bs_bs_banner

Environmental Microbiology (2014) 16(8), 2389–2407 doi:10.1111/1462-2920.12350

Improved group-specific primers based on the full SILVA 16S rRNA gene reference database

Stefan Pfeiffer,1* Milica Pastar,1 Birgit Mitter,1 Introduction Kathrin Lippert,1 Evelyn Hackl,1 Paul Lojan,2 Microbial communities play a tremendous role in ecosys- Andreas Oswald3,4 and Angela Sessitsch1 tem functioning, and are highly important for human, 1Department of Health and Environment, Bioresources animal and plant health. Our understanding of the diver- Unit, AIT Austrian Institute of Technology GmbH, Tulln, sity of complex microbial communities has been boosted Austria. by the establishment of cultivation-independent, PCR- 2Centro de Biologia Cellular y Molecular, UTPL based approaches (Amann et al., 1995), displacing tradi- Universidad Técnica Particular de Loja, Loja, Ecuador. tional cultivation techniques, which are restricted to the 3Integrated Crop Management Division, International culturable component of a microbial community (Staley Potato Center (CIP), Lima, Peru. and Konopka, 1985). In 1997, a new phylogenetic classi- 4Sasakawa Africa Association, Addis Ababa, Ethiopia. fication system for prokaryotes based on 16S rRNA gene Summary sequence variation was proposed (Stackebrandt et al., 1997). Since then, the 16S rRNA gene has served as Quantitative PCR (qPCR) and community finger- standard phylogenetic marker to characterize bacterial printing methods, such as the Terminal Restriction communities. Nowadays, commonly used 16S rRNA Fragment Length Polymorphism (T-RFLP) analysis, gene-based methods to analyse microbial community are well-suited techniques for the examination of structures include large-scale sequencing methods, such microbial community structures. The use of phylum- as 454 amplicon (Margulies et al., 2005) or Illumina and class-specific primers can provide enhanced sen- sequencing (Bentley et al., 2008), offering detailed insight sitivity and phylogenetic resolution as compared with into bacterial community composition and dynamics domain-specific primers. To date, several phylum- and (Pilloni et al., 2012; Székely et al., 2013). Further commu- class-specific primers targeting the 16S ribosomal nity fingerprinting techniques include the Terminal Re- RNA gene have been published. However, many of striction Fragment Length Polymorphism (T-RFLP) or these primers exhibit low discriminatory power denaturing-gradient gel electrophoresis (Collins et al., against non-target bacteria in PCR. In this study, we 2006). In addition, quantitative PCR (qPCR) based on the evaluated the precision of certain published primers in 16S rRNA gene allows the measurement of relative and silico and via specific PCR. We designed new qPCR absolute microbial abundances by overcoming the well- and T-RFLP primer pairs (for the classes Alphaprote- known biases of end point PCR (von Wintzingerode et al., obacteria and Betaproteobacteria, and the phyla 1997; Bustin et al., 2009). For a long time, whole bacterial Bacteroidetes, Firmicutes and Actinobacteria)by communities have been analysed by employing universal combining the sequence information from a public 16S rRNA gene primers, but in recent years more infor- dataset (SILVA SSU Ref 102 NR) with manual primer mation has been obtained on the abundance and behav- design. We evaluated the primer pairs via PCR using iour of higher bacterial taxa in various environments isolates of the above-mentioned groups and via (Fierer et al., 2005; Philippot et al., 2009; Placella et al., screening of clone libraries from environmental soil 2012), enabling more detailed insight into microbial com- samples and human faecal samples. As observed munity dynamics. Although it is difficult to link function to through theoretical and practical evaluation, the higher taxonomic levels, such as phyla or classes, in primers developed in this study showed a higher level some cases a correlation between these groups and func- of precision than previously published primers, thus tional activities has been reported (Fierer et al., 2007; allowing a deeper insight into microbial community Philippot et al., 2010; Placella et al., 2012). Analysis of dynamics. particular taxa rather than of whole communities allows a better understanding of the ecology of different taxa, Received 21 December, 2012; accepted 28 November, 2013. *For correspondence. E-mail stefan.pfeiffer.fl@ait.ac.at or pfeiffer which frequently respond differently to environmental [email protected]; Tel. (+43) 6507068825; Fax (+43) 505503520. factors. For a long time, the design of phylum- and

© 2013 Society for Applied Microbiology and John Wiley & Sons Ltd 2390 S. Pfeiffer et al. class-specific bacterial 16S rRNA gene-based primers libraries from environmental samples and human faecal was limited by the low number of sequences available; samples. We further applied the taxon-specific primers thus, in several cases, primer design was based on few designed in bacterial diversity analysis by T-RFLP profil- sequences of the target taxa (Weisburg et al., 1991; Lane ing of the potato rhizosphere to test which restriction et al., 1992). The establishment of the first public data- enzymes can be used to represent bacterial diversity. base of small subunit RNA genes in 1997, the Ribosomal Database Project (RDP) (Maidak et al., 1997), which com- Results and discussion piles sequences derived from the European Molecular Analysis of published group-specific primers Biology Laboratory (EMBL) and GenBank, has led to the development of primers targeting particular bacterial taxa Taxon-specific bacterial primers at the phylum and class (Overmann et al., 1999). However, the fast rise in level have been developed using manifold approaches, sequence numbers complicated the design of primers. facing the challenge of retaining precision and sensitivity For example, today’s standard 16S rRNA gene database, towards the target taxa in fast-growing ribosomal RNA SILVA (Quast et al., 2013), consists of more than three gene databases. Mühling and colleagues (2008) used million aligned entries (April 2013). To handle this rising a combination of the programs ARB and PRIMROSE amount of sequence data, in silico tools became a neces- (Ashelford et al., 2002) to design primers, whereas other sity for the design of taxon-specific oligonucleotides. PRIM- studies (Bacchetti De Gregoris et al., 2011) performed ROSE (Ashelford et al., 2002) or the probe design and primer design for qPCR based on 20–30 randomly probe match tools of ARB (Ludwig et al., 2004) have been selected sequences of the target groups. Many of these widely used to design phylum- and class-specific PCR primers exhibit a high level of precision and also a high primers (Blackwood et al., 2005; Mühling et al., 2008). sensitivity inside the target group when submitted to in Validation has often been performed through in silico silico analysis tools like ‘RDP Probe Match’. So far, few testing of the primer sequences towards public 16S rRNA studies tested phylum- and class-specific primers in vitro, gene databases, such as RDP-II or Greengenes revealing a lack of precision when they were applied in (DeSantis et al., 2006), evaluating the primer sequence pairs for PCR for clone library construction (Fierer et al., based on percentage values of identities inside the target 2005; Mühling et al., 2008; Bacchetti De Gregoris et al., group (sensitivity) and precision. However, this approach 2011). In this study, we tested target taxon exclusivity of does not provide information on the discriminatory power widely used or recently published group-specific primers. of mismatches. Few studies (Fierer et al., 2005), however, For validation, bacteria isolated from the potato root envi- validated primer precision through screening of clone ronment comprising target and non-target taxa were used libraries of newly designed and published primer pairs, as target in PCR with conditions optimized through the and revealed a considerable amount of non-target application of gradient PCR. Most of the primer pairs sequences. The discrepancy between theoretically re- tested showed amplification of 16S rRNA genes of at least ported and practically proven precision could be one of the non-target strains (Supporting Information explained by the position of the mismatches, which are Table S1), even though theoretical specificities of most often not in the range of the more relevant 3′-end of the primers were high when we checked for sequence identity primer and thus allow the amplification of non-target taxa. in public 16S rRNA databases (Table 1). One explanation The aim of this study was to design new phylum- and for this is the low discriminatory power of the 5′-end class-specific 16S rRNA gene-based primers for relevant of the primer as compared with the 3′-end of the primer, and widely distributed bacterial taxa, including the phyla where the enzyme is active in adding bases against the Actinobacteria, Firmicutes, Bacteroidetes, and the Alpha- template and one single mismatch is in many cases suf- and Betaproteobacteria, which are e.g. suitable for appli- ficient to inhibit PCR (Petruska et al., 1988). So far, in cation in qPCR and bacterial community fingerprint silico primer design tools have been limited to com- analysis, such as the T-RFLP analysis. To overcome the pare sequence identities of one single sequence against difficulties caused by small databases and pure in silico the millions of sequences available in huge public 16S primer design, we present a new approach by designing rRNA databases, such as RDP-II or SILVA. However, primers manually using the ARB editor with a representa- unlike software tools, which design primers for in- tive phylogenetic dataset of 1380 sequences, which main- dividual sequences, the mismatches towards non-target tains the phylogenetic structure of the SILVA small subunit sequences are valued regardless of their position. High (SSU) reference (Ref) 102 non-redundant (NR) database computational power would be demanded to compare tree (262 092 sequences) (Pruesse et al., 2007). We whole class- or phylum-specific datasets consisting of determined the precision and sensitivity of the primers in thousands of sequences against the whole 16S rRNA silico, and validated them thoroughly by performing exclu- public databases. Furthermore, results should be repre- sivity tests and sequence analysis derived from clone sented in a readable format. Nevertheless, the more

© 2013 Society for Applied Microbiology and John Wiley & Sons Ltd, Environmental Microbiology, 16, 2389–2407 03SceyfrApidMcoilg n onWly&Sn Ltd, Sons & Wiley John and Microbiology Applied for Society 2013 ©

Table 1. Sequences and theoretical specificities of newly designed and published phylum-/class-specific primers.

