DOCSLIB.ORG

Development of GFP-Based High-Throughput Screening System for Directed Evolution of Glucose Oxidase

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Development of GFP-Based High-Throughput Screening System for Directed Evolution of Glucose Oxidase Journal of Bioscience and Bioengineering VOL. 127 No. 1, 30e37, 2019 www.elsevier.com/locate/jbiosc Development of GFP-based high-throughput screening system for directed evolution of glucose oxidase Gordana Kovacevic,1,2,* Raluca Ostafe,3 Ana Marija Balaz,4 Rainer Fischer,3 and Radivoje Prodanovic1 Faculty of Chemistry, University of Belgrade, Studentski Trg 12-16, 11000 Belgrade, Serbia,1 Innovation center of the Faculty of Chemistry, University of Belgrade, Studentski Trg 12-16, 11000 Belgrade, Serbia,2 Institute of Molecular Biotechnology, RWTH Aachen University, Worringerweg 1, 52074 Aachen, Germany,3 and Institute of Chemistry, Technology and Metallurgy, University of Belgrade, Njegoseva 12, 11000 Belgrade, Serbia4 Received 7 April 2018; accepted 1 July 2018 Available online 20 July 2018 Glucose oxidase (GOx) mutants with higher activity or stability have important role in industry and in the develop- ment of biosensors and biofuel cells. Discovering these mutants can be time-consuming if appropriate high-throughput screening (HTS) systems are not available. GOx gene libraries were successfully screened and sorted using a HTS system based on GOx activity dependent fluorescent labeling of yeast cells with tyramids and quantification of the amount of expressed enzyme by yeast enhanced green fluorescent protein (yGFP) tagging and flow cytometry. For this purpose, we expressed wild type and a mutant GOx as a chimera with the yGFP to confirm differences in catalytic activity between wild-type and mutant GOx. Fluorescence of yGFP is preserved during expression of chimera, and also after the oxidative enzymatic reaction. We have obtained a 2.5-fold enrichment in population of cells expressing active enzyme, and percentage of enzyme variants with enzymatic mean activity higher than wild type activity was increased to 44% after a single round of GOx gene library sorting. We have found two mutants with 1.3 and 2.3-fold increase in Vmax values compared to the wtGOx. By simultaneous detection of protein expression level and enzyme activity we have increased the likelihood of finding GOx variants with increased activity in a single round of flow cytometry sorting. Ó 2018, The Society for Biotechnology, Japan. All rights reserved. [Keywords: Glucose oxidase; Yeast surface display; High-throughput screening; Yeast enhanced green-fluorescent protein; Directed evolution] Glucose oxidase (GOx, b-D-glucose:oxygen 1-oxidoreductase, EC place in microdroplets that are then sorted according to their 1.1.3.4) is industrially important enzyme, used in food preservation, fluorescence intensity by fluorescent activated cell sorting (FACS) textile bleaching, and as an analytical reagent for glucose level (14e16). Most important aspect of directed evolution is to maintain determination (1). Recent developments led to the construction of connection between genotype and phenotype of the target enzyme GOx based logical gates (2), amperometric biosensors and biofuel in order to isolate the desired mutant. In previous work for GOx cells (3e5). GOx is a glycoprotein, consisting of two identical sub- library screening this connection is obtained through covalent units and each subunit has non-covalently bound FAD co-factor. staining of cells with enzymatic activity with fluorescein-tyramide The enzyme catalyzes the oxidation of b-D-glucose to D-glucono- that binds to tyrosine residues of cell-surface proteins (17). With lactone, using molecular oxygen as electron acceptor and producing this method it is possible to quantitatively determine cells with hydrogen-peroxide (1,6). higher activity enzyme variant, but fluorescence intensity also de- Making enzyme more fit for industrial applications is a great pends of the amount of expressed enzyme on cell surface, which challenge, and the knowledge about structureefunction relation is can lead to false selection. Further