The Tumor Suppressor Gene Rhobtb1 Is a Novel Target of Mir-31 in Human Colon Cancer

676 INTERNATIONAL JOURNAL OF ONCOLOGY 42: 676-682, 2013 The tumor suppressor gene RhoBTB1 is a novel target of miR-31 in human colon cancer RUI-SI XU, XIAO-DONG WU, SI-QI ZHANG, CHANG-FENG LI, LEI YANG, DAN-DAN LI, BAO-GANG ZHANG, YING ZHANG, JING-PENG JIN and BIN ZHANG Endoscopy Center, China-Japan Union Hospital, Jilin University, Changchun 130033, P.R. China Received August 29, 2012; Accepted October 18, 2012 DOI: 10.3892/ijo.2012.1746 Abstract. miRNAs are a class of endogenous non-coding Up to now, the most efficient treatment of colon cancer is the RNA, which can regulate downstream target genes through radical surgery combined with chemotherapy, for local tumors, binding to the 3'UTR of those genes. Numerous studies have the 5-year survival rate is approximately 93% (2), while almost indicated that abnormal expression of miRNAs is implicated half of patients had developed metastasis on admission (3), in tumor development. Aberrant expression of miR-31 has even the localized disease, more than one-third of patients been found in various cancers, including colorectal cancer. develop recurrence after surgery (4). Despite advances in Here, we show that miR-31 is upregulated in human colon surgical techniques and other treatments, even after the novel cancer tissues and cell lines, and that repression of miR-31 molecular agents in recent years, colon cancer high mortality inhibited colon cancer cell proliferation and colony formation rate remains because of the frequent recurrence and metastasis in soft agarose. To further elucidate the mechanism under- (5-7). Currently, the mechanisms underlying the preocess of lying the role of miR-31 in promoting colon cancer, we used colon tumorigenesis remain obscure, understanding the related online miRNA target prediction databases and found that mechanism is important for us to develop new stratege and the tumor suppressor RhoTBT1 may be a target of miR-31. find new efficient target for efficient treatment of colon cancer. Imunohistochemistry assay revealed that RhoBTB1 was MicroRNAs (miRNAs) are a class of 19-24 nt short non- significantly decreased in HT29 cells. In addition, ectopic coding RNAs, which regulate translation and degraduation expression of miR-31 reduced RhoBTB1 in the colon cancer of target mRNAs by direct interactions with 3'-untranslated cell line HT29. The results suggested that suppression of region (3'UTR) of the target mRNAs. Approximately 1,500 RhoBTB1 may be responsible for colon tumorigenesis, which miRNA sequences have been found (8) and it was reported was inhibited directly by miR-31. The results of MTT and that >60% of genes are conserved targets of microRNA in the soft agarose colony-formation assays showed that knockdown human genome (9). It has been demonstrated that miRNAs of RhoBTB1 by RNAi induced cell proliferation, and colony can regulate the expression of a wide rage of genes, and play formation in soft agarose, which mimicked the function of important roles in cell progression such as development (10), miR-31. This further suggested that suppression of RhoBTB1 differentiation (11), proliferation (12,13) and apoptosis (14,15). was responsible for colon tumorigenesis. In conclusion, we Increasing evidence has suggested that miRNAs play a crucial found that miR-31 acts as an oncogene in colon cancer and role in carcinogenesis and tumor progression (16,17), and identified RhoBTB1 as a new target of miR-31 further study many miRNAs were found upregulated or downregulated in demonstrated that miR-31 contributed to the development of various tumor types (18,19). colon cancer at least partly by targeting RhoBTB1. MicroRNA-31 (miR-31) plays important roles in malig- nant tumors, dysregulation of it has been demonstrated to be Introduction involved in many tumors, for example, it was upregulated in head and neck cancer, hepato cellular carcinoma, lung cancer Colon cancer is one of the most common cancers and is the and colon cancer (20-24). Many reports have revealed that third leading cause of cancer-related mortality worldwide (1). miR-31 was correlated to the ability of cancer metastasis. Inhibition of miR-31 contributed to induction of metastasis in breast cancer (25). Interestingly, Laurila et al found both inhibition and enhanced expression of miR-31 lead to reduced Correspondence to: Dr Bin Zhang, Endoscopy Center, China-Japan migration and invasion of pancreatic cancer cells (26). In colon Union Hospital, Jilin University, 126 Xiantai Street, Changchun cancer, miR-31 was reported to be significantly upregulated, 130033, P.R. China and the expression level of which was correlated with the E-mail: [email protected] stage of colon cancer (20,21) and miR-31 was also found to be associated with colon cancer invasion and metastasis, supres- Key words: RhoBTB1, miR-31, colon cancer, tumorigenesis sion of miR-31 affected migration and invasion of colon cancer cells (27). It was also found that for colon cancer at early stage, supression of miR-31 could increase sensitivity to 5-FU (28). XU et