Precisiona Escherichia coli Target group Primer Sequence (5′–> 3′) position RDP SSU Ref 102 NR RSet Reference

Alphaproteobacteria S-C-aProt-0528-a-S-19 CGGTAATACGRAGGGRGYT 528–547 98.3 98.9 96.3 This study S-C-aProt-0689-a-A-21 CBAATATCTACGAATTYCACCT 689–710 94 97.5 97.0 This study Alf28f ARCGAACGCTGGCGGCA 28–44 94.4b 94.5b 96.6 (Ashelford et al., 2002) Alf684r TACGAATTTYACCTCTACA 684–702 75.9 85.9 84.7 (Mühling et al., 2008) ADF681f AGTGTAGAGGTGAAATT 682–698 87.3 97.2 97.9 (Blackwood et al., 2005) ALF968 GGTAAGGTTCTGCGCGTT 968–985 79 84.8 80.4 (Neef, 1997) α682F CIAGTGTAGAGGTGAAATTC 680–699 88.3 99.6 97.9 (Bacchetti De Gregoris et al., 2011) 908αR CCCCGTCAATTCCTTTGAGTT 908–928 7.2 11.8 15.8 (Bacchetti De Gregoris et al., 2011) Betaproteobacteria S-C-bProt-0972-a-S-18 CGAARAACCTTACCYACC 972–989 96.7 97.8 97.3 This study S-C-bProt-1221-a-A-17 GTATGACGTGTGWAGCC 1221–1237 98.1 96.9 97.4 This study Beta359f GGGGAATTTTGGACAATGGG 359–378 97.1 98.0 98.9 (Ashelford et al., 2002) Beta682r ACGCATTTCACTGCTACACG 701–682 98.4 99.0 99.5 (Ashelford et al., 2002) Bet680 TCACTGCTACACGYG 695–680 98.4 99.0 99.5 (Overmann et al., 1999) F948β CGCACAAGCGGTGGAT 932–949 81.4 98.7 99.5 (Gomes et al., 2001) Gammaproteobcateria Gamma395f CMATGCCGCGTGTGTGAA 395–412 87.9 87.4 73.0 (Mühling et al., 2008) Gamma871r ACTCCCCAGGCGGTCDACTTA 871–891 97.1 98.0 99.4 (Mühling et al., 2008) Actinobacteria S-P-Acti-0927-a-S-17 GGRCCCGCACAAGCGGC 927–941 97.9 98.6 99.5 This study bacteria for primers rRNA 16S group-specific Improved S-P-Acti-1154-a-S-19 GADACYGCCGGGGTYAACT 1154–1172 99.6 98.7 99.5 This study niomna Microbiology Environmental S-P-Acti-1339-a-A-18 TCWGCGATTACTAGCGAC 1339–1356 99.6 96.9 99.5 This study Act920F3 TACGGCCGCAAGGCTA 920–935 80.2 85.8 92.3 (Bacchetti De Gregoris et al., 2011) Act1200R TCRTCCCCACCTTCCTCCG 1191–1173 20.7 18.6 23.4 (Bacchetti De Gregoris et al., 2011) S-C-Act-235-a-S-20 CGCGGCCTATCAGCTTGTTG 235–254 96.3 98.8 99.4 (Stach et al., 2003) Bacteroidetes S-P-Bdet-0107-a-S-21 GCACGGGTGMGTAACRCGTAT 107–127 99.5 97.4 97.9 This study S-P-Bdet-0309-a-A-21 GTRTCTCAGTDCCARTGTGGG 309–329 97.1 98.4 96.6 This study cfb967R GGTAAGGTTCCTCGCGTAT 967–98 94.9 98.1 97.7 (Bacchetti De Gregoris et al., 2011) CFB986r GGTAAGGTTCCTCGCGTA 968–985 93.2 97.2 95.5 (Mühling et al., 2008) CFB555f CCGGAWTYATTGGGTTTAAAGGG 555–577 99.7 99.1 93.5 (Mühling et al., 2008) 798cfbF CRAACAGGATTAGATACCCT 779–798 13.4 10.6 10.2 (Bacchetti De Gregoris et al., 2011)

, Firmicutes S-P-Firm-0352-a-S-18 CAGCAGTAGGGAATCTTC 352–369 99.7 99.8 100 This study 16 S-P-Firm-0525-a-A-18 ACCTACGTATTACCGCGG 525–542 96.6 98.3 100 This study 2389–2407 , S-P-Firm-0525-a-S-18 CCGCGGTAATACGTAGGT 525–542 96.6 98.3 100 This study GCLGC354f GCAGTAGGGAATCTTCSR 354–371 99.7 99.8 100 (Meier et al., 1999) Firm350f GGCAGCAGTRGGGAATCTTC 350–369 99.5 99.6 100 (Mühling et al., 2008) Firm814r ACACYTAGYACTCATCGTTT 814–833 97.7 97.7 98.3 (Mühling et al., 2008) 928F-Firm TGAAACTYAAAGGAATTGACG 905–925 54.7 64.6 22.9 (Bacchetti De Gregoris et al., 2011) 1040FirmR ACCATGCACCACCTGTC 1043–1059 98.3 98.7 98.6 (Bacchetti De Gregoris et al., 2011)

a. Percentage of sequence identities falling into the target group. b. Far fewer sequence information available at initial stretch of the 16S rRNA gene compared with other regions. RDP, Ribsomal Database Project II database; search restriction applied: domain bacteria; +/−100 bases of E. coli region of respective primer; SSU Ref 102 NR, SILVA small subunit reference database release 102 non-redundant (released March 2010); RSet, phylogenetically representative set of sequences (1380 sequences) that were used for the design of taxon-specific primers. 2391 2392 S. Pfeiffer et al. precise manual primer design suffers from using a rela- characteristic for Alphaproteobacteria (Supporting Infor- tively low number of selected target and non-target taxa, mation Table S2), and further mismatches occurred in and thus increases the probability of overlooking lower the first five positions from the 3′-end against all other precision due to rarely occurring mismatches or to lose proteobacterial classes and the Actinobacteria in our coverage because of inner-taxonomic discrimination. In comparison with the sequence alignment information our approach, we tried to overcome the drawback of too (SAI) of other groups (Fig. 1). Inside the taxon, the small representative sequence sets by creating a repre- primer showed no aberration at the important 3′-end, sentative database of 1380 high-quality 16S rRNA gene and thus should be able to amplify any of the groups sequences that mirrors the phylogeny and complexity of represented in the analysis (Fig. 2). In our in vitro evalu- the SILVA SSU Ref 102 NR. By manual primer design ation, the exclusivity testing showed no PCR on non- using the editor program of the ARB package, we could target strains (Table 2), and no false positives were overcome the drawbacks of in silico-based design reported in our clone library from potato rhizosphere methods, which lack accuracy in weighing mismatches at samples (Fig. 3). Furthermore, no amplification occurred different primer regions. on human faecal DNA. This goes along with the results from recent studies on bacterial community composition, using high-throughput 16S rRNA gene amplicon Alphaproteobacteria-specific primer pairs sequencing, which rarely located Alphaproteobacteria in Our representative tree included 145 sequences for this environment (Nam et al., 2011; Yatsunenko et al., Alphaproteobacteria out of 21 739 sequences in the 2012; Ling et al., 2013). SILVA SSU Ref 102 NR database. The primers designed To have a primer pair suitable for bacterial diversity specifically for application in qPCR, forward primer S-Sc- analysis, such as T-RFLP, we chose S-Sc-aProt-0528- aProt-0528-a-S-19 and reverse primer S-Sc-aProt-0689- a-S-19 together with the published primer ALF968 a-A-21, encircle the variable region V4 of the 16S rRNA (Neef, 1997) after our exclusivity tests showed only ampli- gene. In the SILVA SSU Ref 102 NR database, 98.9% fication of target DNA using this combination (Table 2). In of the sequences identical to the forward primer and our final evaluation through sequence analysis of even 98.3% in the RDP database were assigned as amplicons from clone libraries obtained from Peru Alphaproteobacteria (Table 1). The specificity is based rhizosphere soil, all PCR products could be assigned to on a universal mismatch at the 3′-end of the primer the Alphaproteobacteria via Blastn. They represented a (position 0) against bacteria from other taxa in the huge diversity of bacteria inside the taxon (14 families) representative sequence set (Supporting Information with no false positives and a highly similar family arrange- Table S2), enhanced with one mismatch against most ment of the qPCR primer pair library (Fig. 3). In our evalu- members of the Actinobacteria and Acidobacteria, and ation of published primer pairs, the combination α682F/ other classes of the Proteobacteria, at position 3, and 908αR (Bacchetti De Gregoris et al., 2011) resulted in one against Bacteroidetes and Acidobacteria at position unspecific amplification members of Firmicutes and 1 (Fig. 1). Within the target group, S-Sc-aProt-0528-a- Gammaproteobacteria at 58°C. The combination Alf28f S-19 was identical to more than 95% of all known (Ashelford et al., 2002) and Alf684r (Mühling et al., 2008) sequences in the reference tree, but showed dissimilar- also amplified 16S rRNA genes of test strains belonging ity at the important 3′-end of the target sequence to the to the genera Variovorax (Betaproteobacteria) and genera Rhodopseudomonas and Gluconacetobacter of Pseudomonas (Gammaproteobacteria) (Supporting Infor- the Rhodospirillaceae (data not shown) and to the mation Table S1), which confirmed the limited discrimina- members of the SAR11 clade (Fig. 2). Bacteria of the tion against these classes that we also observed in our in SAR11 clade are known to be predominant in the ocean silico analysis (Supporting Information Fig. S1). (Morris et al., 2002); thus, it is advised not to apply this primer in marine studies. In our in silico analysis, Betaproteobacteria-specific primer pairs reverse primer S-Sc-aProt-0689-a-A-21 showed preci- sion values of 97.5% for SILVA SSU Ref 102 NR but The Betaproteobacteria are a monophyletic group closely only 94% for the RDP database (Table 1). In our repre- related to the Gamma class of the Proteobacteria, sentative database, Escherichia coli position 689 was comprising the orders Burkholderiales, Methylophilales,

Fig. 1. ARB analysis of primers designed in this study. Primers are matched against sequence alignment information calculated from all representatives of target and non-target phylum/class in the SILVA SSU Ref 102 NR database. Each base pair position is evaluated: Dots (.) indicate a rate of > 95% matches in the target group; small letters > 70% < 95%; x < 70%; IUPAC codes are used when more than one base occurs in > 30% of representatives; white letters in black boxes indicate mismatches towards the primer. IUPAC ambiguity codes: R (A/G), Y (C/T), M (A/C), K (T/G), W (T/A), S (C/G), B (C/T/G), D (A/T/G), H (A/T/C), V (A/C/G), N (A/C/G/T).

© 2013 Society for Applied Microbiology and John Wiley & Sons Ltd, Environmental Microbiology, 16, 2389–2407 Improved group-specific 16S rRNA primers for bacteria 2393

© 2013 Society for Applied Microbiology and John Wiley & Sons Ltd, Environmental Microbiology, 16, 2389–2407 2394 S. Pfeiffer et al.

© 2013 Society for Applied Microbiology and John Wiley & Sons Ltd, Environmental Microbiology, 16, 2389–2407 Improved group-specific 16S rRNA primers for bacteria 2395

Fig. 2. ARB analysis of primers designed in this study. Primers are matched against sequence alignment information calculated from all representatives of selected families of the target phylum/class in the SILVA SSU Ref 102 NR database. Each base pair position is evaluated: Dots (.) indicate a rate of > 95% matches in the target group; small letters > 70% < 95%; x < 70%; IUPAC codes are used when more than one base occurs in > 30% of representatives; white letters in black boxes indicate mismatches towards the primer. IUPAC ambiguity codes: R (A/G), Y (C/T), M (A/C), K (T/G), W (T/A), S (C/G), B (C/T/G), D (A/T/G), H (A/T/C), V (A/C/G), N (A/C/G/T). APhylogenetic nomenclature of the clade Mollicutes is currently under discussion (Davis et al., 2013). BPhylogenetic nomenclature of the clade Negativicutes/Clostridia is currently under discussion (Yutin and Galperin, 2013).