development in high- an advantage. However, sometimes the structure of the enzyme is throughput screening of GOx libraries has been the introduction not available or the property we want to alter is not easily corre- of yeast surface display of GOx and a substrate delivery system, lated to the known structure. In those instances directed evolution using b-D-octyl-glucoside and b-glucosidase for precise control of through random mutagenesis is a tool that enhances probability of the start of the reaction as well as glucose concentration. In this finding novel variant with desired property or variant with several work another novelty was normalization of fluorescence intensity improved ones. For enzymes most important property is its activity using fluorescent antibodies for c-myc epitope for quantification of and there are many reported enzymes with improved activity, the expressed protein on the cell surface (9). Even though antibody obtained through directed evolution and high-throughput binding is highly specific, labeling of cells can be time consuming as screening methods (7e13). well as inconsistent (18). A breakthrough in the screening process has been the in vitro Green fluorescent protein (GFP) is a 27 kDa monomer first time compartmentalization (IVC) where fluorescent enzyme assay takes isolated form jellyfish Aequorea victoria (19,20), with the tendency to form dimers at the high concentrations (21). The GFP chromo- phore is a result of autocatalytic cyclization and air-mediated * Corresponding author at: Faculty of Chemistry, University of Belgrade, Stu- dentski trg 12-16, 11000 Belgrade, Serbia. Tel.: þ381113336669. oxidation (20), and recently it has been shown that chromophore E-mail address: [email protected] (G. Kovacevic). formation affects biological pathways associated with oxidative 1389-1723/$ e see front matter Ó 2018, The Society for Biotechnology, Japan. All rights reserved. https://doi.org/10.1016/j.jbiosc.2018.07.002 VOL. 127, 2019 HIGH-THROUGHPUT SCREENING OF GLUCOSE OXIDASE 31 stress (22). Wild-type GFP absorbs light at two wavelengths, restriction site) before start codon of the yGFP. The yGFP gene was inserted in 395 nm (excitation maximum) and 475 nm, which can be explained pCTCON2 vector (provided by Dane Wittrup, Massachusetts Institute of Technology; Addgene reference no. 41843) between BamHI and XhoI restriction by existence of the two GFP chromophore forms, neutral and sites, leading to excision of c-myc epitope from the vector. anionic (23). In order to expand application of GFP in research, Glucose oxidase library First, we inserted wild-type GOx (wtGOx; accession Cormack and co-workers found a GFP mutant (S65T, F64L, known no. P13006) gene from wtGOx-pCTCON2 plasmid (45) in yGFP-pCTCON2 vector as EGFP) with shifted excitation maximum to 488 nm (24), which is using sense (ATCGCTAGCAGCAATGGCATTGAAGC) and antisense (ATCGGATCC one of the most common wavelengths used for FACS. TCCCTGCATGGAAGC) primers with NheIandBamHI restriction enzymes. With the Because of its small size, GFP is easily expressed as fusion pro- same primers we created GOx library using GeneMorph II Random Mutagensis Kit (Agilent Technologies, Santa Clara, CA, USA) and E. coli XL10Gold competent cells. tein at either N- or C-terminus, making it widely used in PCR mix contained 45 ng/mL of template (wtGOx-yGFP-pCTCON2, for low mutation biochemical and biological research (19,25). When working with frequency, 2 to 5 nucleotide mutations per gene), 2.5 ng/mLofeachprimer,andthe fusion proteins it is important for both entities to retain their rest of the components from the kit. The reaction was heated to 95Cfor2min, functions as well as proper folding. As it was shown in the work of followed by 30 cycles of 95 C for 30 s, 60 C for 30 s, 72 Cfor2min,followedby final extension at 72C for 10 min. Reaction products were digested with DpnI Wu and co-workers, they have correlated activity of the organo- enzyme for 2 h at 37 C. Purified PCR products were digested with BamHI and NheI fl phosphorus hydrolase with the GFP uorescence expressed in restriction enzymes and used as megaprimers for PCR with Phusion