Throughput Phage Display and Building the Foundations of a Novel High-Throughput Intrabody Pipeline

The Generation of Affinity Reagents Using High- throughput Phage Display and Building the Foundations of a Novel High-throughput Intrabody Pipeline

Nicolas Odysseas Economopoulos

A thesis submitted in conformity with the requirements for the degree of Master of Science Graduate Department of Molecular Genetics University of Toronto

The Generation of Affinity Reagents Using High-throughput Phage Display and Building the Foundations of a Novel High- throughput Intrabody Pipeline

Nicolas Odysseas Economopoulos

Master of Science

Graduate Department of Molecular Genetics University of Toronto

2011 Abstract

Phage display technology has emerged as the dominant approach in antibody engineering. Here I describe my work in developing a high-throughput method of reliably generating intracellular antibodies. In my first data chapter, I present the first known high-throughput pipeline for antibody-phage display libraries of synthetic diversity and I demonstrate how increasing the scale of both target production and library selection still results in the capture of antibodies to over 50% of targets. In my second data chapter, I present the construction and validation of a novel scFv-phage library that will serve as the first step in my proposed intrabody pipeline.

Antibodies obtained from this library will be screened for functionality using a novel yeast-two- hybrid approach and have numerous downstream applications. This high-throughput pipeline is amenable to automation and can be scaled up to thousands of domains, resulting in the potential generation of many novel therapeutic reagents.

Acknowledgments

It is surreal to think that I have reached the end of a journey that started three years ago. Although my next chapter in life will be away from the benchtop, my time in the Sidhu Lab has been an unforgettable experience that I will always cherish. I have been blessed to work with a remarkable group of individuals and gained friendships that will last a lifetime.

First and foremost, I want to thank my supervisor Dev Sidhu for being such a great mentor. Not only was Dev patient, encouraging and supportive of my endeavours but his genuine care for me as a person and not just as a student meant a lot to me. It was not easy to think about my future path and I will always be grateful for Dev‟s understanding.

I also want to thank Peter Roy for being there for me in the beginning and helping me navigate through the uncertainties of choosing a lab. If it weren‟t for Peter, I would have never met Dev or been part of such a fantastic group. I would also like to thank my committee members Charlie Boone and Jeff Wrana for their guidance and insight throughout my studies.

I also want to thank all of the Sidhu Lab members from 2008-2011. If I wrote out all of your names, my thesis would be twice as long! It was an honor to work alongside all of you and I am truly grateful for our time together. In particular, I want to give a big thank you to Bryce Nelson, Raffi Tonikian, Helena Persson, Andreas Ernst and Bernard Liu. Our conversations about life and work gave me some much-needed perspective and helped me weather the storms and bask in the successes of grad school.

Most importantly, I want to thank my family for always believing in me and for their unconditional love and support. I am forever indebted to my parents, Marita and Panos, who sacrificed so much for me and are a constant source of inspiration and strength. I also want to thank my brother Aris, who has always been there for me not only as a loving brother but as a true friend. Lastly, I want to thank my wonderful girlfriend Amanda, whose incredible love and encouragement added California sunshine to each and every day.

iii

Table of Contents

Acknowledgments ...... iii

Table of Contents ...... iv

List of Tables ...... viii

List of Figures ...... ix

List of Appendices ...... x

Chapter 1 Introduction ...... 1

1.1 Exploring Protein Function ...... 2

1.2 Antibodies as Scaffolds for Protein Engineering ...... 2

1.2.1 Antibody Structure ...... 2

1.2.2 The Antigen Binding Site ...... 4

1.2.3 Engineering Antibodies ...... 5

1.3 Therapeutic Applications of Antibodies ...... 6

1.3.1 Extracellular Applications ...... 6

1.3.2 Intracellular Applications ...... 7

1.4 Hybridoma Technology for Antibody Generation ...... 8

1.5 Phage Display and Antibody Engineering ...... 9

1.5.1 Displaying Proteins on Phage Particles ...... 9

1.5.2 Site-directed Mutagenesis and Phage Library Construction ...... 12

1.5.3 Construction of Antibody Libraries ...... 13

1.5.4 Fab-Phage Library F ...... 13

1.5.5 Performing Selections ...... 15

1.5.6 Determining Enrichment and Specificity During Selections ...... 17

1.6 Increasing the Scale of Phage Display ...... 17

1.7 Issues with Intracellular Stability of Antibodies ...... 18

1.8 Intein-Yeast-Two-Hybrid: a Novel Approach ...... 20

1.8.1 Intein-mediated Cyclization of Proteins Can Enhance Stability ...... 20

1.8.2 Cyclization of scFvs ...... 20

1.9 Thesis Rationale and Objectives ...... 21

Chapter 2 Generating High Affinity Antibodies using a High-Throughput Pipeline for Phage Display ...... 23

2 Generating High Affinity Antibodies using a High-Throughput Pipeline for Phage Display . 24

2.1 Validation of Library F against a set of 20 high-quality SH2 antigens ...... 25

2.2 Affinity Maturation of anti-SH2 clones results in improved affinities ...... 25

2.3 GST-SH3 constructs as candidates for HTP selections ...... 26

2.4 Selection in a 96-well HTP format yields unique Fabs against 60% of purified targets .. 26

2.5 Affinity Maturation Libraries were generated against a subset of SH3 domains ...... 28

2.6 Selection of Affinity Maturation Libraries yielded clones with improved affinities ...... 36

2.7 Purified Fabs can be used as detection reagents ...... 38

2.8 Construction of Chimeric IgGs as a more direct comparison of detection ...... 41

2.9 Discussion ...... 42

2.10 Materials and Methods ...... 44

2.10.1 Strains and constructs ...... 44

2.10.2 High-throughput Expression and Purification of Protein Targets ...... 45

2.10.3 Construction of Libraries ...... 46

2.10.4 Amplification and Preparation of phage libraries/supernatants before and during selections ...... 46

2.10.5 SH2 Mictrotiter Plate Selections ...... 47

2.10.6 SH3 High-throughput Selections ...... 48

2.10.7 Selection of Affinity Maturation Libraries ...... 49

2.10.8 Determining population enrichment and clone specificities ...... 49

2.10.9 Estimating clone affinities via High-throughput and low-throughput competitive ELISAs ...... 50

2.10.10 Sequencing of clones ...... 51

2.10.11 Introducing AMBER-STOP to Phage Clones ...... 51

2.10.12 Fab Purification and Affinity Analysis ...... 52

2.10.13 Cell culture and Transfection ...... 52

2.10.14 Western Blotting ...... 53

Chapter 3 Validation of scFv-phage Library G and application to the intein-Yeast-two-hybrid intrabody pipeline ...... 54

3 Validation of scFv-phage Library G and application to the intein-Yeast-two-hybrid intrabody pipeline ...... 55

3.1 Construction of scFv Library G ...... 55

3.1.1 scFv Template Design ...... 56

3.1.2 Randomization Strategy ...... 57

3.1.3 Construction of scFv Library G ...... 61

3.2 Proof-of-Principle Selection Targets ...... 62

3.2.1 The 3BP2 SH2 and Abl SH3 domains ...... 62

3.2.2 Downstream assays for intrabody function ...... 64

3.3 Selection of Library G against proof-of-principle targets ...... 64

3.3.1 Selections against 3BP2 SH2 and Abl1 SH3 yield enriched scFv-phage populations ...... 64

3.3.2 scFv-phage clones against 3BP2 SH2 and Abl SH3 are specific and have high affinities against their targets ...... 65

3.3.3 Screening scFv clones in intein-Yeast-two-hybrid system ...... 69

3.4 Library G as a tool in High-throughput selections ...... 69

3.4.1 Selection against SH2 and SH3 domains ...... 69

3.5 Discussion ...... 72

3.6 Materials and Methods ...... 74

3.6.1 Strains and Constructs ...... 74

3.6.2 Expression and Purification of v-Src, 3BP2 and Abl1 Domains ...... 75

3.6.3 Construction of Library G scFv Template ...... 75

3.6.4 Introduction of Diversity to Library G ...... 76

3.6.5 Amplification and Preparation of Library G for Selection ...... 76

3.6.6 Low-throughput Selections against v-Src, Abl1 and 3BP2 domains ...... 77

3.6.7 High-Throughput Selections against SH2 and SH3 domains ...... 78

3.6.8 Determining Population Enrichment and Clonal affinities via ELISA ...... 79

3.6.9 Sequencing of Clones ...... 80

Chapter 4 Conclusions ...... 81

4 Conclusions ...... 82

4.1 Summary of work ...... 82

4.2 Future experiments ...... 83

4.3 Potential Avenues of Research ...... 85

4.4 Applications of Antibodies and Intrabodies ...... 86

4.5 Factors to consider for intrabodies as therapeutic agents ...... 87

4.6 Final Remarks ...... 88

References ...... 89

Appendices ...... 94

vii

List of Tables

Table 2.1: List of 96 SH3 targets for high-throughput selections ……………………………… 27

Table 2.2: List of SH3s for affinity maturation experiments and their Fab-phage binders ……. 34

Table 2.3: Enrichment ratios for affinity maturation selections ……………………………….. 36

Table 2.4: Competitive ELISAs for the 12 Best clones against each SH3 domain ……………. 37

Table 3.1: Enrichment of scFv-phage Library G against SH3 and SH2 domains from Abl1 and 3PB2 ………………………………………………………………………………………...…. 65

Table 3.2: Enrichment of scFv-phage Library G against various SH2 and SH3 domains …….. 70

viii

List of Figures

Figure 1.1: The antibody molecule ……………………………………………………………... 3

Figure 1.2: Antigen Binding Site ……………………………………………………………..… 4

Figure 1.3: Production of monoclonal antibodies by the hybridoma method …………………... 8

Figure 1.4: Antibody selection from M13 bacteriophage libraries ……………………………. 10

Figure 1.5: Phagemid-directed expression of proteins on the phage surface ………………….. 11

Figure 1.6: Fab-phage Library F template ………………………………………………..…..... 14

Figure 1.7: Randomization Strategy for Fab-phage Library F ………………………………… 15

Figure 1.8: Lariat Yeast Two-Hybrid Assay ………………………………………...…….…... 22

Figure 2.1: High-throughput selections of Library F against 96 SH3 targets …………………. 29

Figure 2.2: SH3 targets chosen for Fab-phage clone isolation ……………………………….... 30

Figure 2.3: Unique Fab clones obtained via high-throughput phage display against 96 SH3 domains ………………………………………………………………………………………… 31

Figure 2.4: Affinity maturation strategy for anti-SH3 Fabs …………………………………… 35

Figure 2.5: Affinity maturation results in improved affinities and viable detection reagents …. 39

Figure 2.6: Western blots of anti-RasGAP and anti-Crk1 Fabs ……………………………….. 40

Figure 2.7: Construction, expression and purification of chimeric IgGs ……………………… 43

Figure 3.1: Intrabody scFv construct with ideal polypeptide linker C3 ……………………….. 56

Figure 3.2: Modification of the P8-STOP vector and introduction of scFv constructs ………... 58

Figure 3.3: Analysis of display level between different scFv constructs ……………………… 59

Figure 3.4: Randomization strategy for scFv-phage Library G ……………………………….. 60

Figure 3.5: The Abl protein ……………………………………………………………………. 63

Figure 3.6: Specificity and competitive ELISAs for clones against Abl1 SH3 and 3BP2 SH2 domains ………………………………………………………………………………………… 66

Figure 3.7: Unique scFv-phage binders against the SH2 and SH3 domains of 3BP2 and Abl1 . 68

Figure 3.8: Unique sequences from a high-throughput screen of Library G against SH3 and SH2 domains ………………………………………………………………………………………… 71 ix

List of Appendices

Appendix A: Vector and Template Sequences ………………………………………………… 95

Appendix B: The ImMunoGeneTics (IMGT) Numbering System …………………………… 106

Appendix C: Oligonucleotide Tables …………………………………………………………. 110

x 1

Chapter 1 Introduction

1.1 Exploring Protein Function

The last decade has seen tremendous advances within the biological sciences, especially in the fields of functional genomics and proteomics. As our scientific knowledge and experimental capabilities increase, one major roadblock to our understanding of biological processes lies in our limited understanding of protein functions. Although functional genomics analyses have yielded many insights in this regard, most of the methods in use today involve the complete abrogation of protein expression either through RNA interference-based technologies or DNA deletions. Consequently, further experimentation is required to assess any protein‟s contribution to a particular process or disease. Ideal reagents for such experiments have a dominant mode of action, do not alter the encoding DNA, selectively inhibit specific protein interactions/activities while leaving others unperturbed and are easily and rapidly generated against a vast array of targets. Such reagents would not only allow a much more comprehensive approach to studying proteins but have far-reaching medical implications including their use as tools for drug validation.

1.2 Antibodies as Scaffolds for Protein Engineering

While there are many potential approaches to the development of such transdominant reagents, an appealing class of candidates is the antibody. The attractiveness of antibodies comes from the fact that they are highly sophisticated recognition molecules capable of nanomolar affinities towards a vast array of surfaces (also known as epitopes). Also equally important is the fact that we have extensive knowledge of the genetic loci responsible for antibody structure and specificity. Consequently, the combination of an antibody‟s capacity to support a wide range of specificities and our ability to control its design makes it an ideal candidate for protein engineering. As a matter of fact, engineered antibodies were predicted to account for over 30% of all revenues in the biopharmaceutical industry by the year 2008[1].

1.2.1 Antibody Structure

Antibody molecules are Y-shaped heterotetramers consisting of two identical heavy chains and two identical light chains (Figure 1.1.)[2]. Each chain consists of a series of domains known as immunoglobulin domains and an antibody‟s structural integrity is maintained via inter- and intra- domain disulfide bonds, which are responsible for proper immunoglobulin folding and for

Figure 1.1 – The antibody molecule. Antibody molecules are Y-shaped heterotetramers consisting of two identical heavy chains (purple) and two identical light chains (yellow). Structural integrity of the antibody is maintained via disulfide bonds (dotted lines), which are responsible for linking the two heavy chains to each other and the light chains to the heavy chains. The chains are modular and consist of a series of protein domains known as immunoglobulin domains. Heavy chains can have four to five immunoglobulin domains (depending on antibody type) while light chains are limited to two. The N-terminal domain of each chain contains three hypervariable loops (or CDRs) and is known as the variable (V) domain (VH and VL domain for the heavy and light chains respectively). The unique combination of CDRs from the VH and VL domains forms an antibody‟s antigen binding site and determines its specificity. The C-terminal domains of both chains are invariant in structure and are known as constant domains. Constant domains are numbered in increasing order from the N-terminus. Since the antigen binding site is contained in a defined region of the antibody, engineering efforts involve the display of Fabs (the light chain combined with the VH and CH1 domains of the heavy chain) and scFvs (the VL-VH domain pair fused together via a polypeptide linker) as opposed to the entire protein.

4 linking the two heavy chains to each other and the light chains to the heavy chains. While the C- terminal domains of light and heavy chains are invariant in structure (hence the label of constant or C domains), the N-terminal domain of each chain contains three complementarity determining regions (or CDRs) and is known as the variable (V) domain. The unique combination of CDRs from the heavy chain variable domain (VH) and light chain variable domain (VL) forms the antibody‟s antigen binding site and determines its specificity.

1.2.2 The Antigen Binding Site

The interaction between an antibody and its target occurs at the antigen binding site and is determined by the composition and the conformation adopted by an antibody‟s CDRs (Figure 1.2)[2]. Antibodies against smaller antigens, for example, might possess CDRs that form an interaction pocket while antibodies against larger antigens present a complementary surface that may involve all six CDRs and some framework residues. In general, the vast diversity of antigen binding sites supported by the antibody scaffold means that antigens are not restricted to particular shapes or sizes.

Figure 1.2 – Antigen Binding Site. The N-terminal Variable domain of each heavy and light chain contains three areas of hypervariablity known as complementarity determining regions (CDRs). The unique combination of CDRs from the heavy chain variable domain (VH) and light chain variable domain (VL) forms the antibody‟s antigen binding site and determines its specificity. Adapted from Janeway et al, 2005.

The antibody-antigen interaction involves a variety of non-covalent interactions including hydrophobic interactions, hydrogen bonds, Van der Waals forces and electrostatic forces[2]. The presence of aromatic residues in the antigen binding site contribute to the majority of Van der Waals and hydrophobic interactions and serve to strengthen the attraction between complementary surfaces. Electrostatic interactions from charged residues and hydrogen bonds are selective towards key features of the interacting antigen and further enhance antigen binding. Since antibody-antigen interactions are non-covalent, changes in salt concentration and pH can affect the ability of antibodies to bind to their targets[2].

In addition, it is accepted that the VH CDR3 is the most important contributor to antigen binding and makes the majority of contacts during the antibody-antigen interaction[3]. The other CDRs are also important in this interaction but provide supporting roles that further refine an antibody‟s specificity and affinity. In fact, it has been shown that most contacts in the antigen-antibody interaction occur in the VH domain and that replacing an antibody‟s VH changes its specificity to that of the new VH domain while changes to the VL have negligible effects[4, 5].

1.2.3 Engineering Antibodies

The aims of manipulating antibodies are two-fold. Firstly, changes to an antibody‟s CDRs can result in improvement of binding to an original target (or antigen) or novel binding functions against other targets. Secondly, changes to the framework regions may enhance an antibody‟s stability, half-life and decrease immunogenicity in medical applications.

Due to redundancies in antibody structure, protein engineering attempts have focused on using minimal components of the protein while retaining antigen-binding function. The two most common antibody fragments used in studies involving the generation of antibodies against novel targets are the Fab (Fragment of antigen binding) and scFv (single chain variable fragment) (Figure 1.1.). The Fab is a heterodimer consisting of the first two domains from each chain (the

VH and VL domains as well as the CL and CH1 constant domain) while the scFv consists of the

VH and VL domains connected via a polypeptide linker. In general, Fabs are the more stable of the two constructs due to the hydrophobic interactions of both the variable and constant domains[6]. The scFvs, on the other hand, are much more flexible since their structural integrity depends only on the interaction between the VH and VL domains and thus can adopt more

6 conformations when interacting with other proteins. Consequently, Fabs are associated with supporting higher affinities and greater specificity than their scFv counterparts.

1.3 Therapeutic Applications of Antibodies

In addition to their potential use as valuable detection reagents in the research community, antibodies have emerged as one of the most prominent therapeutic technologies as well. Indeed, successful therapeutic antibodies against viruses, cancers, autoimmune and inflammatory disorders have all been reported[7-9].

1.3.1 Extracellular Applications

The specificity of antibodies to their individual targets has enabled researchers to tackle medical issues through a variety of ways. For example, antibodies can be generated to block receptor- ligand and receptor-receptor interactions on the cell surface by targeting either component. Commercial monoclonal antibodies against the epidermal growth factor receptor EGFR such as Cetuximab and Panitumumab have been approved for treating colorectal cancer by blocking EGF binding and EGFR dimerization respectively[8]. In addition, binding of the commercial antibody Herceptin to EGFR family member HER2 prevents receptor homo- and heterodimerization and is used as a treatment for breast cancer[8]. Furthermore, therapeutic antibodies that neutralize tumor necrosis factor α (TNF) have been developed as a treatment for rheumatoid arthritis (RA) and other inflammatory diseases[9].

In addition to the disruption of receptor-receptor and receptor-ligand interactions as a mechanism of action, antibodies can use the effector functions of their Fc regions to activate different components of the immune system and initiate complement-dependent cytotoxicity (CDC) and/or antibody-dependent cell-mediated cytotoxicity (ADCC) against their targets. For example, if TNF neutralization fails in the treatment of RA, antibodies have been developed to target CD20 on the surface of B immune cells, leading to the inhibition of the autoimmune response through CDC and ADCC[9].

Despite the many successful applications of antibodies, there is still no guarantee that a novel binder will automatically serve as a good therapeutic reagent. Furthermore, therapeutic antibodies can be plagued by issues including low half-life times, inefficient tumor penetration and the development of an immune response against them[7, 9]. In addition, certain applications

7 are more difficult because success involves a multi-pronged approach. For example, very few therapeutic antibodies have been developed against viruses because multiple stages of the viral cycle must be hit simultaneously to abrogate viral replication and subsequent infections[7]. A potential solution to such issues is the use of antibody “cocktails” which contain numerous antibodies specific towards a range of targets associated with the infectious agent or disease.

1.3.2 Intracellular Applications

The use of antibodies as intracellular reagents has been a more recent development and their therapeutic potential is of greater interest for the purposes of this thesis. Again, the idea that antibodies can be generated against virtually any target makes their use as transdominant intracellular reagents quite appealing. Antibodies can be used to block specific protein-protein interactions while leaving others perturbed, they may be used to stabilize particular complexes and can even sequester protein targets to specific compartments through choice of localization sequences. In general, intracellular antibodies (or intrabodies) can serve as very useful research tools and have the potential to become a powerful class of therapeutic reagents.

As with therapeutic antibodies destined for extracellular applications, intrabodies have been found against many types of insult and disease. For example, intrabodies against various components of HIV have been shown to interrupt its viral life cycle and an intrabody that retained the ErbB2 receptor tyrosine kinase within the endoplasmic reticulum rendered T47D breast cancer cells unresponsive to epidermal growth factor and inhibited tumor growth of human SKOV3 ovarian carcinoma cells in a mouse host[10, 11]. Intrabodies that successfully interfere with signal transduction, bacterial toxins, oncogenic proteins and even drug resistance by cancer cells have also been discovered[10-18].

Despite these successes, intrabodies face many barriers prior to their serious consideration as therapeutic reagents. Some of the issues facing the use of intrabodies include the choice delivery systems and restricting expression to target cell types. Another major hurdle is the instability of most intrabodies within the intracellular environment and is discussed in more detail later on.

1.4 Hybridoma Technology for Antibody Generation

The discovery by Kohler and Milstein that antibody-secreting cells could be immortalized revolutionized the immunological field by making it possible to control the production of individual antibodies[19]. In the following decades, hybridoma technology has seen many advances and is currently the primary source of reagent antibodies[20-22]. In brief, hybridoma technology relies on the immunization of animals against a protein antigen followed by the isolation of activated B cells (antibody-secreting immune cells) that produce antibodies against the antigen. These B cells are then fused with myeloma tumour cells to create immortalized lines of antibody-producing cells (Figure 1.3).

Figure 1.3 – Production of monoclonal antibodies by the hybridoma method. Immunization of mice with antigen stimulates immune cells, which produce antibodies that recognize the antigen. At this point, serum can be collected to obtain a polyclonal antibody mixture, or alternatively antibody-producing cells can be fused with tumor cells to generate immortalized hybridoma cells. The hybridoma cells are screened to identify individuals that secrete antibodies with desired specificities and cells of interest can be amplified by clonal expansion and maintained indefinitely as cell lines that produce a unique monoclonal antibody. (Figure and caption taken from Michnick SW and Sidhu SS (2008) and used with permission from Nature Chemical Biology).

While hybridomas can yield highly specific antibodies against a target of interest, a big drawback is the length and complexity of the whole process[21]. Furthermore, hybridoma technology is not readily amenable to the simultaneous interrogation of multiple targets in high- throughput and selection occurs in the sera, which is not suitable for sensitive antigens. Most importantly, the hybridoma process does not provide direct access to the encoding DNA, and thus it is not easy to engineer or alter antibodies of interest.

1.5 Phage Display and Antibody Engineering

In light of the inherent difficulties with hybridoma technology, there has been a push to develop new antibody engineering techniques that focus on the design and production of antibody libraries, relying on the principles of combinatorial diversity and the benefits of in vitro selection. The oldest and perhaps most versatile of these techniques is phage display technology, which relies on the directed expression of proteins on the surfaces of bacteriophage particles[20, 23-25].

Advances in combinatorial mutagenesis strategies have enabled current phage display libraries to achieve diversities of greater than 1010 and these libraries can be screened for strong binders to a target protein via in vitro selections (Figure 1.4). Non-specific phage particles are removed through a series of washes and the remaining bound clones are eluted and amplified in a bacterial host, allowing for further rounds of screening to enrich for clones expressing proteins with the desired traits. Phage display technology is a very powerful tool and has been applied to the mapping of functional epitopes[26-28], the mapping of domain family specificities[29] and in the field of antibody engineering[20, 30].

1.5.1 Displaying Proteins on Phage Particles

The experimental system used by the Sidhu lab involves the directed expression of proteins on the surface of the M13 filamentous bacteriophage, a single-stranded DNA (ssDNA)-containing virus from the Inovirus genus[25]. M13 phage can infect a variety of gram-negative bacteria and the fact that M13 is lysogenic, chemically resilient and its genome can be easily manipulated makes it an ideal system for combinatorial biology approaches[25].

While the M13 phage particle consists of a set of five coat proteins, the two major coat proteins involved in display experiments are proteins 3 and 8[25, 31]. Protein 8 (p8) is the most abundant phage

Figure 1.4 – Antibody selection from M13 bacteriophage libraries. Libraries of antibodies (in this example, Fabs) are displayed on the surfaces of phage particles as fusions to a coat protein. Each phage particle displays a unique antibody and also encapsulates a vector that contains the encoding DNA. Highly diverse libraries (>1010) can be constructed and represented as phage pools, which can be used in selections for binding to immobilized antigen. Antigen-binding phage are retained by the immobilized antigen, and the nonbinding phage are removed by washing. The retained phage pool can be amplified by infection of an Escherichia coli host, and the amplified pool can be used for additional rounds of selection to eventually obtain a population that is dominated by antigen-binding clones. At this point, individual phage clones can be isolated and subjected to DNA sequencing to decode the sequences of the displayed antibodies. (Figure and caption taken from Sidhu SS and Fellouse FA (2006) and used with permission from Nature Chemical Biology).

coat protein with over 2000 copies and forms the body of the phage particle[25]. Display on p8 is usually limited to smaller peptides of up to 10 residues due to issues with the assembly and secretion of newly-formed phage particles. Furthermore, the display of several protein copies on the surface of the phage (polyvalent display) generates avidity effects that make it hard to screen for candidates with higher affinities. Protein 3, on the other hand, is much less abundant (five copies per virion) and is located on the infective end of the phage particle[25]. Not only can larger proteins such as Fabs and scFvs serve as N-terminal fusions to protein 3 but display can be

11 controlled to reduce the number of fusion copies per phage particle to one (monovalent display) or two. This arrangement is much more amenable to studies where the affinity of the displayed proteins is important.

The coat protein fusions are expressed in vectors known as phagemids (Figure 1.5)[25, 31]. Phagemids contain a resistance marker (ampicillin resistance for example), a promoter for driving protein expression, the coat protein fusion, a double stranded DNA origin of replication (dsDNA ori) for propagation in the bacterial host and a filamentous phage origin of replication (f1 ori) that packages minus strand single ssDNA into the phage particles. The remainder of the phage genome is provided by specially modified helper phage (M13 KO7) that contains a deletion in its f1 origin, resulting in dramatically reduced packaging efficiency. Since the M13 helper phage genome also encodes wild-type protein 3, coat protein fusions are present as one or two copies on secreted phage particles.

Figure 1.5 – Phagemid-directed expression of proteins on the phage surface. Proteins can be expressed on the M13 bacteriophage surface through a special vector known as a phagemid (A).

(Figure 1.5 continued) Phagemids contain the protein-coat protein fusion in addition to a phage packaging signal (f1 origin) and double-stranded origin of replication (dsDNA origin) for propagation in a bacterial host. (B) The remainder of the phage genome is supplied via infection of the bacterial host with M13 KO7 helper phage. This results in the synthesis of complete phage particles and preferential packaging of the phagemid vector. Not all coat proteins contain the fusion because the helper phage genome contains the wild-type coat protein gene. 1.5.2 Site-directed Mutagenesis and Phage Library Construction

Once a protein is successfully displayed on the M13 phage coat, mutations can be introduced into its encoding DNA in order to generate vast numbers of variants for study. The ease of manipulating M13 ssDNA makes this phage an ideal system for the synthetic construction of libraries of up to 1011 unique clones.

Changes to the phagemid DNA are performed in series of reactions known as Kunkel mutagenesis[32, 33]. In brief, cells deficient in deoxy uracil transphosphatase (dut) and uracil DNA deglycosylase (ung) are used to synthesis a uracil-rich version of the ssDNA phagemid (dU-ssDNA) that serves as the template for the mutagenesis reaction. Mutagenic oligonucleotides that introduce changes to the region of interest anneal to the dU-ssDNA template through flanking sequences at their 5‟ and 3‟ ends that are complementary to the template and serve as primers for synthesis of the complementary strand. This reaction is completed in the absence of uridine to form covalent closed circular double-stranded DNA (CCC-dsDNA) with an original uracil-rich DNA strand and a mutagenic DNA strand. Transformation of the CCC-dsDNA into a dut+/ung+ bacterial host results in the preferential degradation of the uracil-rich strand and retention of the mutagenic strand. In this manner, a dU- ssDNA template can be simultaneously exposed to huge numbers of unique oligonucleotides that anneal to the same region, resulting in the synthesis of billions of different CCC-dsDNA molecules during a single reaction. The CCC-dsDNA is then electroporated into a bacterial host infected with M13 helper phage to synthesize the phage library.