Nitrosomonadales, Neisseriales, Rhodocyclales and the (Ashelford et al., 2002). As a FISH probe, Beta359f was Hydrogenophilales (Garrity, 2010). The newly designed designed to have discriminating bases located in the more primers S-Sc-bProt-0972-a-S-18 and S-Sc-bProt-1221-a- central region of the probe (positions 7 and 12, Supporting A-17 target an area, including the 16S rRNA variable Information Fig. S1). Still, the exclusivity assay showed no regions V6 and V7 (Chakravorty et al., 2007). The region amplification of non-target strains (Table 2). The clone of our forward primer, S-Sc-bProt-0972-a-S-18, was pre- library consisted entirely of target sequences and was viously used for the design of primer F948β (Gomes et al., similar to the rhizosphere library derived from the qPCR 2001), which targets the class of Betaproteobacteria set, with a lower portion of sequences affiliated to the 30 bp positions upstream. S-Sc-bProt-0972-a-S-18 dis- Burkholderiaceae (Fig. 3). All except one sequence criminates against most members of most non-target taxa belonged to four families or unassigned genera of at up to three bases in the last five positions counted from the order Burkholderiales, the one belonged to the the 3′-end (Fig. 1). However, this high rate of theoretical Rhodocyclales (Supporting Information Table S3). We precision goes along with mismatches against most made exclusivity tests of two pairs of published primers: members of the inner-taxon families, Neisseriaceae and one consisting of the universal 16S rRNA primer Eub338f Methylophilaceae, at positions 1 and 2, making their (Lane, 1991) and the specific primer Bet680 (Overmann detection very unlikely (Fig. 2). While Neisseriaceae et al., 1999), and the other one was Beta359f/Beta682r mostly occur in aquatic environments, such as groundwa- published by Ashelford and colleagues (2002). We ter (Wakelin et al., 2011), Methylophilaceae play a major observed unspecific amplification of strains belonging to role in the C1-carbon cycle (Chistoserdova et al., 2007). the Bacillaceae for Eub338f/Bet680 and to Pseudomonas Theoretically, an adaptation of this primer could be pro- for primer pair Beta359f/Beta682r (Supporting Information vided by adding denatured bases at positions 1 and 2, Table S1). Having a more detailed look on the primer while still maintaining one critical mismatch against sequences, we found that the reverse primers, Bet680 members of non-target bacterial taxa at position 0. and Beta682r, contain a Betaproteobacteria-specific base However, it was found that these modifications affected in the central region at E. coli position 690 and one less the stability of the primer and vastly diminished the ampli- specific base at the 3′ terminal area at E. coli position fication efficiency of the primer pair (data not shown). 682 (Supporting Information Fig. S1 and Table S2). The reverse primer, S-Sc-bProt-1221-a-A-17, has a con- However, the latter and more relevant mismatch position siderably weaker mismatch towards many non-target does not discriminate between Betaproteobacteria and bacterial phyla. While the overall number of mismatches the members of Firmicutes (Bacillaceae), and certain against non-target taxa is similar to that of the forward members of Bacteroidetes and Gammaproteobacteria primer (Table 1), those are mainly located near the (Supporting Information Fig. S1). less relevant 5′-end (positions 13 and 14) (Fig. 1, Sup- porting Information Table S2). Still, the discriminative Bacteroidetes-specific primer pairs characteristics of the primer pair were sufficient for our exclusivity assay (Table 2). Furthermore, all 90 clones Bacteroidetes was a class belonging to the phylum derived from the Andean potato rhizosphere soil and CFB (Cytophaga–Flavobacterium–Bacteroides) but has all 80 clones prepared from faecal samples matched been recently assigned as an independent phylum with Betaproteobacteria according to Blastn. The rhizo- (Garrity et al., 2010). According to the new nomencla- sphere sequences were divided into four families, ture, the phylum Bacteroidetes is divided into four with Comamonadaceae being the most represented classes: Bacteroidia, Flavobacteria, Cytophagia and group. All human faeces sequences were members of the sphingolipid-producing Sphingobacteria. Each class Sutterellaceae (Fig. 3). harbours only one order, namely Bacteroidales, Flav- To have a primer pair applicable in fingerprint commu- obacteriales, Cytophagiales and Sphingobacteriales nity analysis, the primer, S-Sc-bProt-1221-a-A-17, was respectively. Their members are widely distributed in dif- combined with Beta359f, a probe designed for the ferent environments, such as sea- and freshwater, soil, or application in fluorescence in situ hybridization (FISH) rumen, and have been associated with the degradation

© 2013 Society for Applied Microbiology and John Wiley & Sons Ltd, Environmental Microbiology, 16, 2389–2407 2396 .Pfeiffer S. tal et 03SceyfrApidMcoilg n onWly&Sn Ltd, Sons & Wiley John and Microbiology Applied for Society 2013 © . Table 2. TestPrime analysis of newly designed primer pairs and PCR exclusivity testing using strains from target and non-target taxa as template.

Precisiona Sensitivityb DNA from bacterial isolates belonging to phylogenetic class/group

3′end Target group Primer pair 0MM 1MM 1MM* 0MM 1MM 1MM* (1MM) Alphaproteobacteria Betaproteobacteria Gammaproteobacteria Bacteroidetes Actinobacteria Firmicutes

Alphaproteobacteria S-C-aProt-0528-a-S-19 99.4 98.7 99.1 69.3 90 85.1 95.1 X – – – – – S-C-aProt-0689-a-A-21 S-C-aProt-0528-a-S-19 99.8 87.9 87.9 66.9 89.6 89.2 99.6 X – – – – – ALF968 Betaproteobacteria S-C-bProt-0972-a-S-18 97.9 97.1 97.1 69.6 82.1 81.4 99.3 – X – – – – S-C-bProt-1221-a-A-17 Beta359f 99.9 96.8 96.9 71.5 88.4 87.8 99.4 – X – – – – S-C-bProt-1221-a-A-17 Bacteroidetes S-P-Bdet-0107-a-S-21 97.5 91.1 90.6 53.1 69.4 63.8 94.6 – – – X – – S-P-Bdet-0309-a-A-21 S-P-Bdet-0107-a-S-21 99.7 98.8 98.8 51.6 66.9 61.4 94.5 – – – X – – cfb967R Actinobacteria S-P-Acti-1154-a-S-19 98.6 97.2 97.2 55.4 74.1 66.7 92.6 – – – – X – S-P-Acti-1339-a-A-18 S-P-Acti-0927-a-S-17 99 52.5 50.8 58.2 75.8 70.3 94.5 – – – – X – S-P-Acti-1339-a-A-18 Firmicutes S-P-Firm-0352-a-S-18 99.7 96.8 98.1 19.7 30 24.6 94.6 – – – – – X S-P-Firm-0525-a-A-18 niomna Microbiology Environmental S-P-Firm-0525-a-S-18 99.4 84.4 86.1 30.4 78.4 76.1 97.7 – – – – – X 1040FirmR

a. Percentage of sequence identities for both primers restricted to the target taxon in SILVA TestPrime analysis (SSU Ref 114 NR) using three different parameters. 0MM, no mismatch allowed; 1MM, 1 mismatch per primer allowed; 1MM*, 1 mismatch per primer allowed, with a no-mismatch zone at the last three bases from 3′-end. b. Percentage of sequence identities for both primers inside the target taxon in SILVA TestPrime analysis (SSU Ref 114 NR) using 3 different parameters. 3′end(1MM), percentage of sequences with no mismatch at the three terminal bases from 3′-end, when one mismatch is allowed. X, PCR product of correct size was amplified from a target strain; –, no PCR amplification. , 16 2389–2407 , Improved group-specific 16S rRNA primers for bacteria 2397

Fig. 3. Amplicon clone libraries for taxon-specific primer pairs, applicable for T-RFLP, deriving from potato rhizosphere soil and human faecal samples. The pie charts show the number of closest NCBI nucleotide blast hits, summed up at the family level.