High-Fidelity Escherichia coli culture; even though the activity of the enzyme was polymerase (New England Biolabs, Ipswich, MA, USA). Megaprimer PCR mix reduced while fused to the GFP, it was recoverable after separation contained 450 ng of megaprimers, 50 ng of template (wtGOx-yGFP-pCTCON2), 3% of the GFP with enterokinase (19). Using split-GFP technology, DMSO and other components from the kit. Reaction was heated to 98 C for 1 min, followed by 25 cycles of 98C for 30 s, 60Cfor1min,72Cfor4min,followedby normalization of the protein expression level was employed in the final extension at 72C for 10 min. The reaction products were digested with DpnI microtiter-plate screening of small transaminase library (approxi- enzyme for 2 h at 37C and transformed to ultracompetent E. coli XL10Gold. Plasmid mately 600 clones) expressed in E. coli, in which they identified the DNA was isolated using MachereyeNagel Plasmid DNA kit (MachereyeNagel, Düren, variant with improved activity and variant with improved expres- Germany). sion level (26). Along with the use as a fusion protein marker, GFP Transformation of S. cerevisiae EBY100 cells Plasmid DNA was introduced into S. cerevisiae EBY 100 cells (provided by Dane Wittrup, Massachusetts Institute of can also be employed as an indicator of successful cloning, with Technology) as described previously (46), using a 42C heat-shock step for 1 h. Cells fl either non-recombinants that emit uorescence (27) or recombi- were grown in YNB-CAA (yeast nitrogen baseecasaminoacid) glucose medium (2% nants that do (28). (w/v) glucose) for 48 h at 27C, 160 rpm, then induced to express GOx-yGFP Using different yeast signal peptides, both GFP and EGFP have construct by transferring to YNB-CAA galactose (2% (w/v) galactose) medium fi w shown low secretion levels in yeast cells (29,30). With codon ( nal OD600 1 in galactose medium) under the same conditions for 18 h. optimization and introduction of new mutations (S65G, S72A) Flow cytometry analysis Cells expressing GOx-yGFP construct were washed three times with PBS (phosphate buffered saline) and adjusted to concentration of 2 yeast-enhanced GFP (yGFP) has been developed and used as an x108 cells/mL.
Load more

Recommended publications
  • Yeast Surface 2-Hybrid to Detect Protein-Protein Interactions Via the Secretory Pathway As a Platform for Antibody Discovery
    CORE Metadata, citation and similar papers at core.ac.uk Provided by Nature Precedings Yeast surface 2-hybrid to detect protein-protein interactions via the secretory pathway as a platform for antibody discovery Xuebo Hu1, Sungkwon Kang1, Xiaoyue Chen1, Charles B Shoemaker2, Moonsoo M Jin1 1Department of Biomedical Engineering, Cornell University, Hungerford Hill Road, Ithaca, NY 14853 2Department of Biomedical Sciences, Tufts Cummings School of Veterinary Medicine, 200 Westboro Rd, North Grafton, MA 01536 Correspondence should be addressed to M.M.J. ([email protected]). Abstract: High throughput methods to measure protein-protein interactions will facilitate uncovering pairs of unknown interactions as well as designing new interactions. We have developed a platform to detect protein interactions on the surface of yeast, where one protein (bait) is covalently anchored to the cell wall and the other (prey) is expressed in secretory form. The prey is released either outside of the cells or remains on the cell surface by its binding to the bait. The strength of their interaction is measured by antibody binding to the epitope tag fused to the prey or direct readout of split fluorescence protein complementation. Our novel ‘yeast surface 2-hybrid’ system was found to differentiate 6-log difference in binding affinities between coiled coil associations and to measure specific interactions of antibodies and antigens. We demonstrate the use of YS2H in exploring activation allostery in integrins and isolating heavy chain only antibodies against botulinum neurotoxin. Introduction Protein-protein interactions are essential to virtually every cellular process and their understanding is of great interest in basic science as well as in the development of effective therapeutics.