al: RhoBTB1 IS A TARGET OF miR-31 677 RhoBTB proteins belong to a subfamily of the Rho family GAPDH primers for qRT-PCR, forward: 5'-ACGGATTTGGT of small GTPases. The RhoBTB subfamily comprises three CGTATTGGG-3', reverse: 5'-TGATTTTGGAGGGATCT members, RhoTBT1, RhoTBT2 and RhoTBT3. RhoTBT2 was CGC-3'. first proposed as a tumor supressor, it has been reported that in breast cancer, lack of RHOBTB2 transcripts results in growth Luciferase reporter assays. Twenty-four hours before trans- inhibition (29). Studies also found high rates of loss of hetero- fection HT29 cells were seeded into a 24-well plate (2.5-3x104/ zygosity at the RHOTBT2 locus in gastric tumors and bladder well), then the cells were cotransfected with Renilla luciferase tumors (30,31). Similarly to RhoTBT2, recently RhoTBT1 was and luciferase reporter plasmids containing miR-31 or vector also proposed as a tumor supressor in a study on head and neck control and wild-type or mutated target gene 3'UTR with cancer (32). Lipofectamine 2000 (Invitrogen). Forty-eight hours after Athough miR-31 was demonstrated to be envolved in colon transfection, luciferase activities were measured using dual- cancer, its mechanisms are still not clear. In this study, we luciferase reporter assay system (Promega). Firefly luciferase found miR-31 was upregulated in colon cancer, and demon- activities were normalized to Renilla luciferase. strated for the first time that RhoBTB1 was a target of miR-31. We also explored the role of miR-31 in colon and revealed that Western blotting. After transfection as indicated, cells were miR-31 could promote colon tumorigenesis and invasiveness, harvested and lysed in RIPA lysis buffer [150 mM NaCl, 10 mM at least partly through targeting RhoBTB1. Tris, pH 7.5, 1% NP40, 1% deoxycholate, 0.1% SDS, protease inhibitor cocktail (Sigma)] and total protein was measured Meterials and methods using the Bradford protein assay (Bio-Rad, Hercules, CA). Equal amounts of protein sample was subjected to 10% Tumor samples. Colon cacer tissues and mathed adjacent SDS-PAGE and transferred to PVDF membrane (Millipore, normal tissues were collected from 17 colon cancer patients. Billerica, MA, USA), after blocking in 5% skimmed milk for All carcinoma samples were obtained at the time of operation 30 min at room temperature, the membrane was incubated in and obtained with the informed consent of the patients. All anti-RhoBTB1 (1:2000, Abcam) for 2 h at room temperature, human materials were used in accordance with the policies of followed by incubating with horseradish peroxidase-linked the institutional review board at China-Japan Union Hospital secondary antibody for 1 h at room temerature and visual- of Jilin University, China. ized with ECL (Millipore). β-actin (1:5000, Abcam, Inc., Cambridge, MA) was used as loading control. Cell culture and transfection. The HT29 and SW480 cell lines were from American Type Culture Collection (ATCC) and Immunohistochemistry (ICH) and in situ hybridization. Tumor cultured under conditions provided by the manufacturer. Twenty- or matched normal tissues were fixed with 4% paraformalde- four hours before transfection cells were seeded, then miR-31 hyde, then the samples were embeded in paraffin and sectioned. antisense locked nucleic acid (LNA anti-miR31) and control Followed incubated with RhoBTB1 antibody (1:500), the oligonucleotides (LAN control) or RhoBTB1 siRNA and control bound antibodies were detected with the biotin-streptavidin- siRNA were transfected with Lipofectamine 2000 (Invitrogen, peroxidase system (Vector Labs, Burlingame, CA, USA) using Carlsbad, CA) according to the manufacturer's instructions. diaminobenzidine (Sigma-Aldrich) as chromogen. Twenty-four or forty-eight hours later, cells were collected and For in situ hybridization assay, DIG-labeled locked nucleic subjected to further analysis. The human RhoBTB1 siRNA and acid (LNA)-based probe specific for miR-31 (Exiqon, control siRNA were purchased from Origene. Vedbaek, Denmark) was introduced. The in situ hybridization signal was detected by incubation with horseradish peroxi- RNA extraction and real-time RT-PCR. Total RNA was extracted dase (HRP)-conjugated anti-digoxigenin (1:200, Abcam Inc., from cells and tumor tissues by using TRIzol (Invitrogen). For Cambridge, MA). miR-31 detection, stem-loop RT-PCR assay was performed. U6 snRNA was used as an internal control. The following M T T. Cell proliferation rates were measured using 3-(4,5-dimeth- stem-loop primers were used for miRNA-31: 5'-GTCGTATC ylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) CAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACA reduction assay according to the manufacturer's instructios. In GCTAT-3' and U6 snRNA: 5'-GTCGTATCCAGTGCAGG brief, HT29 cells were seeded into 96-well plates 24 h before GTCCGAGGTATTCGCACTGGATACGACAAAATATGG transfection and treated as described previously. Then MTT AAC-3'. For RhoBTB1 mRNA detection, M-MLV Reverse solution was added in each well, and the cells were cultured Transcriptase system (Promega) was used to reverse-transcribe in incubator for another 4 h.

Load more