Ð1672 41 Ð358889 9069227 24461 41.5233 Ð362986 41.5 Ð1665 9561 Ð366440 44.98 41.7 9654 Ð369893 Ð1677 Ð1629 Ð380254 9764 44.79 Ð1622 9857 Ð1623 9950 45.11 43.82 10229 Ð1627 43.63 Ð1628 43.66 Ð1629 Ð1631 43.77 43.79 43.82 43.87 allelic variants DNA size, nucleotides Du281 , and AAGAGG 192 47.7 Ð318826 8576 Ð1660 44.65 7 10 Du214 , 10 10 (AGG) (AGG) 5 7 Du183 (G) (G) 8 7 (AGG) (AGG) 7 7 (G) (G) (AG) (AG) 7 7 4 4 21 20 21 24 Microsatellite cluster TAGATATAGATATAGATAGATGATATAGATAGATGATATAGATA 566GATGATATAGATA 197 40.7 204 36.2 Ð902409 208 201 34.3 Ð311489 212 34.3 36 Ð319231 34 24275 Ð325190 Ð317448 8379 Ð331149 8587 Ð1623 8748 8539 Ð1581 8908 Ð1564 43.66 Ð1563 Ð1579 42.53 Ð1562 42.07 42.04 42.48 42.02 GATGATATAGATA 200 34.6 Ð313272 8427 Ð1566 42.13 10 10 9 11 10 11 12 (AG) (AG) 10 10 25 26 29 (TG) TGAG(TG) TGAG(TG) (TG) GTAA(GT) GTAA(GT) GTAA(GT) GTAA(GT) (GT) (GT) (GT) (GATA) (GATA) (GATA) (GATA) (GATA) (GATA) (GATA) variant** Locus*/allelic Du183 2 3 1 Du214 2 4 6 1 3 5 Du281 4 1 6 3 5 2 Notes: * Full insert of recombinant clone; ** of recombinant clone. PCR ampliﬁcant produced on DNA Thermodynamic characteristic of the