    [Show full text]
  • WO 2010/129541 Al
    (12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization International Bureau (10) International Publication Number (43) International Publication Date 11 November 2010 (11.11.2010) WO 2010/129541 Al (51) International Patent Classification: (81) Designated States (unless otherwise indicated, for every GOlN 33/53 (2006.01) C07K 16/00 (2006.01) kind of national protection available): AE, AG, AL, AM, AO, AT, AU, AZ, BA, BB, BG, BH, BR, BW, BY, BZ, (21) International Application Number: CA, CH, CL, CN, CO, CR, CU, CZ, DE, DK, DM, DO, PCT/US20 10/033537 DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, (22) International Filing Date: HN, HR, HU, ID, IL, IN, IS, JP, KE, KG, KM, KN, KP, 4 May 2010 (04.05.2010) KR, KZ, LA, LC, LK, LR, LS, LT, LU, LY, MA, MD, ME, MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, (25) Filing Language: English NO, NZ, OM, PE, PG, PH, PL, PT, RO, RS, RU, SC, SD, (26) Publication Language: English SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, TM, TN, TR, TT, TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, ZW. (30) Priority Data: 61/175,076 4 May 2009 (04.05.2009) US (84) Designated States (unless otherwise indicated, for every 61/305,991 19 February 2010 (19.02.2010) US kind of regional protection available): ARIPO (BW, GH, GM, KE, LR, LS, MW, MZ, NA, SD, SL, SZ, TZ, UG, (71) Applicant (for all designated States except US): AF- ZM, ZW), Eurasian (AM, AZ, BY, KG, KZ, MD, RU, TJ, FOMIX CORPORATION [US/US]; 688 E.
    [Show full text]
  • Development of Novel Surface Display Platforms for Anchoring
    Yang et al. Microb Cell Fact (2019) 18:85 https://doi.org/10.1186/s12934-019-1133-x Microbial Cell Factories RESEARCH Open Access Development of novel surface display platforms for anchoring heterologous proteins in Saccharomyces cerevisiae Xiaoyu Yang1†, Hongting Tang1,3†, Meihui Song1, Yu Shen1, Jin Hou1* and Xiaoming Bao1,2* Abstract Background: Cell surface display of recombinant proteins has become a powerful tool for biotechnology and biomedical applications. As a model eukaryotic microorganism, Saccharomyces cerevisiae is an ideal candidate for surface display of heterologous proteins. However, the frequently used commercial yeast surface display system, the a-agglutinin anchor system, often results in low display efciency. Results: We initially reconstructed the a-agglutinin system by replacing two anchor proteins with one anchor protein. By directly fusing the target protein to the N-terminus of Aga1p and inserting a fexible linker, the display ef- ciency almost doubled, and the activity of reporter protein α-galactosidase increased by 39%. We also developed new surface display systems. Six glycosylphosphatidylinositol (GPI) anchored cell wall proteins were selected to construct the display systems. Among them, Dan4p and Sed1p showed higher display efciency than the a-agglutinin anchor system. Linkers were also inserted to eliminate the efects of GPI fusion on the activity of the target protein. We further used the newly developed Aga1p, Dan4p systems and Sed1p system to display exoglucanase and a relatively large protein β-glucosidase, and found that Aga1p and Dan4p were more suitable for immobilizing large proteins. Conclusion: Our study developed novel efcient yeast surface display systems, that will be attractive tools for bio- technological and biomedical applications Keywords: Yeast surface display, Aga1, Dan4, Sed1, a-Agglutinin, Glycosylphosphatidylinositol (GPI) Background and antibody development, library screening, biosensor Cell surface display expresses a target protein or peptide detection systems, and bioconversion [2].