© 2013 Society for Applied Microbiology and John Wiley & Sons Ltd, Environmental Microbiology, 16, 2389–2407 2398 S. Pfeiffer et al. of complex organic materials (Thomas et al., 2011). The sequences from a strain belonging to Alphaprote- oligonucleotides proposed for qPCR, S-P-Bdet-0107-a- obacteria, even though theoretical precision was high, S-21 and S-P-Bdet-0309-a-A-21, target the 16S rRNA and in the case of CFB555f/cfb967R even exceeded 99% hypervariable region V2 (Chakravorty et al., 2007), one of in our TestPrime analysis (Supporting Information Table the longest and least conserved segments of the 16S S1). While 798cfbF is identical to most sequences in the rRNA gene. For the reverse primer S-P-Bdet-0309-a-A- database, CFB555f possesses taxon-specific bases that 21, high specificity – i.e. 96.6% of identical sequences are not positioned at the last seven positions from the inside the target group of the customized representative 3′-end, and thus more likely allows unspecific amplifica- database – was found, and further confirmed by values of tion (Supporting Information Fig. S1 and Table S2). 98.4% in SILVA SSU Ref 102 NR and 97.1% in the RDP database (Table 1). This is mainly due to strong mis- Actinobacteria-specific primer pairs matches at the last two bases of the 3′-end to all other bacterial phyla in the database (Supporting Information Actinobacteria are known to be abundant and ubiquitous Table S2). Inside the target group of our representative in different environments (Ventura et al., 2007), and to be tree, 131 out of 135 sequences shared the same base of interest in agriculture and medicine due to their produc- succession in this critical range, with all of the deviating tion of bioactive compounds (Kurtböke, 2012). The high members belonging to the family Chitinophagaceae. Our GC content of actinobacterial DNA may lead to an over- forward primer, S-P-Bdet-0107-a-S-21, also discriminated or underestimation of copy numbers, depending on the non-target groups at the terminal 3′ position, but had PCR conditions applied (Dabney and Meyer, 2012). The a second mismatch with most other bacterial phyla at reverse primer-designed S-P-Acti-1339-a-A-18 proved to the less discriminatory position 20 (Fig. 1, Supporting be suitable for both, qPCR and community fingerprinting, Information Table S2). Both S-P-Bdet-0107-a-S-21 and and had a distinctive mismatch at the 3′-end position S-P-Bdet-0309-a-A-21 do not match the 3′-base positions towards all other phyla and classes analysed, with further, of the Chitinophagaceae, making an amplification of many less relevant mismatches towards the region close to the of its members less likely (Fig. 2). Chen and colleagues 5′-end (Fig. 1, Supporting Information Table S2). Inside (2006) suggested a region that is specific for CFB ampli- the target group, the only relevant mismatch (at position fication, neighbouring the variable region V6, with target 2) found in our representative database was against many group-specific bases at the 3′ positions. We, however, genera of the Coriobacteriaceae (Fig. 2), which have chose to use the recently designed primer cfb967R been found as part of the human oral microflora (Dewhirst (Bacchetti De Gregoris et al., 2011) (Table 1, Supporting et al., 2001). The designed forward primers, S-P-Acti- Information Fig. S1), which is an improved version of 1154-a-S-19 and S-P-Acti-0972-a-S-17, have both their CFB967 (Chen et al., 2006), due to an additional mis- phylum-specific base at the 3′-end position (Fig. 2, Sup- match at the 3′-end against all groups in our analysis, porting Information Table S2). Additionally, S-P-Acti-1154- except Epsilonproteobacteria (Supporting Information a-S-19 exhibits various mismatches against other taxa at Fig. S1, Table S2), to be combined with the forward primer many positions, which is unsurprising as the sequence S-P-Bdet-0107-a-S-21, to have a primer pair confining an stretch falls into the downstream end of the variable amplicon long enough to be applied in certain techniques region V7 of the 16S rRNA gene (Chakravorty et al., of community analysis. Both primer combinations showed 2007), a region that proved to be more conserved inside taxon-specific results when tested in PCR using bacterial the phylum Actinobacteria as compared with other groups strains belonging to target and non-target groups (Fig. 1). (Table 2), and were further evaluated by creating clone Inside the target group, S-P-Acti-1154-a-S-19 shared a libraries. Peruvian potato rhizosphere libraries for both similar discrimination pattern towards Coriobacteriaceae primer sets contained only inserts belonging to the as primer S-P-Acti-1339-a-A-18 (Fig. 2). S-P-Acti-0972-a- target group and were of similar consortia (Fig. 3). The S-17 discriminated between Actinobacteria and other taxa clone library derived from human faecal samples con- with a universal mismatch at position 0 (Fig. 1). For all sisted of 51 sequences (all Bacteroidetes), with the three primers designed, around 99% of sequence identi- Rikenellaceae as the largest group (Fig. 3) We tested the ties in public 16S rRNA databases were associated with published primer pairs CFB555f/CFB986r (Mühling et al., the phylum Actinobacteria (Table 1). After obtaining spe- 2008) and cfb798F/cfb967R (Bacchetti De Gregoris cific results from our PCR exclusivity assay (Table 2), the et al., 2011) at temperatures selected via gradient PCR. primer pairs designed for qPCR (S-P-Acti-1154-a-S-19/S- We found that the combination of the more universal P-Acti-1339-a-A-18) and community analysis (S-P-Acti- primer 798cfbF (Table 1) with cfb967R also amplified 0972-a-S-17/S-P-Acti-1339-a-A-18) all were tested with members of Firmicutes (Supporting Information Table S1). the same rhizosphere DNA from Ecuador, resulting in 68 The combination CFB555f/cfb967R additionally amplified clones belonging to 17 families and 76 clones belonging

© 2013 Society for Applied Microbiology and John Wiley & Sons Ltd, Environmental Microbiology, 16, 2389–2407 Improved group-specific 16S rRNA primers for bacteria 2399 to 20 families respectively (Fig. 3). Further, a clone library classes, have mismatches at position 4, and several was made from DNA extracted from human faecal members have mismatches also at position 0, while most samples using the qPCR primer pair, resulting in 61 members of Negativicutes have no mismatches at these sequences, all assigned to Bifidobacteriaceae (Fig. 3, positions. To have a primer pair suitable for community Supporting Information Table S3). analysis, we designed S-P-Firm-0525-a-S-18 as forward In vitro evaluation of primer pairs S-C-Act-235-a-S-20/ primer, which is clearly distinct from other phyla at the 518r and Act920F3/Act1200R performed by Fierer and 3′-end (Fig. 1) and highly precise to Firmicutes colleagues (2005) and by Bacchetti De Gregoris and sequences in public databases (Table 1). We decided to colleagues (2011), respectively, revealed a considerable use this primer as a reverse primer (i.e. S-P-Firm-0525- amount of non-target sequences in clone libraries derived a-A-18) for qPCRs, together with S-P-Firm-0352-a-S-18 from soil and seawater, which was expected given the as forward primer, switching the position of the taxon- relative low percentage of identical sequences, which specific bases from the 3′- to the 5′-end of the primer. The were restricted to the target group for some of the primers precision of the reverse primer S-P-Firm-0525-a-A-18 is (Table 1). In our ARB analysis of group-specific SAI highly reduced due to the switch of the mismatch position (Supporting Information Fig. S1), primer Act1200R had from the 3′- to the 5′-end, although it has been shown that no discriminatory power against Betaproteobacteria the 5′-end can account for preferential amplification of the and several members of Firmicutes, Bacteroidetes and target phyla (Sipos et al., 2007). Together with the high Acidobacteria. For forward primer Act920F3, mismatches discrimination level of S-P-Firm-0352-a-S-18, all of the 70 occur against most representatives of various groups at clones sequences obtained from the rhizosphere soil positions 0 and 2, but theoretical precision was only clone library and all 51 sequences obtained from the 81.1% when both primers were applied together in SILVA human faeces library belonged to the Firmicutes (Fig. 3). TestPrime (Supporting Information Table S1). In our exclu- The results from both clone libraries confirm the results sivity test, Act920F3/Act1200R (Bacchetti De Gregoris obtained for specificity with the theoretical primer pair et al., 2011) showed amplification of DNA isolated from validation using the online tool TestPrime (Klindworth several non-target strains (Supporting Information Table et al., 2013) with the SILVA SSU Ref 114 NR database S1). The primer S-C-Act-235-a-S-20 (Stach et al., 2003) (Table 2). However, the calculated rates for the theoreti- was commonly used in qPCR assays in combination with cal sensitivity of the primer pair is 19.7% (when 0 mis- the universal reverse primer 518r (Muyzer et al., 1993). matches per primer pair are allowed), indicating that This primer pair includes the variable region V3 and parts according to these values only a fraction of the target of V2 of the 16S rRNA gene. Although we observed group should be amplified. This would exclude the ampli- various mismatches against many SAIs of non-target bac- fication of 99.8% of all Firmicutes sequences of the data- terial phyla (Supporting Information Fig. S1), amplification base that are assigned to classes Clostridia and of non-target strains was found (Supporting Information Negativicutes, which encompass 69.3% of the Firmicutes Table S1). sequences in the database. However, the low rate of theoretical sensitivity conflicts with the sequence data derived from the Firmicutes-specific human faeces Firmicutes-specific primer pairs library, which contained a high percentage (74.5%) of The forward primer S-P-Firm-0352-a-S-18, designed clones derived from Clostridia and Negativicutes (Fig. 3). for application in qPCR, targets a stretch containing Thus, it is likely that the above-mentioned mismatches of Firmicutes-specific sequence successions, which have S-P-Firm-0352-a-S-18 will bias the sensitivity of the been described first by Meier and colleagues (1999). Our primer but will not hamper the amplification of classes primer is located two base pairs upstream, thus providing Negativicutes and Clostridia. This was proven by a com- a mismatch against other phyla at the 3′-end position parison between 454 sequencing data generated with the (Fig. 1), and shows a precision value of 100% in our universal primer pair combination 8f (Edwards et al., own database and 99.7% in RDP-II (Table 1). The primer 1989) and 518r and the group-specific clone library also exhibits a strong universal mismatch with most on the human faecal samples. For the second primer sequences from classes Clostridia and Negativicutes pair, which amplifies a longer fragment, S-P-Firm-0525- at position 8 from the 3′-end. Due to the long distance a-S-18 in combination with 1040FirmR, a recently pub- from the 3′-end, this should not inhibit amplification of lished primer (Bacchetti De Gregoris et al., 2011), all target strains, although the primer could be potentially sequences of the rhizosphere library showed to be improved by adding a wobble base at this position phylum-specific and displayed a similar community com- (Fig. 2). Further, most members of the Lachnospiraceae position as the qPCR primer library (Fig. 3). The exclu- and Ruminococcaceae, and certain groups of not dis- sivity testing showed accurate results for both primer tinctly phylogenetically assigned sequences in these pairs (Table 2).

© 2013 Society for Applied Microbiology and John Wiley & Sons Ltd, Environmental Microbiology, 16, 2389–2407 2400 S. Pfeiffer et al.