RUSSIAN JOURNAL OF GENETICS Vol. 45 No. 8 2009 THERMODYNAMIC CHARACTERISTIZATION OF DI-, TRI-, AND TETRANUCLEOTIDE LOCI 1007 to the increase or reduction of the repeat length by one demonstrated that the numbers of monomeric units of monomeric unit [12]. Based on these data, it can be microsatellite clusters will change to the decrease of the suggested that the changes in microsatellite clusters mean free energy of these sequences. Furthermore, the investigated in the present study will tend to such num- sizes of the Du183 and Du214 2 microsatellites will ber of microsatellite units, which will provide the low- increase, while the size of the Du281 microsatellite will ∆ est Gm value to the whole cluster. Based on thermody- decrease. Based on thermodynamic calculations, namic calculations, it can be expected that changes in molecular genetic interpretation of different polymor- the Du183 and Du214 loci will be directed to the phism levels of the loci examined is given. The reason enlargement of microsatellite clusters, while changes in for the differences observed lies in different free energy Du281 will tend to decrease of microsatellite cluster. In (Gibbs energy) alteration rates upon single mutational ∆ addition, dynamics of the Gm variation among allelic event in each microsatellite in accordance with the step- variants of the loci can serve as an explanation of dif- wise model. Based on comparison and analysis of the ferent polymorphism levels. Specifically, Du214 and GC content of each locus, belonging of the loci exam- Du281 have six allelic variants each, while Du183 has ined to certain isochore families is suggested. three alleles. This finding can be explained in terms that microsatellite variation of Du183 by one monomeric |∆ | ACKNOWLEDGEMENTS unit involves its several cluster, and in terms of Gm and the module of total ∆G corresponds to changes of We thank A. P. Ryskov for critical discussion and Du214 and Du281 microsatellites by several mono- many helpful comments. meric units (see the table). Hence, changes in the microsatellite monomer composition of the Du183 locus, This work was supported by the Russian Founda- during equal time interval and by equal ∆G value, tion for Basic Research (grant nos. 08-04-0668-a, should be lower than in Du214 and Du281. Thus, pop- 07-04-00462-a, and ofi-08-04-12204), the Program of ulations of D. unisexualis accumulate lower numbers of the Presidium of Russian Academy of Sciences the Du183 allelic variants, along with higher numbers “Molecular and Cellular Biology”, Subprogram of the of the Du214 and Du281 allelic variants. Presidium of the Russian Academy of Sciences (AE 142/200404-112) “Dynamics of Plant, Animal and Microsatellite sequences in general, and GT micro- Human Gene Pools”, and the Programs of the President satellites in particular, are able to form numerous non- of the Russian Federation “Leading Scientific Schools” canonical DNA structures. These structures include (grant no. NSh-2107.2008.4) and for support of young G-quadruplexes, parallel duplexes, and triplexes. It is scientists (grant no. MK-4748.2007.4). known that DNA polymerase can lag or delay at stable hairpins, triplexes, and quadruplexes, and the repeat number is critical for formation of different noncanon- REFERENCES ical structures [13]. However, looping of any microsat- 1. Ellegren, H., Microsatellites: Simple Sequences with ellite cluster region, which plays the key role in the Complex Evolution, Nat. Rev. Genet., 2004, vol. 5, stepwise mutation model, can take place only within pp. 435Ð445. the DNA region with linear structure. Hence, it is likely 2. Wells, R.D., Molecular Basis of Genetic Instability of that the number of units in microsatellite clusters, Triplet Repeats, J. Biol. Chem., 1996, vol. 271, no. 6, where slippage of the replication fork happens more pp. 2875Ð2878. often, is such that they are able to form noncanonical 3. SantaLucia, J., Jr. and Hicks, D., The Thermodynamics structures only in very seldom cases. of DNA Structural Motifs, Annu. Rev. Biophys. Biomol. Analysis of nucleotide compositions of the loci Struct., 2004, vol. 33, pp. 415Ð440. showed that these loci were stable in terms of the GC 4. Patrushev, L.I. and Minkevich, I.G., The Problem of the content irrespectively of the sizes of the locus frag- Eukaryote Genome Size, Usp. Biol. Khim., 2007, ments examined. Deviations in the GC content for any vol. 47, pp. 293Ð370. of allelic variant tested were insignificant (see the 5. Lercher, M.J., Smith, N.G.C., Eyre-Walker, A., and table). It can be thus suggested, that GC content of Hurst, L.D., The Evolution of Isochores: Evidence from these loci can be preserved along the regions of 100 to SNP Frequency Distributions, Genetics, 2002, vol. 162, 300 thousand nucleotides. The Du183 locus can be thus pp. 1805Ð1810. attributed to the first family of heavy isochors, which is 6. Omel’chenko, A.V., Korchagin, V.I., Tokarskaya, O.N., characterized by localization in the telomeric regions of and Sevast’yanova, G.A., Study of Microsatellite Dinu- metaphase chromosomes and early replication in the cleotide Sequences in the Genome of Parthenogenetic cell cycle [4]. In this case, Du214 and Du281 should Lizard Darevskia unisexualis, in Perspektivnye naprav- belong to the family of “light” isochors, with different leniya fiziko-khimicheskoi biologii (Priority Directions localization and characterized by late replication. of Physico-Chemical Biology), Proc. XVII Winter Youth Sci. School, Moscow, 2005, p. 60. In conclusion, in this study, thermodynamic charac- 7. Korchagin, V.I., Badaeva, T.N., and Tokarskaya, O.N., teristization of three polymorphic microsatellite loci is Molecular Characterization of Allelic Variants of ∆ presented. Based on calculation of the Gm values, it is (GATA)n Microsatellite Loci in Parthenogenetic Lizards

RUSSIAN JOURNAL OF GENETICS Vol. 45 No. 8 2009 1008 OMELCHENKO, KORCHAGIN

Darevskia unisexualis (Lacertidae), Gene, 2007, 10. SantaLucia, J., A Uniﬁed View of Polymer, Dumbbell, vol. 392, pp. 126Ð133. and Oligonucleotide DNA Nearest-Neighbor Thermo- dynamics, Biochemistry, 1998, vol. 95, pp. 1460Ð1465. 8. Owczarzy, R., Vallone, P.M., and Gallo, F.J., Predicting 11. Siman, N., Nanotechnology and the Double Helix, Sci. Sequence-Dependent Melting Stability of Short Duplex Am., 2007, no. 9, pp. 23Ð31. DNA Oligomers, Biopolymers, 1997, vol. 44, pp. 217Ð 239. 12. Valdes, A.M., Slatkin, M., and Freimer, N.B., Allele Fre- quencies at Microsatellite Loci: The Stepwise Mutation 9. SantaLucia, J., Jr., Allawi, H.T., and Seneviratne, P.A., Model Revisited, Genetics, 1993, vol. 133, pp. 737Ð749. Improved Nearest-Neighbor Parameters for Predicting 13. Siyanova, E.Yu. and Mirkin, S.M., Expansion of Trinu- DNA Duplex Stability, Biochemistry, 1996, vol. 35, cleotide Repeats, Mol. Biol. (Moscow), 2001, vol. 35, pp. 3555Ð3562. no. 2, pp. 208Ð223.

RUSSIAN JOURNAL OF GENETICS Vol. 45 No. 8 2009

View publication stats