    [Show full text]
  • M.Sc. [Botany] 346 13
    cover page as mentioned below: below: mentioned Youas arepage instructedcover the to updateupdate to the coverinstructed pageare asYou mentioned below: Increase the font size of the Course Name. Name. 1. IncreaseCourse the theof fontsize sizefont ofthe the CourseIncrease 1. Name. use the following as a header in the Cover Page. Page. Cover 2. the usein the followingheader a as as a headerfollowing the inuse the 2. Cover Page. ALAGAPPAUNIVERSITY UNIVERSITYALAGAPPA [Accredited with ’A+’ Grade by NAAC (CGPA:3.64) in the Third Cycle Cycle Third the in (CGPA:3.64) [AccreditedNAAC by withGrade ’A+’’A+’ Gradewith by NAAC[Accredited (CGPA:3.64) in the Third Cycle and Graded as Category–I University by MHRD-UGC] MHRD-UGC] by University and Category–I Graded as as Graded Category–I and University by MHRD-UGC] M.Sc. [Botany] 003 630 – KARAIKUDIKARAIKUDI – 630 003 346 13 EDUCATION DIRECTORATEDISTANCE OF OF DISTANCEDIRECTORATE EDUCATION BIOLOGICAL TECHNIQUES IN BOTANY I - Semester BOTANY IN TECHNIQUES BIOLOGICAL M.Sc. [Botany] 346 13 cover page as mentioned below: below: mentioned Youas arepage instructedcover the to updateupdate to the coverinstructed pageare asYou mentioned below: Increase the font size of the Course Name. Name. 1. IncreaseCourse the theof fontsize sizefont ofthe the CourseIncrease 1. Name. use the following as a header in the Cover Page. Page. Cover 2. the usein the followingheader a as as a headerfollowing the inuse the 2. Cover Page. ALAGAPPAUNIVERSITY UNIVERSITYALAGAPPA [Accredited with ’A+’ Grade by NAAC (CGPA:3.64) in the Third Cycle Cycle Third the in (CGPA:3.64) [AccreditedNAAC by withGrade ’A+’’A+’ Gradewith by NAAC[Accredited (CGPA:3.64) in the Third Cycle and Graded as Category–I University by MHRD-UGC] MHRD-UGC] by University and Category–I Graded as as Graded Category–I and University by MHRD-UGC] M.Sc.
    [Show full text]
  • Title Evaluation of the Yeast Surface Display System For
    Evaluation of the yeast surface display system for screening of Title functional nanobodies Author(s) Kajiwara, Kaho; Aoki, Wataru; Ueda, Mitsuyoshi Citation AMB Express (2020), 10 Issue Date 2020-03-16 URL http://hdl.handle.net/2433/250108 © The Author(s) 2020. This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included Right in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. Type Journal Article Textversion publisher Kyoto University Kajiwara et al. AMB Expr (2020) 10:51 https://doi.org/10.1186/s13568-020-00983-y ORIGINAL ARTICLE Open Access Evaluation of the yeast surface display system for screening of functional nanobodies Kaho Kajiwara1, Wataru Aoki1,2 and Mitsuyoshi Ueda1,2* Abstract Yeast surface display is a powerful technology used to isolate and engineer proteins to improve their activity, specifc- ity, and stability. In this method, gene expression is regulated by promoters, and secretion efciency is afected by secretion signals.