Kunkel site-directed mutagenesis is ideal for phage display applications because it allows for complete control over library construction from the design of the mutagenic oligonucleotides themselves to the annealing and synthesis conditions.

1.5.3 Construction of Antibody Libraries

Currently, there are two main types of antibody-phage libraries – those with natural diversity and those with synthetic diversity[20, 30]. Libraries with natural diversity obtain their repertoires by cloning VH and VL gene segments from immune system B cells while synthetic antibody libraries rely on site-directed mutagenesis of the CDR loops in chosen VH-VL scaffolds. While much work has involved the use of Fab- and scFv-phage libraries with natural diversity, the construction of libraries with synthetic diversity also has its advantages. Not only does it allow researchers to choose starting scaffolds with desirable properties but the diversity can be tailored to meet the specific requirements of any particular experiment[20].

The use of synthetic diversity in the construction of Fab-phage and scFv-phage libraries allows exquisite control over the randomization of the antigen binding site and/or framework residues depending on the biological application in question. For the generation of novel binders against a target, an antibody‟s CDRs are usually the targets of randomization procedures and the oligonucleotides selected depend on the aims of the selection experiment. In general, the two features subject to randomization are CDR length and residue composition. Previous experiments by Dr. Sidhu and other researchers have already demonstrated that it is possible to obtain Fabs specific towards their targets and with nanomolar affinities using minimal two- and four-amino acid codes[34, 35]. These findings were used as the basis for the rational construction of Fab- phage libraries with increased diversities and enhanced affinities[36].

1.5.4 Fab-Phage Library F

The newest antibody library developed in the Sidhu lab has been Fab-phage Library F. Constructed by Dr. Helena Persson (a former postdoctoral fellow in the lab), Fab-phage Library F uses the lessons learned from previous iterations[36] to improve on the theoretical diversity and affinities possible.

The library template is taken from a Fab specific towards the maltose-binding protein, MBP

(Figure 1.6). This anti-MBP Fab contains a VH domain from the VH3 gene family, a VL domain from the Kappa light chain gene family and is a very desirable scaffold for library construction

(both the VH3 and kappa light chain gene families have been noted for their stability relative to other variants). The Library F phagemid vector (HP153) contains all of the features discussed in

14 section 1.4.1. including an ampicillin resistance marker, a dsDNA ori and an f1 ori as well. The light and heavy chains are located in series downstream of a single PhoA promoter and both chains have an N-terminal STII E.coli secretion signal that promotes secretion into the periplasm, allowing for proper folding and disulphide bond formation (Figure 1.6). The heavy chain is fused to a truncated version of p3 which localizes to the inner membrane and serves as the anchor for Fab formation in the periplasm. This fusion construct also employs the use of cysteine-containing dimerization domain between the heavy chain and truncated p3 that allows the joining of two heavy chain-protein 3 fusions through a disulphide bond. In this manner, Fab dimers are preferentially integrated into the phage particle (i.e. 2 out of 5 p3 proteins are fusions) and mimic the interaction interface of full-length antibodies.

Figure 1.6 – Fab-phage Library F template. The template scaffold is an anti-MBP Fab and contains the two chains in series downstream of a single PhoA promoter. Both light and heavy Fab chains contain an E. coli STII secretion signal for localization to the periplasm and the heavy chain is fused to a truncated version of coat protein 3 comprised of its C-terminal domain and associated linker. Localization of protein 3 to the inner membrane serves to anchor the heavy chain in place and allows for Fab formation. The cysteine in the dimerization domain allows for the formation of heavy chain-protein 3 dimers via disulfide bonding to mimic the two arms of a full-length antibody. The flexible IGHG1 hinge region reduces steric interactions between the Fab and protein 3 and allows for a greater range of motion by the Fab fusion.

Diversity of Fab-phage Library F has been introduced into four CDRs (CDRL3, CDRH1, CDRH2 and CDRH3) (Figure 1.7). This arrangement covers the entire VH portion of the antigen binding site as well as the most important VL CDR in the antibody-antigen interaction. A range of loop lengths have been permitted, with the greatest freedom given to CDRs H3 and L3. These CDRs also have the greatest residue diversity with nine distinct amino acids permitted. The type and composition of residues were selected based on a survey of wild-type human CDRH3s by

Zemlin and colleagues[37] and in total, Library F has a theoretical diversity of 1029. However, the actual diversity of the library is 3x1010 unique clones due to the limitations of electroporation efficiencies.

As the newest of the Fab-phage libraries, Library F has been used in numerous experiments to validate its function and its use as a tool for novel applications (discussed in Chapter 2).

1.5.5 Performing Selections

Once a phage display library is constructed, it can be screened for binders to a target protein via in vitro selections. After incubation of the library with the immobilized target, non-specific phage particles are removed through a series of washes and the remaining bound clones are eluted and amplified in a bacterial host, allowing for further rounds of screening to enrich for clones expressing proteins with the desired traits.

Figure 1.7 (caption on following page).

CDRL3

105 106 107 108 109 114 115 116 117 anti-MBP Q Q S S Y S L I T Library F Q Q X X X X PL FI T CDRL3 X-residue Loop Length: 3 - 7

CDRH1

27 28 29 30 35 36 37 38 39 anti-MBP G F N F S S S S I Library F G F N IL YS YS YS YS IM CDRH1 YS-residue Loop Length: 4

CDRH2

56 57 58 59 62 63 64 65 66 55 anti-MBP S I S S S Y G Y T Y Library F YS I YS PS YS YS GS YS T YS CDRH2 YS-residue Loop Length: 6

CDRH3

106 107 108 109 110 111 111 111 111 112 112 112 112 113 114 115 116 117 105 anti-MBP A R T V R G S K K P Y F S G W A M D Y Library F A R X X X X X X X X X X X X X AG FILM D Y

CDRH3 X-residue Loop Length: 1 - 17

X = Y/S/G/A/F/W/H/P/V (25/20/20/10/5/5/5/5/5) YS = Y/S (50/50)

Figure 1.7- Randomization strategy for Fab-phage Library F. Mutagenesis of the Library F template involved the targeting of four CDRs – CDRL3, CDRH1, CDRH2 and CDRH3). Diversity was introduced both in terms of loop length and residue composition. CDRs H1 and H2 contain much less diversity than CDRs L3 and H3 due to their smaller contributions to antigen binding. Positions denoted by X may contain Tyrosine (Y), Serine (S), Glycine (G), Alanine (A), Phenylalanine (F), Tryptophan (W), Histidine (H), Proline (P) or Valine (V). The frequency of each residue is included as a percentage in the adjacent brackets. The residues in positions denoted by YS (Tyrosine/Serine), PS (Proline/Serine) and GS (Glycine/Serine) each appear in a 50/50 ratio. Residues in grey have not been altered. The residues are numbered according to the IMGT system[38].

The success of the selection depends on both the quality of the phage display library and the quality of the protein targets[31].

From the library standpoint, quality can be affected by library construction and coverage. In terms of library construction, inefficient completion of the site-directed mutagenesis reaction may result in a large proportion of phage particles that display the wild-type protein or stop codons depending on whether the regions targeted for mutagenesis during library construction were replaced with stop codons prior to randomization[33]. In addition, libraries for which randomization adversely affects the proper folding of the displayed protein would also suffer from a large number of undesirable clones. In both cases, such libraries would have much more limited diversities and chances of obtaining clones against their targets. From the library coverage standpoint, display efficiencies must be considered prior to calculating the number of total phage to use during a selection since improper coverage of phage display libraries can result in the omission of the best clones or even any relevant clones at all.

From the immobilized target side, the quality and stability of the target are both important factors in the success of a selection[25]. For example, the presence of contaminants in impure protein samples or denaturation of the samples themselves can result in the enrichment of unwanted phage clones. Furthermore, the use of constructs that are unstable may result in a heterogeneous and inconsistent interface that differs between rounds and is not amenable to enrichment of binders against the intended target conformation. Consequently the choice of immobilization surface can be important in a selection experiment and can range from plastic microtiter plates[39] and metallic pins[40] to nitrocellulose and PVDF membranes[41, 42] and magnetic beads[43].

In light of these considerations, it is not only important to monitor the behavior of the phage population throughout the selection but optimization of the selection conditions and reagents may be required for a successful outcome.

1.5.6 Determining Enrichment and Specificity During Selections

In brief, population enrichment is determined through an Enzyme Linked Immunosorbant Assay (ELISA)[32]. First, the selected phage population is incubated with the immobilized target and an irrelevant protein in parallel. Unbound phage particles are removed from the wells through a series of washes and the remaining phage are then probed with anti-M13 antibodies conjugated to horseradish peroxidase. Addition of substrate results in the synthesis of a blue pigment and the reaction is stopped with phosphoric acid to allow for a spectrophotometric reading at 450nm. The enrichment ratio is determined by comparing the signal intensity of the target well relative to the negative control well. Depending on the stringency of the experiment, successful enrichment can be defined as a target:control ratio of three or greater. ELISAs are also used to determine the specificity of individual clones by screening clone populations against their targets and a set of negative control proteins.

1.6 Increasing the Scale of Phage Display

In light of the power of phage display to generate antibodies against a multitude of protein targets, efforts have been made in the last 10 years to increase the throughput of and introduce automation to this technology. Initial attempts reported the use of 96-well microtiter plates as the platform for selections[44] and expanded to strategies involving the use of multipin plates and magnetic beads in 96-well microtiter plates to sort bacterial expression libraries, perform selection experiments with phage display libraries and run assays to assess individual phage clones[43, 45-47]. Other strategies have employed the transfer of entire cell-lysates to PVDF membranes after performing 2D-PAGE and selection of phage display libraries against individual proteins excised from the membrane[41]. More recently, selections against larger sets of antigens [48] and/or that screen many more clones[48, 49] have also been performed. In addition, an initial high-throughput approach has also been attempted for synthetic antibody- phage libraries with promising results[36].

When it comes to high-throughput selections, the primary issues involve adequate production of protein[50], selection procedure[40] and library coverage. From the protein production standpoint, the construction of bacterial expression libraries followed by the validation of target purity and quality is still the most widely used approach. However, in light of the difference in post-translational modifications between prokaryotes and eukaryotes, new libraries involving yeast and mammalian cell expression systems are being introduced. In terms of selection method, the standardization of high-throughput procedures makes it difficult to ensure ideal conditions for every antigen and optimization may be required for individual targets of interest for which the selection has failed. When considering the level of coverage of a phage display library, it is accepted that screens should be performed using phage library concentrations 1000- fold greater than the calculated diversity to guarantee inclusion of at least 1 displaying member of each clone (display is not particularly efficient and most phage particles do not actually display the fusion protein)[25]. The emphasis on proper coverage also affects overnight amplification volumes, which are increased so that the number of phage synthesized by the bacterial host is far greater than the diversity of the infecting population from the previous round.

In light of such issues, an argument can be made against increasing the throughput of phage display selections. However, advances in the throughput and automation of phage display technology have demonstrated a well-designed experiment can limit the issues posed by increasing scale. Most importantly, by greatly enhancing the number of antigens that can be screened simultaneously, the large-scale impact of high-throughput phage display technology far outweighs potential decreases in selection efficiencies for any given set of antigens.

1.7 Issues with Intracellular Stability of Antibodies

The fact that antibodies can be generated against virtually any target has led researchers to pursue the intracellular applications of these molecules. Indeed, the microinjection of antibodies against virulence proteins has been shown to inhibit viral function and the ectopic expression of antibody fragments within cells to hinder bacterial, viral and oncogenic proteins has also been met with some success[11, 13, 15, 51].

However despite these advances, the ability to reliably generate antibodies that are functional within cells remains limited due to their structural reliance on intra- and inter-domain disulphide bonds. Since the intracellular environment is reducing, the formation of disulphide bonds is

19 prevented and attempts to introduce or express antibody fragments have been plagued with high incidences of misfolding, protein aggregation and reduced solubility[52]. In addition, studies involving the application of antibodies as viable intracellular reagents are restricted to smaller fragments such as scFvs that do not rely on inter-domain disulphide bonds.

In light of the inherent difficulties associated with stably expressing antibody fragments within cells, there have been many attempts to discover antibodies with improved intracellular properties. In general, efforts have focused on the engineering of variable domains with increased stability and the intracellular screening of scFv libraries for functional binders.

From the protein engineering standpoint, the major aim has been designing variable domains with enhanced stability as separate entities and as part of the same fragment[53-55]. However, the VH domain has drawn the most attention because it is essential to the antibody-antigen interaction and because single-domain VH antibodies exist in nature as part of the immune repertoire of the Camelidae family[56]. These camelid VH domains (known as VHH domains) contain a set of residue substitutions in the normally hydrophobic VH interface that reduce hydrophobicity and allow for reversible folding in the absence of an interacting VL domain.

While attempts to engineer stable VH domains have been met with some success, a rational design strategy by the Sidhu group used phage display to introduce the camelid substitutions and other mutations to human VH, generating autonomous and reversibly folding VH domains[57]. Other notable research includes work to engineer antibody fragments that fold in the absence of disulphide bonds[58, 59] and the use of a cytoplasmically stable scFv as a scaffold for grafting in CDRs from poorly soluble antibodies to explore whether antigen binding is supported [60].

From the screening side, most attempts have involved the screening of naïve scFv libraries with two-hybrid complementation assays in bacterial and eukaryotic hosts[61-63]. However, efforts to identify soluble antibody fragments also include screening for soluble scFv scaffolds and the design of scFv-phage libraries based on such frameworks[64, 65]. Although functional cytoplasmic scFvs have been identified in the above experiments, the majority of screened scFvs are not viable within the cell and the soluble scaffolds impose structural constraints on CDR diversity.

In light of these issues, much work has also focused on the use of soluble scaffolds that resemble immunoglobulin domains, such as the fibronectin type III domain (FN3)[66]. Libraries

20 constructed using FN3 as the scaffold have been successful but lack the diversities found in antibody-based approaches[66, 67].

1.8 Intein-Yeast-Two-Hybrid: a Novel Approach

While current intrabody systems have their merits, the fact remains that most antibody fragments are not successfully expressed within the cell. While this is an expected outcome, attempts to further enhance the stability of potential candidates can result in the capture of larger numbers of binders and increase the chances of obtaining high-affinity scFvs that would have never been otherwise detected. The intein-Yeast-Two-Hybrid system is one such approach.

1.8.1 Intein-mediated Cyclization of Proteins Can Enhance Stability

Inteins are protein introns that excise themselves from translation products through proteolytic and protein ligase activities. While inteins are usually located within a nascent protein, it was discovered that some inteins work in trans, as was observed for the dnaE gene of Synechocystis sp. PCC6803[68, 69]. While the dnaE gene encodes for the catalytic subunit of DNA polymerase III, it is split into an N-terminal-encoding portion and a C-terminal-encoding portion in two different regions of the genome. Each portion contains half of the dnaE intein, which catalyzes its excision in complete form and the ligation of the complete dnaE protein. This finding led to a new series of experiments where it was shown that flanking a protein constructs with the two halves of the dnaE split-intein resulted in intein excision and the cyclization of the target proteins[70].

Studies of cyclized proteins have shown that cyclization enhances protein stability and half-life by increasing protein resistance to elevated temperatures and exoprotease activity[70, 71]. While cyclization has predominantly focused on peptides and proteins with C- and N-termini in close proximity, the application of this technique to scFvs is a very appealing prospect.

1.8.2 Cyclization of scFvs

As previously mentioned, scFvs consist of the antibody variable domains joined together through a polypeptide linker. Cyclized scFvs would require another linker between the free terminus of each V domain and would, in theory, be much more stable than their free counterparts. Not only would the cyclized versions be resistant to exoproteases but the fact that the domains are

21 constrained in proximity to each other will increase their effective concentrations. Furthermore, restricting the flexibility of the scFv creates a more rigid antigen binding site conformation that will support higher affinity interactions[72].

While the cyclization of scFvs should enable the intracellular screening of larger numbers of candidates, the issue of identifying positive interactions remains. However, the Geyer lab in Saskatchewan has developed a groundbreaking innovation that makes cyclization of proteins amenable to yeast-two-hybrid studies (Figure 1.7)[73].

In general, the mutation of a key Asparagine residue to Alanine prevents the completion of the intein-mediated cyclization reaction and results in the formation of a lariat where the construct is cyclized and also conjugated to an N-terminal domain through an amide bond[73]. The free N- terminus allows for conjugation to transcription activation domains used in yeast-two-hybrid assays to select for lariat proteins that interact with the expressed bait partner. Using this technology, the Geyer lab successfully identified a peptide inhibitor of LexA, a bacterial repressor protein that promotes the bacterial stress response upon exposure to mitomycin C[73].

1.9 Thesis Rationale and Objectives

Despite the many benefits of using antibodies in research and medical applications, the issues of scale and stability remain unresolved. Solutions to these issues would significantly alter the landscape of phage display and antibody engineering by allowing researchers to simultaneously investigate a wide array of biological questions without the current constraints imposed by antibody structure, the intracellular environment and experimental scale.

My goal was to develop a system that allows for the large-scale targeting of intracellular pathways and my work is described in the following chapters. In Chapter 2, I present the development of high-throughput system of phage display that enables the simultaneous interrogation of 96 different targets. In Chapter 3, I present my work in the development of a new scFv-phage library (Library G) and the validation of this library as a tool for a high- throughput intrabody pipeline involving the Geyer lab‟s intein-yeast-two-hybrid screen. Together, these results provide the foundation for the generation intrabodies in a reliable and high-throughput manner.

Figure 1.8 – Lariat Yeast Two- Hybrid Assay. (A) The lariat is an intermediate product in the intein- catalyzed cyclization reaction. The C-terminal amino acid in the lariat peptide is covalently attached through a lactone bond to a specific residue in the C-Intein domain (IC). The cyclized section of the lariat or “noose” region is used to display random peptides or scFvs. (B) Combinatorial lariat libraries are screen using the yeast two-hybrid assay. The lariat intein contains a nuclear localization sequence (NLS), transcription activation domain (ACT), haemagglutinin tag (HA) fused to the IC domain. An interaction between the lariat and target results in the transcription of the reporter gene. (Figure and caption used with permission by Dr. SS Sidhu).

Chapter 2 Generating High Affinity Antibodies using a High-Throughput Pipeline for Phage Display

2 Generating High Affinity Antibodies using a High- Throughput Pipeline for Phage Display

In light of the ability of phage display to simultaneously generate binders against small sets of targets and improvements to high-throughput formats, I found it surprising that few attempts had been made to increase the scale and throughput of this technology for libraries of synthetic diversity. This was especially intriguing since antigens are already being immobilized on 96-well microtiter plates and that most of the volumes used during the panning process are quite small. Consequently, I set out to establish whether phage display can be performed in a HTP format (i.e. every single well is coated with a different antigen, resulting in 96 simultaneous selections) with our newest library, Fab-phage library F. The results from such an experiment would serve two purposes. Firstly, they would answer questions such as whether sacrificing library coverage and decreasing overnight amplification volumes adversely affect the selection experiments. Secondly, the success of this approach would allow the investigation of larger biological problems through the design and implementation of experiments on an unprecedented scale.

In addition to using Fab-phage Library F, I also decided to use a set of GST-tagged SH3 targets from a bacterial expression library constructed by Dr. Haiming Huang, a postdoctoral fellow in our lab. The benefits of using both Library F and a set of SH3 domains for my approach were that I could validate HTP phage-display as a potential approach in generating binders against large sets of antigens while simultaneously generating high-affinity reagents that could be used immediately for downstream biological applications.

Indeed, I was able to show that HTP phage display yields enrichment against a majority of purified targets and that Fab-phage clones obtained in this manner can be used to create second- generation libraries with significantly improved binding affinities. Furthermore, Fabs obtained through my HTP approach can serve as potential reagents in downstream biochemical screens. My results have been adapted from a manuscript that I prepared for submission to Molecular Biosystems and are described in the following sections of this chapter.

2.1 Validation of Library F against a set of 20 high-quality SH2 antigens

Fab-phage Library F was chosen based on earlier experiments performed by Dr. Persson. In order to determine the suitability of the library for HTP selections in a 96-well format, Dr. Persson first screened it against a set of 20 high-quality SH2 domains. The quality of the protein isolates was important because it increased selective pressure on clones that recognized the domains in their native conformations while minimizing the presence of protein contaminants.

The selections were performed in parallel on a 96-well microtiter plate, using four wells per antigen and four rounds of panning. 24 clones per SH2 target were screened for specificity via ELISAs and sequenced. In some cases, the affinity of the Fab-phage clones was measured by purifying the Fab separately and observing association and dissociation rates against its SH2 target via surface plasmon resonance (SPR). Based on the sequencing and SPR results, 110 unique clones were obtained against 19/20 of the SH2 targets with affinities ranging from 2nM to 495nM. This outcome validated Fab-phage Library F as a useful tool for generating binders against immobilized targets.

2.2 Affinity Maturation of anti-SH2 clones results in improved affinities

Positive Fab-phage clones obtained from the initial SH2 screens were identified via ELISA experiments. In order to see whether affinities of these clones could be improved, their DNA was used as the template for the construction of second-generation libraries in a process known as affinity maturation. The first strategy involved introducing diversity into VL CDRL1 and CDRL3 in the context of the selected VH. The second approach was to introduce diversity into VH

CDRH1 and CDRH2 in the context of the selected VH CDRH3 and VL.

Once the affinity maturation libraries were constructed and pooled together, a second selection was performed under more stringent conditions. The selection plates were coated with lower levels of antigen and the number of washes was increased to remove non-specific and low- affinity binders. Affinities of the resulting clones were measured via Surface Plasmon Resonance (SPR) and ranged from 1nM to 272nM. For the SH2 targets where a comparison is possible, affinity maturation generally produced Fabs with higher affinities than their naïve counterparts.

2.3 GST-SH3 constructs as candidates for HTP selections

In light of the success of Library F in generating binders against the SH2 set, I decided to target a group of 96 antigens from our lab‟s bacterial expression library of GST-tagged SH3 constructs (Table 2.1). SH3 domains were chosen as targets because of (1) their importance in intracellular signaling and (2) because they have a well-defined modular structure and can thus be purified with relative ease. Consequently, any success of the high-throughput method would yield useful high-affinity antibodies that could immediately be put to use in many biologically relevant studies. Furthermore, this method would also enable me to determine whether the library performs as well against targets of lower quality since the SH3 domains were expressed and purified in a 96-well format without the use of gel filtration to separate the SH3s from bacterial contaminants.

2.4 Selection in a 96-well HTP format yields unique Fabs against 60% of purified targets

The GST-SH3 constructs were expressed and purified in a 96-well format. Protein quality was verified via SDS-PAGE and 75% of the SH3 targets were successfully purified in this manner (Table 2.1). Selections were performed with Library F in a 96-well format. Each well of a 96- well Maxisorp plate was coated with a different SH3 construct prior to incubation with Library F and non-specific phage particles were removed through a series of manual washes. The remaining bound clones were eluted and amplified in XL1-Blue E. coli, allowing for further rounds of screening to enrich for clones expressing Fabs with the desired SH3-binding specificities.

Based on earlier optimization experiments, I decided to introduce negative selection pressure in order to increase the stringency of selection and to ensure that the bound phage only recognized the SH3 domain and not the GST fusion tag. Selection pressure was applied in two phases: for the first two rounds, an irrelevant protein (PDZ-GST) was immobilized on „mirror‟ plates and used to remove non-specific binders from the library pool prior to incubation with the target antigen. The last two rounds, our strategy was to perform negative selection by incubating phage supernatants with a GST-peptide fusion in solution and then transferring this mixture to the plate coated with immobilized target. Incubating our phage supernatants with an irrelevant GST- protein fusion prior to selection allows for the capture of non-specific Fab-phage through the

SH3 Domain SH3 ID SH3 Domain Expression SH3 ID SH3 Domain Expression Expression ? (y/n) ? (y/n) SH3 ID ? (y/n) Hom. to RBPs / KIAA0318 A01 Mlk2 Y C09 Homology to FISH Y F05 #1 Y A02 PACSIN2 Y C10 Nck2 #1 N F06 RasGAP Y A03 Jip-2 N C11 DLG2 N F07 SRGAP1 Y A04 Homology to PRAX1 #1 Y C12 Nck2 #2 Y F08 Neuroblastoma Y Erythroid alpha (a-I) A05 Lck Y D01 spectrin Y F09 CMS #2 Y

Predicted protein of a A06 human BAC N D02 CrkL #2 Y F10 Homology to Lasp-1 Y

A07 Neuroblastoma Y D03 Homology to PRAX-1 #3 Y F11 Homology to IRSp53 Y SH3-ENSP00000305779/ A08 PACSIN3 Y D04 Itk Y F12 242-301 Y A09 CCB3/CAB3 N D05 POSH #3 Y G01 Eps8R3 Y A10 SH3GLB2/endophilin B2 Y D06 Homology to Lasp-1 N G02 Nebulin N

A11 BPAG1 N D07 Crk #1 Y G03 Homology to p115 #1 Y

A12 Trio #2 Y D08 GADS/Grp2 #2 Y G04 DUO Y Osteoclast stimulating B01 SH3d19 #1 Y D09 Sorting nexin 18 Y G05 factor1 Y B02 Vinexin #2 Y D10 Peroxin-13 Y G06 CMS #1 Y B03 Sorting nexin 26 Y D11 Homology to PRAX-1 #2 Y G07 Lasp-1/MLN 50 Y B04 SGEF Y D12 SH3d19 #5 Y G08 Intersectin2 #2 Y B05 Crk #2 N E01 PACSIN1 Y G09 Intersectin 1 #3 Y Predicted protein with a B06 Intersectin 1 #5 Y E02 RhoGEFdomain #2 N G10 Mlk3 Y B07 Kalirin / Duo Y E03 POSH #4 Y G11 MPP1 Y Homology to GEFs G12 B08 SH3GLB1 Y E04 (KIAA1010) #4 Y Peroxin-13 Y Homology to myosin VIIb / B09 Homology to SAMSN1 N E05 SPIN90/VIP54 N H01 FLJ00256 N B10 Homology to EEN-B1 N E06 Ack N H02 DOCK4 (9-66) N B11 N-Src Y E07 CIN85 #2 Y H03 HEFL Y Predicted zinc finger B12 Btk Y E08 NESCA Y H04 protein FLJ23654 #1 Y C01 FISH #1 Y E09 Abi-1 N H05 HIP-55/DrebrinF Y C02 FISH #3 N E10 SH3d19 #3 Y H06 Grb2 #2 Y Hom. to RBPs / KIAA0318 C03 Trio #1 Y E11 Otoraplin Y H07 #3 Y C04 DUET/TRAD Y E12 Nebulette Y H08 Grap #1 Y EEN-B1/SH3GL2 / C05 Vav1 #1 N F01 endophilin 1 Y H09 Fyn Y Predicted protein C06 FLJ00204 #2 Y F02 Intersectin 1 #2 N H10 Asef / ARHGEF4 Y C07 MIA2 N F03 Homology to P41nox N H11 P85B Y C08 Nephrocystin Y F04 ArgBP2a #1 Y H12 ASPP1 Y

Table 2.1 – List of 96 SH3 targets for high-throughput selections. The set of 96 GST-SH3 fusions was selected from a bacterial expression library constructed by Dr. Haiming Huang in the lab. The SH3 ID corresponds to the location of each protein from the expression plate HH0139. Expression of the SH3 constructs was performed in a high-throughput manner and verified via SDS-PAGE. Positive expression is denoted by Y and undetectable expression is denoted by N. In total, 72 SH3 proteins (75%) were successfully expressed.

28 formation of GST-peptide:Fab-phage complexes. Furthermore, the addition of the entire Fab- phage/GST-peptide mixture to the antigen-coated wells enables the GST-peptide to continuously compete with the immobilized antigen for any remaining free GST-binders.

Population enrichment was determined by performing ELISAs after rounds 3 and 4 and successful enrichment was defined as an ELISA absorbance ratio of greater than 3 for target protein relative to the GST negative control. Based on these criteria, enrichment was observed against 41 (57%) successfully purified targets in Round 3 and 44 (60%) successfully purified targets in Round 4 (Figure 2.1).

I decided to isolate clones from wells displaying population enrichment in addition to wells with borderline ratios (3> Ratio >2) and no enrichment at all (2> Ratio >1) (Figure 2.2). In total, 684 clones against 57 GST-SH3 constructs were screened for binding specificity towards their SH3 targets using a S.cerevisiae GST-PDZ and two C.elegans SH3 domains as negative controls. Sequencing of 240 clones that demonstrated specificity towards their target yielded 109 unique Fab sequences against 44 SH3 domains (Figure 2.3).

2.5 Affinity Maturation Libraries were generated against a subset of SH3 domains

Having verified that my HTP approach yields diverse clones against most targets, I wanted to determine the kinds of affinities being observed and whether they could be improved. To do this, I narrowed down my focus to six SH3 domains that were of particular biological interest to Dr. Tony Pawson and their respective Fab-phage clones. Competitive ELISAs in which binding of the Fab-phage to immobilized antigen was measured in the presence of the same antigen in solution were used as an initial approximation to determine the best Fab-phage clone for each domain (Table 2.2). In brief, Fab-phage clones were incubated with competing antigen concentrations of 0nM, 50nM and 100nM and the concentration of competing antigen that resulted in a 50% decrease in ELISA signal or greater versus the 0nM treatment was used as an approximation of Fab affinity.