For the published qPCR primer pair 928F-Firm and relinquished further efforts to design primers. The 1040FirmR, we performed exclusivity testing using the paraphyly of Betaproteobacteria and certain groups of PCR conditions recommended by the authors (Bacchetti Gammaproteobacteria was addressed already several De Gregoris et al., 2011), resulting in amplification of the times and further confirmed by multi-genome alignment target strains and a strain belonging to the Bacteroidetes studies (Williams et al., 2010; Yutin et al., 2012). Never- (Supporting Information Table S1). The primer 928F- theless, primer pair Gam395f/Gam871r (Mühling et al., Firm did not show a characteristic mismatch position 2008) was successful in specific amplification of selected against the taxonomic groups of Gammaproteobacteria target and non-target strains (Supporting Information and Bacteroidetes, while discrimination against most Table S1) in our exclusivity assay, which, however, did sequences of other bacterial groups is due to a mismatch not include strains of this phylogenetically ambiguous close to the less discriminative 5′-end of the primer (Sup- lineage. porting Information Fig. S1). 1040FirmR has a strong mismatch against almost all non-target sequences in the Evaluation of primer-pair sensitivity using TestPrime and public databases at position 8 (E. coli pos 1051) and the 454 sequencing 5′-end position. The 3′-end of the primer does not contain phylum-specific bases. This might have resulted in the In terms of primer pair precision, the results from the amplification of Bacteroidetes strains in our exclusivity exclusivity tests and group-specific clone libraries confirm testing (Supporting Information Table S1). A part of the the results obtained for precision with the theoretical primer (E. coli position 833-822) of Firm814r (Mühling primer pair validation using the online tool TestPrime et al., 2008) is positioned in the V5 variable region, where (Klindworth et al., 2013) with the SILVA SSU Ref 114 NR Firmicutes show a relatively high level of base pair con- database (Table 2). However, published primer pairs that servation when compared with other phylogenetic groups had high percentages of precision in the TestPrime analy- in this analysis. Thus, as the 3′-end does not contain sis (Supporting Information Table S1) amplified non-target phylum-specific bases, the high precision is given by a strains in the exclusivity assays, even though the primer combination of mismatches against non-target taxa pairs had at least one mismatch towards non-targets at between the 5′-end and the centre of the oligonucleotide the last three bases from the 3′-end. The reason for this is (Supporting Information Fig. S1). In our exclusivity assay, that TestPrime provides no information about the number we observed amplification of a strain belonging to the and nature of 3′-end mismatches. It has been shown that Bacteroidetes when combined with primer Firm350f (Sup- one 3′ terminal mismatch influences PCR depending on porting Information Table S1). the type of mismatch but does not necessarily hamper amplification (Huang et al., 1992). On the other hand, amplification of template DNA was avoided if multiple Polyphyly of 16S ribosomal RNA genes 3′-end mismatches or 3′-end mismatches in both primers of Gammaproteobacteria were introduced into standard-size primers (18–24 bp) The Gammaproteobacteria include important pathogenic (Stadhouders et al., 2010). This concludes that only one species, intracellular symbionts as well as a range of 3′-end mismatch in only one primer might not be enough beneficial bacteria, and are distributed over a wide range to avoid amplification, and this should be taken into con- of terrestrial, sea- and freshwater environments. This sideration when evaluating group-specific primers using taxon harbours more genera than any other phylogenetic TestPrime. A more itemized analysis to investigate on the group of the bacterial world, except Firmicutes (Garrity, differences in primer length and type, position, and the 2010). The SILVA reference trees for the 16S rRNA number of 3′-end mismatches, and an in vitro examination and 23S rRNA SILVA LSUParc release 102 (Pruesse of the results, are recommended to assure the specificity et al., 2007) show a missing discrimination between of group-specific primers. Betaproteobacteria and Gammaproteobacteria; more In terms of sensitivity, which is the covered fraction of precisely, the gammaproteobacterial orders Xantho- sequence identities for both primers inside the target monadales, Chromatiales and Thiotrichales share the taxon, our results showed a clear deviation between same root with the Betaproteobacteria. Thus, when we predicted and tested primer sensitivity for certain screened for class-specific bases of our target group groups (Table 2, Supporting Information Table S6). As an in the representative datasets of 16S rRNA (1380 example, Table 2 shows that 53.1% of Bacteroidetes sequences) and 23S rRNA genes (540 sequences), we sequences in the SILVA SSU Ref 114 NR database are failed to identify characteristic bases (> 90% specificity identical to the Bacteroidetes-specific primer pair S-P- in the representative database), which solely target Bdet-0107-a-S-21/S-P-Bdet-0309-a-A-21. If 1 mismatch all orders of our target group, while discriminating per primer was allowed (1MM), we covered 69.4% of against the Betaproteobacteria. Consequentially, we sequences. These sequences could be amplifiable or

© 2013 Society for Applied Microbiology and John Wiley & Sons Ltd, Environmental Microbiology, 16, 2389–2407 Improved group-specific 16S rRNA primers for bacteria 2401 not, depending if the position of the mismatch is situated different potato rhizosphere samples. Although the com- closer to the 3′-end or to the 5′ end of the primer. Of parability is based on the habitat type only, we found the Bacteroidetes-assigned sequences, 63.8% were similarities in the family compositions (Supporting Infor- covered if the mismatch in question was not positioned in mation Table S6). the critical range close to the 3′-end of the primer We additionally evaluated primer pair sensitivity by (1MM*), which indicates that this part of the sequences is comparing the presence of families in the NGS data likely to be amplified. Therefore, the difference between of human faecal samples with our group-specific 1MM and 1MM* represents the fraction of sequences clone libraries. Unlike the rhizosphere comparison, 454 that have at least one mismatch at the last three bases sequencing was done only with some of the human faecal from the 3′-end (in the particular case 5.6%). This means samples that were used for clone library construction. that in the case of Bacteroidetes-specific primer pair Thus, our results demonstrate that almost all NGS- S-P-Bdet-0107-a-S-21/S-P-Bdet-0309-a-A-21, 5.6% of assigned families were retrieved also in the group-specific TestPrime-assigned Bacteroidetes sequences are more clone libraries, but they cannot be used to evaluate the likely to be not amplified by this primer pair, while 94.4% sensitivity of the universal 16S primer pair. The NGS data of the Bacteroidetes sequences that have up to one mis- contained no reads assigned to Actinobacteria and match to each primer, are more likely to be amplified. By Alphaproteobacteria. The only betaproteobacterial family looking at the base-wise partition of the primers S-P- detected was the Sutturellaceae, which was also found Bdet-0107-a-S-21 and S-P-Bdet-0309-a-A-21 in Fig. 2, in the clone library. Concerning Bacteroidetes and we can conclude that this fraction predominantly includes Firmicutes, apart from the Erysipelotrichaceae, NGS data members of the family Chitinophagaceae. Thus, the cal- contained only families, which were also found in the culated 3′-end sensitivity values (if not more than 1MM clone libraries. We suggest that the Erysipelotrichaceae is allowed) add accuracy to the sensitivity values of would be detected if a higher number of clones were the newly designed (Table 2) and published primer pairs available, as they do not contain any important mis- (Supporting Information Table S1). However, in our matches to the primer pair (Fig. 2). example, 30.6% of Bacteroidetes sequences have more By comparison of theoretical primer precision and than one mismatch to at least one of the primers S-P- sensitivity with our in vitro results, we could illustrate that Bdet-0107-a-S-21/S-P-Bdet-0309-a-A-21. Although we in silico primer evaluation gains explanatory power if can calculate the fraction of sequences that have more primer-template mismatches are subjected to an item- than one mismatch but share the same 3′ end, a higher ized analysis. number of 5′ end mismatches increases the probability of reduced or hampered amplification. Conclusions We addressed this uncertainty of TestPrime-based sen- sitivity analysis of group-specific primers by estimating the In this study, we examined the deviation of theoretical concomitance of families in our group-specific clone librar- precision of published primers by comparing results ies and in 454 sequencing data, generated by applying obtained from in silico methods with those of exclusivity the universal 16S rRNA gene primer pair 8f/518r. For testing against target- and non-target DNA. We overcame the highly diverse potato rhizosphere samples, we com- the difficulties of previous approaches and designed new pared the total number of different operational taxonomic primers exclusively targeting the selected taxa to be used units (OTUs) assigned to families of one phylum/class for quantifying their abundance and for studying commu- to the number of the respective group-specific clones nity shifts, e.g. by PCR. Eleven taxon-specific primers of Alphaproteobacteria, Bacteroidetes and Firmicutes. were designed and thoroughly validated for the analy- Despite the much lower amount of sequences available in sis of Alpha- and Betaproteobacteria, Actinobacteria, the clone libraries, all families that had a notable diversity Firmicutes and Bacteroidetes. Ensued from our results in in the 454 library were detected in the clone libraries in silico and lab analyses, the primer pairs developed in (Supporting Information Table S6). In some cases, fami- this study show substantially improved specificity than lies present in the clone libraries were not detected in previously published group-specific primers. The sensitiv- the 454 library. This can be attributed to mismatches of ity of the primers inside the target groups was assured by the universal primer pair 8f/518r. Accordingly, the univer- a detailed sequence analysis on the family level of the sal primer pair does not exceed the percentages of respective taxa targeted by the group-specific primers. TestPrime-based sensitivity in the respective target Most notably, the Alphaproteobacteria-specific primer groups compared with group-specific primers (Supporting S-C-aProt-0528-a-S-19 has one mismatch against the Information Table S7). For Betaproteobacteria and members of the SAR11 clade, suggesting a re-evaluation Actinobacteria, we had no specific sample data available and potential adaptation of the primer before applying it for both datasets; thus, we compared rhizospheres from in marine studies. The newly designed primers will be

© 2013 Society for Applied Microbiology and John Wiley & Sons Ltd, Environmental Microbiology, 16, 2389–2407 2402 S. Pfeiffer et al.

Table 3. Annealing temperatures for taxon-specific primer pairs designed in this study.

Target group AL (bp) Primer Sequence (5′–> 3′) AT (°C) Reference

Alphaproteobacteria 142 S-C-aProt-0528-a-S-19 CGGTAATACGRAGGGRGYT 61 This study S-C-aProt-0689-a-A-21 CBAATATCTACGAATTYCACCT This study 421 S-C-aProt-0528-a-S-19 CGGTAATACGRAGGGRGYT 61 This study ALF968 GGTAAGGTTCTGCGCGTT (Neef, 1997) Actinobacteria 166 S-P-Acti-1154-a-S-19 GRDACYGCCGGGGTYAACT 59 This study S-P-Acti-1339-a-A-18 TCWGCGATTACTAGCGAC This study 340 S-P-Acti-0972-a-S-17 GGRCCCGCACAAGCRGC 59 This study S-P-Acti-1339-a-A-18 TCWGCGATTACTAGCGAC This study Bacteroidetes 181 S-P-Bdet-0107-a-S-21 GCACGGGTGMGTAACRCGTACCCT 61 This study S-P-Bdet-0309-a-A-21 GTRTCTCAGTDCCARTGTGGG This study 840 S-P-Bdet-0107-a-S-21 GCACGGGTGMGTAACRCGTACCCT 61 This study cfb967R GGTAAGGTTCCTCGCGTAT (Bacchetti De Gregoris et al., 2011) Betaproteobacteria 231 S-C-bProt-0972-a-S-18 CGAARAACCTTACCYACC 61 This study S-C-bProt-1221-a-A-17 GTATGACGTGTGWAGCC This study 843 Beta359f GGGGAATTTTGGACAATGGG 55 (Ashelford et al., 2002) S-C-bProt-1221-a-A-17 TGACGTGTGWAGCCCKACC This study Firmicutes 156 S-P-Firm-0352-a-S-18 CAGCAGTAGGGAATCTTC 57 This study S-P-Firm-0525-a-A-18 ACCTACGTATTACCGCGG This study 501 S-P-Firm-0525-a-S-18 CCGCGGTAATACGTAGGT 57 This study 1040FirmR ACCATGCACCACCTGTC (Bacchetti De Gregoris et al., 2011)