    [Show full text]
  • Screening of Yeast Display Libraries of Enzymatically Treated Peptides to Discover Macrocyclic Peptide Ligands
    International Journal of Molecular Sciences Article Screening of Yeast Display Libraries of Enzymatically Treated Peptides to Discover Macrocyclic Peptide Ligands John Bowen 1, John Schneible 1 , Kaitlyn Bacon 1, Collin Labar 2, Stefano Menegatti 1,3,* and Balaji M. Rao 1,3,* 1 Department of Chemical and Biomolecular Engineering, North Carolina State University, 911 Partners Way, Raleigh, NC 27695, USA; [email protected] (J.B.); [email protected] (J.S.); [email protected] (K.B.) 2 Department of Molecular and Structural Biochemistry, North Carolina State University, Raleigh, NC 27695, USA; [email protected] 3 Biomanufacturing Training and Education Center (BTEC), North Carolina State University, 850 Oval Dr, Raleigh, NC 27606, USA * Correspondence: [email protected] (S.M.); [email protected] (B.M.R.) Abstract: We present the construction and screening of yeast display libraries of post-translationally modified peptides wherein site-selective enzymatic treatment of linear peptides is achieved using bacterial transglutaminase. To this end, we developed two alternative routes, namely (i) yeast display of linear peptides followed by treatment with recombinant transglutaminase in solution; or (ii) intracellular co-expression of linear peptides and transglutaminase to achieve peptide modification in the endoplasmic reticulum prior to yeast surface display. The efficiency of peptide modification was evaluated via orthogonal detection of epitope tags integrated in the yeast-displayed peptides by flow cytometry, and via comparative cleavage of putative cyclic vs. linear peptides by tobacco etch virus (TEV) protease. Subsequently, yeast display libraries of transglutaminase-treated peptides were screened to isolate binders to the N-terminal region of the Yes-Associated Protein (YAP) and its WW domains using magnetic selection and fluorescence activated cell sorting (FACS).
    [Show full text]
  • Phage and Yeast Display of Antibodies and Proteins
    Register EARLY and SAVE! the sheraton boston hotel boston TWELFTH ANNUAL Phage and Yeast Display of Antibodies and Proteins May 17 - 18, 2010 DESIGN proteins and novel scaffolds with drug-like properties and IMPACT the biologics PIPELINE DISTINGUISHED FacUlty KEYNOTE PRESENTATIONS Phage Display Traps for Protein Conformation and Jennifer Cochran, Ph.D., Stanford Medical Center Specific Composition Daniel Christ, Ph.D., Garvan Institute of Medical Research James A. Wells, Ph.D., Department of Pharmaceutical and The University of New South Wales Chemistry, University of California, San Francisco Stephen J. Demarest, Ph.D., Biogen IDEC Inc. Michael J. Feldhaus, Ph.D., Adimab Inc. Research and Development of Next-Generation of Antibody-Based Therapeutics: Challenges and Nicolas Fischer, Ph.D., NovImmune SA Opportunities Prof. Christian Heinis, Ph.D., Ecole Polytechnique Federal Zhenping Zhu, M.D., Ph.D., Vice President and Global de Lausanne (EPFL) Head, Protein Sciences & Design, Novartis Biologics David King, Ph.D., Anaptys Bio Joost Kolkman, Ph.D., Ablynx Next-Generation Biologics Albert Einstein College of Medicine Herren Wu, Ph.D., Vice President, Antibody Discovery & Jonathan R. Lai, Ph.D., Protein Engineering, MedImmune Peter Luo, Ph.D., Merck & Co., Inc. and Abmaxis, Inc. Jaume Pons, Ph.D., Rinat Pfizer Balaji Rao, Ph.D., North Carolina State Eric V. Shusta, Ph.D., University of Wisconsin Madison RECOMMENDED SHORT COURSES Danica Stanimirovic, M.D., Ph.D., National Research (SC1) Phage and Yeast Display Libraries and Council, Canada their Screening John Wheeler, Ph.D., Centocor Lonza Biologics plc (SC7) Phage Display for Vaccine Development Jesús Zurdo, Ph.D., Corporate Sponsors Corporate Support Sponsor MedImmune Part of: Sixth Annual Cambridge Healthtech Institute 250 First Avenue, Suite 300 Needham, Massachusetts 02494 Telephone: 781-972-5400 PEGS Toll-free in the U.S.