In order to see whether affinities of these clones could be improved, I used their DNA as the template for the construction of second-generation libraries in a process known as affinity maturation. Three different strategies were use to generate each affinity maturation library

Round 3 ELISA against GST-PDZ control Negative 1 2 3 4 5 6 7 8 9 10 11 12 Control A 0.15 0.14 0.08 0.10 0.13 0.09 0.13 0.13 0.14 0.15 0.09 0.46 B 0.20 0.15 0.28 0.45 0.20 0.14 0.14 0.08 0.46 0.11 0.12 0.16 C 0.11 0.17 0.21 0.14 0.50 0.16 0.16 0.43 0.17 0.21 0.11 0.19 D 0.17 0.15 0.17 0.11 0.24 0.10 0.10 0.16 0.26 0.20 0.13 0.10 E 0.27 0.14 0.18 0.25 0.17 0.16 0.22 0.33 0.13 0.43 0.09 0.15 F 0.20 0.18 0.14 0.14 0.13 0.13 0.21 0.12 0.22 0.12 0.18 0.11 G 0.38 0.17 0.20 1.51 0.18 0.13 0.41 0.48 1.86 0.68 0.17 0.11 H 0.10 0.18 0.28 0.18 0.12 0.28 0.28 0.17 0.19 0.26 0.26 0.16

Round 3 ELISA against GST-SH3 Targets GST-SH3 1 2 3 4 5 6 7 8 9 10 11 12 Target A 1.17 0.36 0.10 0.17 2.77 0.11 1.85 0.23 0.18 0.33 0.13 2.59 B 0.29 0.23 0.81 1.24 0.28 0.22 0.46 0.12 1.00 0.48 2.04 2.96 C 0.99 0.32 0.88 0.53 0.84 2.15 0.24 1.76 2.67 0.28 0.18 0.47 D 0.27 0.27 0.72 0.86 1.60 0.15 0.40 2.21 0.48 0.33 0.27 0.59 E 0.54 0.26 1.47 0.66 0.34 0.27 0.37 0.71 0.22 1.47 0.14 0.45 F 0.40 0.32 0.23 0.45 0.55 2.72 3.01 1.70 0.50 0.18 2.67 0.15 G 2.65 0.26 0.48 1.81 2.62 1.46 0.85 1.54 2.52 1.47 0.30 0.17 H 0.14 0.31 1.15 0.47 2.71 1.73 1.79 0.31 1.65 1.47 2.48 2.72

Round 3 Enrichment Ratios Enrichment 1 2 3 4 5 6 7 8 9 10 11 12 Ratio A 7.75 2.55 1.23 1.74 21.17 1.19 14.71 1.81 1.32 2.17 1.53 5.63 B 1.44 1.56 2.92 2.77 1.41 1.51 3.21 1.48 2.18 4.18 16.86 18.58 C 8.92 1.86 4.25 3.70 1.70 13.61 1.52 4.14 15.79 1.37 1.62 2.47 D 1.61 1.85 4.31 8.17 6.56 1.44 4.08 13.91 1.81 1.69 2.11 6.10 E 2.03 1.88 8.10 2.63 1.95 1.70 1.70 2.14 1.64 3.40 1.55 3.05 F 2.01 1.79 1.69 3.17 4.19 21.60 14.26 13.81 2.21 1.48 15.10 1.42 G 6.92 1.56 2.37 1.19 14.77 11.57 2.09 3.19 1.36 2.18 1.80 1.60 H 1.46 1.71 4.08 2.61 22.54 6.29 6.36 1.80 8.52 5.70 9.70 16.86

Figure 2.1 – High-throughput selections of Library F against 96 SH3 targets. Selections were performed in 96-well microtiter plates for four rounds. The GST-SH3s were immobilized in the same positions as expression plate HH0139 in table 2.1. Non-specific phage were removed with negative selection techniques prior to incubation with immobilized SH3s and with washes afterwards. The remaining bound clones were eluted in actively growing XL1-Blue E.coli cells and grown overnight in 96-well format again. The resulting amplified phage pools were used for the next round of selection. The ELISA results and enrichment ratios for rounds 3 (A) and 4 (B) are shown. For the negative control GST-PDZ plates, ELISA A450 values greater than 0.4 are highlighted in red. For the GST-SH3 ELISA plates, A450 values greater than 0.4 are highlighted in yellow. The enrichment ratios are calculated by dividing the A450s from the SH3 plate by the corresponding A450s in the GST-PDZ plate. Enrichment ratios of 3 or greater are highlighted in blue. According to these criteria, enrichment was observed for 41 GST-SH3s in round 3 and 44 GST-SH3s in round 4. Position B10 has been outlined in yellow because this protein was not expressed according to my SDS-PAGE results. Positions outlined in red were enriched in round 3 but not in round 4.

B) Round 4 ELISA against GST-PDZ control Negative 1 2 3 4 5 6 7 8 9 10 11 12 Control A 0.16 0.42 0.07 0.08 0.10 0.10 0.11 0.12 0.19 0.13 0.06 0.72 B 0.22 0.10 0.36 0.94 0.10 0.09 0.10 0.06 1.98 0.08 0.11 0.15 C 0.08 0.20 0.20 0.08 0.76 0.20 0.12 0.42 0.20 0.14 0.07 0.19 D 0.15 0.15 0.12 0.10 0.65 0.10 0.08 0.12 0.40 0.10 0.11 0.20 E 0.38 0.22 0.12 0.59 0.15 0.10 0.12 0.39 0.12 0.69 0.07 0.14 F 0.33 0.24 0.14 0.16 0.14 0.10 0.15 0.15 0.22 0.10 0.23 0.07 G 0.17 0.18 0.42 2.56 0.13 0.10 0.81 1.18 2.21 1.69 0.25 0.10 H 0.07 0.17 0.32 0.15 0.10 0.55 0.29 0.14 0.12 0.29 0.23 0.11

Round 4 ELISA against GST-SH3 Targets GST-SH3 1 2 3 4 5 6 7 8 9 10 11 12 Target A 2.60 1.62 0.09 0.27 2.89 0.11 2.85 0.32 0.19 0.40 0.08 2.91 B 0.33 0.14 1.96 1.95 0.17 0.10 0.29 0.07 2.54 1.40 2.94 3.01 C 2.64 0.30 2.07 0.48 1.52 2.73 0.15 2.39 2.89 0.18 0.11 0.45 D 0.21 0.27 2.08 2.34 2.74 0.18 1.40 2.74 0.43 0.13 0.34 1.83 E 0.93 0.62 2.76 1.65 0.30 0.19 0.21 0.73 0.22 2.60 0.11 1.67 F 0.92 0.39 0.27 0.44 1.83 3.02 3.08 2.86 0.50 0.17 2.90 0.09 G 2.97 0.27 2.18 2.54 2.92 2.87 1.88 2.67 2.79 2.26 0.39 0.15 H 0.08 0.24 2.14 0.47 3.13 2.78 2.85 0.21 2.66 2.44 2.85 2.88

Round 4 Enrichment Ratios Enrichment 1 2 3 4 5 6 7 8 9 10 11 12 Ratio A 16.55 3.88 1.41 3.47 28.63 1.11 26.41 2.69 1.01 2.99 1.35 4.06 B 1.54 1.34 5.48 2.07 1.66 1.16 2.94 1.15 1.28 16.84 26.75 20.77 C 31.46 1.51 10.36 5.72 2.01 13.66 1.25 5.67 14.23 1.35 1.51 2.40 D 1.45 1.76 16.81 23.18 4.23 1.79 16.84 22.86 1.07 1.35 3.23 9.07 E 2.42 2.85 23.55 2.79 1.95 1.90 1.67 1.89 1.88 3.77 1.50 11.83 F 2.79 1.64 1.96 2.76 12.85 31.42 20.80 19.32 2.29 1.73 12.57 1.32 G 17.57 1.54 5.15 0.99 22.11 27.55 2.32 2.27 1.27 1.34 1.55 1.40 H 1.17 1.46 6.59 3.12 32.63 5.04 9.76 1.53 23.13 8.41 12.62 26.62

Figure 2.1 – High-throughput selections of Library F against 96 SH3 targets. (B) ELISAs and enrichment ratios for round 4.

Figure 2.2 – SH3 targets chosen for Fab-phage clone isolation. Clones were isolated and tested from the SH3 targets highlighted above. The SH3 targets are in the same positions as indicated in Table 2.1. and enrichment ratios from round 4 are shown. The highlight colors denote different enrichment ratios – Blue (Ratio > 3), Yellow (3>Ratio>2) and Red (2>Ratio>1). Targets for which enrichment was observed in round 3 but not round 4 are outlined in red.

CDRL3 CDRH1 CDRH2 CDRH3

105 106 107 108 109 110 111 111.1 111.2 111.3 111.4 111.5 112.5 112.4 112.3 112.2 112.1 112 113 114 115 116 117

106 107 108 109 110 111 112 113 114 115 116 117 27 28 29 30 35 36 37 38 39 55 56 57 58 59 62 63 64 65 66 SH3 Domain Fab ID 105 WT Q Q S S Y - - - - S L I T G F N F S S S S I S I S S S Y G Y T Y A R T V R G S K K P - - - - Y F S G W A M D Y PACSIN2 NE_001 Q Q S G - - - - - Y L I T G F N L S Y Y Y I S I Y S S Y G S T S A R S A G A ------G P A F D Y Lck NE_002 Q Q W S - - - - - A P I T G F N L S Y S S M S I Y S Y S G Y T Y A R Y A P V Y P ------G S Y Y G M D Y NE_003 Q Q G H - - - - - W L I T G F N L S S Y S I S I Y P Y S S Y T Y A R P H W P S ------V A Y G L D Y Neuroblastoma NE_004 Q Q W Y H - - - G Y P I T G F N I Y S Y Y M Y I S P Y S G Y T S A R W G A Y A A S - - - - - P H G S Y G L D Y NE_005 Q Q W Y H - - - G Y P I T G F N L S S Y Y I S I Y S Y S S Y T Y A R W G G W W ------G H W G L D Y NE_006 Q Q Y Y G - - - S S L I T G F N I Y Y S S M S I S S S Y G Y T Y A R A Y F S Y G G ------S P S Y A L D Y Trio#2 NE_007 Q Q H W S S - - Y G L I T G F N L Y Y S Y M S I Y P Y S G Y T S A R W Y G G Y S ------G W Y G F D Y NE_008 Q Q H W S S - - Y G L I T G F N I Y Y S S M S I S S S Y G Y T Y A R A Y F S Y G G ------S P S Y A L D Y SH3GLB2/ W G G S A Y H L I T L S S S S I S I Y P Y Y S S T Y V S G Y Y Y S Y H G S A V W Y W Y A L D Y endophilin B2 NE_009 Q Q - G F N A R N-Src NE_010 Q Q S Y - - - - - S L F T G F N I Y S Y Y I S I S S S Y G Y T Y A R S G P W S Y ------P G G W A F D Y NE_011 Q Q F Y - - - - - S P I T G F N I S Y Y S I S I Y P Y S S S T Y A R Y Y P ------F G L D Y Sorting nexin 26 NE_012 Q Q Y V Y G - - G G P I T G F N L Y S S S M S I Y P S Y G Y T S A R Y Y G H Y W S G - - - Y G S S G W A M D Y Btk NE_013 Q Q V S S Y - - F W L I T G F N I S S Y S M S I S S S Y G Y T Y A R V S P S S ------V W G M D Y NE_014 Q Q G A S P - F G H L F T G F N L S S S Y M S I Y P Y Y S Y T Y A R S S S ------G G M D Y NE_015 Q Q G W - - - - - F L I T G F N L S S S Y M S I Y P Y Y S Y T Y A R S S S ------G G M D Y NE_016 Q Q Y V H Y - F A G L I T G F N L Y S S Y M S I S S S Y G S T Y A R S W A ------Y G L D Y FISH#1 NE_017 Q Q Y H W Y - P A H P I T G F N L Y Y S S M S I S S Y Y G Y T Y A R G Y ------A M D Y NE_018 Q Q Y W W - - - - G L I T G F N I S S Y Y M S I S S Y S S Y T S A R W V S G ------Y G A L D Y NE_019 Q Q S S Y - - - - S L I T G F N L S Y Y S M S I S P Y Y G F T Y A R T V R G S K K P - - - - Y F S G W A M D Y Trio#1 NE_020 Q Q H Y - - - - - Y L I T G F N I Y Y S Y I Y I S P Y S G Y T S A R G W G W G H ------Y W H A M D Y NE_021 Q Q S S Y - - - - S L I T G F N L Y Y Y Y I S I Y P Y S G Y T Y A R W G A Y W A Y A - - - G G S Y W P G M D Y Predicted protein A S G P F T I Y Y Y S I S I Y P Y S G Y T Y V A S Y A S S Y P Y W S W W G L D Y FLJ00204#2 NE_022 Q Q - - - - - G F N A R - - - Homology to FISH NE_023 Q Q Y A W Y - - F G L F T G F N L S S Y Y I S I Y P S Y S Y T Y A R H W ------A M D Y NE_024 Q Q Y A W Y - - F G L F T G F N I Y Y Y S I S I Y P Y S G Y T Y A R V A S Y A S S Y - - - P Y W S W W G L D Y NE_025 Q Q S S Y - - - - S L I T G F N F S S S S I S I S S Y Y G Y T S A R S P G A Y P A P Y - F S G S W A S A L D Y Nephrocystin NE_026 Q Q H P Y G - W G S P I T G F N L Y S Y S M S I Y S Y Y G Y T Y A R S S H S ------W W A M D Y Nck2#2 NE_027 Q Q Y Y - - - - - Y P I T G F N L Y Y S S M S I S P Y S S Y T Y A R H V ------G L D Y POSH#3 NE_028 Q Q S S Y - - - - S L I T G F N L Y Y Y S M S I S P S S G S T S A R H G A W W A G - - - - - H W W A P G M D Y NE_029 Q Q H G G Y - - V G L I T G F N I S S Y S I S I S S Y S S S T S A R H W G H S S S S S Y F S Y W F G W A L D Y SH3d19#5 NE_030 Q Q W S A A - - W Y P I T G F N L Y Y Y S M S I S P S S G S T S A R H G A W W A G - - - - - H W W A P G M D Y NE_031 Q Q G Y V - - - V Y L F T G F N I S S Y Y I Y I S S S Y G Y T Y A R S V R G S K K P - - - - Y F S G W A M D Y NE_032 Q Q W S A A - - W Y P I T G F N I S Y Y Y I S I Y S Y Y G S T Y A R G S Y G ------S A L D Y Homology to PRAX- NE_033 Q Q W A P - - - - Y L I T G F N L Y Y Y S I Y I Y P S Y S Y T Y A R S S W S ------W Y A L D Y 1 #3 NE_034 Q Q W H P H - Y H A L I T G F N I Y S Y Y I S I Y S Y S G S T Y A R G W V Y S W G - - - - - P W S A F G L D Y Itk NE_035 Q Q S H Y Y - - G H P I T G F N F S S S S I S I Y S Y Y S S T Y A R Y Y W ------G G L D Y NE_036 Q Q S H Y Y - - G H P I T G F N F S S S S I S I Y S Y Y G S T S A R F F W ------G G L D Y NE_037 Q Q H W P - - - Y S L I T G F N L S Y S S M Y I S S S Y G S T S A R G S S A ------S A L D Y NE_038 Q Q Y Y Y - - - - G L F T G F N L S S S S M Y I S P Y S G Y T Y A R F Y W ------F G M D Y

Figure 2.3 - Unique Fab clones obtained via high-throughput phage display against 96 SH3 domains. A high-throughput phage display selection was performed against 96 separate human SH3 domains and populations against 57 targets were screened for clones specific to their target protein. Examination of 240 clones demonstrating high specificity for their target yielded 109 unique Fab sequences spanning 44 SH3 domains. For simplicity, only the randomized CDRs are shown. Residues are numbered according the IMGT system for immunoglobulin domains. The colored residues are Tyrosine (Y, yellow), Serine (S, red), Glycine (G, green) and Alanine (A, blue). Grey residues denote positions that every clone shares with the parental anti-MBP sequence and entire CDRs if no changes were observed.

CDRL3 CDRH1 CDRH2 CDRH3

105 106 107 108 109 110 111 112 113 114 115 116 117 27 28 29 30 35 36 37 38 39 55 56 57 58 59 62 63 64 65 66

106 107 108 109 110 111 111.1 111.2 111.3 111.4 111.5 112.5 112.4 112.3 112.2 112.1 112 113 114 115 116 117 SH3 Domain Fab ID 105 WT Q Q S S Y - - - - S L I T G F N F S S S S I S I S S S Y G Y T Y A R T V R G S K K P - - - - Y F S G W A M D Y GADS/Grp2#2 NE_039 Q Q Y S A - - - H S L I T G F N L Y Y Y S I S I S S S Y G Y T Y A R V G Y ------A M D Y Crk#1 NE_040 Q Q Y G G H - Y H Y P I T G F N L Y S Y S M S I Y S Y S S Y T Y A R A S Y W A S S A P P S Y S Y S Y W G M D Y PACSIN1 NE_041 Q Q Y S F - - - S G L I T G F N L Y Y S S I Y I Y S Y S G Y T Y A R S A G V A A W Y Y A Y S G W A P V A I D Y POSH#4 NE_042 Q Q Y W G F - A Y Y P I T G F N I S Y S S M S I Y P Y S S Y T Y A R Y Y G ------V G L D Y NE_043 Q Q G A - - - - - S P I T G F N I S Y S S I S I Y P Y S G Y T Y A R W P G Y H Y ------S S A V G L D Y Homology to GEFs NE_044 Q Q S H F - - - G G L F T G F N L Y Y S Y M S I S S S Y G Y T Y A R P S H W S ------A W G I D Y (KIAA1010)#4 NE_045 Q Q S H F - - - G G L F T G F N I S Y S S I S I Y P Y S G Y T Y A R W P G Y H Y ------S S A V G L D Y SH3d19#3 NE_046 Q Q G P Y - - - G G L I T G F N L S Y S S I S I Y S Y S S Y T S A R P Y Y W V S Y - - - - - A S W Y S A F D Y NE_047 Q Q P V Y - - - - S L I T G F N I Y Y Y Y M S I S P Y Y G S T Y A R A P G S ------V A M D Y Nebulette NE_048 Q Q Y G - - - - - V P I T G F N I Y Y Y Y M S I S P Y S G Y T S A R S G G Y S F G ------S Y S W G M D Y Homology to RBPs NE_049 Q Q Y Y G - - - S H P F T G F N L Y Y S S I S I S P Y Y G S T Y A R F Y Y ------G L D Y (KIAA0318)#1 NE_050 Q Q H W G - - - S F P I T G F N I Y Y Y S I Y I S P Y Y G Y T Y A R S G ------G M D Y Neuroblastoma NE_051 Q Q W Y Y - - - S G L I T G F N I Y Y Y S I Y I S P Y Y G Y T Y A R S G ------G M D Y NE_052 Q Q V Y W G - - F Y P F T G F N L Y S S Y M S I Y S S Y G Y T Y A R A Y S S H S H - - - - - S W H W Y A M D Y NE_053 Q Q S S Y - - - - S L I T G F N I S Y Y Y I S I Y P Y Y S Y T Y A R S Y P S V ------Y Y G M D Y NE_054 Q Q W Y Y - - - Y S L I T G F N I Y S Y Y I Y I S P Y Y G Y T S A R Y G S ------Y G L D Y RasGAP NE_055 Q Q H Y S - - - V H P I T G F N I Y Y S Y I S I Y S Y Y S Y T Y A R S P S Y S W G P Y - Y G G P S G F A M D Y NE_056 Q Q F W - - - - - G P I T G F N I S Y S S I S I S S Y S G S T Y A R Y P Y Y G ------G Y A L D Y NE_057 Q Q F Y - - - - - S P I T G F N F S S S S I S I S P Y S G S T Y A R Y F Y Y H ------V V G L D Y NE_058 Q Q S G Y - - - - S P I T G F N I S Y S S M S I S S Y S G S T Y A R Y S Y Y H ------Y A G A M D Y NE_059 Q Q W F A - - - - S P I T G F N I Y Y S S I S I S S Y S G Y T Y A R Y S Y Y G ------H Y G A L D Y NE_060 Q Q F W - - - - - G P I T G F N I S Y S S I S I S S Y S G S T Y A R Y P Y Y G ------G Y A L D Y SRGAP1 NE_061 Q Q S Y Y - - - - Y L I T G F N L Y Y S Y M S I Y P S Y G Y T S A R F S H G P S W - - - - - S W G S Y A I D Y NE_062 Q Q W P - - - - - V L I T G F N I S Y S S I S I S S Y S G S T Y A R Y P Y Y G ------G Y A L D Y NE_063 Q Q S S Y Y - - S S L I T G F N L S Y Y S M Y I Y S S Y G S T Y A R W Y G ------A M D Y NE_064 Q Q S S - - - - - F P F T G F N I Y Y S S M S I S S Y Y G Y T S A R W Y Y H ------S Y A M D Y NE_065 Q Q G F - - - - - V L F T G F N I S Y S Y I S I Y S S S G S T Y A R S V H G ------F G L D Y NE_066 Q Q H S W Y - F V H P F T G F N L Y Y S S M Y I S P S Y G S T Y A R S G G ------Y A M D Y NE_067 Q Q A Y - - - - - Y L I T G F N L Y Y S S I S I Y P Y Y G Y T Y A R G W S Y V ------S Y W G F D Y Eps8R3 NE_068 Q Q A Y W - - - - Y P F T G F N I Y S S S I S I Y P Y Y G Y T S A R A S Y F G H ------W G G A M D Y NE_069 Q Q G S Y - - - F Y P I T G F N L Y Y Y S M S I S P Y S G Y T S A R Y G W S ------H A G M D Y NE_070 Q Q G G S - - - Y G L I T G F N L Y Y S Y I Y I S S S Y G Y T S A R G V W G W ------G Y A I D Y NE_071 Q Q G G H - - - - G P I T G F N L Y S Y S I Y I S S Y Y G Y T Y A R V G V W P W ------S Y Y A M D Y NE_072 Q Q S F G A - - Y P L F T G F N L Y S Y S I Y I Y P Y S S Y T Y A R V S P W ------A H A M D Y Osteoclast NE_073 Q Q S Y S - - - H A P I T G F N I S Y Y S M S I Y S Y Y G S T Y A R Y S P Y G ------H G W A F D Y stimulating factor 1 NE_074 Q Q S Y S - - - H A P I T G F N L Y Y S Y I Y I S S S Y G Y T S A R G V W G W ------G Y A I D Y CMS#1 NE_075 Q Q Y P H H - - W S L F T G F N I S S S S I S I Y S S Y G Y T Y A R T V R G S K K P - - - - Y F S G W A M D Y NE_076 Q Q Y P G - - - Y P L F T G F N I S Y S S I S I Y S S Y G Y T Y A R T V R G S K K P - - - - Y F S G W A M D Y NE_077 Q Q Y P Y - - - G S L I T G F N L S S Y S M Y I S S Y Y G Y T Y A R W S Y S H H ------S G Y P A L D Y NE_078 Q Q A G Y - - - Y S L F T G F N L Y Y S Y M Y I S P Y Y G Y T S A R W W S G S Y ------F W W P G F D Y NE_079 Q Q S S Y - - - - S L I T G F N I Y S Y Y M S I Y P Y S G Y T Y A R G Y Y Y S ------A Y A M D Y

Figure 2.3. Continued.

CDRL3 CDRH1 CDRH2 CDRH3

105 106 107 108 109 110 111 111.1 111.2 111.3 111.4 111.5 112.5 112.4 112.3 112.2 112.1 112 113 114 115 116 117

106 107 108 109 110 111 112 113 114 115 116 117 27 28 29 30 35 36 37 38 39 55 56 57 58 59 62 63 64 65 66 SH3 Domain Fab ID 105 WT Q Q S S Y - - - - S L I T G F N F S S S S I S I S S S Y G Y T Y A R T V R G S K K P - - - - Y F S G W A M D Y Homology to p115#1 NE_080 Q Q S Y - - - - - W L I T G F N L Y S S Y M S I Y S Y Y G Y T S A R Y G V Y Y G ------V S W A M D Y NE_081 Q Q S Y - - - - - W L I T G F N L Y Y S Y M Y I S P Y Y G Y T S A R W W S G S Y ------F W W P G F D Y Lasp-1/MLN50 NE_082 Q Q Y Y F - - - S Y L I T G F N I Y S Y S I S I Y S Y Y G Y T Y A R G S G W G ------F Y A L D Y Intersectin2#2 NE_083 Q Q W G S - - - G F P I T G F N I Y S Y S M S I Y S Y Y S S T Y A R G S W S Y Y S S S S H H F G A H P G L D Y NE_084 Q Q V W - - - - - Y P I T G F N L Y S Y S M S I S S Y S G Y T S A R Y G V G Y P Y - - - - - F Y Y Y F G L D Y NE_085 Q Q V A P W - S Y Y P F T G F N L Y S S Y M S I S S S Y G Y T Y A R W V Y Y Y S G ------Y Y F Y G L D Y NE_086 Q Q F W G - - - G S L F T G F N I S S S Y I Y I S S Y S G Y T Y A R A G W Y Y G Y ------G G W S G I D Y Intersectin1#3 NE_087 Q Q Y G V - - - F H P I T G F N L Y S S Y M S I Y P Y Y S Y T S A R S W Y ------A F D Y NE_088 Q Q Y G V - - - F H P I T G F N I S S S Y I Y I Y P S Y G Y T S A R S W Y ------A I D Y Mlk3 NE_089 Q Q F S Y - - - H G L I T G F N L Y S S S M Y I S S S Y G S T Y A R T V R G S K K P - - - - Y F S G W A M D Y HEFL NE_090 Q Q S G P - - - - Y L I T G F N L Y S S S I S I Y P Y Y S Y T Y A R S Y F Y Y W Y H S G Y A H F A Y P A M D Y NE_091 Q Q Y Y V P - - V Y L I T G F N L Y S S S I S I Y P Y Y S Y T Y A R Y H ------A M D Y HIP-55/DrebrinF NE_092 Q Q Y Y W - - - S S L I T G F N L S Y S S M S I Y S Y Y G Y T S A R G G ------M D Y NE_093 Q Q Y Y - - - - - H L I T G F N I Y Y S S M Y I Y P S Y G Y T S A R G G ------M D Y NE_094 Q Q S Y - - - - - Y L I T G F N I Y S Y S I S I S P Y S G S T Y A R T V R G S K K P - - - - Y F S G W A M D Y NE_095 Q Q S Y F - - - - V P I T G F N L S Y Y S I S I S S Y S G S T Y A R H C S W I Q K N - - - R T S L V G A M D Y NE_096 Q Q Y V S - - - - S P F T G F N L S S S S I Y I S S Y Y G Y T Y A R G G ------M D Y Grb2#2 NE_097 Q Q S Y P V - Y A W L F T G F N I S S Y S M S I S S Y Y G S T Y A R H Y S Y G ------W F A L D Y NE_098 Q Q W G H V - Y Y A L I T G F N I Y Y Y S I S I Y P Y Y S S T Y A R Y G W Y ------H A A M D Y Asef/ARHGEF4 NE_099 Q Q Y P Y - - - Y V P F T G F N I Y Y Y Y M S I S S S Y G Y T Y A R H Y G P ------Y A L D Y NE_100 Q Q S S Y - - - - S L I T G F N F S S S S I S I S S S Y G Y T Y A R H S W Y F H W - - - - - G Y Y G G A F D Y Homolgy to RBPs G S S A S L I T I Y Y Y S M S I Y S Y S G Y T Y Y Y W A A G I D Y (KIAA0318)#3 NE_101 Q Q - - - G F N A R ------Fyn NE_102 Q Q H Y W - - - S G L I T G F N I Y S S Y I S I Y S S S S Y T S A R S S S Y Y ------Y H G I D Y NE_103 Q Q S Y P W - - Y W P F T G F N L Y S Y Y M S I S S Y Y S Y T Y A R G W A Y ------P A L D Y P85B NE_104 Q Q G Y Y S - - P W L I T G F N I S Y S S I S I Y P Y Y G Y T Y A R W G S S G ------W S G F D Y NE_105 Q Q W Y Y Y - V H S P I T G F N L S Y Y Y M Y I Y P Y Y G Y T Y A R G A ------L D Y NE_106 Q Q P Y - - - - - S P I T G F N I S Y Y Y M S I Y S S S S Y T Y A R S W Y S G ------A Y Y G I D Y NE_107 Q Q G V - - - - - Y P F T G F N L S Y Y Y M S I Y S Y Y G S T S A R Y F P G W ------Y F A F D Y NE_108 Q Q Y S V Y - - P P P I T G F N I Y Y S S M S I Y S Y Y S Y T S A R P Y S F ------G Y G F D Y NE_109 Q Q G V - - - - - Y P F T G F N I S Y S S I S I Y P Y Y G Y T Y A R W G S S G ------W S G F D Y

Figure 2.3. Continued.