AT, annealing temperature; AL, amplicon length. IUPAC ambiguity codes: R (A/G), Y (C/T), M (A/C), K (T/G), W (T/A), S (C/G), B (C/T/G), D (A/T/G), H (A/T/C), V (A/C/G), N (A/C/G/T). [Correction made on 21 April 2014, after first online publication: The reverse complementary sequence of the primers S-P-Firm-0525-a-S-18 and S-P-Firm-0525-a-A-18 in Table 3 (column 4) was incorrect. This is now amended.] applicable in a wide variety of studies on the behaviour of Subsequently, the remaining tree was scanned for single microbial communities in different environments. genus entries and redundant entries were removed. For groups containing sequences from long-branched, phyloge- netically distant groups derived from cultivation-independent Experimental procedures molecular characterization (e.g. clone libraries of insular envi- Primer design ronments), only one high-quality sequence was used to main- tain the branching pattern of the full sequence tree. The PCR primers applicable for qPCR were designed to produce resulting tree contained 1380 16S rRNA gene sequences but short-read PCR products between 150 and 250 bp, as it is conserved the branching pattern and phylogenetic distances known that amplicons longer than 300 bp reduce PCR effi- of the SSU Ref 102 NR tree, and served as our dataset for ciency (Mallona et al., 2011). However, short reads are not classification, phylogenetic analysis and probe design. For suitable for community fingerprinting methods, such as primer design, sequences of the representative tree were T-RFLP, by reducing the potential number of restriction displayed in the ARB editor, where the set was manually sites, and therefore the informational content of this method screened for phylum- and class-specific bases and base (Liu et al., 1997; Egert and Friedrich, 2003). Thus, we successions affiliated to the phylogenetic groups of Alpha-, designed a second set of primer pairs, targeting the same Beta- and Gammaproteobacteria, and Bacteroidetes, phylogenetic groups like the qPCR pairs but targeting Actinobacteria and Firmicutes. Primers were designed with a stretches between 400 and 900 bp of the 16S rRNA gene. focus on sensitivity towards a maximum of sequences inside Primer design based on a representative phylogenetic the target group and 3′-end mismatches (Petruska et al., dataset derived from the quality-checked and aligned 1988) towards non-target groups. To check for occurrence of sequences of the SILVA rRNA database project (Pruesse secondary structures and dimer formation, primers were ana- et al., 2007) (http://www.arb-silva.de), which is the standard lysed with OLIGO7 software (Molecular Biology Insights, database of small subunit (16S) and large subunit (23S) Cascade, CO, USA) and further assayed via the ’Probe ribosomal RNA genes. The reference database SSU Ref 102 Match’ tool of the ARB program by matching the oligonucleo- NR, released in March 2010, which comprises 262 092 full- tides against the full SILVA SSU Ref 102 NR dataset loaded length, quality-checked and aligned bacterial 16S rRNA gene into the .pt server. To compare our new primers (Table 3) sequences, was downloaded from the SILVA database and against a second public 16S rRNA gene sequence collection, applied using the ARB software package (Ludwig et al., 2004). we tested the primers by using the ‘probe match tool’ within By using this tool, the aligned SILVA sequences are displayed the RDP-II database (Maidak et al., 2001). in a phylogenetic tree through its configuration as an .arb file, set up by ‘The All-Species Living Tree Project’ (Yarza et al., DNA isolation from complex rhizosphere soils and 2010; Munoz et al., 2011). To have a well-arranged tree, human faecal samples representing the phylogeny from the SILVA tree but with a largely reduced number of sequences, entries assigned to Potato plants were harvested in the Andes in Huancayo, eukaryotes and Archaea were removed from the database. Peru, and in Saraguro Gueledel, Ecuador. Plants were care-

© 2013 Society for Applied Microbiology and John Wiley & Sons Ltd, Environmental Microbiology, 16, 2389–2407 Improved group-specific 16S rRNA primers for bacteria 2403 fully harvested with the complete root system, and the soil mental PCR products were visualized using agarose gel elec- attached to the roots was brushed off and sieved through a trophoresis and ligated with the TA vector of the StrataClone 1 mm sieve. To preserve rhizosphere microbial community PCR Cloning kit (Agilent Technologies, Santa Clara, CA, DNA and to maintain the community structure at the time USA), and further processed according to the manufacturer’s point of sampling, fresh samples were heated at 85°C for 2 h, recommendations. Depending on the primer pair tested, a treatment that, according to prior testing, conserved the between 51 and 148 clones were sequenced at LGC community composition. Samples were transferred to Austria genomics (LGC Genomics GmbH, Berlin, Germany) using within 2 weeks and stored at −20°C. For DNA extraction, we the vector-bound T3 primer. aimed to reduce various biases related to DNA extraction We evaluated the sensitivity of the newly designed primer (Mitchell and Takacs-Vesbach, 2008; Pan et al., 2010), and pairs by comparing the results of the group-specific clone performed successive extractions to decrease preferential libraries with the 454 amplicon sequencing data of the same extraction of gram-negative bacteria or bacteria with thinner samples, generated by using universal 16S rRNA gene cell walls (Feinstein et al., 2009) and to reduce the presence primers. These included two of the eight human faecal of low molecular contaminants, such as humic organic sub- samples (SRS498367 and SRS498638) that were pooled stances and heavy metals through plug diffusion (Moreira, for the construction of the group-specific clone libraries and 1998). We, therefore, combined classical phenol-chloroform- the two potato rhizospheres from Peru (SRS498350 and isoamyl DNA extraction with a modified bead-beating proto- SRS498351), which were used also for the Firmicutes, col from the FastDNA spin kit for soil (MP Biomedicals, LLC, Alphaproteobacteria and Bacteroidetes libraries. In both Solon, OH, USA). habitats, 16S rRNA genes had been amplified using the uni- Human faecal samples were obtained from 77 patients versal primer pair 8f/518r, with the forward primer containing recruited for a clinical study (FFG FEMtech FTI-project a sample-specific barcode sequence (Kuffner et al., 2012). 826210) at the Department of Internal Medicine I, Paracelsus The raw 454 data were processed using QIIME (Caporaso Medical University, Salzburg, Austria. DNA was extracted et al., 2010) with default parameters. The picking of OTUs, using the Maxwell 16 System together with the Maxwell 16 the removal of singletons and chimera checking were per- Cell DNA Purification Kit (Promega, Madison, WI, USA), with formed using the usearch quality filtering (Edgar et al., 2011). the addition of lysozyme, as recommended for bacterial We assigned taxonomy using the RDP classifier (Wang et al., samples by the manufacturer. All study participants gave their 2007) with a minimum confidence score of 85%. Finally, the written informed consent, and the study was approved by the OTU tables were rarefied to 2000 reads, and OTUs that were ethical committee of Land Salzburg. The DNA samples were taxonomically unassigned above the family level were sent to AIT in Tulln on dry ice for further processing. removed.

Evaluation of published and newly designed Sequence and diversity analysis primer pairs Sequences were manually verified and trimmed by removing PCR conditions were optimized using genomic DNA from vector and primer sequences using BIOEDIT (http://www bacterial isolates of known taxonomy (Supporting Information .mbio.ncsu.edu/bioedit/). Sequences were checked for Table S4). PCR amplifications were carried out in 20 μl chimera formation using BELLEROPHON (Huber et al., 2004) volumes, containing 1xHOT FIREPol EvaGreen qPCR Mix and DECIPHER (Wright et al., 2012), and submitted to (Solis Biodyne, Tartu, Estonia), and were performed in a nucleotide Blast of the National Center for Biotechnology Biorad CFX cycler (Bio-Rad Laboratories, Hercules, CA, Information (NCBI). Phylogenetically affiliated sequences USA). Gradient PCRs were performed to optimize PCR effi- were sorted into families to display the inner-taxon diversity ciency. The temperature range for gradient PCR was chosen and to compare sequence information of clone libraries gen- upon the melting temperatures calculated using OLIGO7. erated with primers targeting the same phylogenetic group. Optimized PCR conditions for the primer pairs used in this study are displayed in Table 3. To obtain additional confirma- Bacterial community profiling by T-RFLP tion on the specificity of the PCR assays, newly designed and published primer pairs were tested with DNA of For terminal restriction length polymorphism (T-RFLP) analy- phylogenetically characterized bacterial isolates belonging to sis, group-specific PCRs were performed with newly target and non-target groups (Table 2, Supporting Informa- designed primer pairs applicable for bacterial diversity analy- tion Table S1). Additionally, we used the novel in silico primer sis, labelled with 6-carboxylfluorescein (FAM) under the con- pair evaluation tool TestPrime (Klindworth et al., 2013) to ditions described in Table 3. All reactions were performed in evaluate newly and published primer pairs by screening both duplicates. Restriction enzymes and the primer end for FAM primers of each pair simultaneously against the sequence labelling were selected according to simulated T-RFLP collection RefNR of the SILVA database SSU 114 using three dendrograms created by the program TRIFLE (Junier et al., different parameters, 0 mismatches, 1 mismatch per primer 2008) after feeding the software with sequence information of and 1 mismatch per primer with an additional 0-mismatch group-specific clone libraries and the primer sequences zone of three bases at the 3′-end (Table 2, Supporting Infor- (Table 1). Pooled duplicates were cleaned by centrifugation mation Table S1). through 96-well filter column plates containing Sephadex Precision of newly designed primers was furthermore G-50 (GE Healthcare, Waukesha, WI, USA) at 2800 r.p.m. for evaluated by sequence analysis of clone libraries obtained 3 min. Five microlitre of eluates were visualized on agarose from potato rhizosphere and human faecal samples. Environ- gels (1%) using the BioSpectrumImaging System (UVP,

© 2013 Society for Applied Microbiology and John Wiley & Sons Ltd, Environmental Microbiology, 16, 2389–2407 2404 S. Pfeiffer et al.