    [Show full text]
  • Yeast Display-Based Antibody Discovery and Optimization Technologies Avantgen Company Overview
    Advantageous Technologies, Exceptional Results Yeast Display-Based Antibody Discovery and Optimization Technologies AvantGen Company Overview • Services and Collaborations – San Diego-based leader in providing antibody discovery and optimization services based on its state-of-the-art yeast display technology platform • Rapid discovery of human antibodies • Exceptional antibody humanization and optimization • Rabbit mAb generation for IHC and PK/PD studies • Core technologies – Superior antibody yeast display platform • Proprietary, inducible, secretable display motif – Comprehensive human antibody database – Large collection of human antibody libraries • Team – Proven expert R&D and business leaders in therapeutic antibodies 2 Yeast Display is a Superior Platform • Widely recognized as a preferred technology platform for rapidly discovering and optimizing mAbs of exceptional quality for therapeutic development • Can also be used to optimize and humanize antibodies originating from in vivo immunization or in vitro phage display approaches 3 Core Platform Technology Advantages Comparison of in vitro Antibody Discovery and Optimization Platforms Features Phage Display Yeast Display Antibody Format Limited Extensive Display Diversified Limited/Biased Excellent Libraries ¹ Developability Low High ¹ Yeast System Provides Improved Display of Diversity Across Diverse Human Antibody V Families vs. Phage Phage Display Yeast Display 4 Core Platform Exceptional Human Antibody Libraries • Constructed to mimic natural sequence variation in human antibodies
    [Show full text]
  • Throughput Phage Display and Building the Foundations of a Novel High-Throughput Intrabody Pipeline
    The Generation of Affinity Reagents Using High- throughput Phage Display and Building the Foundations of a Novel High-throughput Intrabody Pipeline by Nicolas Odysseas Economopoulos A thesis submitted in conformity with the requirements for the degree of Master of Science Graduate Department of Molecular Genetics University of Toronto © Copyright by Nicolas Economopoulos 2011 The Generation of Affinity Reagents Using High-throughput Phage Display and Building the Foundations of a Novel High- throughput Intrabody Pipeline Nicolas Odysseas Economopoulos Master of Science Graduate Department of Molecular Genetics University of Toronto 2011 Abstract Phage display technology has emerged as the dominant approach in antibody engineering. Here I describe my work in developing a high-throughput method of reliably generating intracellular antibodies. In my first data chapter, I present the first known high-throughput pipeline for antibody-phage display libraries of synthetic diversity and I demonstrate how increasing the scale of both target production and library selection still results in the capture of antibodies to over 50% of targets. In my second data chapter, I present the construction and validation of a novel scFv-phage library that will serve as the first step in my proposed intrabody pipeline. Antibodies obtained from this library will be screened for functionality using a novel yeast-two- hybrid approach and have numerous downstream applications. This high-throughput pipeline is amenable to automation and can be scaled up to thousands of domains, resulting in the potential generation of many novel therapeutic reagents. ii Acknowledgments It is surreal to think that I have reached the end of a journey that started three years ago.