(A450 XnM) / (A450 0nM) SH3 Target Fab ID* 50nM** 100nM** GADS/Grp2#2 NE_039 0.19 0.14 Crk#1 NE_040 0.46 0.38

Homology to GEFs (KIAA1010) #4 NE_044 0.65 0.55 NE_055 0.81 0.74 NE_056 0.76 0.8 RasGAP NE_057 0.76 0.72 NE_058 0.96 0.83 NE_059 0.79 0.73 NE_083 0.83 0.8

Intersectin2#2 NE_084 0.76 0.73 NE_085 0.67 0.65 NE_086 0.76 0.8 Intersectin1#3 NE_087 0.82 0.84 NE_088 0.86 0.86

*Fab IDs are the same as in Figure 2.2 ** The SH3 targets were added in solution as the competitors. Each SH3 was the competitor against its own Fab-phage clones

Table 2.2 – List of SH3s for affinity maturation experiments and their Fab-phage binders. The six SH3s in the list above were selected based on biological interest to our collaborator, Dr. Pawson. The affinity of each Fab-phage binder against these SH3s was tested via a competitive ELISA where the Fab-phage clones were incubated against their immobilized target with a competitor in solution. In every case, the immobilized SH3 target was also the competitor and three different concentrations (0nM, 50nM, 100nM) were tested. The ELISA signals were compared to the result at 0nM of competitor to determine the drop in signal. Clones for which binding was most diminished in the presence of competitor are highlighted in red and were chosen as the template for construction of affinity maturation libraries against their respective SH3 targets. For SH3s with only one Fab-phage binder, the clone was selected regardless of the ELISA results.

(Figure 2.4). The first strategy involved introducing diversity into VL CDRL1 and CDRL3 in the context of a selected affinity VH. The second approach was to introduce diversity into VH

CDRH1 and CDRH2 in the context of selected VH CDRH3 and VL. The last strategy was to introduce diversity into VH CDRH3 in the context of selected VH CDRH1, VH CDRH2 and VL. In each case, the introduction of diversity in the context of selected regions may result in different Fab sequences that exhibit even higher affinities against their original targets.

CDRL1

27 28 29 36 37 38 39 Randomization Q YSG YSG YSG YSG YSG V CDRL1 YSG-residue Loop Length: 5 Strategy

1 CDRL3

106 107 108 109 114 115 116 117 105 Q Q X X X X PL FI T CDRL3 X-residue Loop Length: same as parental

CDRH1

27 28 29 30 35 36 37 38 39 Randomization G F N IL YSG YSG YSG YSG IM CDRH1 YSG-residue Loop Length: 4 Strategy

2 CDRH2

56 57 58 59 62 63 64 65 66 55 YS I YS PS YS YS GS YS T YS CDRH2 YS-residue Loop Length: 6

CDRH3

106 107 108 109 110 111 111.1 111.2 111.3 112.3 112.2 112.1 112 113 114 115 116 117 Randomization 105 Strategy A R X X X X X X X X X X X X X AG FILM D Y 3 CDRH3 X-residue Loop Length: same as parental

X = Y/S/G/A/F/W/H/P/V (25/20/20/10/5/5/5/5/5) YSG = Y/S/G (50/25/25)

Figure 2.4 – Affinity maturation strategy for anti-SH3 Fabs. Since the selected Fabs already demonstrated specificity towards their SH3 targets, the affinity maturation approach focused on randomizing sets of CDRs while leaving others unchanged. Three different approaches were pursued (A) and the CDRs selected for each one are circled above. (B) Randomization details. Diversity was modified based on the CDRs chosen, with greater diversity allocated to CDRs L3 and H3. However, loop length was held constant in every case. Positions denoted by X may contain Tyrosine (Y), Serine (S), Glycine (G), Alanine (A), Phenylalanine (F), Tryptophan (W), Histidine (H), Proline (P) or Valine (V). The frequency of each residue is included as a

(Figure 2.4 continued) percentage in the adjacent brackets. The residues in positions denoted by YS (Tyrosine/Serine), PS (Proline/Serine) and GS (Glycine/Serine) each appear in a 50/50 ratio. Residues in grey have not been altered. The residues are numbered according to the IMGT system[38]. 2.6 Selection of Affinity Maturation Libraries yielded clones with improved affinities

After constructing and pooling together the three sub-libraries for each clone, I performed another selection under much more stringent conditions. The selection plates were coated with lower levels of antigen and the number of washes was increased to remove non-specific and low- affinity binders. Successful library enrichment was once again defined as an ELISA absorbance ratio of greater than 3 for target protein relative to the GST negative control. Based on these criteria, I observed significant enrichment for all six affinity maturation libraries (Table 2.3).

Enrichment Ratio SH3 Target Round 4 Round 5 GADS/Grp2#2 18.5 28.6 Crk#1 8.4 19.1 Homology to GEFs (KIAA1010) #4 16.8 20.7 RasGAP 33.2 41.0 Intersectin2#2 9.5 18.9 Intersectin1#3 20.4 22.0

Table 2.3 – Enrichment ratios for affinity maturation selections. Affinity maturation libraries were constructed for six of the SH3 targets and selections were performed. ELISAs were performed to test each selected population for binding against a negative control protein (GST- PDZ) and their GST-SH3 target. Enrichment was determined by diving the GST-SH3 signal by the GST-PDZ signal. Successful enrichment was defined as a ratio of at least 3. According to these criteria, enrichment was observed for all six selections.

Multiple-point competitive ELISAs that tested Fab-phage affinity with 10nM and 20nM of competing antigen were performed for 96 clones from round 5 of every selection. The 12 best clones from each ELISA (Table 2.4) were then sent for sequencing and compared to the parental sequences used as the basis for the affinity maturations (Figure 2.5). Based on these results, 15 unique sequences were identified.

10nM/0nM 20nM/0nM 10nM/0nM 20nM/0nM Domain Best Clones ELISA Ratio ELISA Ratio Domain Best Clones ELISA Ratio ELISA Ratio A01 0.39 0.30 A02 0.04 0.03 A06 0.21 0.18 A08 0.03 0.04 A07 0.35 0.30 A11 0.04 0.03 A08 0.37 0.30 B02 0.04 0.04 C06 0.33 0.22 B04 0.04 0.04 GADS/Grp2#2 C07 0.39 0.27 RasGAP D01 0.04 0.04 D06 0.39 0.23 D02 0.04 0.04 E06 0.35 0.24 D09 0.04 0.03 F02 0.25 0.20 E02 0.04 0.03 F06 0.31 0.23 F09 0.04 0.04 G06 0.35 0.33 G02 0.04 0.03 G12 0.36 0.26 H04 0.04 0.04 A06 0.28 0.27 A01 0.43 0.41 A07 0.27 0.21 A02 0.38 0.31 A10 0.28 0.17 A05 0.38 0.27 A12 0.27 0.18 A07 0.36 0.27 B06 0.21 0.16 B06 0.43 0.38 Crk#1 C01 0.27 0.21 Intersectin2#2 B07 0.40 0.31 C04 0.26 0.22 B08 0.44 0.31 C06 0.30 0.23 C11 0.42 0.28 E03 0.28 0.25 E05 0.37 0.26 E06 0.27 0.25 G02 0.37 0.26 G02 0.24 0.23 G03 0.38 0.27 H12 0.26 0.18 G08 0.39 0.32 A09 0.19 0.12 A02 0.72 0.54 B08 0.19 0.13 A06 0.61 0.54 B12 0.17 0.11 B01 0.69 0.55 C09 0.19 0.14 C01 0.64 0.51 Homology to D01 0.15 0.12 C09 0.65 0.58 GEFS E02 0.18 0.12 Intersectin1#3 E01 0.65 0.54 (KIAA1010) #4 F05 0.19 0.14 F04 0.57 0.50 F06 0.19 0.14 G01 0.70 0.55 F11 0.20 0.13 G04 0.57 0.45 G01 0.19 0.13 G09 0.70 0.63 G08 0.19 0.13 H06 0.50 0.31 H02 0.18 0.10 H12 0.54 0.33

Table 2.4 – Competitive ELISAs for the 12 Best clones against each SH3 domain. 96 Fab- phage clones were picked from round 5 of each affinity maturation selection and tested in a competitive ELISA against 0nM, 10nM and 20nM of competing antigen. In each case, the immobilized SH3 target was also the competing antigen in solution. The ELISA signal for 0nM was compared to the ELISA signal for a negative control (GST-SH3 Nck2#2) to verify specificity and the signals for 10nM and 20nM were compared to the 0nM condition to determine the drop in signal. The 10nM/0nM and 20nM/0nM ratios are shown for the 12 best clones for each SH3 target.

The affinities of each Fab were characterized in detail with SPR (Figure 2.5). I purified the Fabs of 21 unique clones from the six libraries (15 affinity matured Fab-phage, 6 parental Fab-phage) and tested each of them against all six SH3-GST targets. This approach enabled me to determine the improvement in affinities and to test for cross-reactivity against other GST-SH3 fusion proteins. Many of the parental Fabs exhibited single-digit nanomolar affinities against their GST- SH3 targets and affinity-maturation yielded improved binders in each case. Of particular note is the fact that affinity maturation resulted in two clones that exhibit picomolar affinities. Most importantly, there was no observed cross-reactivity against the other GST-SH3 constructs for all 21 purified proteins.

2.7 Purified Fabs can be used as detection reagents

In order to examine potential applications of HTP Fab-phage display technology, I decided to test some of the resultant Fabs as detection reagents for Western Blotting. With the help of Dr. Bernard Liu from the Pawson lab, I performed westerns with two anti-RasGAP SH3 Fabs and two anti-Crk1 SH3 Fabs from my affinity maturation selections described in section 2.6. The Fabs were used to probe the full-length RasGAP and Crk1 proteins and both high affinity Fabs (Kd=26-62pM) and lower affinity Fabs (Kd=11.9-12.5pM) were represented. In both cases, results show that the Fabs have similar sensitivity to commercially available antibodies (Figure 2.6).

While it must be noted that the signal intensity of the Fab blots is noticeably lower than the commercial antibodies, there are a couple of reasons for this occurrence. Firstly, since the Fabs were lacking an Fc region and the conjugated antibody used for detection was raised against murine Fc, a secondary anti-FLAG mouse antibody was required in order to detect the Fabs. Consequently, the conjugated antibody was a secondary probe for the commercial antibody blots and a tertiary probe for the Fabs, which could have resulted in a loss of signal. The second point is that as full-length immunoglobulins, the commercial antibodies contain two arms and are thus bivalent (Fabs are monovalent). Therefore, the commercial antibodies would dissociate at much lower rates than the Fabs since both antigen-binding sites would need to be unoccupied at the same time. This would result in the capture of more commercial antibodies versus their Fab counterparts.

CDRL3 CDRH1 CDRH2 CDRH3

K off K on Kd

105 106 107 108 109 110 111 111.1 111.2 111.3 111.4 111.5 112.5 112.4 112.3 112.2 112.1 112 113 114 115 116 117

106 107 108 109 110 111 112 113 114 115 116 117 27 28 29 30 35 36 37 38 39 55 56 57 58 59 62 63 64 65 66 105 106 SH3 Domain Fab ID 105 (s-1 M-1) (s-1) (nM) GADS/Grp2#2 NE_039 Q Q Y S A - - - H S L I T G F N L Y Y Y S I S I S S S Y G Y T Y A R A R V G Y ------A M D Y 3.25E+05 6.64E-04 2.04 NE_039.1 Q Q Y S A - - - H S L I T G F N L Y Y Y S I S I S S S Y G Y T Y A R A R V G Y ------A M D Y 3.78E+05 7.76E-04 2.05 NE_039.2 Q Q Y S A - - - H S L I T G F N L Y Y Y S I S I S S S Y G Y T Y A R A R W G Y ------A M D Y 1.44E+06 6.68E-04 0.464 NE_039.3 Q Q Y S A - - - H S L I T G F N L Y Y Y S I S I S S S Y G Y T Y A R A R V G Y ------T M D Y 9.81E+05 0.03 32.2

Crk#1 NE_040 Q Q Y G G H - Y H Y P I T G F N L Y S Y S M S I Y S Y S S Y T Y A R A R A S Y W A S S A P P S Y S Y S Y W G M D Y 7.27E+04 9.07E-04 12.5 NE_040.1 Q Q Y G G H - Y H Y P I T G F N L Y S Y S M S I Y S Y S S Y T Y A R A R A S Y W A S S A P P S Y S Y S Y W G M D Y 6.27E+04 9.78E-04 15.6 NE_040.2 Q Q Y G G H - Y H Y P I T G F N L Y S Y S M S I Y S Y S G Y T Y A R A R A S Y W A S S A P P S Y S Y S Y W G M D Y 6.37E+04 7.95E-04 12.5 NE_040.3 Q Q Y G G H - Y H Y P I T G F N L Y S Y S M S I Y P Y S G Y T Y A R A R A S Y W A S S A P P S Y S Y S Y W G M D Y 4.58E+04 5.45E-04 11.9

Homology NE_044 Q Q S H F - - - G G L F T G F N L Y Y S Y M S I S S S Y G Y T Y A R A R P S H W S ------A W G I D Y 2.24E+05 4.84E-03 21.6 to GEFs NE_044.1 Q Q S H F - - - G G L F T G F N L W Y G Y M S I S S S Y G Y T Y A R A R P S H W S ------A W G I D Y 7.18E+05 4.50E-04 0.626 (KIAA1010)#4 NE_044.2 Q Q S H F - - - G G L F T G F N L Y Y G Y M S I S P S Y G Y T Y A R A R P S H W S ------A W G I D Y 7.30E+05 4.26E-04 0.584

RasGAP NE_057 Q Q F Y - - - - - S P I T G F N F S S S S I S I S P Y S G S T Y A R A R Y F Y Y H ------V V G L D Y 8.99E+04 3.62E-03 40.3 NE_057.1 Q Q F Y - - - - - S P I T G F N I S Y S S M S I S P Y S G S T Y A R A R Y F Y Y H ------V V G L D Y 2.22E+05 1.46E-05 0.0656 NE_057.2 Q Q F Y - - - - - S P I T G F N I S Y S S I S I S P Y S G S T Y A R A R Y F Y Y H ------V V G L D Y 4.73E+05 1.24E-05 0.0262 Intersectin2#2 NE_085 Q Q V A P W - S Y Y P F T G F N L Y S S Y M S I S S S Y G Y T Y A R A R W V Y Y Y S G ------Y Y F Y G L D Y 3.41E+05 6.68E-03 19.6 NE_085.1 Q Q - A R W V Y Y Y S G ------Y Y F Y G L D Y 7.18E+05 3.72E-03 5.18 V A P W S Y Y P F T G F N L Y S S Y M S I S S Y - G Y T Y A R Intersectin1#3 NE_087 Q Q Y G V - - - F H P I T G F N L Y S S Y M S I Y P Y Y S Y T S A R A R S W Y ------A F D Y 4.31E+05 1.83E-03 4.26 NE_087.1 Q Q Y G V - - - F H P I T G F N I G Y S Y M S I Y P Y Y S Y T Y A R A R S W Y ------A F D Y 5.62E+05 1.41E-03 2.52 NE_087.2 Q Q Y G V - - - F H P I T G F N L Y S S Y M S I Y P Y Y S Y T Y A R A R S W Y ------A F D Y 5.51E+05 1.08E-03 1.95 NE_087.3 Q Q Y G V - - - F H P I T G F N L Y S S Y M S I Y P Y Y G Y T Y A R A R S W Y ------A F D Y 4.59E+05 1.09E-03 2.38 NE_087.4 Q Q Y G V - - - F H P I T G F N L Y S S Y M S I Y P Y Y S Y T S A R A R A W Y ------A F D Y 5.39E+05 4.39E-04 0.814

Figure 2.5 – Affinity maturation results in improved affinities and viable detection reagents. High affinity clones against a subset of the SH3 domains were used as templates for the construction of second-generation libraries in a process known as affinity maturation. A second selection was performed using the affinity maturation libraries and the resulting populations were screened for clones with high specificity and high affinity. The affinities of each Fab were measured via surface plasmon resonance using the Proteon XPR36 from BioRad. GST-SH3 fusion proteins were adsorbed on a sensor surface and the purified Fabs were flowed over them at specific concentrations (0nM, 12.5nM, 25nM, 50nM, 100nM). Purified Fab proteins were given 1 minute association time, followed by a 15- minute dissociation period where buffer alone was flowed over the surface. The kinetics of association and dissociation were calculated by Proteon XPR36 software using the Langmuir model of one ligand (i.e. adsorbed GST-SH3) and one analyte (i.e. purified Fab protein). Parental Fabs are displayed on the top row of each group of anti-SH3 sequences. Most Fabs have dissociation constants in the low nanomolar range and affinity maturation has improved affinities to subnanomolar levels in some cases.

Figure 2.6 – Western blots of anti-RasGAP and anti-Crk1 Fabs. HEK293T cells were transfected with DNA using Lipofectamine 2000 and lysed 36-48h after transfection. Supernatants were boiled at 95C with SDS loading dye prior to SDS-PAGE on a 10% gel. Proteins were transferred to a PVDF membrane via electroblotting and detection by the Fabs and other affinity reagents was accomplished using the LI-800 system (Li-core Biosciences). (A) Detection of RasGAP by Fab13 (NE_057.1, Kd=62.5pM) and Fab14 (NE_057.2, Kd=26.2pM) from the affinity maturation clones. The first lane of each blot is the control vector pcDNA3 and represents endogenous expression of RasGAP. The second lane in each blot represents transfection with a pcDNA vector encoding RasGAP. Detection was also performed with the anti-FLAG antibody M2 (negative control) and the anti-RasGAP antibody B4F8. (B) Detection of Crk1 by Fab7 (NE_040.2, Kd=12.5nM) and Fab8 (NE_040.3, Kd = 11.9nM). The first lane is the control vector pcDNA3 and the second lane is a Myc-tagged Crk1 pCMV vector from Clonetech. Anti-Myc and anti-Crk antibodies were used as positive controls. In both cases (RasGAP and Crk), the original concentration of each reagent and the subsequent dilution is provided below the blot. The Fabs obtained from phage display demonstrate comparable specificity with the commercial antibodies. (Experiments by Bernard Liu, Pawson lab)

In light of these issues, a more fair comparison between the Fabs and commercial antibodies would require converting the Fabs full-length chimeric IgGs with a mouse Fc and performing the detection with secondary antibodies in the same way as the commercial reagents. In addition, a serial dilution of lysates would be required to accurately compare sensitivities of either the Fabs or their chimeric IgG counterparts.

2.8 Construction of Chimeric IgGs as a more direct comparison of detection

Since the commercial anti-RasGAP and anti-Crk antibodies were derived from immunized mice, I wanted to convert my four Fabs into chimeric IgGs with human Fabs and murine Fcs. In this manner, all of the IgGs could be visualized simultaneously with secondary anti-mouse-IgG antibodies. I decided to use the Fc portion of murine IgG1 since IgG1 antibodies are the most abundant of all antibody classes and would be most certainly be detected[74]. After ordering murine IgG1 Fc cDNA from Invivogen, I performed all of the necessary steps to clone the Fc into my Fab-containing phagemids to generate my chimeric IgGs (Figure 2.7A). In addition, I added a C-terminal 6xHis tag to heavy chain for the option of performing two-step purifications involving protein A and nickel-NTA beads.

Since my Fabs were derived from Library F parental clones, protein expression was under the control of a PhoA promoter in an E. coli bacterial host. Consequently, after sequence-verifying my chimeric IgGs, I performed a set of IgG expression and purification steps using the same protocols as for my Fabs. However, analysis of my proteins via SDS-PAGE (Figure 2.7B) led me to conclude that my IgG yields were too low downstream applications. A subsequent literature search confirmed that my PhoA system was not ideal for IgG expression[75] and I decided to try an IPTG-inducible system instead. I obtained an IPTG-inducible IgG vector from the Structural Genomics Consortium (SGC) and modified my IgG sequences for cloning purposes by removing internal restriction sites. After successfully cloning my IgGs into the new IPTG-inducible vector, I attempted expression in a variety of ways including the recommended conditions by the SGC (Figure 2.7C). Despite using two different expression systems, I was unable to obtain IgG proteins. This was not a particularly surprising result since complete IgGs require the formation of four disulphide bonds (linking the light chains to the heavy chains and the heavy chains to each other) in the periplasm and are very difficult to express using bacterial systems[75, 76].

2.9 Discussion

My experiments have validated the usefulness of a HTP phage display approach in the generation of novel high-affinity reagents. Not only did I obtain binding clones against 60% of immobilized GST-SH3 targets, but analysis of Fab proteins raised against six SH3 domains revealed that affinities from the naïve library were already in the low nanomolar range. Furthermore, I was able to improve the Fab affinities into the low picomolar range in a sequence- blind manner as there were no biases in the mutagenesis approach.

It must also be noted that all of the SH3 work has been based on screening 12 clones per antigen for specificity and sequencing the successful ones. Consequently, there may very well be Fabs within the selected phage populations that have even higher affinities and more desirable binding properties in light of such a small sample numbers. This is especially important when combined with the fact that alterations in the selection conditions can result in the capture of entirely different sets of clones[40].

In addition to their potential use as detection reagents, the Fabs generated by my HTP approach can also be tested as tools for purifying complexes via immunoprecipitation. This is a particularly appealing option because protein targets would not require the introduction of affinity tags and can be captured in their native conformations. Further evidence in support of such an application is the fact that the Fabs generated by my HTP pipeline fall within range of the observed affinities for successful Fab IPs (Colwill et al, submitted). While I could not generate full-length chimeric antibodies, expression of IgGs in bacterial systems is notoriously difficult[76] and this means that my Fabs must be transferred to a mammalian expression system if further study is warranted.

(Figure 2.7 is on the next page)

B) C)

Figure 2.7 – Construction, expression and purification of chimeric IgGs. Anti-Crk and anti- RasGAP Fabs were converted to chimeric IgGs by adding a murine IgG1 Fc at the C-terminus of each Fab heavy chain (A). In total, four IgGs were created and expressed in the original Library F vector, which has a PhoA promoter (B). SDS-PAGE of IgGs on a non-reducing gel. The lanes are numbered according to each IgG expressed and correspond to a specific Fab and Fab affinity: 1 (NE_040.2, anti-Crk#1, 12.5nM), 2 (NE_040.3, anti-Crk#1, 11.5nM), 3 (NE_057.1, anti- RasGAP, 62.5nM) and 4 (NE_057.2, anti-RasGAP, 26.2nM). Based on no observable IgG at the expected size of 150kDa, each IgG was cloned into an IPTG-inducible vector from the Structural Genomics Consortium (SGC). As a test, IgG 2 was chosen and expressed in a variety of conditions (B). Different overnight growth temperature (16C, 25C), lysis conditions (d-lysozyme digestion, s-sonication) and number of elutions (first-E1, second-E2) were used to determine the ideal conditions for IgG expression. Again, no IgG was observed at the expected size of 150kDa. The remaining bands represent IgG degradation products as well as expected IgG components (Light Chain[LC] ~ 28kDa, Heavy Chain[HC] ~55kDa, LC+HC ~ 74kDa, 2HC~100kDa, LC+2HC ~120kDa).

My approach is not only useful for generating reagents but also yields insights for further refining approaches to improve antibody specificity and affinity. While the light chain CDRs contribute to antibody specificity, the heavy chain CDRs are widely understood to be the largest players in the antibody-antigen interaction. Indeed, the selection results from my affinity maturation libraries show that subtle changes to the heavy chain CDRH1 and CDRH2 can result in affinity improvements of three orders of magnitude (none of the clones had changes in their light chain CDRs). However, recent work by Bostrom et al, in which the light chain CDRs were randomized in relation to high-affinity VH, has demonstrated the remarkable ability of single antibodies to support two different specificities at nanomolar affinities[77].

Most importantly, the low volumes involved in selections (50uL – 1.5mL) and the high rate of enrichment (60%) against purified targets make my HTP phage display pipeline an ideal candidate for robotic automation. Scaling up the HTP approach to thousands of protein targets would be a significant milestone that lays the foundation for the design and implementation of large scale experiments. The impact of an elegant and simple high-throughput solution cannot be overstated, especially when one considers the many uses of phage display in addition to the generation of high-affinity antibodies. However, the success of a high-thoughput phage display pipeline will also rely on advances in the throughput of its downstream applications since the generation of antibodies would only be the first step in the investigation of any particular biological question.

2.10 Materials and Methods

2.10.1 Strains and constructs

Fab-phage libraries were electroporated and amplified in E. coli SS320 (Genentech). During selection, phage were eluted and amplified overnight with E. coli XL1-blue (Stratagene). dU- ssDNA for site-directed mutagenesis was synthesized by infecting E. coli CJ236 (New England Biolabs). Human SH3 domains were synthesized by GENEART and cloned into the vector pHH0103 with NotI and SfiI restriction sites. Aliquots of S. cerevisiae SH3 and C. elegans PDZ protein were provided by Dr. Raffi Tonikian (University of Toronto). The vectors used for

45 transfection and expression of human SH3s in mammalian HEK293T cells were pcDNA3 (Clonetech) for RasGAP and pCMV (Clonetech) for Myc-tagged Crk1.

2.10.2 High-throughput Expression and Purification of Protein Targets

SH2 constructs were obtained from the work described by Colwill et al (2010). SS320 cultures transformed with the SH3 constructs were grown in a 96-well format by inoculating 0.4mL 2YT/Carbenicillin(50ng/mL) with each bacterial stock and incubating overnight at 37C and 200RPM. The cultures were then used to inoculate two 96-well plates with 1.5mL 2YT/Carbenicillin(50ug/mL)/IPTG(1mM) and grown at 37C for 18-24h. To maximize protein yield, the cultures were then recombined by performing sequential precipitation steps in the same plate. After obtaining one set of bacterial pellets via centrifugation at 3500RPM and 4C for 10 minutes, the supernatant was discarded and a second centrifugation step was performed after adding the cultures from the second plate to the corresponding wells. The supernatant was again discarded and the plates were stored overnight at -20C.

Protein purification was initiated by thawing the frozen pellets for 5 minutes and resuspending them in 250uL Suspension Buffer (50mM HEPES pH 7.5, 500mM NaCl, 5mM Imidazole, 5% Glycerol, 1x Protease Inhibitor [1mM PMSF, 1mM Benzamidine]) by shaking at 80RPM for 10 minutes at room temperature. Cells were lysed by adding 750uL Lysis Buffer (47mM HEPES pH 7.5, 470mM NaCl, 4.7mM Imidazole, 4.7% Glycerol, 0.6% CHAPS, 1x Protease Inhibitor, 0.5mg/mL Lysozyme, Benzonase) and shaking at 80RPM for 30 minutes at room temperature. 40uL of each lysate was aliquoted for SDS-PAGE analysis and the remaining lysates were centrifuged for 10 minutes at 3000RPM and 4C. 850uL of each supernatant was transferred to a binding plate of 96 columns coated with 150uL Ni-NTA resin mix (resin was diluted 5-fold in Suspension buffer and washed 3x in Suspension buffer by centrifugation at 1000RPM for 5 minutes followed by discarding of the supernatant and addition of fresh Suspension Buffer). The binding plate was shaken at 167RPM for 1 hour at 25C and then centrifuged at 1000RPM for 10minutes at 4C. The columns were washed 3x by adding Wash Buffer (50mM HEPES pH 7.5, 500mM NaCl, 30mM Imidazole, 5% Glycerol) and spinning at 1500RPM for 2 minutes each time. After the washes were completed, the columns were incubated with Elution Buffer (50mM HEPES pH 7.5, 500mM NaCl, 250mM Imidazole, 5% Glycerol) for 5 minutes and centrifuged at

2000RPM for 10 minutes. At this point, the eluted SH3 constructs can be stored at 4C for up to 2 months.

Purification of the constructs was verified via SDS-PAGE electrophoresis. Both lysates and elutions were added to 5x SDS Loading Buffer (250mM Tris pH 6.8, 500mM DTT, 10% SDS, 0.5% Bromophenol Blue, 50% Glycerol) and heated to 95C for 10 minutes. Eight 26-well criterion gels (10-20% Tris HCl) were loaded with 10uL of the samples and the gels were run at 200V, 100W and 1.4A for 80 minutes. The gels were washed 3x with distilled water and stained with Simply Blue Safestain for 1 hour. Gels were destained by incubating overnight in distilled water at 25RPM and room temperature.

2.10.3 Construction of Libraries

Library F was constructed as described by Helena Persson (submitted). Affinity Maturation Libraries of selected clones were constructed by oligonucleotide site-directed mutagenesis. In each case, three different strategies were employed: (1) mutagenesis of CDRH1 and CDRH2, (2) mutagenesis of CDRH3 and (3) mutagenesis of CDRL1 and CDRL3. The lengths of each clone‟s CDRs were not altered and diversities were restricted to Y/S for CDRH1,H2 and L1 while CDRs H3 and L3 had diversities of Y/S/G/A/F/W/H/P/V The oligonucleotides were synthesized using the same Trimer Phophoramididte Mix as for Library F and have the same composition (Persson et al, in preparation).