Upland, CA, USA) and quantified by comparing band signal Phylum- and class-specific PCR primers for general micro- intensities with those of 2.5 μl of Gene Ruler DNA Ladder Mix bial community analysis. Appl Environ Microbiol 71: 6193– 100–1000 bp (Thermo Fisher Scientific, Waltham, MA, USA) 6198. using ImageJ (http://rsbweb.nih.gov/ij/index.html). PCR prod- Bustin, S.A., Benes, V., Garson, J.A., Hellemans, J., Huggett, ucts (150 ng) were digested with 5 U of the selected restriction J., Kubista, M., et al. (2009) The MIQE guidelines: enzyme (Thermo Fisher Scientific) at 37°C for 4 h and purified minimum information for publication of quantitative real- using the SPIN PCRapace kit (Stratec Biomedical AG, time PCR experiments. Clin Chem 55: 611–622. Birkenfeld, Germany). Five microlitre of purified amplicons Caporaso, J.G., Kuczynski, J., Stombaugh, J., Bittinger, K., were mixed with 15 μl HiDi formamide (Applied Biosys- Bushman, F.D., Costello, E.K., et al. (2010) QIIME allows tems, Carlsbad, CA, USA) and 0.3 μl of internal size analysis of high-throughput community sequencing data. standard (MapMarker X-Rhodamine Labeled 50–1000 bp, Nat Methods 7: 335–336. Bioventures, Murfreesboro, TN, USA). FAM-labelled terminal Chakravorty, S., Helb, D., Burday, M., Connell, N., and restriction fragments were denatured at 95° for 3 min, chilled Alland, D. (2007) A detailed analysis of 16S ribosomal RNA on ice and detected with a 16-capillary 3130xl Genetic gene segments for the diagnosis of pathogenic bacteria. J Analyzer (Applied Biosystems). Raw electropherograms were Microbiol Methods 69: 330–339. displayed in the GeneMapper software (Applied Biosystems) Chen, X., Zeng, Y., and Jiao, N. (2006) Development and and showed to be congruent with the simulated T-RFLP evaluation of specific 16S rDNA primers for marine profiles calculated with TRIFLE. Supporting Information Fig. Cytophaga–Flavobacteria cluster. Mol Ecol Notes 6: 1278– S2 shows the electropherograms of all five taxonomic groups 1281. from Peruvian rhizosphere soil. Chistoserdova, L., Lapidus, A., Han, C., Goodwin, L., Saunders, L., Brettin, T., et al. (2007) Genome of Methylobacillus flagellatus, molecular basis for obligate Nucleotide sequence accession numbers methylotrophy, and polyphyletic origin of methylotrophy. J The 1153 nucleotide sequences determined in this study Bacteriol 189: 4020–4027. were deposited in the European Nucleotide Archive (ENA) Collins, G., Kavanagh, S., McHugh, S., Connaughton, S., under the accession numbers HF563682-HF564588 and Kearney, A., Rice, O., et al. (2006) Accessing the black box HF953105-HF953350. of microbial diversity and ecophysiology: recent advances through polyphasic experiments. J Environ Sci Health A 41: 897–922. Acknowledgements Dabney, J., and Meyer, M. (2012) Length and GC-biases during sequencing library amplification: a comparison of The research leading to these results has received funding various polymerase-buffer systems with ancient and from the European Commission’s Seventh Framework Pro- modern DNA sequencing libraries. Biotechniques 52: gramme FP7/2007–2013 under Grant Agreement No. 27552. 87–94. The authors thank Univ.-Doz. Dr. Bernhard Paulweber and Davis, J.J., Xia, F., Overbeek, R.A., and Olsen, G.J. (2013) Dr. Ludmilla Kedenko from the Department of Internal Medi- Genomes of the class Erysipelotrichia clarify the firmicute cine I, Paracelsus Medical University, Salzburg, Austria, for origin of the class Mollicutes. Int J Syst Evol Microbiol 63: providing the DNA preparations from human faecal samples. 2727–2741. The authors further like to thank Marlene Redl for her assis- DeSantis, T.Z., Hugenholtz, P., Larsen, N., Rojas, M., Brodie, tance in clone library construction. E.L., Keller, K., et al. (2006) Greengenes, a chimera- checked 16S rRNA gene database and workbench References compatible with ARB. Appl Environ Microbiol 72: 5069– 5072. Amann, R.I., Ludwig, W., and Schleifer, K.H. (1995) Dewhirst, F.E., Paster, B.J., Tzellas, N., Coleman, B., Phylogenetic identification and in situ detection of indi- Downes, J., Spratt, D.A., and Wade, W.G. (2001) Charac- vidual microbial cells without cultivation. Microbiol Rev 59: terization of novel human oral isolates and cloned 16S 143–169. rDNA sequences that fall in the family Coriobacteriaceae: Ashelford, K.E., Weightman, A.J., and Fry, J.C. (2002) PRIM- description of olsenella gen. nov., reclassification of ROSE: a computer program for generating and estimating Lactobacillus uli as Olsenella uli comb. nov. and description the phylogenetic range of 16S rRNA oligonucleotide of Olsenella profusa sp. nov. Int J Syst Evol Microbiol 51: probes and primers in conjunction with the RDPII data- 1797–1804. base. Nucleic Acids Res 30: 3481–3489. Edgar, R.C., Haas, B.J., Clemente, J.C., Quince, C., and Bacchetti De Gregoris, T., Aldred, N., Clare, A.S., and Knight, R. (2011) UCHIME improves sensitivity and speed Burgess, J.G. (2011) Improvement of phylum- and class- of chimera detection. Bioinformatics 15: 2194–2200. specific primers for real-time PCR quantification of bacte- Edwards, U., Rogall, T., Blöcker, H., Emde, M., and Böttger, rial taxa. J Microbiol Methods 86: 351–356. E.C. (1989) Isolation and direct complete nucleotide Bentley, D.R., Balasubramanian, S., Swerdlow, H.P., Smith, determination of entire genes: characterization of a gene G.P., Milton, J., Brown, C.G., et al. (2008) Accurate whole coding for 16S ribosomal RNA. Nucleic Acids Res 17: human genome sequencing using reversible terminator 7843–7853. chemistry. Nature 456: 53–59. Egert, M., and Friedrich, M.W. (2003) Formation of pseudo- Blackwood, C.B., Oaks, A., and Buyer, J.S. (2005) terminal restriction fragments, a PCR-related bias affecting

© 2013 Society for Applied Microbiology and John Wiley & Sons Ltd, Environmental Microbiology, 16, 2389–2407 Improved group-specific 16S rRNA primers for bacteria 2405

terminal restriction fragment length polymorphism analysis relationships among sulfur- and iron-oxidizing eubacteria. J of microbial community structure. Appl Environ Microbiol Bacteriol 174: 269–278. 69: 2555–2562. Ling, Z., Liu, X., Luo, Y., Yuan, L., Nelson, K., Wang, Y., et al. Feinstein, L.M., Sul, W.J., and Blackwood, C.B. (2009) (2013) Pyrosequencing analysis of the human microbiota Assessment of bias associated with incomplete extraction of healthy Chinese undergraduates. BMC Genomics 14: of microbial DNA from soil. Appl Environ Microbiol 75: e390. 5428–5433. Liu, W.T., Marsh, T.L., Cheng, H., and Forney, L.J. (1997) Fierer, N., Bradford, M.A., and Jackson, R.B. (2007) Toward Characterization of microbial diversity by determining ter- an ecological classification of soil bacteria. Ecology 88: minal restriction fragment length polymorphisms of genes 1354–1364. encoding 16S rRNA. Appl Environ Microbiol 63: 4516– Fierer, N., Jackson, J.A., Vilgalys, R., and Jackson, R.B. 4522. (2005) Assessment of soil microbial community structure Ludwig, W., Strunk, O., Westram, R., Richter, L., Meier, H., by use of taxon-specific quantitative PCR assays. Appl Yadhukumar, A., et al. (2004) ARB: a software environ- Environ Microbiol 71: 4117–4120. ment for sequence data. Nucleic Acids Res 32: 1363– Garrity, G. (2010) Bergey’s Manual® of Systematic Bacteri- 1371. ology, Vol. II, The Proteobacteria, Part A Introductory Maidak, B.L., Olsen, G.J., Larsen, N., Overbeek, R., Essays. New York, USA: Springer. McCaughey, M.J., and Woese, C.R. (1997) The RDP (Ribo- Garrity, G.M., Krieg, N.R., and Staley, J.T. (2010) somal Database Project). Nucleic Acids Res 25: 109–111. Bergey’s Manual of Systematic Bacteriology, Vol. IV, The Maidak, B.L., Cole, J.R., Lilburn, T.G., Parker, C.T., Jr, Bacteroidetes, Spirochaetes, Tenericutes (Mollicutes), Saxman, P.R., Farris, R.J., et al. (2001) The RDP-II Acidobacteria, Fibrobacteres, Fusobacteria, Dictyoglomi, (Ribosomal Database Project). Nucleic Acids Res 29: 173– Gemmatimonadetes, Lentisphaerae, Verrucomicrobia, 174. Chlamydiae, and Planctomycetes. New York, USA: Mallona, I., Weiss, J., and Egea-Cortines, M. (2011) Springer. pcrEfficiency: a web tool for PCR amplification efficiency Gomes, N.C.M., Heuer, H., Schönfeld, J., Costa, R., prediction. BMC Bioinformatics 12: e404. Mendonça-Hagler, L., and Smalla, K. (2001) Bacterial Margulies, M., Egholm, M., Altman, W.E., Attiya, S., Bader, diversity of the rhizosphere of maize (Zea mays) grown in J.S., Bemben, L.A., et al. (2005) Genome sequencing in tropical soil studied by temperature gradient gel electro- microfabricated high-density picolitre reactors. Nature 437: phoresis. Plant Soil 232: 167–180. 376–380. Huang, M.M., Arnheim, M., and Goodman, M.F. (1992) Meier, H., Amann, R., Ludwig, W., and Schleifer, K.H. (1999) Extension of base mispairs by Taq DNA polymerase: impli- Specific oligonucleotide probes for in situ detection of a cations for single nucleotide discrimination in PCR. Nucleic major group of gram-positive bacteria with low DNA G + C Acids Res 20: 4567–4573. content. Syst Appl Microbiol 22: 186–196. Huber, T., Faulkner, G., and Hugenholtz, P. (2004) Mitchell, K., and Takacs-Vesbach, C. (2008) A comparison of Bellerophon: a program to detect chimeric sequences in methods for total community DNA preservation and extrac- multiple sequence alignments. Bioinformatics 20: 2317– tion from various thermal environments. J Ind Microbiol 2319. Biotechnol 35: 1139–1147. Junier, P., Junier, T., and Witzel, K.-P. (2008) TRiFLe, a Moreira, D. (1998) Efficient removal of PCR inhibitors using program for in silico terminal restriction fragment length agarose-embedded DNA preparations. Nucleic Acids Res polymorphism analysis with user-defined sequence sets. 26: 3309–3310. Appl Environ Microbiol 74: 6452–6456. Morris, R.M., Rappe, M.S., Connon, S.A., Vergin, K.L., Klindworth, A., Pruesse, E., Schweer, T., Peplies, J., Quast, Siebold, W.A., Carlson, C.A., and Giovannoni, S.J. (2002) C., Horn, M., and Glöckner, F.O. (2013) Evaluation of SAR11 clade dominates ocean surface bacterioplankton general 16S ribosomal RNA gene PCR primers for classi- communities. Nature 420: 806–810. cal and next-generation sequencing-based diversity Munoz, R., Yarza, P., Ludwig, W., Euzéby, J., Amann, R., studies. Nucleic Acids Res 41: e1. Schleifer, K., et al. (2011) Release LTPs104 of the all- Kuffner, M., Hai, B., Rattei, T., Melodelima, C., Schloter, M., species living tree. Syst Appl Microbiol 34: 169–170. Zechmeister-Boltenstern, S., et al. (2012) Effects of Muyzer, G., de Waal, E.C., and Uitterlinden, A.G. (1993) season and experimental warming on the bacterial com- Profiling of complex microbial populations by denaturing munity in a temperate mountain forest soil assessed by gradient gel electrophoresis analysis of polymerase chain 16S rRNA gene pyrosequencing. FEMS Microbiol Ecol 82: reaction-amplified genes coding for 16S rRNA. Appl 551–562. Environ Microbiol 59: 695–700. Kurtböke, D. (2012) Biodiscovery from rare actinomycetes: Mühling, M., Woolven-Allen, J., Murrell, J.C., and Joint, I. an eco-taxonomical perspective. Appl Microbiol Biotechnol (2008) Improved group-specific PCR primers for denatur- 93: 1843–1852. ing gradient gel electrophoresis analysis of the genetic Lane, D. (1991) 16S/23S rRNA sequencing. In Nucleic diversity of complex microbial communities. ISME J 2: Acid Techniques in Bacterial Systematics. Stackebrandt, E. 379–392. and Goodfellow, M. (eds). New York, USA: Wiley, pp. 115– Nam, Y.-D., Jung, M.-J., Roh, S.W., Kim, M.-S., and Bae, 175. J.-W. (2011) Comparative analysis of Korean human gut Lane, D.J., Harrison, A.P., Stahl, D., Pace, B., Giovannoni, microbiota by barcoded pyrosequencing. PLoS ONE 6: S.J., Olsen, G.J., and Pace, N.R. (1992) Evolutionary e22109.