    [Show full text]
  • Peptide Design by Optimization on a Data-Parameterized Protein
    Peptide design by optimization on a data- parameterized protein interaction landscape Justin M. Jensona,1, Vincent Xueb,1, Lindsey Stretza, Tirtha Mandala, Lothar “Luther” Reicha, and Amy E. Keatinga,b,c,d,2 aDepartment of Biology, Massachusetts Institute of Technology, Cambridge, MA 02139; bComputational and Systems Biology Program, Massachusetts Institute of Technology, Cambridge, MA 02139; cDepartment of Biological Engineering, Massachusetts Institute of Technology, Cambridge, MA 02139; and dKoch Institute for Integrative Cancer Research, Cambridge, MA 02139 Edited by William F. DeGrado, University of California, San Francisco, CA, and approved September 18, 2018 (received for review July 28, 2018) Many applications in protein engineering require optimizing Proteins of the B cell lymphoma 2 (Bcl-2) family are regulators multiple protein properties simultaneously, such as binding one of apoptosis that have emerged as key therapeutic targets in target but not others or binding a target while maintaining cancer biology. Overexpression of human antiapoptotic proteins stability. Such multistate design problems require navigating a Bcl-2, Mcl-1, Bfl-1, Bcl-xL, and Bcl-w contributes to oncogenesis high-dimensional space to find proteins with desired characteris- and resistance to chemotherapy (10, 11). These five proteins tics. A model that relates protein sequence to functional attributes share the same fold and are 18–53% identical in sequence (12). can guide design to solutions that would be hard to discover via Many native partners of Bcl-2, Mcl-1, Bfl-1, Bcl-xL, and Bcl-w screening. In this work, we measured thousands of protein–pep- contain an ∼23-residue Bcl-2 homology 3 (BH3) motif that is tide binding affinities with the high-throughput interaction assay disordered in isolation but forms a helix upon binding.
    [Show full text]
  • Consequences of Sequence Variants for the Expression of a Dual Targeting Novel Format Antibody Construct
    Consequences of sequence variants for the expression of a dual targeting novel format antibody construct A Thesis Submitted to The University of Manchester for the Degree of Doctor of Philosophy 2014 Claire Gaffney CONTENTS CONTENTS ........................................................................................................................... 2 LIST OF FIGURES .................................................................................................................. 7 LIST OF TABLES ..................................................................................................................10 ABSTRACT ..........................................................................................................................12 DECLARATION ....................................................................................................................13 COPYRIGHT STATEMENT ...................................................................................................13 ACKNOWLEDGEMENTS .....................................................................................................14 DEDICATION ......................................................................................................................14 ABBREVIATIONS ................................................................................................................15 CHAPTER 1: INTRODUCTION ..............................................................................................19 1.1 Introduction to biopharmaceuticals ........................................................................20
    [Show full text]
  • Facile Chemical Functionalization of Proteins Through Intein-Linked Yeast Display † † ‡ † § Carrie J
    Article pubs.acs.org/bc Facile Chemical Functionalization of Proteins through Intein-Linked Yeast Display † † ‡ † § Carrie J. Marshall, Nitin Agarwal, Jeet Kalia, Vanessa A. Grosskopf, Nicholas A. McGrath, † ‡ § † Nicholas L. Abbott, Ronald T. Raines, , and Eric V. Shusta*, † Department of Chemical and Biological Engineering, University of Wisconsin-Madison, 1415 Engineering Drive, Madison, Wisconsin 53706, United States ‡ Department of Biochemistry, University of Wisconsin-Madison, 433 Babcock Drive, Madison, Wisconsin 53706, United States § Department of Chemistry, University of Wisconsin-Madison, 1101 University Avenue, Madison, Wisconsin 53706, United States *S Supporting Information ABSTRACT: Intein-mediated expressed protein ligation (EPL) permits the site-specific chemical customization of proteins. While traditional techniques have used purified, soluble proteins, we have extended these methods to release and modify intein fusion proteins expressed on the yeast surface, thereby eliminating the need for soluble protein expression and purification. To this end, we sought to simultaneously release yeast surface-displayed proteins and selectively conjugate with chemical functionalities compatible with EPL and click chemistry. Single-chain antibodies (scFv) and green fluorescent protein (GFP) were displayed on the yeast surface as fusions to the N-terminus of the Mxe GyrA intein. ScFv and GFP were released from the yeast surface with either a sulfur nucleophile (MESNA) or a nitrogen nucleophile (hydrazine) linked to an azido group. The hydrazine azide permitted the simultaneous release and azido functionalization of displayed proteins, but nonspecific reactions with other yeast proteins were detected, and cleavage efficiency was limited. In contrast, MESNA released significantly more protein from the yeast surface while also generating a unique thioester at the carboxy-terminus of the released protein.
    [Show full text]