2.10.4 Amplification and Preparation of phage libraries/supernatants before and during selections

The construction of Library F is described in previous work by Helena Persson (manuscript in progress). Fab-phage Library F was amplified by incubating SS320 E.coli with approximately 10^13 cfu/mL of infective phage. 250mL of SS320 were grown in 2YT/tetracycline (5ug/mL) to an OD600 of 0.8 prior to infection with the phage library. Infection was allowed to proceed for 30min at 37C, 200RPM and was followed by the addition of M13 KO7 helper phage to a final concentration of 10^10 cfu/mL. The culture was left at 37C, 200RPM for another 45 minutes and then added to 8L of 2YT/Carbenicillin (50ug/mL)/Kanamycin(25ug/mL) and incubated at 37C, 200RPM for 18h. The overnight cultures were pelleted the following day at 10minutes, 10000RPM, 4C and the phage-containing supernatant was incubated with 1/5 volume PEG/NaCl

47 on ice for 20 minutes. The amplified phage library was pelleted at 11000 RPM, 20 minutes, 4C and the supernatant was decanted (bottles were spun again for 2 minutes to pool the remaining supernatant, which was then aspirated). Phage pellets were gently resuspended in 1/40 volume of TE-PMSF buffer (10mM Tris-HCl, 1mM EDTA, 0.5mM PMSF) and spun down again for 10minutes at 11000RPM, 4C. The supernatants were transferred to new tubes with 20mL TE buffer and spun down again for 10minutes, 11000RPM, 4C. The supernatant was incubated with 1/5 volume PEG/NaCl for 20 minutes on ice and the phage were precipated once again by spinning the tubes down at 11000RPM, 4C for 30 minutes. The supernatant was decanted in the same manner as the first precipitation step and the phage pellets were gently resuspended in 8mL sterile PBS (total volume). The resuspension was spun for 10 minutes at 11000RPM, 4C and the supernatant was transferred to a new tube. EDTA and glycerol were added to final concentrations of 2mM and 50% respectively. The purified Fab-phage library was then stored at -20C.

On the day of the first round of selection, approximately 10^13 cfu of Fab-phage library F glycerol stock were purified via PEG/NaCl precipitation. The phage stock was mixed with sterile PBS and incubated with 1/5 volume PEG/NaCl (20% PEG8000, 2.5M NaCl) on ice for 20 minutes. Phage were precipitated by centrifugation for 20 minutes at 11000RPM, 4C and the resultant phage pellet was resuspended in sterile PBS+0.5%BSA+0.005%Tween-20 (PBT). The same purification procedure was used for overnight phage supernatants in each round of selection for the affinity maturation libraries.

2.10.5 SH2 Mictrotiter Plate Selections

Selections of Fab library F were performed using a high through put selection method that enables parallel selection of a large number of antigens. Briefly, four rounds of selections were carried out in 96 well microtiter plates, using 4 wells per antigen and a concentration of 10 ug/ml. Pre-absorbtion was carried out on GST. Following 8 washes, the captured phages were used directly to infect bacteria without prior elution. Phages were amplified over night in a 96 well deep well plates with no precipitation of phages prior to the next round of selection. Clones considered positive in an initial ELISA screen were subjected to affinity maturation. Additional diversity was introduced in the first and second hypervariable loops of the heavy chain or the

48 light chain followed by another 3 rounds of panning of higher stringency– less antigen (5, 2, 1 ug/ml) and more washes (8, 10, 12).

2.10.6 SH3 High-throughput Selections

Selections and overnight amplifications were performed in a 96-well format. Prior to each round, 96-well Maxisorp microtiter plates (NUNC) were coated with 100uL of the purified GST-SH3 targets (diluted in PBS) and incubated overnight at 4C to allow for adsorption. The levels of immobilized antigen were decreased with each subsequent round (10x dilution, 20x dilution, 50x dilution, 50x dilution). In addition to the plates containing immobilized antigens, negative selection „mirror plates‟ were coated with 100uL of 5ug/mL GST-PDZ from the lab (AP02- 43[PDZ3 (P58)]) for rounds 1 and 2.

After overnight adsorption, the supernatant was decanted from both the selection and mirror plates and the immobilized antigens were blocked for 2h with 200uL PBS+0.5%BSA at room temperature and 25RPM. For rounds 1 and 2, the blocking solution was then decanted for the GST-PDZ plate and the wells were washed 4x with sterile PBS+0.1%Tween-20. 100uL of purified phage library (round 1) or pH-adjusted phage supernatant (rounds 2-4) were added to each well and incubated for 1h at room temperature and 25RPM. For rounds 3 and 4, the overnight amplified phage were pH-adjusted and incubated with 0.6mg/mL GST-heptapeptide (100uL total volume) in a 96-well non-binding plate (Corning) for 1.5-2h prior to addition to the antigen plate. In each case, the supernatants were then transferred to the selection plates (washed 4x with PBS+0.1%Tween-20) and incubated for 2h at room temperature and 25RPM. Unbound Fab-phage were then removed by washing the selection plate 8x with PBS+0.1%Tween-20 and the remaining clones were eluted by adding 100uL of actively growing E. coli XL1-Blue (OD600 ~0.5) and incubating at 37C, 200RPM for 30 minutes. M13 KO7 helper phage was then added to each well at a final concentration of 1x10^10 pfu/mL and the plates were incubated at 37C, 200RPM for 45 minutes. Phage were amplified by transferring the contents of each well

(E.coli + eluted phage + KO7) to 1.4mL 2YT/Carb50/Kan25 and incubating overnight at 37C and 200RPM. The following day, the now-amplified phage were isolated in the supernatant (as described earlier), pH-adjusted and used for the next round of selection.

2.10.7 Selection of Affinity Maturation Libraries

For selection of the affinity maturation libraries, 96-well selection plates were coated with 100uL of immobilized antigen and blocked as described previously. In this case, 8 wells were coated per antigen and antigen concentrations were much lower for each round (5ug/mL  2ug/mL  2ug/mL  1ug/mL). Prior to each round of selection, phage were incubated with purified GST (final concentrations of 1.2mg/mL for round 1 and 1mg/mL for each subsequent round) for 1-2h at 25RPM and room temperature. The plates were washed 4x with PBS+0.1%Tween-20 and the Fab-phage/GST solutions were transferred to the appropriate wells (100uL/well) and incubated for 2h at 25RPM and room temperature. Unbound phage particles were removed by washing 8x with PBS+0.1%Tween-20 and bound phage were eluted by incubating with 0.1M HCl for 5 minutes at room temperature. Eluted phage were pooled for each antigen (8 wells x 100uL = 800uL total volume) and neutralized with the appropriate volume (~1/10) of 1.0M Tris buffer (pH 11). 200uL of neutralized phage were used to infect 2mL of actively growing E. coli XL1- Blue (OD600 ~0.5-0.8) and the reaction was incubated at 37C and 200RPM for 30 minutes. M13 KO7 helper phage was added to final concentration of 10^10 pfu/mL and the cultures were incubated for another 45 minutes at 37C and 200RPM. Phage were amplified overnight by transferring the cultures to 20mL 2YT/Carb250/Kan25 and incubating at 37C and 200RPM.

2.10.8 Determining population enrichment and clone specificities

Population enrichment was determined via ELISAs using two 96-well microtiter plates coated with 50uL of antigen (10x dilution in PBS) and GST-PDZ (negative control, 5ug/mL in PBS) respectively. Amplified phage supernatant was obtained by spinning down the overnight 96-well deep plates at 3000RPM for 10min at 4C. Phage supernatant was then pH-adjusted by mixing phage with 1/10 volume of 10xPBS+0.05%Tween-20. The immobilized antigens on the microtiter plates were blocked for 1h with 200uL PBS+0.5%BSA at room temperature and 25RPM and then washed 4x with PBS+0.05%Tween-20. 50uL of pH-adjusted phage supernatant was then added to the appropriate well of the antigen ELISA plate and the corresponding well on the GST-PDZ ELISA plate and incubated for 2h at room temperature and 25C. Unbound phage particles were removed by washing the plates 6x with PBS+0.05%Tween-20 and the wells were incubated with 50uL of anti-M13-HRP antibody (1:5000 dilution in PBS+0.5%BSA+0.05%Tween-20) for 30 min at room temperature and 25C. The plates were

50 then washed 6x with PBS+0.05%Tween-20 followed by 2x with chilled sterile PBS. 50uL of TMB substrate (1:1 mix of solutions A and B) was added to each well and the reaction was allowed to proceed for 5 minutes. The reaction was stopped with 50uL of 1.0M H3PO4 and the plates were read at 450nm with the PowerWave XS plate reader (BioTek). ELISA ratios for a given phage supernatant were calculated by dividing the A450 of the antigen well by the A450 of the corresponding GST-PDZ-coated well.

Clone specificities were performed in the same manner. Actively growing XLI-Blue cells (OD600 = 0.5-0.8) were infected with diluted phage supernatant (~10^5 dilution) at 37C for 30 minutes and plated on prewarmed LB/Carb plates to select for infected cells. Individual colonies were picked on the following day and grown overnight in a 96-well format in 400uL

2YT/Carb50ug/mL/KO7 phage10^10 pfu/mL at 37C and 200RPM. The cultures were spun down at 3000RPM, 10min, 4C and the amplified clone supernatants were pH-adjusted prior to the ELISA. ELISAs were performed in 384-well maxisorp plates (50uL volumes for 96-well ELISA are now 30uL and 200uL volumes for 96-well ELISA are now 60uL).

2.10.9 Estimating clone affinities via High-throughput and low-throughput competitive ELISAs

Low-throughput competitive ELISAs were performed on 96-well maxisorp plates. Wells were coated overnight with target antigen (5ug/mL) and negative control protein (5ug/mL). Plates were blocked with PBS+0.5%BSA+0.05%Tween-20 for 2h. In the meantime, pH-adjusted phage supernatants were diluted 5-fold and incubated with target antigen in solution (0nM, 50nM, 100nM in PBS+0.5%BSA+0.05%Tween-20) in 96-well non-binding mictrotiter plates (Corning). Plates were washed 4x with PBS+0.05%Tween-20 and the competition mixtures were transferred to their corresponding positions. After incubation for 1h at room temperature and 25RPM, plates were washed 8x with PBS+0.05%Tween-20. Plates were incubated with anti- M13-HRP antibody (1:5000 dilution in PBS+0.5%BSA+0.05%Tween-20) for 30 minutes at room temperature and 25RPM and then washed 6x with PBS+0.05%Tween-20 and 2x with PBS. Plates were then incubated with TMB substrate (1:1 mix) for 5 minutes and the reaction was stopped with an equal volume of 1.0M H3PO4. Plates were read at 450nm using a PowerWave XS plate reader (BioTek).

For high-throughput competitive ELISAs, 384-well Maxisorp microtiter plates were coated with target antigen (2ug/mL) and negative control protein (5ug/mL) as described earlier. Plates were blocked with PBS+0.5%BSA+0.05%Tween-20 the following day and pH-adjusted phage supernatants were diluted 5-fold and incubated with different concentrations of the target antigen in PBS+0.5%BSA+0.05%Tween-20 (0nM, 10nM, 20nM) on non-binding microtiter plates (Corning). The mixtures were incubated for 2h at room temperature and 25RPM. The ELISA plates were washed 3x with PBS+0.05%Tween-20 using the Velocity11 automated liquid handler (Agilent Technologies) prior to addition of the competition mixtures. After an incubating for 20-24 minutes, the plates were washed 3x with PBS+0.05%Tween-20. Anti-M13-HRP antibody (1:5000 dilution in PBS+0.5%BSA+0.05%Tween) was added and incubated for 30minutes at room temperature and 25RPM. Plates were washed 6x with PBS+0.5%BSA+0.05%Tween-20 and TMB substrate (1:1 mix) was added for 6 minutes. The reaction was stopped by an equal volume of 1M H3PO4 and the plates were read at 450nm.

2.10.10 Sequencing of clones

Clones were sequenced by PCR-amplifying the VL and VH regions using primers with M13 forward and M13 reverse sequences (underlined in red). The primer sequences are: VL-forward 5‟-TGTAAAACGACGGCCAGTCTGTCATAAAGTTGTCACGG-3‟, VL-reverse 5‟- CAGGAAACAGCTATGACCCCTTGGTACCCTGTCCG-3‟, VH-forward 5‟- TGTAAAACGACGGCCAGTGGACGCATCGTGGCCCTA-3‟, and VH-reverse 5‟- CAGGAAACAGCTATGACCCCTTGGTGGAGGCCGAG-3‟. PCR reactions were performed in 25uL reaction volumes with 1.25 uL of phage supernatant. PCR products were purified with an Exonuclease-I and Shrimp Alkaline Phosphatase mix (1uL PCR product, 10uL reaction mix) prior to sequencing.

2.10.11 Introducing AMBER-STOP to Phage Clones

A 6xHis-Amber STOP tag (5‟- TGT GAC AAA ACT CAC ACA GGT GGC TCT CAT CAT CAC CAT CAC CAC TAG GGC GGT GGC TCT GGT TCC GGT GAT TTT -3‟) was added via oligonucleotide site-directed mutagenesis to the C-terminal end of the Fab Heavy Chain prior to the start of gene III encoding the phage coat protein 3. Successful introduction of the 6xHis- Amber STOP tag was verified by PCR-amplifying and sequencing the DNA from a couple of clones from each mutagenesis reaction with M13-tagged primers ( geneIII forward 5‟-

TGTAAAACGACGGCCAGTAGCTTGGGCACCCAGACC-3‟, geneIII reverse 3‟- CAGGAAACAGCTATGACCCCCAGTCACGACGTTGTA-3‟).

2.10.12 Fab Purification and Affinity Analysis

E.coli 55244 cells were transformed with phagemids encoding the desired 6xHis-Amber STOP tagged Fabs and plated on LB/Carbenicillin plates. Individual clones were grown overnight in

30mL 2YT/Carb50/Kan25 at 230RPM and 37C. The cells were pelleted the following day by spinning at 3000RPM for 10 minutes at 4C. The supernatant was decanted and the tubes were spun once more for 2 minutes and the remaining supernatant was subsequently aspirated. Pellets were resuspended in 15mL CRAP media and 5mL of the suspensions were used to inoculate 900mL of CRAP media supplemented with 6 drops of Anti-foam 204 (Sigma). The cultures were grown for 27h at 230RPM and 30C in a shaker or for 27h at 32C using a LEX bioreactor (Harbinger). OD600 measurements were taken for each culture and the cells were pelleted at 8000RPM, 10 minutes, 4C and weighed. Pellets were resuspended in 25mL PBS and the suspensions were stored at -20C until completely frozen. The suspensions were thawed and incubated with 15mg Lysozyme and 30U DNAseI for 1 hour on ice. The cells were sonicated with the Vibra-Cell Ultrasonic Processor (Sonics and Materials Inc.) at 40% amplitude, 4 minutes total duration (5 seconds ON, 5 seconds OFF). Cell debris was precipitated by two consecutive centrifugations for 30 minutes at 12500RPM and 4C (supernatants were transferred to fresh tubes at the end of each centrifugation). The lysate supernatants were then added to columns packed with 1mL of rProtein A-sepharose beads (GE Healthcare) and equlibriated with 20mL PBS. The supernatants were flowed through twice and the columns were then washed with

30mL PBS. Proteins were eluted with 5mL Elution Buffer (50mM NaH2PO4, 100mM H3PO4,

140mM NaCl, pH 2.5) and neutralized with 1.5mL Neutralization Buffer (1M Na2HPO4, 140mM NaCl, pH 8.6).

2.10.13 Cell culture and Transfection

HEK293T cells were maintained in DMEM (Dulbecco‟s Modified Eagle‟s Medium) supplemented with 10% fetal calf serum, 100µg/ml penicillin, and 100µg/ml streptomycin. Cells were transiently transfected using Lipofectamine 2000 (Invitrogen) according to manufacturer‟s instructions. After 12 hrs, cells were replenished with normal media conditions. Cells were

53 harvested 36-48 hrs post-transfection. Plasmids used for transfection such as pcDNA3-RasGAP and pLP-Myc-Crk were gifts from the T. Pawson (Samuel Lunenfeld Research Institute).

2.10.14 Western Blotting

For analysis of whole cell extracts by western blotting, cells were scraped directing in Laemmli sample buffer (4% SDS, 20% glycerol, 10% 2-mercaptoethanol, 0.004% bromphenol blue, 0.125 M Tris HCl), collected and then boiled. After SDS-page, proteins were transferred to nitrocellulose and then detected using the Odyssey Infared Imaging System (LiCor Biosciences).

Antibodies used were as follows: anti-Flag-M2 (1:1000; Sigma), anti-RasGAP B4F8 (1:1000; Santa Cruz Biotechnology, Inc.), anti-Crk I/II (1:1000; Santa Cruz Biotechnology, Inc.) and anti- Crk (BD Biosciences). For Odyssey detection, IRDye-800-conjucated goat anti-mouse (1:10,000; LiCor Biosciences) secondary antibodies were used. For immunodetection using FABs, membranes were blocked in 5% non-fat milk in Tris-buffered saline (TBS, 50mM Tris, 150mM NaCl, pH 7.6) for 1 hour at room temperature or overnight at 4C. FABs were incubated for 1.5 hours at room temperature. After washing with 0.1% Tween-20 in TBS (TBS-T), membranes were incubated with anti-Flag-M2 for 1.5 hours. After the membranes were washed with TBS-T, the secondary antibodies IR-Dye-800 goat-anti-mouse were incubated for 1 hour and then scanned using the Odyssey Infared Imaging System (LiCor Biosciences).

Chapter 3 Validation of scFv-phage Library G and application to the intein- Yeast-two-hybrid intrabody pipeline

3 Validation of scFv-phage Library G and application to the intein-Yeast-two-hybrid intrabody pipeline

The last two decades have seen many efforts to improve the generation of intrabodies against intracellular targets. During this time, researchers have attempted a variety of approaches with varying levels of success. However, one common theme has been the incorporation of preselection rounds in vitro followed by transfer of the antibody-encoding DNA into eukaryotic expression cells. Another trait that all these attempts share in common has been the low starting number of target antigens for intrabody generation. Consequently, I thought that combining my high-throughput selection approach from Chapter 2 with a novel system for screening captured clones within eukaryotic cells would enable the construction of a new intrabody pipeline that would not be restricted by scale.

In this chapter I present my work in the construction of a new scFv library (Library G) and selection experiments that validate the effectiveness of this library as a potential tool in the intein-Yeast-two-hybrid intrabody pipeline. I also cover a set of proof-of-principle targets for which downstream functional assays can be performed to confirm the generation of functional intrabodies.

3.1 Construction of scFv Library G

In order to generate an intrabody pipeline, it was important to choose the type of antibody fragment used. While Fabs are generally more stable both extra- and intra-cellularly and support higher affinities than scFvs, their reliance on inter-domain disulphide bonds eliminate them from applications relying on ectopic antibody expression within the cytoplasm. Not only would the immunoglobulin domains need to fold properly within the cell but the chains (heavy and light) would have no way of associating together in a reliable manner. The heavy and light chain variable domains of the scFv on the other hand are joined together by a flexible polypeptide linker, which ensures that expressed scFvs remain intact. Furthermore, preliminary work done by Dr. Helena Persson to construct scFvs for incorporation into the intein-Y2H strategy had already proven promising. ScFvs derived from the Library F anti-MBP template Fab were used to establish an ideal polypeptide linker between the VH and VL domains for the intracellular scFv scaffold (Figure 3.1). These experiments had the added benefit of demonstrating that the anti-

MBP VH and VL domains are suitable scaffolds for intracellular applications.

3.1.1 scFv Template Design Based on the success of the Fab-phage Library F for my previous work and the intracellular potential of the derived scFvs, my scFv template was composed of the same anti-MBP VL and

VH domains joined by the ideal polypeptide linker, C3 (Figure 3.1). Furthermore, it was important to construct this library in an IPTG-inducible vector in order to simplify protein expression for downstream applications. In order to accomplish these goals, I needed to find an IPTG-inducible vector that was suitable for both site-directed mutagenesis and phage display. Furthermore, I wanted to retain the same truncated version of protein 3 and linker region in my scFv constructs to maximize the chances of obtaining scFv-phage particles with similar display properties to Fab-phage Library F.

Figure 3.1 – Intrabody scFv construct with ideal polypeptide linker C3. The scFv consists of the VL and VH domains joined by a polypeptide linker and shares many of the same features with the Library F Fab template (secretion signal, variable domains, hinge region, dimerization domain and protein 3). Localization of protein 3 to the inner membrane serves to anchor the scFv in place and the cysteine in the dimerization domain allows for the formation of scFv-protein 3 dimers via disulfide bonding to mimic the two arms of a full-length antibody. The flexible IGHG1 hinge region reduces steric interactions between the scFv and protein 3 and allows for a greater range of motion by the scFv fusion.

After testing various vectors, I decided to work with the p8-STOP phagemid (Figure 3.2A). This vector had already been successfully used in the construction and selection of phage libraries by others in the lab and contained the identical gene for phage coat protein 3 as Library F. I

57 modified p8-STOP by introducing two restriction sites (NcoI and XbaI) and cloned in two versions of the Library F anti-MBP Fab template: a version with the same periplasmic secretion signals as the original library F (1.10 anti-MBP) and another version from the Structural Genomics Consortium (SGC) with different secretion signals (6.31 anti-MBP) (Figure 3.2B-D). In order to test the relative yields from each set of secretion signals, I introduced a 6xHis-Amber STOP tag at the C-terminal end of each Fab‟s heavy chain so that the proteins could be secreted separately from the phage coat during expression in a non-suppressor bacterial strain. I then performed site-directed mutagenesis on both Fabs to generate the corresponding scFv templates. I finished construction of the library templates for both versions (1.10 and 6.31) of scFv by removing the NcoI and XbaI restriction sites. In addition, I introduced an N-terminal FLAG tag for detection purposes.

I then assessed the quality of each construct via anti-FLAG ELISAs and capture by protein A (Figure 3.3). These methods provide a direct comparison between display levels of different antibody constructs on the phage surface when each construct is tested at the same starting concentration of phage particles. From these experiments, I observed no difference between the 1.10 and 6.31 scFvs in terms of anti-FLAG ELISA signal or protein A capture. Consequently, I chose to work with the 1.10 scFv for simplicity since it retained the same secretion signals and anti-MBP scaffold as the lab‟s Fab-phage Library F template.

3.1.2 Randomization Strategy The randomization strategy for scFv-phage Library G was adapted from the design of Fab-phage Library F and involved the randomization of all six antibody CDRs (Figure 3.4). The lesser CDRs (L1, L2, H1 and H2) were limited in both terms of residue composition and loop length due to their smaller contributions to antigen-binding and the unknown effects of their simultaneous randomization on scaffold stability. In direct contrast, incredible diversity was introduced into CDRs L3 and H3 due to their importance in antigen binding and the lack of established structurally important residues within the loops themselves.

In terms of residue composition, CDRs L1, L2, H1 and H2 were randomized based on a YSG code (Tyrosine/Serine/Glycine). This approach was chosen due to previous work by the Sidhu group that established that the two-amino acid code of Tyrosine and Serine is sufficient for

A) B)

C) Figure 3.2 – Modification of the P8-STOP vector and introduction of scFv constructs. (A) P8-STOP phagemid. This IPTG-inducible vector contains an ampicillin resistance marker, an f1 origin of replication, a dsDNA origin of replication and the repressor LacIq. The gene encoding protein 8 is located downstream of a ptac promoter and STII E. coli secretion signal. The truncated version of protein 3 is also present in this vector but is not expressed. (B) P3- STOP phagemid. This vector was constructed by removing gene 8 and replacing it with a multiple cloning site containing NcoI and XbaI restriction sequences. I also created another version of P3-STOP that also lacked the secretion signal so that the PelB signal could be introduced. (C) Introduction of scFv constructs. The constructs were introduced through a digestion and ligation step. The restriction sites were then removed via site-directed mutagenesis to generate an uninterrupted construct throughout. (D) The scFv constructs. Both scFv versions share all of the same architecture as the Library

(Figure 3.2 – Continued) F-based construct in figure 3.1. An N-terminal FLAG tag has been introduced for detection purposes and both scFvs contain the same ideal polypeptide linker C3. The 6.31 scFv has a PelB secretion signal while the 1.10 scFv has the same STII signal as Library F.

A) B) 1.10 scFv 6.31 scFv Dilution FLAG+ PBS FLAG+ PBS 0* 2.05 0.12 2.07 0.11 3 2.12 0.06 2.10 0.06 Construct Starting Phage Phage captured 3^2 2.09 0.06 2.07 0.05 by protein A 3^3 1.94 0.05 1.91 0.05 (pfu/well) (cfu/well) 3^4 1.64 0.04 1.62 0.04 1.10 scFv 7.9 x 10^12 0.9 + 0.6 x 10^5 3^5 1.17 0.05 1.12 0.04 6.31 scFv 21.3 x 10^12 2.8 + 0.0 x 10^5 3^6 0.60 0.05 0.58 0.04 3^7 0.25 0.05 0.23 0.05

* OD268 = 1.0 Figure 3.3 – Analysis of display level between different scFv constructs. Display levels of each construct were explored through anti-FLAG ELISAs (A) and protein A capture (B). For anti-FLAG ELISAs, the scFv-phage were diluted to an OD268 of 1 and serial three-fold dilutions were incubated with immobilized anti-FLAG antibodies and a Phosphate Buffered Saline (PBS) negative control. For protein A capture, the supernatants from the 3^4 dilution were incubated in immobilized protein A in triplicate. After incubation and a series of washes to remove non-displaying phage and misfolded scFvs, the remaining bound phage were eluted and tittered in actively growing XL1-Blue E. coli. There is no observable difference between 1.10 and 6.31 scFvs in terms of anti-FLAG ELISA signal or protein A capture when starting titres are taken into account.

CDRL1

27 28 29 36 37 38 anti-MBP Q S V S S A V Library G Q YSG YSG YSG YSG YSG V CDRL1 YSG-residue Loop Length: 4-6

CDRL2

57 65 66 67 68 69 56 anti-MBP S A S S L Y S Library G YSG A S YSG L Y S CDRL2 YSG-residue Loop Lenth: 2

CDRL3

105 106 107 108 109 114 115 116 117 anti-MBP Q Q S S Y S L I T Library G Q Q X X X X PL FI T CDRL3 X-residue Loop Length: 3 - 10

CDRH1

28 29 30 35 36 37 38 39 27 anti-MBP G F N F S S S S I Library G G F N IL YSG YSG YSG YSG IM CDRH1 YSG-residue Loop Length: 4-6

CDRH2

55 56 57 58 59 62 63 64 65 66 anti-MBP S I S S S Y G Y T Y Library G YS I YSG PS YSG YSG YSG YSG T YSG CDRH2 YSG-residue Loop Length: 6

CDRH3

105 106 107 108 109 110 111 111 111 111 112 112 112 112 113 114 115 116 117 anti-MBP A R T V R G S K K P Y F S G W A M D Y Library G A R X X X X X X X X X X X X X AG FILM D Y

CDRH3 X-residue Loop Length: 1 - 17

X = Y/S/G/A/F/W/H/P/V (25/20/20/10/5/5/5/5/5) YSG = Y/S/G (50/25/25)

Figure 3.4 - Randomization strategy for scFv-phage Library G. Mutagenesis of the Library G template involved the targeting all six CDRs. Diversity was introduced both in terms of loop length and residue composition. CDRs L1, L2, H1, and H2 contain much less diversity than CDRs L3 and H3 due to their smaller contributions to antigen binding. Positions denoted by X may contain Tyrosine (Y), Serine (S), Glycine (G), Alanine (A), Phenylalanine (F), Tryptophan (W), Histidine (H), Proline (P) or Valine (V). The frequency of each residue is included as a percentage in the adjacent brackets. The residues in positions denoted by YSG (Tyrosine/Serine/Glycine) appear in a 50/25/25 ratio. Residues in grey have not been altered. The residues are numbered according to the IMGT system.

61 generating high-affinity antigen interactions. In addition, loop lengths of 4-6 residues were allowed for CDRs H1 and L1 while loop lengths of 1-2 residues were allowed for CDRs L2 and L2.

For CDRs L3 and H3, nine different residues were allowed (Tyrosine, Serine, Glycine, Alanine, Phenylalanine, Tryptophan, Histidine, Proline, Valine) based on a survey of CDRH3s from the immune repertoire[37]. In addition, loop lengths of 3-10 residues and 1-17 residues were allowed for L3 and H3 respectively.

3.1.3 Construction of scFv Library G The randomization of all six CDRs in an antibody framework had never been attempted before in the scientific community due to concerns about potential adverse effects on antibody stability. Consequently, the construction of scFv-phage Library G required extra precautions to ensure that it was of high quality and contained a majority of properly folded clones (construction of the library was mainly performed by three postdoctoral fellows: Dr. Sarav Rajan, Dr. Amandeep Gakhal and Dr. Nish Patel).

In order to accomplish this, the lesser CDRs (H1, H2, L1 and L2) were randomized first and the resulting phage clones were prescreened for proper folding prior to randomization of CDRs H3 and L3. The prescreening step was performed as a two-round selection against staphylococcal protein A, which binds to correctly folded VH domains[57, 78]. This procedure ensured that the resulting scFv-phage clones were structurally sound in addition to having unprecedented diversity in CDRs H1, H2, L1 and L2.