© 2013 Society for Applied Microbiology and John Wiley & Sons Ltd, Environmental Microbiology, 16, 2389–2407 2406 S. Pfeiffer et al.

Neef, A. (1997) Anwendung der in situ Einzelzell- Székely, A.J., Berga, M., and Langenheder, S. (2013) Identifizierung von Bakterien zur Populationsanalyse in Mechanisms determining the fate of dispersed bacterial komplexen mikrobiellen Biozönosen. Doctoral Thesis. communities in new environments. ISME J 7: 61–71. Germany: Technische Universität München. Thomas, F., Hehemann, J.H., Rebuffet, E., Czjzek, M., and Overmann, J., Coolen, M.J., and Tuschak, C. (1999) Specific Michel, G. (2011) Environmental and gut bacteroidetes: the detection of different phylogenetic groups of chemocline food connection. Front Microbiol 2: e93. bacteria based on PCR and denaturing gradient gel elec- Ventura, M., Canchaya, C., Tauch, A., Chandra, G., trophoresis of 16S rRNA gene fragments. Arch Microbiol Fitzgerald, G.F., Chater, K.F., and van Sinderen, D. (2007) 172: 83–94. Genomics of Actinobacteria: tracing the evolutionary Pan, Y., Bodrossy, L., Frenzel, P., Hestnes, A.-G., Krause, S., history of an ancient phylum. Microbiol Mol Biol Rev 71: Lüke, C., et al. (2010) Impacts of inter- and intralaboratory 495–548. variations on the reproducibility of microbial community Wakelin, S.A., Nelson, P.N., Armour, J.D., Rasiah, V., and analyses. Appl Environ Microbiol 76: 7451–7458. Colloff, M.J. (2011) Bacterial community structure and Petruska, J., Goodman, M.F., Boosalis, M.S., Sowers, L.C., denitrifier (nir-gene) abundance in soil water and ground- Cheong, C., and Tinoco, I. (1988) Comparison between water beneath agricultural land in tropical North Queens- DNA melting thermodynamics and DNA polymerase fidel- land, Australia. Soil Res 49: 65–76. ity. Proc Natl Acad Sci 85: 6252–6256. Wang, Q., Garrity, G.M., Tiedje, M.J., and Cole, J.R. (2007) Philippot, L., Bru, D., Saby, N.P.A., Cˇ uhel, J., Arrouays, D., Naïve Bayesian classifier for rapid assignment of rRNA Šimek, M., and Hallin, S. (2009) Spatial patterns of bacte- sequences into the new bacterial taxonomy. Appl Environ rial taxa in nature reflect ecological traits of deep branches Microbiol 73: 5261–5267. of the 16S rRNA bacterial tree. Environ Microbiol 11: 3096– Weisburg, W.G., Barns, S.M., Pelletier, D.A., and Lane, D.J. 3104. (1991) 16S ribosomal DNA amplification for phylogenetic Philippot, L., Andersson, S., Battin, T., Prosser, J., Schimel, study. J Bacteriol 173: 697–703. J., Whitman, W., and Hallin, S. (2010) The ecological Williams, K.P., Gillespie, J.J., Sobral, B.W.S., Nordberg, E.K., coherence of high bacterial taxonomic ranks. Nat Rev Snyder, E.E., Shallom, J.M., and Dickerman, A.W. (2010) Microbiol 8: 523–529. Phylogeny of Gammaproteobacteria. J Bacteriol 192: Pilloni, G., Granitsiotis, M.S., Engel, M., and Lueders, T. 2305–2314. (2012) Testing the limits of 454 pyrotag sequencing: repro- von Wintzingerode, F., Gobel, U.B., and Stackebrandt, E. ducibility, quantitative assessment and comparison to (1997) Determination of microbial diversity in environmen- T-RFLP fingerprinting of aquifer microbes. PLoS ONE 7: tal samples: pitfalls of PCR-based rRNA analysis. FEMS e40467. Microbiol Rev 21: 213–229. Placella, S.A., Brodie, E.L., and Firestone, M.K. (2012) Wright, E.S., Yilmaz, L.S., and Noguera, D.R. (2012) DECI- Rainfall-induced carbon dioxide pulses result from sequen- PHER, a search-based approach to chimera identification tial resuscitation of phylogenetically clustered microbial for 16S rRNA sequences. Appl Environ Microbiol 78: 717– groups. Proc Natl Acad Sci 109: 10931–10936. 725. Quast, C., Pruesse, E., Yilmaz, P., Gerken, J., Schweer, T., Yarza, P., Ludwig, W., Euzeby, J., Amann, R., Schleifer, K., Yarza, P., et al. (2013) The SILVA ribosomal RNA gene Gloeckner, F., and Rossello-Mora, R. (2010) Update of the database project: improved data processing and web- All-Species Living Tree Project based on 16S and 23S based tools. Nucleic Acids Res 41: 590–596. rRNA sequence analyses. Syst Appl Microbiol 33: 291– Sipos, R., Székely, A.J., Palatinszky, M., Révész, S., 299. Márialigeti, K., and Nikolausz, M. (2007) Effect of primer Yatsunenko, T., Rey, F.E., Manary, M.J., Trehan, I., mismatch, annealing temperature and PCR cycle number Dominguez-Bello, M.G., Contreras, M., et al. (2012) on 16S rRNA gene-targetting bacterial community analy- Human gut microbiome viewed across age and geography. sis. FEMS Microbiol Ecol 60: 341–350. Nature 486: 222–227. Stach, J.E.M., Maldonado, L.A., Masson, D.G., Ward, Yutin, N., and Galperin, M.Y. (2013) A genomic update on A.C., Goodfellow, M., and Bull, A.T. (2003) Statistical clostridial phylogeny: Gram-negative spore formers and approaches for estimating actinobacterial diversity in other misplaced clostridia. Environ Microbiol 15: 2631– marine sediments. Appl Environ Microbiol 69: 6189–6200. 2641. Stackebrandt, E., Rainey, F., and Ward-Rainey, N. (1997) Yutin, N., Puigbò, P., Koonin, E.V., and Wolf, Y.I. (2012) Proposal for a new hierarchic classification system, Phylogenomics of prokaryotic ribosomal proteins. PLoS Actinobacteria classis nov. Int J Syst Bacteriol 47: 479– ONE 7: e36972. 491. Stadhouders, R., Pas, S.D., Anber, J., Voermans, J., Mes, T.H.M., and Schutten, M. (2010) The effect of primer- Supporting information template mismatches on the detection and quantification of Additional Supporting Information may be found in the online nucleic acids using the 5′ nuclease assay. J Mol Diagn 12: version of this article at the publisher’s web-site: 109–117. Staley, J., and Konopka, A. (1985) Measurement of in situ Fig. S1. ARB analysis of published primers. Primers are activities of nonphotosynthetic microorganisms in aquatic matched against sequence alignment information (SAI) cal- and terrestrial habitats. Annu Rev Microbiol 39: 321– culated from all representatives of target and non-target 346. phylum/class in the SILVA SSU Ref 102 NR database. Each

© 2013 Society for Applied Microbiology and John Wiley & Sons Ltd, Environmental Microbiology, 16, 2389–2407 Improved group-specific 16S rRNA primers for bacteria 2407 base pair position is evaluated: Dots (.) indicate a rate of Table S2. Base pair positions with high target-taxon > 95% matches in the target group; small letters > 70% specificity. < 95%; x < 70%; IUPAC codes are used when more than one Table S3. Phylogenetic affiliation at the family level of 16S base occurs in > 30% of representatives; white letters in rRNA gene sequences from rhizosphere soil clone libraries. black boxes indicate mismatches towards the primer. IUPAC Table S4. Isolates used for optimization of newly designed ambiguity codes: R (A/G), Y (C/T), M (A/C), K (T/G), W (T/A), primers and exclusivity testing. S (C/G), B (C/T/G), D (A/T/G), H (A/T/C), V (A/C/G), N (A/C/ Table S5. Earlier evaluations of primer pairs though G/T). sequencing of clone libraries. Fig. S2. A–E. Example of phylum/class specific T-RFLP Table S6. Comparison of 454 data generated with universal electropherograms from one potato rhizosphere, sampled at primers and group-specific clone libraries. the plant flowering stage in Peru, analysed via GeneMapper. Table S7. Percentage of sequence identities for both primers FAM, 6-carboxyfluorescin-labelled primer. inside the target taxon in SILVA TestPrime analysis. Table S1. TestPrime analysis of published primer pairs and PCR exclusivity testing using strains from target and non- target taxa as template.

© 2013 Society for Applied Microbiology and John Wiley & Sons Ltd, Environmental Microbiology, 16, 2389–2407