After the protein A selection steps, diversity was introduced into CDRs L3 and H3. This was accomplished through four site-directed mutagenesis reactions to maximize the number of oligonucleotides incorporated and resulted in four sublibraries labeled A-D. Each sublibrary contained complete diversity in CDRs L1, L2, L3, H1 and H2 while the diversity in CDR H3 was divided up into each sublibrary so that all 17 allowable loop lengths were equally represented.

After electroporation of scFv-phage DNA into its superinfected bacterial host, the diversity of Library G was calculated at 3x1010 unique clones. At this point, we sequenced 24 clones from

62 each sublibrary to ensure that there were no biases resulting from our randomization procedure. The sequencing results indicated that site-directed mutagenesis worked in approximately 50% of cases and the remaining clones retained stop codons in regions to be randomized. Consequently, the functional diversity of scFv-phage Library G was actually 1.5x1010 unique clones and was still comparable to the diversity of Fab-phage Library F (3x1010).

Based on these results, my colleagues decided to repeat the construction of scFv Library G in order to improve the number of functional clones for their projects. I, however, decided to proceed with the original scFv-phage Library G since I reasoned that it had sufficient diversity to capture functional clones against my targets. Furthermore, my experiments would be completed prior to the second attempt at constructing scFv-phage Library G and would yield useful information as to whether the randomization of all six CDRs was indeed a feasible approach.

3.2 Proof-of-Principle Selection Targets

Since the performance of scFv-phage Library G had not yet been tested in selection experiments, I decided to proceed with selections against Abl and 3BP2, the two proof-of-principle proteins in the validation of my intrabody pipeline.

3.2.1 The 3BP2 SH2 and Abl SH3 domains

The 3BP2 and Abl proteins have established roles in proper osteoblast maturation and activity[79]. Abl is a non-receptor tyrosine kinase that consists of an N-terminal region known as the „cap‟ followed by an SH3 domain, an SH2 domain, the kinase domain, and a series of proline-rich stretches, nuclear localization signals and various other binding domains (Figure 3.5)[80]. By itself, Abl adopts an inactive conformation through a combination of intramolecular interactions that include the SH2 domain clustering with the C-lobe of the kinase domain and the SH3 domain binding to the proline-rich linker region between the SH2 and kinase domains (Figure 3.5). Catalytic activation is induced by opening the conformation through interactions of the SH3 and/or SH2 domain(s) with other binding partners. One such partner is the 3BP2 protein, which consists of an N-terminal pleckstrin homology (PH) domain followed by a proline-rich region and a C-terminal SH2 domain[81]. The proline-rich region in 3BP2 binds to the SH3 domain of Abl, resulting in the disruption of the inactive conformation and the activation of the Abl kinase domain[79, 80]. Finally, subsequent phosphorylation of two Abl

63 tyrosines (Y245 in the linker region and Y412 in the kinase domain) stabilizes Abl in the active conformation.

Figure 3.5 – The Abl protein. (A) Architecture of the Abl protein. Abl is a non-receptor tyrosine kinase that exists as two isoforms, 1a and 1b. The only difference between the two is the presence of an N-terminal myristylation domain found in 1b. Both proteins have N-terminal cap domains followed by an SH3 domain (green), and SH2 domain (yellow), a proline rich linker, the kinase domain (dark red), three proline-rich regions (PXXP, dark blue), three nuclear localization signals (NLS, dark red), a DNA binding domain, a G-actin binding domain, an F- actin binding domain and a nuclear export signal (NES, light blue). (B) Closed and open conformations of the Abl protein. Abl adopts an inactive conformation through a combination of intramolecular interactions that include the SH2 domain clustering with the C-lobe of the kinase domain and the SH3 domain binding to the proline-rich linker region between the SH2 and kinase domains. Catalytic activation is induced by opening the conformation through interactions of the SH3 and/or SH2 domain(s) with other binding partners. Finally, subsequent phosphorylation of two Abl tyrosines (Y245 in the linker region and Y412 in the kinase domain) stabilizes Abl in the active conformation. Figure adapted from Sirvent et al, 2008[80].

Experiments performed by the Rottapel lab demonstrate that when 3BP2 is deleted in mice (3BP2-/-), fewer osteoblasts are derived from progenitor cells and they exhibit reduced mineral deposition and bone formation activities. However, the constitutively active version of Abl effectively abolishes the effects of a 3BP2 knockout and restores the behaviour of murine

64 osteoblasts. Furthermore, the Rottapel group has also established that the proline-rich region of 3BP2 alone is enough to convert Abl to its active conformation[79].

3.2.2 Downstream assays for intrabody function

The established link between the 3BP2-Abl interaction and its effect on osteoblast activity provides a great way to test the scFvs generated by my proposed scFv-phage/Y2H intrabody pipeline. By introducing scFvs into murine osteoblasts through a lentiviral vector and inducing their expression, one can screen anti-3BP2-SH2 scFvs for inhibition of the 3BP2-Abl interaction in regular osteoblasts and anti-Abl-SH3 scFvs for the activation of Abl in 3BP2-/- cells.

Assays measuring osteoblast function have already been developed by the Rottapel lab and are readily available for the downstream validation of the scFv/Y2H pipeline. The ability of osteoblasts to synthesize bone tissue is determined through a collagen-formation screen that involves staining with picric acid while the abilities of osteoblasts to perform their mineral- deposition functions is measured in an alizarin red and von Kossa staining procedure[79]. Both assays have been adapted from protocols in Bone Research[82].

3.3 Selection of Library G against proof-of-principle targets

Since the behavior of Library G was not yet extensively characterized, I performed my selections in a low-throughput format (i.e. multiple wells per target, large overnight amplification volumes) in order to maximize the chances of obtaining scFv-phage binders. This approach had the added benefit of maximizing the number of unique clones captured against each target, which would enable the screening of many more scFvs within the yeast cells.

3.3.1 Selections against 3BP2 SH2 and Abl1 SH3 yield enriched scFv-phage populations

The selections were performed for four rounds and enrichment of the phage populations was determined by pooled ELISAs in rounds 3 and 4 (Table 3.1). Since my targets were fused to GST, I also included negative selection pressure in each round to reduce the presence of non- specific binders. During the first two rounds of selection, I pre-incubated my phage pools in plates coated with two irrelevant SH3-GST fusions (Nck2#2 and Grb2#2) prior to transferring

65 unbound phage to my selection plates. In rounds 3 and 4, my phage pools were incubated with GST-SH3 protein in solution throughout the entire selection procedure.

Successful population enrichment was defined as an ELISA absorbance ratio of greater than 2.5 for target protein relative to the GST negative control. Based on these criteria, I observed consistent enrichment for each protein when the ELISA signals were compared between the targets and the GST-SH3 control wells. Target Round 3 Round 4 Enrichment Enrichment Ratio Ratio

Abl1 SH3 12.4 15 3BP2 SH2 6.6 8.7

Table 3.1 – Enrichment of scFv-phage Library G against SH3 and SH2 domains from Abl1 and 3PB2. Selections were performed for four rounds and enrichment of the phage populations was determined by pooled ELISAs in rounds 3 and 4. Since the protein targets were fused to GST, negative selection pressure was included in each round to reduce the presence of non- specific binders. Successful population enrichment was defined as an ELISA absorbance ratio of greater than 2.5 for target protein relative to the GST negative control. Enrichment was observed for every target.

3.3.2 scFv-phage clones against 3BP2 SH2 and Abl SH3 are specific and have high affinities against their targets

Since my selections worked, I picked 96 scFv-phage clones against each protein and performed large-scale competitive ELISAs to simultaneously determine which clones demonstrated specificity for their target and which of these clones had the highest affinities (Figure 3.6). ScFv- phage clones were pre-incubated with 0nM, 10nM and 50nM of target prior to incubation in ELISA plates coated with the same protein. Signal intensities were measured at 450nm for each condition (including a GST-SH3 control) and specificity was defined as a target to control ratio of at least 2.5.

Affinity was defined as the level of antigen required to block scFv-phage binding to the immobilized antigen by 50%. Based on these criteria, scFv-phage clones with affinities in the low nanomolar range were obtained for each target.

Sequencing results for 24 clones picked against each target revealed 13 unique scFv binders for Abl1 SH3 and 11 unique scFvs for 3BP2 SH2 (Figure 3.7). Apart from the large number of unique scFvs against each target, it was also a positive sign to observe that clones against the same domain were more similar in terms of sequence lengths and residues present versus clones selected against another protein. In general, my results confirm that Library G can be used as a screening tool for future experiments.

Figure 3.6 Specificity and competitive ELISAs for clones against Abl1 SH3 and 3BP2 SH2 domains. (Caption and remainder of figure on next page).

Abl1 SH3 GST control 1 2 3 4 5 6 7 8 9 10 11 12 A 0.20 0.21 0.19 0.19 0.18 0.21 0.20 0.20 0.21 0.16 0.16 0.17 B 0.20 0.18 0.21 0.20 0.19 0.19 0.18 0.19 0.20 0.18 0.21 0.25 C 0.18 0.19 0.20 0.18 0.20 0.20 0.20 0.18 0.22 0.30 0.19 0.21 D 0.19 0.23 0.19 0.18 0.18 0.21 0.19 0.19 0.24 0.15 0.19 0.17 E 0.24 0.28 0.19 0.19 0.17 0.17 0.21 0.17 0.19 0.17 0.18 0.20 F 0.19 0.19 0.18 0.18 0.21 0.18 0.18 0.18 0.23 0.28 0.18 0.20 G 0.37 0.20 0.22 0.18 0.30 0.18 0.24 0.18 0.22 0.21 0.16 0.21 H 0.18 0.18 0.17 0.17 0.18 0.16 0.16 0.18 0.19 0.18 0.16 0.17

0nM 1 2 3 4 5 6 7 8 9 10 11 12 A 0.33 0.55 0.39 0.46 0.35 0.79 0.47 1.45 0.44 0.28 0.26 0.40 B 0.59 1.50 0.45 0.57 0.43 0.69 0.24 1.42 0.99 0.24 0.83 0.36 C 0.40 1.37 0.79 0.18 0.51 0.91 0.58 0.28 1.45 0.92 0.67 1.27 D 1.60 0.82 0.91 1.20 0.85 1.04 0.27 0.63 0.86 0.17 1.70 1.97 E 1.01 0.09 1.16 0.44 1.19 1.38 0.67 0.61 0.72 1.06 0.26 0.40 F 1.08 0.74 0.89 1.37 1.17 0.27 1.71 0.50 0.37 0.47 0.57 2.12 G 2.10 0.77 1.10 0.20 1.85 0.34 0.68 1.04 1.23 1.17 0.38 0.32 H 1.64 0.21 0.41 0.20 2.11 1.22 0.20 1.07 0.66 1.32 0.65 0.90

10nM 1 2 3 4 5 6 7 8 9 10 11 12 A 0.19 0.19 0.17 0.18 0.17 0.18 0.21 0.22 0.19 0.17 0.16 0.16 B 0.19 0.21 0.17 0.20 0.17 0.19 0.17 0.20 0.18 0.16 0.24 0.18 C 0.17 0.21 0.18 0.16 0.19 0.19 0.18 0.15 0.21 0.19 0.17 0.22 D 0.22 0.21 0.17 0.20 0.19 0.19 0.18 0.18 0.20 0.15 0.20 0.18 E 0.20 0.05 0.22 0.19 0.19 0.21 0.17 0.21 0.22 0.19 0.18 0.21 F 0.20 0.20 0.22 0.23 0.20 0.17 0.23 0.18 0.21 0.22 0.18 0.22 G 2.60 0.19 0.21 0.18 0.32 0.18 0.22 0.21 0.22 0.21 0.18 0.20 H 2.12 0.18 0.18 0.17 0.24 0.21 0.17 0.22 0.20 0.19 0.17 0.18

10nM/ 0nM 1 2 3 4 5 6 7 8 9 10 11 12 A 0.58 0.35 0.44 0.39 0.49 0.23 0.45 0.15 0.43 0.62 0.62 0.41 B 0.33 0.14 0.38 0.34 0.41 0.27 0.70 0.14 0.19 0.64 0.29 0.51 C 0.43 0.16 0.23 0.87 0.36 0.21 0.32 0.56 0.14 0.21 0.26 0.18 D 0.14 0.25 0.19 0.16 0.23 0.19 0.65 0.28 0.23 0.89 0.12 0.09 E 0.20 0.52 0.19 0.43 0.16 0.15 0.26 0.35 0.31 0.18 0.68 0.54 F 0.19 0.27 0.25 0.17 0.17 0.63 0.13 0.36 0.56 0.46 0.31 0.10 G 1.24 0.24 0.19 0.92 0.17 0.53 0.32 0.21 0.18 0.18 0.47 0.64 H 1.30 0.87 0.44 0.86 0.11 0.17 0.84 0.21 0.31 0.15 0.26 0.20

Figure 3.6 – Specificity and competitive ELISAs for clones against Abl1 SH3 and 3BP2 SH2 domains. 96 scFv-phage clones were picked from round 4 from the selections of Library G against Abl1 SH3 (A) and 3BP2 SH2 (B). The clones were tested immediately in a competitive ELISA in order to determine specificity and approximate affinity. Clones were incubated with a GST-SH3 negative control and against their targets in the presence of 0nM, 10nM and 50nM of competitor in solution (the Abl1 and 3BP2 domains served as the competitors for their clones in every case). For simplicity, the 50nM condition is omitted. The ELISA signals of the 0nM condition were compared to the negative control to determine specific binding and to the competitor conditions to determine the drop in signal. ELISA signals of at least 0.4 are highlighted in light blue and signals of at least 1.0 are highlighted in dark blue. 10nM/0nM ELISA ratios of 0.5 or less are highlighted in red and the rows from which clones were sequenced are highlighted in yellow.

3BP2 SH2 GST control 1 2 3 4 5 6 7 8 9 10 11 12 A 0.18 0.36 0.17 2.29 0.30 0.20 0.18 0.22 0.25 0.15 0.43 0.31 B 0.41 0.17 1.06 0.47 0.22 0.33 0.16 0.16 0.24 0.59 0.30 0.17 C 0.46 0.45 0.64 0.34 0.36 0.32 0.35 0.26 0.30 0.41 0.30 0.31 D 0.43 0.41 0.38 0.32 0.35 0.35 0.40 0.36 0.32 0.20 0.46 0.37 E 0.38 0.34 0.45 0.26 0.34 0.26 0.49 0.25 0.30 0.35 0.34 0.39 F 0.34 0.33 0.46 0.39 0.29 0.16 0.31 0.18 0.34 0.29 0.36 0.23 G 0.83 0.45 0.50 0.35 0.41 0.32 0.34 0.26 0.35 0.37 0.55 0.44 H 0.40 0.37 0.38 0.40 0.40 0.32 0.34 0.35 0.29 0.33 0.37 0.25

0nM 1 2 3 4 5 6 7 8 9 10 11 12 A 0.22 0.87 0.20 2.91 0.90 0.29 0.23 0.28 0.87 0.20 1.13 0.64 B 0.63 0.22 1.58 0.73 0.37 1.26 0.19 0.20 0.53 1.07 0.96 0.46 C 1.47 1.52 1.89 2.29 0.70 1.89 1.44 0.61 1.23 1.57 2.20 0.54 D 2.87 2.49 2.38 1.57 1.58 1.27 1.11 0.75 1.91 0.45 1.03 2.40 E 1.56 0.05 1.49 0.47 2.05 1.76 1.75 0.75 1.79 2.47 1.36 0.70 F 0.83 0.85 2.80 2.40 0.80 0.26 0.90 0.58 2.70 1.29 2.04 0.52 G 1.13 2.85 2.85 2.08 2.67 2.17 1.71 0.77 1.58 1.33 1.59 2.62 H 2.48 1.72 1.74 1.27 2.46 0.63 1.43 2.28 1.36 2.37 2.28 1.08

10nM 1 2 3 4 5 6 7 8 9 10 11 12 A 0.21 0.52 0.18 2.46 0.48 0.27 0.22 0.27 0.33 0.16 0.45 0.42 B 0.57 0.22 1.48 0.71 0.31 0.41 0.17 0.19 0.35 0.65 0.57 0.21 C 0.51 0.50 0.54 0.60 0.49 0.48 0.39 0.33 0.37 0.51 0.60 0.43 D 0.64 0.67 0.64 0.47 0.43 0.43 0.52 0.48 0.56 0.33 0.58 0.53 E 0.48 0.04 0.48 0.29 0.55 0.57 0.44 0.47 0.51 0.69 0.47 0.53 F 0.61 0.58 0.92 0.74 0.45 0.20 0.61 0.23 0.78 0.50 0.67 0.41 G 0.92 0.79 0.89 0.63 0.73 0.60 0.62 0.57 0.56 0.48 0.70 0.62 H 0.56 0.52 0.49 0.55 0.78 0.48 0.50 0.63 0.42 0.54 0.58 0.36

10nM/ 0nM 1 2 3 4 5 6 7 8 9 10 11 12 A 0.93 0.59 0.90 0.84 0.53 0.90 0.98 0.95 0.38 0.82 0.40 0.66 B 0.92 1.04 0.93 0.97 0.84 0.32 0.93 0.94 0.66 0.61 0.59 0.45 C 0.35 0.33 0.29 0.26 0.70 0.25 0.27 0.54 0.30 0.32 0.27 0.79 D 0.22 0.27 0.27 0.30 0.27 0.34 0.46 0.65 0.29 0.74 0.56 0.22 E 0.31 0.81 0.33 0.62 0.27 0.32 0.25 0.63 0.28 0.28 0.35 0.76 F 0.74 0.69 0.33 0.31 0.57 0.76 0.68 0.39 0.29 0.39 0.33 0.79 G 0.82 0.28 0.31 0.30 0.27 0.28 0.36 0.74 0.35 0.36 0.44 0.24 H 0.23 0.30 0.28 0.43 0.32 0.76 0.35 0.27 0.31 0.23 0.26 0.33

CDR-L1 CDR-L2 CDRL3 Affinity Measurments

% drop % drop

27 28 29 30 36 37 38 56 57 65 66 67 68 69

106 107 108 109 110 112 113 114 115 116 117 A) 105 at 10nM at 50nM anti-MBP WT Q S V - S S A S A S S L Y S Q Q S S Y - - - S L I T - - Abl1 SH3-1 Q Y Y S Y G Y Y A S Y L Y S Q Q A A G - - - S P I T 86 87 Abl1 SH3-2 Q Y G - Y S S G A S G L Y S Q Q Y G Y - - - S L I T 76 78 Abl1 SH3-3 Q Y G - Y S S G A S G L Y S Q Q Y G Y - - G W P I T 82 84 Abl1 SH3-4 Q S S - - G Y G A S Y L Y S Q Q S Y V Y V S S L F T 35 36 Abl1 SH3-5 Q Y G - Y S S G A S G L Y S Q Q Y S Y - - V P P I T 72 71 Abl1 SH3-6 Q S S - - G Y G A S Y L Y S Q Q A S - - - - Y L I T 91 90 Abl1 SH3-7 Q Y G - Y S S G A S G L Y S Q Q Y G Y - - - S L I T 81 70 Abl1 SH3-8 Q Y G - Y S S G A S G L Y S Q Q Y S Y - - V Y P I T 73 73 Abl1 SH3-9 Q Y S Y G Y Y G A S S L Y S Q Q S W - - - - A L I T 37 42 Abl1 SH3-10 Q Y G - Y S S G A S G L Y S Q Q Y G Y - - - A L I T 64 68 Abl1 SH3-11 Q Y G - Y S S G A S G L Y S Q Q Y A Y - - - H L I T 44 49 Abl1 SH3-12 Q Y S - - G S G A S S L Y S Q Q S Y A - - - G L F T 54 58 Abl1 SH3-13 Q S S - - G Y G A S Y L Y S Q Q S G H - - P A L I T 69 72 3BP2 SH2-1 Q Y Y - - S Y S A S Y L Y S Q Q W Y Y S W S G P I T 18 44 3BP2 SH2-2 Q Y Y - - S Y G A S Y L Y S Q Q S Y Y S S G G L I T 72 81 3BP2 SH2-3 Q Y Y - - S Y G A S Y L Y S Q Q S Y Y S P S S L I T 64 75 3BP2 SH2-4 Q S Y - - S Y G A S S L Y S Q Q W Y Y V S G S P I T 26 46 3BP2 SH2-5 Q Y Y - - S Y G A S Y L Y S Q Q G Y F H Y H S L I T 65 77 3BP2 SH2-6 Q Y Y - - S Y G A S Y L Y S Q Q G F W S S Y S L I T 57 73 3BP2 SH2-7 Q Y Y - - S Y G A S Y L Y S Q Q S W Y A H S G L I T 71 77 3BP2 SH2-8 Q S Y - - S Y G A S S L Y S Q Q W Y W A - S S P I T 24 30 3BP2 SH2-9 Q Y Y - - S Y G A S Y L Y S Q Q S Y V G G V S L I T 65 74 3BP2 SH2-10 Q Y Y - - S Y G A S Y L Y S Q Q S Y V S A Y S L I T 69 76 3BP2 SH2-11 Q Y Y - - S Y G A S Y L Y S Q Q G Y F G A A A L I T 67 69

B) CDRH1 CDR-H2 CDR-H3

27 28 29 30 31 34 35 36 37 38 39 55 56 57 58 59 62 63 64 65 66

105 106 107 108 109 110 111 112 113 114 115 116 117

111.1 111.2 111.3 112.3 112.2 112.1 anti-MBP WT G F N F - - S S S S I S I S S S Y G Y T Y A R T V R G S K K P Y F S G W A M D Y Abl1 SH3-1 G F N I G - S G S S I Y I S P G Y S Y T S A R G W W ------W A M D Y Abl1 SH3-2 G F N L - - S Y S G M G I Y S S Y G Y T Y A R Y Y Y F G - - - - - S A V G M D Y Abl1 SH3-3 G F N L - - S Y S G M G I Y S S Y G Y T Y A R Y Y W S S - - - - - Y G G G M D Y Abl1 SH3-4 G F N I G - S Y G S M Y I S P S Y S Y T S A R G H Y ------F G I D Y Abl1 SH3-5 G F N L - - S Y S G M G I Y S S Y G Y T Y A R Y H Y S W ------Y S G M D Y Abl1 SH3-6 G F N I G - S Y G S M Y I S P S Y S Y T S A R G S H ------W A M D Y Abl1 SH3-7 G F N L - - S Y S G M G I Y S S Y G Y T Y A R Y Y Y G ------A G M D Y Abl1 SH3-8 G F N L - - S Y S G M G I Y S S Y G Y T Y A R Y Y F S G - - - - - G G G G L D Y Abl1 SH3-9 G F N L - - Y Y S S M S I Y P Y Y S S T S A R S V F ------H G M D Y Abl1 SH3-10 G F N L - - S Y S G M G I Y S S Y G Y T Y A R A S Y A G P - - - - S S H G M D Y Abl1 SH3-11 G F N L - - S Y S G M G I Y S S Y G Y T Y A R Y G Y W S Y - - - Y Y G G G L D Y Abl1 SH3-12 G F N I S - Y S Y G M S I Y P Y Y S Y T S A R S Y W ------Y G L D Y Abl1 SH3-13 G F N I G - S Y G S M Y I S P S Y S Y T S A R G H Y ------W A L D Y

3BP2 SH2-1 G F N I - - S Y Y S I S I Y P S Y S Y T Y A R T V R G S K K P Y F S G W A M D Y 3BP2 SH2-2 G F N I - - G G G S I Y I Y P G Y S S T Y A R T V R G S K K P Y F S G W A M D Y 3BP2 SH2-3 G F N I - - G G G S I Y I Y P G Y S S T Y A R T V R G S K K P Y F S G W A M D Y 3BP2 SH2-4 G F N I - - G S Y G M Y I S S Y S S G T Y A R T V R G S K K P Y F S G W A M D Y 3BP2 SH2-5 G F N I - - G G G S I Y I Y P G Y S S T Y A R T V R G S K K P Y F S G W A M D Y 3BP2 SH2-6 G F N I - - G G G S I Y I Y P G Y S S T Y A R T V R G S K K P Y F S G W A M D Y 3BP2 SH2-7 G F N I - - G G G S I Y I Y P G Y S S T Y A R T V R G S K K P Y F S G W A M D Y 3BP2 SH2-8 G F N I - - G S Y G M Y I S S Y S S G T Y A R T V R G S K K P Y F S G W A M D Y 3BP2 SH2-9 G F N I - - G G G S I Y I Y P G Y S S T Y A R T V R G S K K P Y F S G W A M D Y 3BP2 SH2-10 G F N I - - G G G S I Y I Y P G Y S S T Y A R T V R G S K K P Y F S G W A M D Y 3BP2 SH2-11 G F N I - - G G G S I Y I Y P G Y S S T Y A R T V R G S K K P Y F S G W A M D Y Figure 3.7 – Unique scFv-phage binders against the SH2 and SH3 domains of 3BP2 and Abl. After four rounds of selection against Abl SH3 and 3BP2 SH2, I picked 96 scFv-phage clones against each protein and performed large-scale competitive ELISAs to simultaneously determine which clones demonstrated specificity for their target and which of these clones had the highest affinities. Sequencing results for 24 clones picked against each target reveal 13 unique scFv binders for Abl SH3 and 11 unique scFvs for 3BP2 SH2. CDR sequences of the VL domain (A) and the VH domain (B) are shown above. Residues are numbered according the IMGT system for immunoglobulin domains. The colored residues are Tyrosine (Y, yellow),

(Figure 3.7 – continued) Serine (S, red), Glycine (G, green) and Alanine (A, blue). Grey residues denote positions that every clone shares with the parental anti-MBP sequence. Also included are the percent decrease of ELISA signal in the presence of 10nM and 50nM competitor (A). Instances where scFv-phage binding is blocked by 50% or more are highlighted in red.

3.3.3 Screening scFv clones in intein-Yeast-two-hybrid system

To test whether there is a difference between scFv sequences that are tolerated in the non- reducing conditions of my in vitro selections and the reducing environment of the cytoplasm, I sent phage pools from each round of the selections to the Geyer lab for subsequent rounds of selection via the intein-Yeast-two-hybrid system. Such a setup will allow for the intracellular screening of ~105 clones specific for each protein target and for a comparison of scFv sequences between the two conditions. At the time of this writing, the experiments are underway and the results are unknown.

3.4 Library G as a tool in High-throughput selections

Based on the success of scFv-phage Library G in low-throughput format, I decided to test in a high- throughput selection using SH2 and SH3 proteins from Chapter 2.

3.4.1 Selection against SH2 and SH3 domains

In total, I screened scFv-phage Library G against 7 SH2 domains and 6 SH3 domains. The selections were performed for four rounds and enrichment of the phage populations was determined by pooled ELISAs in rounds 3 and 4. Since my targets were fused to GST, I also included negative selection pressure in each round to reduce the presence of non-specific binders. During the first two rounds of selection, I pre-incubated my phage pools in plates coated an irrelevant GST-SH3 fusion (Nck2#2) prior to transferring unbound phage to my selection plates. In rounds 3 and 4, my phage pools were incubated with GST-Nck2#2 in solution throughout the entire selection process. Based on my earlier definition for population enrichment, I observed enrichment for 4 targets (31%) after round 3 and 7 targets (46%) after round 4 (Table 3.2). These values are in line with my original high-throughput selection where I screened Fab-phage Library F against 96 SH3 domains and further support the use of Library G as a new selection tool.

Round 3 Round 4 Target Type Name Enrichment Enrichment Ratio Ratio GRB2 2.9 3.8 CRK 1.9 4.3 NCK1 3.3 4.1 SH2 RASA1C 1.2 1.9 PTPN11C 1.7 2.4

LYN 2.7 4.1 SHCA 2.2 2.4 Crk#1 1.6 2.7 GADS/Grp2#2 1.9 1.5

SH3 Homology to GEFS 2.4 2.1 (KIAA1010) #4 RasGAP 10.7 7 Intersectin2#2 2 1.4 Intersectin1#3 0.8 1

Table 3.2 – Enrichment of scFv-phage Library G against various SH2 and SH3 domains. Selections were performed for four rounds and enrichment of the phage populations was determined by pooled ELISAs in rounds 3 and 4. Since the protein targets were fused to GST, negative selection pressure was included in each round to reduce the presence of non-specific binders. Successful population enrichment was defined as an ELISA absorbance ratio of greater than 2.5 for target protein relative to the GST negative control. Populations for which enrichment is observed are highlighted in blue.

I subsequently screened 12 clones from each enriched population in round 4 for specificity towards their target and for cross-reactivity against GST-Nck2#2. I obtained highly specific binders against my SH3 targets (Crk#1 and RasGAP) but I needed to dilute the anti-SH2 clones 20-fold before I could observe a difference between GST-Nck2#2 and the target SH2. In total, I sent 56 clones for sequencing and I obtained 52 unique scFv sequences against my targets (Figure 3.8).

While the diversity of sequences is preferred, it must be noted that the anti-SH2 scFvs have an abundance of Tryptophan residues in their CDRH3s. Proteins enriched in tryptophan have been associated with non-specific binding to microtiter plates[83] and this result may account for the fact that I needed to dilute my phage supernants in order to reduce the negative control signal.

However, once the negative control signal is reduced beyond saturation, a clear preference for the target SH2s is observed.

A) CDRL3 CDR-H3

105 106 107 108 109 110 111 112 113 114 115 116 117

111.1 111.2 111.3 111.4 112.4 112.3 112.2 112.1

105 106 107 108 109 110 112 113 114 115 116 117 anti-MBP WT Q Q S S Y - - - S L I T A R T V R G S K K P - - Y F S G W A M D Y GRB2 SH2-1 Q Q G G Y - - W L F T A R Y G F Y S Y Y W Y V G Y S F G G L D Y GRB2 SH2-2 Q Q F G W - - Y Y P F T A R Y F H Y G Y S Y W Y G S Y V G A I D Y GRB2 SH2-3 Q Q S W G - - F S P F T A R Y V P Y Y W W Y P F A G F Y S A L D Y GRB2 SH2-4 Q Q Y Y W P F W W L F T A R Y P G P Y Y ------F S S G I D Y GRB2 SH2-5 Q Q W W P H P W A L F T A R Y W Y P W W S - - - H Y S Y Y A I D Y GRB2 SH2-6 Q Q S S A - - - Y P F T A R Y S Y G A Y W - - - W W Y G Y A F D Y GRB2 SH2-7 Q Q G S Y Y G G G L F T A R Y P W Y Y S G - - - W W Y G Y G M D Y GRB2 SH2-8 Q Q G S Y Y A W Y P F T A R Y S V H Y A W Y Y Y V P G Y A G L D Y GRB2 SH2-9 Q Q W G Y G F S S L F T A R Y Y Y W Y W G - - - Y V H G Y A L D Y GRB2 SH2-10 Q Q Y G - - - - S P I T A R Y Y Y H G Y ------W Y V G L D Y GRB2 SH2-11 Q Q Y A - - - - W P F T A R S A Y W H W W - - - W W G H G G I D Y GRB2 SH2-12 Q Q Y S A - - - S P I T A R Y W Y W G S Y - - - F Y S A Y G L D Y

CRK SH2-1 Q Q S S Y - - - S L I T A R W A Y H G G P H S Y W F P A V A M D Y CRK SH2-2 Q Q A S V W S F H P I T A R W G S H P W G G G W Y H Y Y W G L D Y CRK SH2-3 Q Q W Y Y - - G S L I T A R W Y S S W W G Y - S W Y W Y Y G M D Y CRK SH2-4 Q Q Y Y F P F H P L F T A R W S Y Y P Y W - - - W Y Y W P G I D Y CRK SH2-5 Q Q Y S W Y - W W P F T A R S S F P A S Y - - - F G W Y A G F D Y CRK SH2-6 Q Q Y Y W - - W A P F T A R P G A H W G - - - - - G A G A G I D Y CRK SH2-7 Q Q W S Y - - Y P I T A R Y W W Y A W ------H P Y A L D Y CRK SH2-8 Q Q W Y G Y - Y F P F T A R A P S Y W W Y A - F Y Y Y V H G L D Y CRK SH2-9 Q Q P W Y - - Y Y P I T A R W W W W P Y ------W H Y G F D Y CRK SH2-10 Q Q S H Y L Y W P P F T A R Y P W S Y S G Y W Y H S Y F A G L D Y CRK SH2-11 Q Q W P Y - - A Y P I T A R Y P W W S A Y S - Y W Y H Y V A L D Y CRK SH2-12 Q Q Y G F - - W P L I T A R W S Y W S W ------S Y Y A I D Y

NCK SH2-1 Q Q Y Y Y - - S P F T A R W W Y G G W G - - - W S P W S A F D Y NCK SH2-2 Q Q Y S W Y - W W P F T A R S S F P A S Y - - - F G W Y A G F D Y NCK SH2-3 Q Q S W G - - F S P F T A R Y V P Y Y W W Y P F A G F Y S A L D Y NCK SH2-4 Q Q Y S W Y - W W P F T A R S S F P A S Y - - - F G W Y A G F D Y NCK SH2-5 Q Q G S V Y - S S L F T A R W A G G F A A A - W Y S W F S G L D Y NCK SH2-6 Q Q G Y W - - S P F T A R W A S W S P Y Y - S W S F G S A F D Y NCK SH2-7 Q Q Y S W Y - W W P F T A R S S F P A S Y - - - F G W Y A G F D Y NCK SH2-8 Q Q W Y A G - P G L I T A R P Y S Y Y ------W S G L D Y NCK SH2-9 Q Q G H H - - W W P F T A R L F W A G Y G A W Y F Y W G Y A M D Y NCK SH2-10 Q Q Y H Y W - W W P I T A R S A Y P W A W - - - - P S P F G M D Y

LYN SH2-1 Q Q G Y - - - - S L I T A R G G H Y Y ------V F G L D Y LYN SH2-2 Q Q S Y - - - - G P F T A R Y W W Y F G - - - - - P W Y S G L D Y LYN SH2-3 Q Q Y S W Y - W W P F T A R S S F P A S Y - - - F G W Y A G F D Y LYN SH2-4 Q Q H S S S - S G P I T A R Y Y H H W P Y Y Y V W S Y W S G I D Y LYN SH2-5 Q Q S S Y - - A S P F T A R S F G G W G P Y W Y Y V Y Y Y G M D Y LYN SH2-6 Q Q W A Y S - P F P F T A R W P Y V S Y W A H W G W W S Y G F D Y LYN SH2-7 Q Q Y S W Y - W W P F T A R S S F P A S Y F - - - G W Y A G F D Y LYN SH2-8 Q Q Y Y G - - H Y L F T A R Y S H W S A W W - A F G V F F A L D Y LYN SH2-9 Q Q F Y Y W - W Y P F T A R H Y S W S P W A - W S Y Y S Y A M D Y LYN SH2-10 Q Q F Y Y V - G W P F T A R G Y S W W S S W - V Y V Y S Y A L D Y LYN SH2-11 Q Q H A Y - - Y S P F T A R V W W Y P G S Y - W W G Y Y Y A M D Y LYN SH2-12 Q Q F G W - - Y Y P F T A R Y F H Y G Y S Y W Y G S Y V G A I D Y

Figure 3.8 – Unique sequences from a high-throughput screen of Library G against SH3 and SH2 domains. Library G was used in a HTP screen against 7 SH2 domains and 6 SH3 domains. Enrichment was observed against four SH2 domains (GRB2, CRK, LYN, NCK) and two SH3 domains (Crk#1, RasGAP). 12 clones against each target were sent for sequencing, resulting in 52 unique sequences. The CDRH3 and CDRL3 sequences for the anti-SH2 clones are shown in (A) while all CDRs of the anti-SH3 clones are shown (B,C). Residues are

B) CDRH1 CDR-H2 CDR-H3

27 28 29 30 31 34 35 36 37 38 39 55 56 57 58 59 62 63 64 65 66

105 106 107 108 109 110 111 112 113 114 115 116 117

111.1 111.2 111.3 112.3 112.2 112.1 anti-MBP WT G F N F - - S S S S I S I S S S Y G Y T Y A R T V R G S K K P Y F S G W A M D Y Crk#1-1 G F N I S - G Y S Y M G I Y P Y Y S S T Y A R T V R G S K K P Y F S G W A M D Y

RasGAP-1 G F N I S Y Y S Y G I S I S S G Y S Y T S A R S Y Y S W - - - - - G P G G F D Y RasGAP-2 G F N I - - S S G G M S I S P Y G S Y T Y A R T V R G S K K P Y F S G W A M D Y RasGAP-3 G F N L S Y S Y S S I G I Y P G Y S Y T S A R Y S S P W H W - - G G S W G F D Y RasGAP-4 G F N I S S G S Y G I Y I Y P S Y G Y T Y A R W G Y ------H G M D Y RasGAP-5 G F N L S Y S Y S S I G I Y P G Y S Y T S A R S A S G W H G - - G W Y H A M D Y

C) CDR-L1 CDR-L2 CDRL3

27 28 29 36 37 38 56 57 65 66 67 68 69

105 106 107 108 109 114 115 116 117 anti-MBP WT Q S V S S A S A S S L Y S Q Q S S Y S L I T Crk#1-1 Q S S G G S S A S Y L Y S Q Q H Y - P P I T

RasGAP-1 Q S S - Y Y G A S Y L Y S Q Q S S Y S L I T RasGAP-2 Q Y G - S S Y A S Y L Y S Q Q G S - Y L I T RasGAP-3 Q Y Y - G S Y A S G L Y S Q Q P W - Y P F T RasGAP-4 Q S Y - Y S S A S Y L Y S Q Q G Y - G P F T RasGAP-5 Q Y Y - G S Y A S G L Y S Q Q G V W P L I T

(Figure 3.8 – continued) numbered according the IMGT system for immunoglobulin domains[38]. The colored residues are Tyrosine (Y, yellow), Serine (S, red), Glycine (G, green) and Alanine (A, blue). Grey residues denote positions that every clone shares with the parental anti-MBP sequence. The anti-SH2 sequences were rich in Tryptophan (W) and this residue has been colored purple to highlight its prevalence.

3.5 Discussion The versatility of antibodies as binders to targets makes them very appealing as intracellular tools to perturb and investigate intracellular processes. However, issues with antibody stability and folding within the reducing intracellular environment have spurred efforts to develop screening procedures that can capture antibodies that are both specific to their targets and retain their function within the cell.

Since the diversities of phage-display libraries (~1010-1011) far outnumber the transformation efficiencies of intracellular screens (~105-107), most reported attempts at generating intrabodies involve a series of preselection steps in vitro. This approach is advantageous because it greatly reduces the number of downstream steps by removing non-specific clones early on and narrowing down the population to a much more manageable size. In light of such strategies, my work in generating a HTP Fab-phage display pipeline is a direct improvement by eliminating the antigen bottleneck and providing the means of screening against a much larger group of targets.

When it comes to the intracellular expression and screening system, most approaches again focus on providing a selective advantage to cells that successfully express an interacting scFv-target pair. This has been accomplished in bacterial systems through protein fragment complementation assays and in eukaryotic systems through yeast-two-hybrid. Despite these methods, issues pertaining to scFv stability within the cell remain unresolved. While there have been attempts to engineer VH and VL domains with more desirable properties, the fact remains that most scFvs do not fold properly within the cell. Consequently, it has been accepted that a majority of scFvs from the in vitro preselection steps will lose function once expressed within the cytoplasm.

The proposed intein-Y2H system offers a creative solution that has the potential to change the way intrabody generation is approached. Cyclization of scFv candidates from the preselection steps should in theory increase their stability through enhanced resistance to denaturing temperatures and exoproteases. Furthermore, the use of modified intein fragments to generate a lariat conjugated to an N-terminal domain makes Y2H experiments possible and allows for incredible control over the choice of transactivation domain, localization signal and detection tag.

With these notions in mind, the generation of scFv library G was the first step in the realization of a novel intrabody pipeline. Although the final version of the library will be of much higher quality, the current Library G diversity of 1.5x1010 functional clones is comparable to that of Fab-phage Library F and would provide useful information as to the feasibility of altering all six CDRs as a randomization approach. My low-throughput selections of scFv-phage Library G resulted in 13 unique scFv binders against the Abl1 SH3 domain and 11 unique scFv binders against the 3BP2 SH2 domain. Not only do many of these clones have nanomolar affinities (as determined by competitive ELISAs) but it also appears that different residues and loop lengths are preferred against each target, which is a sign that the selections are working and confirms the suitability of scFv-phage Library G as a viable selection tool.

Screening of scFv-phage Library G against seven SH2 domains and six SH3 domains in a HTP screen resulted in enrichment against 46% of targets (6/13) which is comparable to the enrichment rates observed in my HTP Fab-phage selections in Chapter 2. While I observed unique scFv-binders against the Crk1 and RasGAP SH3 domains that displayed target-specific sequence preferences, my clones against SH2 domains were all rich in Tryptophan which is

74 associated with nonspecific binding to the plastic of microtiter plates[83]. It is entirely plausible that a repetition of the HTP selection could yield scFvs that lack this problem and the experiment should be repeated in the future.

Even with the validation and success of the scFv-phage display/Y2H approach, a couple interesting issues still remain for future exploration. One issue is the fact that different selection conditions may favor different antibodies against the same target. This is particularly important for intrabody generation since there is the possibility that the in vitro preselection steps may be biasing the screen towards candidates that are inherently unsuitable for intracellular expression. Although current in vitro preselection steps still generate functional intrabodies, selection conditions can be optimized to increase the chances that resulting scFv clones will be functional within the cell. For example, performing the preselection steps in a reducing agent such as DTT will screen for scFv clones that recognize their target in a reducing environment. Preselected populations resulting from such experiments can be expected to yield a greater number of functional intrabodies per antigen versus those obtained from non-reducing in vitro procedures.

Another issue to be considered is whether the expression of cyclized Fabs may yield even better results than cyclized scFvs. Indeed, Fabs are already more stable and support higher affinities than scFvs but are not viable intrabody candidates due to their reliance on inter-domain disulphide bonds. However, the generation of single-chain Fabs (scFabs) where the constant domain of either chain is connected to the N-terminus of the opposing chain‟s variable domain through a polypeptide linker may be an elegant solution to this problem. There is already evidence that scFabs are more stable and support even higher affinities than their corresponding Fabs[84] and the application of this development to intrabody generation must be considered.

3.6 Materials and Methods

3.6.1 Strains and Constructs

(Mount Sinai Hospital, Toronto) and the Structural Genomics Consortium group in Stockholm. The v-Src SH3, Abl1 SH3 and 3BP2 SH2 constructs were obtained from the Rottapel Lab (MaRS building, University of Toronto).

3.6.2 Expression and Purification of v-Src, 3BP2 and Abl1 Domains

Single colonies of SS320 cells transformed with the corresponding expression vectors were grown overnight in 5mL 2YT/Carb50 at 37C, 200RPM to generate starter cultures. The cultures were each used to inoculate 500mL 2YT/Carb50/Tet5. Cultures were incubated at 37C, 200RPM and grown to an OD600 of 0.5. At this point, protein expression was induced with 1mM IPTG and the cultures were grown overnight at 16C, 200RPM. The following day, the cells were pelleted by spinning in 1L bottles at 7000RPM, 20min, 4C. The supernatant was decanted and the cell pellets were resuspended in 10mL of resuspension buffer (1mM EDTA, 1mM DTT, 0.5% Triton X-100, Protease inhibitor (1/5 tablet) in PBS). The resuspended cells were then subjected to three cycles of freeze-thawing by immersing the tubes in liquid nitrogen followed by incubation in a 37C water bath. 251U of DNAseI were added to each lysate and allowed to incubate for 1h at 4C. The lysates were then sonicated using a VibraCell sonicator (SONICS) at settings of 1min, 40% amplitude, 5 seconds ON, 5 seconds OFF. Insoluble debris was pelleted by spinning the lysates at 12500RPM for 30 min at 4C. The supernatants were transferred to new tubes and 300uL of glutathione-sepharose resin was added to each. The tubes were nutated at 25RPM for 1h at 4C. The lysate-resin mixtures were added to 20mL columns (BioRad) and washed with 6mL of PBS, followed by 6mL PBS+150mM NaCl and then 6mL of PBS alone again. The proteins were eluted by incubating with 2mL of elution buffer (3mg/mL, 50mM Tris pH8.0 in dH2O) for 10 min at room temperature. The eluates were tested via SDS-PAGE for presence of protein and concentration was measured using a Bradford Assay. PMSF and EDTA were added to final concentrations of 1mM and 100% Glycerol (autoclaved) was added to final concentration of 50%. The proteins were then stored at -20C.

3.6.3 Construction of Library G scFv Template

The P8-STOP phagemid was obtained from Dr. Gang Chen in the lab. Two different P3-STOP phagemids were constructed by introducing a cloning site that replaced gene VIII alone (leaving the STII secretion signal intact) or gene VIII and the STII signal. In each case, the cloning site was introduced through site-directed mutagenesis. Three different oligos were used for each case

76 and all encode for the same residues. They are NE077-79 (replace gene VIII and secretion signal) and NE080-82 (replace gene VIII). The oligo sequences are provided in Appendix C. Both P3-STOP phagemids were double digested with NcoI and XbaI.

The 1.10 and 6.31 Fabs were PCR-amplified with primers NE056-57 and NE057-58 respectively to introduced flanking NcoI and XbaI restriction sites. The PCR products were confirmed through gel electrophoresis and double digested with NcoI and XbaI. The 1.10 Fab was ligated into the P3-STOP vector containing the STII secretion signal while the 6.31 Fab was ligated into the P3-STOP vector that had both gene VII and the signal removed. The ligations were sequence-verified using the primers NE059-NE069.

The scFv versions were created through a series of site-directed mutagenesis reactions. In the first step to create the 1.10 scFv, the NcoI site was removed with NE070, a CDR1 mutation was fixed with NE089, the C3 linker was introduced with HP93 and CH1 was removed with NE049. For the second step, NE087 was used to introduce the dimerization domain and NE090 was used to introduce an N-terminal FLAG tag. In the first step to create the 6.31 scFv, the NcoI site was removed with NE071, the C3 linker was introduced with HP93 and CH1 was removed with NE049. For the second step, NE087 was used to introduce the dimerization domain and NE091 was used to introduce an N-terminal FLAG tag. After every mutagenesis step, clones were sequence-verified using primers NE059-69 prior to continuing.

3.6.4 Introduction of Diversity to Library G

These experiments were mainly performed by three postdoctoral fellows (Dr. Sarav Rajan, Dr. Amandeep Gakhal and Dr. Nish Patel) and will be described in detail in an upcoming publication on scFv Library G.

3.6.5 Amplification and Preparation of Library G for Selection

The scFv-phage Library G was amplified by incubating XL1-Blue E.coli with approximately 10^13 cfu/mL of total infective phage. 1L of XL1-Blue was grown for each sublibrary (A-D) in

2YT/tetracycline (10ug/mL) to an OD600 of 0.8 prior to infection. Infection was allowed to proceed for 30min at 37C, 200RPM and was followed by the addition of M13 KO7 helper phage to a final concentration of 10^10 cfu/mL. The culture was left at 37C, 200RPM for another 45 minutes and then incubated O/N at 37C, 200RPM for 18h. The overnight cultures were pelleted

77 the following day at 10minutes, 10000RPM, 4C and the phage-containing supernatant was incubated with 1/5 volume PEG/NaCl on ice for 20 minutes. The amplified phage library was pelleted at 11000 RPM, 20 minutes, 4C and the supernatant was decanted (bottles were spun again for 2 minutes to pool the remaining supernatant, which was then aspirated). Phage pellets were gently resuspended in 1/40 volume of TE-PMSF buffer (10mM Tris-HCl, 1mM EDTA, 0.5mM PMSF) and spun down again for 10minutes at 11000RPM, 4C. The supernatants were transferred to new tubes with 20mL TE buffer and spun down again for 10minutes, 11000RPM, 4C. The supernatant was incubated with 1/5 volume PEG/NaCl for 20 minutes on ice and the phage were precipated once again by spinning the tubes down at 11000RPM, 4C for 30 minutes. The supernatant was decanted in the same manner as the first precipitation step and the phage pellets were gently resuspended in 8mL sterile PBS (total volume). The resuspension was spun for 10 minutes at 11000RPM, 4C and the supernatant was transferred to a new tube. EDTA and glycerol were added to final concentrations of 2mM and 50% respectively. The purified Fab- phage library was then stored at -20C.

3.6.6 Low-throughput Selections against v-Src, Abl1 and 3BP2 domains

96-well selection plates were coated with 100uL of immobilized antigen and blocked as described in Chapter 2 materials and methods. In this case, 8 wells were coated per antigen and antigen concentrations decreased in later rounds (10ug/mL  5ug/mL  2ug/mL  2ug/mL). In addition, „mirror‟ plates were coated with 5ug/mL of GST-Grb2#2 (SH3) for rounds 1 and 2 of selection.

GST-Grb2#2 mirror plate and the wells were washed 4x with sterile PBS+0.1%Tween-20. 100uL of purified phage library (round 1) or purified phage supernatant (round 2) were added to each well and incubated for 1h at room temperature and 25RPM. For rounds 3 and 4, the overnight amplified phage were pelleted and resuspended in 985uL PBS+0.5%BSA+ 0.1%Tween-20 and incubated with ~50ug/mL GST-heptapeptide in a 15mL Falcon tube for 1.5- 2h prior to addition to the 8 wells of immobilized antigen.

The selection plate was washed 4x with PBS+0.1%Tween-20 and the unbound phage (from mirror plates in rounds 1 and 2) or scFv-phage/GST solutions (rounds 3 and 4) were transferred to the appropriate wells (100uL/well) and incubated for 1h at 25RPM and room temperature. Unbound phage particles were removed by washing 8x with PBS+0.1%Tween-20 and bound phage were eluted by incubating with 0.1M HCl for 5 minutes at room temperature. Eluted phage were pooled for each antigen (8 wells x 100uL = 800uL total volume) and neutralized with the appropriate volume (~1/10) of 1.0M Tris buffer (pH 11). 200uL of neutralized phage were used to infect 2mL of actively growing E. coli XL1-Blue (OD600 ~0.5-0.6) and the reaction was incubated at 37C and 200RPM for 30 minutes. M13 KO7 helper phage was added to final concentration of 10^10 pfu/mL and the cultures were incubated for another 45 minutes at 37C and 200RPM. Phage were amplified overnight by transferring the cultures to 20mL

2YT/Carb100/Kan25 and incubating at 37C and 200RPM.

3.6.7 High-Throughput Selections against SH2 and SH3 domains

Selections and overnight amplifications were performed in a 96-well format. Prior to each round, 96-well Maxisorp microtiter plates (NUNC) were coated with 100uL of the purified GST-SH3 targets (diluted in PBS) and incubated overnight at 4C to allow for adsorption. The levels of immobilized antigen were decreased with each subsequent round (10ug/mL  5ug/mL  2ug/mL  2ug/mL). In addition to the plates containing immobilized antigens, negative selection „mirror plates‟ were coated with 100uL of 10ug/mL GST-Nck2#2 (SH3) for rounds 1 and 2.

79 purified phage library (round 1) or pH-adjusted phage supernatant (rounds 2-4) were added to each well and incubated for 1h at room temperature and 25RPM. For rounds 3 and 4, the overnight amplified phage were pH-adjusted and incubated with 50ug/mL GST-Nck2#2 in a 96- well non-binding plate (Corning) for 1.5-2h prior to addition to the antigen plate. In each case, the supernatants were then transferred to the selection plates (washed 4x with PBS+0.1%Tween- 20) and incubated for 2h at room temperature and 25RPM. Unbound Fab-phage were then removed by washing the selection plate 8x with PBS+0.1%Tween-20 and the remaining clones were eluted by adding 100uL of actively growing E. coli XL1-Blue (OD600 ~0.5) and incubating at 37C, 200RPM for 30 minutes. M13 KO7 helper phage was then added to each well at a final concentration of 1x10^10 pfu/mL and the plates were incubated at 37C, 200RPM for 45 minutes. Phage were amplified by transferring the contents of each well (E.coli + eluted phage +

KO7) to 1.4mL 2YT/Carb50/Kan25 and incubating overnight at 37C and 200RPM. The following day, the now-amplified phage were isolated in the supernatant (as described earlier), pH-adjusted and used for the next round of selection.

3.6.8 Determining Population Enrichment and Clonal affinities via ELISA

Population enrichment was determined via ELISAs using a 96-well microtiter plate coated with 50uL of antigen (5ug/mL in PBS) and GST-Nck2#2 (negative control, 5ug/mL in PBS) respectively. Amplified phage supernatant was obtained by spinning down the overnight 96-well deep plates at 3000RPM for 10min at 4C. Phage supernatant was then pH-adjusted by mixing phage with 1/10 volume of 10xPBS+0.05%Tween-20. The immobilized antigens on the microtiter plates were blocked for 1h with 200uL PBS+0.5%BSA at room temperature and 25RPM and then washed 4x with PBS+0.05%Tween-20. 50uL of pH-adjusted phage supernatant was then added to the appropriate well of the antigen ELISA plate and the corresponding well on the GST-PDZ ELISA plate and incubated for 2h at room temperature and 25C. Unbound phage particles were removed by washing the plates 6x with PBS+0.05%Tween-20 and the wells were incubated with 50uL of anti-M13-HRP antibody (1:5000 dilution in PBS+0.5%BSA+0.05%Tween-20) for 30 min at room temperature and 25C. The plates were then washed 6x with PBS+0.05%Tween-20 followed by 2x with chilled sterile PBS. 50uL of TMB substrate (1:1 mix of solutions A and B) was added to each well and the reaction was allowed to proceed for 5 minutes. The reaction was stopped with 50uL of 1.0M H3PO4 and the plates were read at 450nm with the PowerWave XS plate reader (BioTek). ELISA ratios for a

80 given phage supernatant were calculated by dividing the A450 of the antigen well by the A450 of the corresponding GST-PDZ-coated well.

For high-throughput competitive ELISAs, 384-well Maxisorp microtiter plates were coated with target antigen (2ug/mL) and negative control protein (5ug/mL) as described earlier. Plates were blocked with PBS+0.5%BSA+0.05%Tween-20 the following day and pH-adjusted phage supernatants were diluted 5-fold and incubated with different concentrations of the target antigen in PBS+0.5%BSA+0.05%Tween-20 (0nM, 10nM, 50nM) on non-binding microtiter plates (Corning). The mixtures were incubated for 2h at room temperature and 25RPM. The ELISA plates were washed 3x with PBS+0.05%Tween-20 using the Velocity11 automated liquid handler (Agilent Technologies) prior to addition of the competition mixtures. After an incubating for 20-24 minutes, the plates were washed 3x with PBS+0.05%Tween-20. Anti-M13-HRP antibody (1:5000 dilution in PBS+0.5%BSA+0.05%Tween) was added and incubated for 30minutes at room temperature and 25RPM. Plates were washed 6x with PBS+0.5%BSA+0.05%Tween-20 and TMB substrate (1:1 mix) was added for 6 minutes. The reaction was stopped by an equal volume of 1M H3PO4 and the plates were read at 450nm.

3.6.9 Sequencing of Clones

The clones were sequence-verified using various sets of primers. In general, NE059-69 were used for the majority of sequencing reactions. However, for Library G-derived clones, primer NE104 was used instead of NE059 to anneal to the N-terminal portion of VL. In each case, the primers were prepared at a concentration of 0.33mg/mL added to the following mixture for one PCR reaction: 2.5uL 10x Taq Buffer, 0.625 10mM dNTP mix, 1uL forward primer (0.33mg/mL), 1uL reverse primer (0.33mg/mL), 19.25uL USP H2O, 0.125uL Taq Polymerase and 1uL phage clone supernatant. The PCR reaction steps are 94C for 5min followed by 29 repetitions of 94C (30sec), 57C (30sec), 72C (1min, depends on length of PCR product). The reaction ends with a final extension step of 72C for 5min followed by a permanent decrease to 4C.

Chapter 4 Conclusions

4 Conclusions 4.1 Summary of work

The fact that antibodies are easily manipulated and provide ready-made scaffolds that can support virtually any specificity makes them ideal candidates for intracellular applications. However, their use is limited by experimental scale and the constraints imposed by the reducing environment within cells. Consequently, my aim was to use phage display technology to develop a high-throughput selection system and apply it to the generation of a novel intrabody pipeline.

In Chapter 2, I covered my work in developing a high-throughput system of phage display and I described the first time that the entire display process from antigen generation to antibody production has been performed in such a manner for a library of synthetic diversity. After a set of validation experiments by Dr. Helena Persson, I expressed a set of 96 GST-SH3 domains and used Fab-phage Library F to perform 96 selections in parallel, resulting in 109 unique Fab sequences against 60% of purified targets. I chose a subset of Fabs (against six SH3s) for which I constructed second-generation libraries and the ensuing selections resulted in the capture of clones with subnanomolar affinities. Finally, I demonstrated that both high- and low-affinity Fabs from these selections can serve as potential detection reagents in Western blotting applications.

In Chapter 3, I presented my contributions to the construction of a new scFv-phage Library (Library G) and my work in validating it as a viable tool for my proposed intrabody pipeline. I first screened Library G in a low-throughput manner against the SH2 domain of 3BP2 and the SH3 domain of Abl1, two proof-of-principle proteins for which downstream functional assays have been established. After successfully obtaining unique scFv-phage clones with low nanomolar affinities against each target and validating Library G as useful selection tool, I then attempted a high-throughput selection against a set of SH2 and SH3 domains from Chapter 2. While I observed enrichment against a similar proportion of targets as my high-throughput Library F selections, my anti-SH2 scFv-phage clones were non-specific and were enriched for a residue (Tryptophan) associated with unwanted binding to the plastic surfaces of microtiter plates.

Pending the success of the downstream intein-Yeast-two-hybrid screen, I have laid the foundations for a new intrabody pipeline that will serve as the central tool for future intrabody- based applications. By removing the restrictions of scale and minimizing the obstacles posed by the reducing nature of the cytoplasm, I will have created the first-known high-throughput intrabody pipeline.

4.2 Future experiments

Although my work has yielded promising results thus far, a couple of key experiments are required to validate my high-throughput intrabody pipeline.

Of immediate importance is the fact that the scFvs obtained from my selections against 3BP2 SH2 and Abl1 SH3 must be screened in the intein-Yeast-two-hybrid system. Since different selection conditions can bias screens towards different sets of clones, it would be unwise to test only the clones from the final rounds of my in vitro selections. Consequently, entire phage pools from every round of selection should be screened as opposed to individual clones. This set-up will ensure that all potential scFv binders from the library are represented since enrichment in the later rounds may be biased against scFvs with intracellular functionality. Furthermore, there will be no issues of library diversity outnumbering yeast transformation efficiencies since ~107 total phage particles per well are usually recovered after each round of in vitro selection.

The intracellular screening process itself involves PCR-amplifying the scFv-encoding DNA from the scFv-phage pools to generate a heterogeneous mix. Incorporation of scFv DNA into yeast cells is accomplished through transformation and subsequent homologous recombination into the “prey” plasmid. The resulting scFv lariats will then be screened for interactions with the 3BP2 SH2 and Abl SH3 “baits” through the activation of LacZ, ADE2 and LEU2 reporter genes and survival of yeast cells on selective media.

As I mentioned in Chapter 3, these intein-Yeast-two-hybrid screens are already underway. If successful, my proposed intrabody pipeline will be validated as an effective method to generate intrabodies in a reliable and high-throughput manner. Furthermore, a comparison of scFv sequences from my in vitro selections with the scFvs obtained from from the intein-Yeast-two- hybrid screens will yield valuable insight into whether the same or different protein sequences

84 are tolerated between the two environments. Most importantly, the functional scFv clones obtained from the intein screen will be good candidate intrabodies for use in mammalian cells.

Once functional intracellular scFvs have been identified, it will be important to determine their binding characteristics in terms of affinity and target epitope. For example, whether the anti-SH3 scFvs bind near or inside the ligand-binding pocket may play a role in their ability to hinder the inactive conformation of the Abl kinase. Since the Rottapel lab has established that the proline- rich region of 3BP2 is enough to activate Abl, this peptide can be used as a competitor against the anti-SH3 scFvs to determine whether they bind to the same region. However, even anti-SH3 scFvs that do not bind in the SH3 ligand-binding pocket may prevent the autoinhibitory SH3 interaction through steric interference with the rest of the Abl protein. This effect can be tested in vitro with the full-length Abl and will provide more conclusive information on the effectiveness of the scFv-SH3 interaction. Furthermore, since the proline-rich region of 3BP2 binds to the Abl SH3 domain with an affinity of 2.8+0.95μM[79], anti-SH3 scFvs will need to need to have similar (if not better) affinities to compete with the autoinhibitory proline-rich region within Abl itself. This will not be a major issue since scFv phage libraries with diversities of 10^10 and greater will enable the capture of clones with nanomolar affinities.

When looking at anti-3BP2 SH2 scFvs, their main purpose will be to block the Abl SH3 domain from interacting with the proline-rich region of 3BP2. This inhibitory effect can be tested in vitro by incubating full-length 3BP2 in an excess of scFv followed by addition of inactive Abl and measuring the resultant kinase activity. While it is possible that tyrosine phosphorylation of the 3BP2 SH2 might interfere with scFv binding, it is necessary to screen all positive binders in order to determine whether there are any that both interfere with the 3BP2-Abl interaction and are not affected by the 3BP2 SH2 phosphorylation state.

Once intracellular scFvs have been identified and characterized, the next step would be to screen them in the downstream functional assays that I mentioned in Chapter 3. As discussed previously, the established link between the 3BP2-Abl interaction and its effect on osteoblast activity provides a great way to test the scFvs generated with my proposed intrabody pipeline. By introducing scFvs into murine osteoblasts through a lentiviral vector and inducing their expression, one can screen anti-3BP2-SH2 scFvs for inhibition of the 3BP2-Abl interaction in regular osteoblasts and anti-Abl-SH3 scFvs for the activation of Abl in 3BP2-/- cells. More

85 specifically, anti-3BP2 SH2 scFvs that inhibit the interaction between 3BP2 and Abl will negatively affect the bone-formation and mineral-deposition activities of wild-type osteoblasts while anti-Abl-SH3 scFvs that bind to the Abl SH3 and sterically prevent autoinhibitory folding will restore these activities in 3BP2-/- cells. Both of the screens in question have already been covered in Chapter 3 and are readily available for the validation of the intrabody pipelne.

4.3 Potential Avenues of Research

In addition to validating my intrabody pipeline, the success of the above screens will also open the door to a host of other applications. In general, larger sets of protein targets and factors important to intrabody scaffold stability can be explored on an unprecedented scale.

From the target standpoint, focus can now shift to development of therapeutic intrabodies against intracellular proteins. One appealing family of proteins is the Ubiquitin specific protease (USP) family, which contains over 50 deubiquitinases responsible for regulating the ubiquitination and degradation of their substrates[85]. The Sidhu lab has already performed considerable work in developing ubiquitin-like inhibitors against a smaller set of USPs and intracellular assays are currently being established in conjunction with the Moffat lab in the Terrence Donnelly Centre for Cellular and Biomedical Research (CCBR). Using my high-throughput intrabody pipeline, scFv-phage libraries can be simultaneously screened against the entire USP family followed by incorporation into the intein-Yeast-two-hybrid system to generate intrabodies with potential inhibitory effects on USP activitities.

From a scaffold stability standpoint, new scFv- and scFab-phage display libraries can be constructed where the framework residues are randomized instead of the CDRs. These libraries can be screened in reducing in vitro conditions against proteins that detect properly folded immunoglobulin domains (protein A for example) and then introduced into intein-Yeast-two- hybrid system to identify potential consensus sequences that confer increased intracellular stability. Indeed, similar in vitro experiments have already been explored in the past[86] and the addition of a downstream intracellular screen would greatly enhance the information gained from such an approach. Furthermore, recent findings that low hydrophilicity (as calculated by Kyte and Doolittle[87]) and a net negative charge improve scFv solubility within the cytoplasm can be used to improve on the design of the intrabody scaffold[88].

4.4 Applications of Antibodies and Intrabodies

The antibodies generated by my high-throughput in vitro selections and the intrabodies captured through the high-throughput intrabody pipeline have many useful applications in the research field. As detection reagents, antibodies can be used in Westerns, immunofluorescence, IPs and as tools for mass spectrometry applications. Another potential application of antibodies is their use as crystallization reagents to enable the structural visualization of difficult protein targets. Indeed, such uses do not require the use of intrabodies since they can be performed in vitro. Furthermore, the ease, speed and cost efficiency of phage display makes high-throughput screens a much more appealing alternative than the use of hybridoma technology, which is labor- intensive and unreliable. My proposed intrabody pipeline will not only in theory generate intrabody reagents that can support all of the applications listed above but will expand the capacity of researchers to explore and perturb intracellular processes.

As easily modifiable reagents, intrabodies can be designed for a variety of exciting intracellular applications. For example, in addition to perturbing specific protein-protein interactions and enabling a much more comprehensive investigation into protein functions, intrabodies can serve as a new class of chimeric adaptor molecules through their conjugation to protein domains with known effector functions. This concept has already been demonstrated with SH2 domains to rewire mitogenic receptor tyrosine kinase signaling to caspase activation and cell death[89]. Furthermore, new technologies that involve the conjugation of proteins to natural ligands[90] and synthetic small molecules[91] can usher a new era of intrabody-based drug delivery systems.

Intrabodies can also be used to inhibit enzyme catalytic activities[18, 92] and to redirect the localization of their protein targets[14, 15]. In addition to their use as transdominant intracellular reagents, intrabodies would also add significant contributions to rational drug design[14]. Not only can intrabodies serve as tools in drug validation by targeting the same protein and generating the same phenotype as a known small molecule but the identification of the interaction interfaces through the crystallization of intrabody-target complexes will help researchers identify important features to guide the construction of new small molecule drugs.

4.5 Factors to consider for intrabodies as therapeutic agents

While there are many potential applications of intrabodies, there are also many issues that must be addressed in their consideration as reagents of therapeutic value. For example, one major obstacle is the delivery method of intrabodies to the target cells. This can be accomplished in a variety of ways ranging from gene-based delivery systems such as lentiviral and adenoviral vectors to protein-based methods such as liposomes, cationic-peptide encapsulation and the use of peptide transduction domains (PTDs)[93-96]. However, delivery systems in general have issues that must be resolved before their use in an effective intrabody strategy. For example, while viral vectors are more established and well-suited to the delivery of nucleic acids, they can be hindered by potential immune responses, insertion-induced oncogenesis and a lack of transductional specificity[93]. While protein-delivery methods avoid issues involved with intrabody expression, they also have low transductional specificities and treatment would require repeated doses to account for protein turnover within the patient[93].

Assuming that intrabodies can be effectively delivered to their target cells, a new set of challenges faces their use as therapeutic reagents. In addition to stability issues which have been discussed in earlier chapters, intrabodies may be cytotoxic and even immunogenic. Furthermore, the expression of intrabodies within target cells will need to be optimized since the appropriate levels for effective function might vary for different intracellular targets and applications. In addition, intrabody expression will most likely need to be controlled from a transcriptional standpoint in order to minimize the issue of transductional specificity mentioned earlier. This might be accomplished by using promoters and enhancer elements that are only active in the target cell type.

In addition to issues regarding the delivery and expression of intrabodies, other factors must also be considered for their use as therapeutic reagents. For example, the randomization of CDR loops during library construction may result in the creation of protease cleavage sites and other recognition sequences that can invite modification. Indeed, the prevalence of tyrosine and even serine in current randomization strategies can result in phosphorylation of the antigen binding site. Furthermore, the localization of intrabodies to particular intracellular compartments may result in exposure to harsh microenvironments that can affect intrabody function. This might not

88 be as significant an issue if the intrabodies in question were used as trafficking agents with the sole purpose of delivering protein to such compartments.

Apart from delivery and expression issues, it must be stressed that it would be extraordinarily difficult to design libraries and randomization strategies that would account for all potential challenges within the cell. Furthermore, the selection strategies employed in vitro do not guarantee that the enriched binders are most suitable to intracellular applications. Consequently, it is necessary to screen all potential clones after the initial preselection step and even then, it can be argued that all intrabodies that interact with their targets in the yeast-two-hybrid system should be screened in mammalian cells for the same reason, regardless of in vitro characterization. In this manner, the chances of finding intrabodies with the expected phenotype are increased.

4.6 Final Remarks

Regardless of the challenges that lie ahead, the potential applications of intrabodies are limitless and range from their use as therapeutic reagents to valuable instruments in the study of proteins, their interactions and their associated pathways. The incorporation of high-throughput phage display with a novel screen for intracellular functionality is an important step in increasing the scale and reliability with which these powerful tools are generated.

References

1. Holliger, P. and P.J. Hudson, Engineered antibody fragments and the rise of single domains. Nat Biotechnol, 2005. 23(9): p. 1126-36. 2. Janeway, C.A., et al., Immunobiology: the immune system in health and disease. 6 ed. 2005, New York: Garland Science. 3. Xu, J.L. and M.M. Davis, Diversity in the CDR3 region of V(H) is sufficient for most antibody specificities. Immunity, 2000. 13(1): p. 37-45. 4. Hoogenboom, H.R. and G. Winter, By-passing immunisation. Human antibodies from synthetic repertoires of germline VH gene segments rearranged in vitro. J Mol Biol, 1992. 227(2): p. 381-8. 5. Nissim, A., et al., Antibody fragments from a 'single pot' phage display library as immunochemical reagents. EMBO J, 1994. 13(3): p. 692-8. 6. Rothlisberger, D., A. Honegger, and A. Pluckthun, Domain interactions in the Fab fragment: a comparative evaluation of the single-chain Fv and Fab format engineered with variable domains of different stability. J Mol Biol, 2005. 347(4): p. 773-89. 7. Brekke, O.H. and I. Sandlie, Therapeutic antibodies for human diseases at the dawn of the twenty-first century. Nat Rev Drug Discov, 2003. 2(1): p. 52-62. 8. Weiner, L.M., R. Surana, and W. Shangzi, Monoclonal antibodies: versatile platforms for cancer immunotherapy. Nature Reviews Immunology, 2010. 10: p. 317-327. 9. Chan, A.C. and P.J. Carter, Therapeutic antibodies for autoimmunity and inflammation. Nat Rev Immunol, 2010. 10(5): p. 301-16. 10. Lo, A.S.Y., Q. Zhu, and W.A. Marasco, Intracellular antibodies (Intrabodies) and their therapeutic potential, in Therapeutic antibodies. Handbook of experimental pharmacology 181, Y. Chernajovsky and A. Nissim, Editors. 2008, Springer: Verlag Berlin Heidelberg. p. 343-373. 11. Richardson, J.H. and W.A. Marasco, Intracellular antibodies: development and therapeutic potential. Trends Biotechnol, 1995. 13(8): p. 306-10. 12. Alzogaray, V., et al., Single-domain llama antibodies as specific intracellular inhibitors of SpvB, the actin ADP-ribosylating toxin of Salmonella typhimurium. FASEB J. 25(2): p. 526-34. 13. Strube, R.W. and S.Y. Chen, Characterization of anti-cyclin E single-chain Fv antibodies and intrabodies in breast cancer cells: enhanced intracellular stability of novel sFv-F(c) intrabodies. J Immunol Methods, 2002. 263(1-2): p. 149-67. 14. Stocks, M., Intrabodies as drug discovery tools and therapeutics. Curr Opin Chem Biol, 2005. 9(4): p. 359-65. 15. Kontermann, R.E., Intrabodies as therapeutic agents. Methods, 2004. 34(2): p. 163-70. 16. Duan, L., et al., Potent inhibition of human immunodeficiency virus type 1 replication by an intracellular anti-Rev single-chain antibody. Proc Natl Acad Sci U S A, 1994. 91(11): p. 5075-9. 17. Mhashilkar, A.M., et al., Inhibition of HIV-1 Tat-mediated LTR transactivation and HIV- 1 infection by anti-Tat single chain intrabodies. EMBO J, 1995. 14(7): p. 1542-51. 18. Paz, K., et al., Human single-domain neutralizing intrabodies directed against Etk kinase: a novel approach to impair cellular transformation. Mol Cancer Ther, 2005. 4(11): p. 1801-9. 19. Kohler, G. and C. Milstein, Continuous cultures of fused cells secreting antibody of predefined specificity. Nature, 1975. 256(5517): p. 495-7.

20. Sidhu, S.S. and F.A. Fellouse, Synthetic therapeutic antibodies. Nat Chem Biol, 2006. 2(12): p. 682-8. 21. Michnick, S.W. and S.S. Sidhu, Submitting antibodies to binding arbitration. Nat Chem Biol, 2008. 4(6): p. 326-9. 22. Little, M., et al., Of mice and men: hybridoma and recombinant antibodies. Immunol Today, 2000. 21(8): p. 364-70. 23. Sidhu, S.S. and A.A. Kossiakoff, Exploring and designing protein function with restricted diversity. Curr Opin Chem Biol, 2007. 11(3): p. 347-54. 24. Scott, J.K. and G.P. Smith, Searching for peptide ligands with an epitope library. Science, 1990. 249(4967): p. 386-90. 25. Sidhu, S.S., ed. Phage Display in Biotechnology and Drug Discovery. 1 ed. 2005, Taylor & Francis Group: Boca Raton. 768. 26. Morrison, K.L. and G.A. Weiss, Combinatorial alanine-scanning. Curr Opin Chem Biol, 2001. 5(3): p. 302-7. 27. Weiss, G.A., et al., Rapid mapping of protein functional epitopes by combinatorial alanine scanning. Proc Natl Acad Sci U S A, 2000. 97(16): p. 8950-4. 28. Sidhu, S.S. and S. Koide, Phage display for engineering and analyzing protein interaction interfaces. Curr Opin Struct Biol, 2007. 17(4): p. 481-7. 29. Tonikian, R., et al., Identifying specificity profiles for peptide recognition modules from phage-displayed peptide libraries. Nat Protoc, 2007. 2(6): p. 1368-86. 30. Hoogenboom, H.R., Selecting and screening recombinant antibody libraries. Nat Biotechnol, 2005. 23(9): p. 1105-16. 31. Bradbury, A.R. and J.D. Marks, Antibodies from phage antibody libraries. J Immunol Methods, 2004. 290(1-2): p. 29-49. 32. Fellouse, F.A. and S.S. Sidhu, Making antibodies in bacteria, in Making and using antibodies, G.C. Howard and M.R. Kaser, Editors. 2007, CRC Press: Boca Raton. p. 157- 180. 33. Muller, K. and K. Arndt, eds. Protein Engineering Protocols. 1 ed. Methods in Molecular Biology, ed. J.M. Walker. 2007, Humana Press: Totowa, New Jersey. 34. Fellouse, F.A., et al., Molecular recognition by a binary code. J Mol Biol, 2005. 348(5): p. 1153-62. 35. Fellouse, F.A., C. Wiesmann, and S.S. Sidhu, Synthetic antibodies from a four-amino- acid code: a dominant role for tyrosine in antigen recognition. Proc Natl Acad Sci U S A, 2004. 101(34): p. 12467-72. 36. Fellouse, F.A., et al., High-throughput generation of synthetic antibodies from highly functional minimalist phage-displayed libraries. J Mol Biol, 2007. 373(4): p. 924-40. 37. Zemlin, M., et al., Expressed murine and human CDR-H3 intervals of equal length exhibit distinct repertoires that differ in their amino acid composition and predicted range of structures. J Mol Biol, 2003. 334(4): p. 733-49. 38. Lefranc, M.P., et al., IMGT unique numbering for immunoglobulin and T cell receptor variable domains and Ig superfamily V-like domains. Dev Comp Immunol, 2003. 27(1): p. 55-77. 39. Sidhu, S.S., et al., Phage-displayed antibody libraries of synthetic heavy chain complementarity determining regions. J Mol Biol, 2004. 338(2): p. 299-310. 40. Lou, J., et al., Antibodies in haystacks: how selection strategy influences the outcome of selection from molecular diversity libraries. J Immunol Methods, 2001. 253(1-2): p. 233- 42.

41. Liu, B., et al., Towards proteome-wide production of monoclonal antibody by phage display. J Mol Biol, 2002. 315(5): p. 1063-73. 42. Liu, B. and J.D. Marks, Applying phage antibodies to proteomics: selecting single chain Fv antibodies to antigens blotted on nitrocellulose. Anal Biochem, 2000. 286(1): p. 119- 28. 43. Konthur, Z. and G. Walter, Automation of phage display for high-throughput antibody development. TARGETS, 2002. 1(1): p. 30-36. 44. Krebs, B., et al., High-throughput generation and engineering of recombinant human antibodies. J Immunol Methods, 2001. 254(1-2): p. 67-84. 45. Walter, G., Z. Konthur, and H. Lehrach, High-throughput screening of surface displayed gene products. Comb Chem High Throughput Screen, 2001. 4(2): p. 193-205. 46. Konthur, Z. and R. Crameri, High-throughput applications of phage display in proteomic analyses. TARGETS, 2003. 2(6): p. 261-270. 47. Rhyner, C., et al., High-throughput isolation of recombinant antibodies against recombinant allergens. Biotechniques, 2003. 35(4): p. 672-4. 48. Schofield, D.J., et al., Application of phage display to high throughput antibody generation and characterization. Genome Biol, 2007. 8(11): p. R254. 49. Pershad, K., et al., Generating a panel of highly specific antibodies to 20 human SH2 domains by phage display. Protein Eng Des Sel. 23(4): p. 279-88. 50. Chambers, R.S., High-throughput antibody production. Curr Opin Chem Biol, 2005. 9(1): p. 46-50. 51. Bonnin, E., et al., Generation of functional scFv intrabodies for triggering anti-tumor immunity. Methods, 2004. 34(2): p. 225-32. 52. Cattaneo, A. and S. Biocca, The selection of intracellular antibodies. Trends Biotechnol, 1999. 17(3): p. 115-21. 53. Wirtz, P. and B. Steipe, Intrabody construction and expression III: engineering hyperstable V(H) domains. Protein Sci, 1999. 8(11): p. 2245-50. 54. Worn, A. and A. Pluckthun, Mutual stabilization of VL and VH in single-chain antibody fragments, investigated with mutants engineered for stability. Biochemistry, 1998. 37(38): p. 13120-7. 55. Ohage, E.C., et al., Intrabody construction and expression. II. A synthetic catalytic Fv fragment. J Mol Biol, 1999. 291(5): p. 1129-34. 56. Hamers-Casterman, C., et al., Naturally occurring antibodies devoid of light chains. Nature, 1993. 363(6428): p. 446-8. 57. Barthelemy, P.A., et al., Comprehensive analysis of the factors contributing to the stability and solubility of autonomous human VH domains. J Biol Chem, 2008. 283(6): p. 3639-54. 58. Seo, M.J., et al., Engineering antibody fragments to fold in the absence of disulfide bonds. Protein Sci, 2009. 18(2): p. 259-67. 59. Tanaka, T. and T.H. Rabbitts, Functional intracellular antibody fragments do not require invariant intra-domain disulfide bonds. J Mol Biol, 2008. 376(3): p. 749-57. 60. Donini, M., et al., Engineering stable cytoplasmic intrabodies with designed specificity. J Mol Biol, 2003. 330(2): p. 323-32. 61. Visintin, M., et al., The intracellular antibody capture technology (IACT): towards a consensus sequence for intracellular antibodies. J Mol Biol, 2002. 317(1): p. 73-83. 62. Visintin, M., et al., Intracellular antibodies for proteomics. J Immunol Methods, 2004. 290(1-2): p. 135-53.

63. Koch, H., et al., Direct selection of antibodies from complex libraries with the protein fragment complementation assay. J Mol Biol, 2006. 357(2): p. 427-41. 64. der Maur, A.A., et al., Direct in vivo screening of intrabody libraries constructed on a highly stable single-chain framework. J Biol Chem, 2002. 277(47): p. 45075-85. 65. Desiderio, A., et al., A semi-synthetic repertoire of intrinsically stable antibody fragments derived from a single-framework scaffold. J Mol Biol, 2001. 310(3): p. 603-15. 66. Koide, A., et al., The fibronectin type III domain as a scaffold for novel binding proteins. J Mol Biol, 1998. 284(4): p. 1141-51. 67. Wojcik, J., et al., A potent and highly specific FN3 monobody inhibitor of the Abl SH2 domain. Nat Struct Mol Biol, 2010. 17(4): p. 519-527. 68. Wu, H., Z. Hu, and X.Q. Liu, Protein trans-splicing by a split intein encoded in a split DnaE gene of Synechocystis sp. PCC6803. Proc Natl Acad Sci U S A, 1998. 95(16): p. 9226-31. 69. Evans, T.C., Jr., et al., Protein trans-splicing and cyclization by a naturally split intein from the dnaE gene of Synechocystis species PCC6803. J Biol Chem, 2000. 275(13): p. 9091-4. 70. Scott, C.P., et al., Production of cyclic peptides and proteins in vivo. Proc Natl Acad Sci U S A, 1999. 96(24): p. 13638-43. 71. Iwai, H. and A. Pluckthun, Circular beta-lactamase: stability enhancement by cyclizing the backbone. FEBS Lett, 1999. 459(2): p. 166-72. 72. Thorpe, I.F. and C.L. Brooks, 3rd, Molecular evolution of affinity and flexibility in the immune system. Proc Natl Acad Sci U S A, 2007. 104(21): p. 8821-6. 73. Barreto, K., et al., A genetic screen for isolating "lariat" Peptide inhibitors of protein function. Chem Biol, 2009. 16(11): p. 1148-57. 74. Sant'Anna, O.A., et al., Basal immunoglobulin serum concentration and isotype distribution in relation to the polygenic control of antibody responsiveness in mice. Immunogenetics, 1985. 22(2): p. 131-9. 75. Simmons, L.C., et al., Expression of full-length immunoglobulins in Escherichia coli: rapid and efficient production of aglycosylated antibodies. J Immunol Methods, 2002. 263(1-2): p. 133-47. 76. Chan, C.E., et al., Optimized expression of full-length IgG1 antibody in a common E. coli strain. PLoS One, 2010. 5(4): p. e10261. 77. Bostrom, J., et al., Variants of the antibody herceptin that interact with HER2 and VEGF at the antigen binding site. Science, 2009. 323(5921): p. 1610-4. 78. Hillson, J.L., et al., The structural basis of germline-encoded VH3 immunoglobulin binding to staphylococcal protein A. J Exp Med, 1993. 178(1): p. 331-6. 79. Levaot, N., et al., 3BP2, encoded by the cherubism locus, is essential for Abl activation required for osteoblast maturation. submitted: p. 1-22. 80. Sirvent, A., C. Benistant, and S. Roche, Cytoplasmic signalling by the c-Abl tyrosine kinase in normal and cancer cells. Biol Cell, 2008. 100(11): p. 617-31. 81. Deckert, M. and R. Rottapel, The adapter 3BP2: how it plugs into leukocyte signaling. Adv Exp Med Biol, 2006. 584: p. 107-14. 82. Helfrich, M.H. and S.H. Ralston, eds. Bone Research Protocols. 2003, Humana Press: Totowa, New Jersey. 468. 83. Adey, N.B., et al., Characterization of phage that bind plastic from phage-displayed random peptide libraries. Gene, 1995. 156(1): p. 27-31.

84. Walker, L.M., D.R. Bowley, and D.R. Burton, Efficient recovery of high-affinity antibodies from a single-chain Fab yeast display library. J Mol Biol, 2009. 389(2): p. 365-75. 85. Komander, D., M.J. Clague, and S. Urbe, Breaking the chains: structure and function of the deubiquitinases. Nat Rev Mol Cell Biol, 2009. 10(8): p. 550-63. 86. Brockmann, E.C., et al., Selecting for antibody scFv fragments with improved stability using phage display with denaturation under reducing conditions. J Immunol Methods, 2005. 296(1-2): p. 159-70. 87. Kyte, J. and R.F. Doolittle, A simple method for displaying the hydropathic character of a protein. J Mol Biol, 1982. 157(1): p. 105-32. 88. Kvam, E., et al., Physico-chemical determinants of soluble intrabody expression in mammalian cell cytoplasm. Protein Eng Des Sel, 2010. 23(6): p. 489-98. 89. Howard, P.L., et al., Redirecting tyrosine kinase signaling to an apoptotic caspase pathway through chimeric adaptor proteins. Proc Natl Acad Sci U S A, 2003. 100(20): p. 11267-72. 90. Rizk, S.S., et al., An engineered substance P variant for receptor-mediated delivery of synthetic antibodies into tumor cells. Proc Natl Acad Sci U S A, 2009. 106(27): p. 11011- 5. 91. Hofer, T., et al., An engineered selenocysteine defines a unique class of antibody derivatives. PNAS, 2008. 105(34): p. 12451-12456. 92. Wu, Y., et al., Structural insight into distinct mechanisms of protease inhibition by antibodies. PNAS, 2007. 104(50): p. 19784-19789. 93. Stocks, M.R., Intrabodies: production and promise. Drug Discov Today, 2004. 9(22): p. 960-6. 94. Dalkara, D., G. Zuber, and J.P. Behr, Intracytoplasmic delivery of anionic proteins. Mol Ther, 2004. 9(6): p. 964-9. 95. Joliot, A. and A. Prochiantz, Transduction peptides: from technology to physiology. Nat Cell Biol, 2004. 6(3): p. 189-96. 96. Lundstrom, K., Latest development in viral vectors for gene therapy. Trends Biotechnol, 2003. 21(3): p. 117-22.

Appendices

APPENDIX A: Vector and Template Sequences

The vectors and template sequences are provided in the following pages.

Library F vector (5037bp total):

STII secretion signal = Yellow STII secretion signal = Yellow Anti-MBP VL = 1st Blue Anti-MBP VH = 2nd Blue CL = 1st Red CH1 = 2nd Red FLAG = 1st Green IGHG1 Hinge Region = 2nd Green Dimerization domain = Grey Truncated gene III = purple

GGAAATTGTAAACGTTAATATTTTGTTAAAATTCGCGTTAAATTTTTGTTAAATCAGCTCATTT TTTAACCAATAGGCCGAAATCGGCAAAATCCCTTATAAATCAAAAGAATAGACCGAGATAGGGT TGAGTGTTGTTCCAGTTTGGAACAAGAGTCCACTATTAAAGAACGTGGACTCCAACGTCAAAGG GCGAAAAACCGTCTATCAGGGCGATGGCCCACTACGTGAACCATCACCCTAATCAAGTTTTTTG GGGTCGAGGTGCCGTAAAGCACTAAATCGGAACCCTAAAGGGAGCCCCCGATTTAGAGCTTGAC GGGGAAAGCCGGCGAACGTGGCGAGAAAGGAAGGGAAGAAAGCGAAAGGAGCGGGCGCTAGGGC GCTGGCAAGTGTAGCGGTCACGCTGCGCGTAACCACCACACCCGCCGCGCTTAATGCGCCGCTA CAGGGCGCGTCGCGCCATTCGCCATTCAGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGG CCTCTTCGCTATTACGCGCATGCGACCAACAGCGGTTGATTGATCAGGTAGAGGGGGCGCTGTA CGAGGTAAAGCCCGATGCCAGCATTCCTGACGACGATACGGAGCTGCTGCGCGATTACGTAAAG AAGTTATTGAAGCATCCTCGTCAGTAAAAAGTTAATCTTTTCAACAGCTGTCATAAAGTTGTCA CGGCCGAGACTTATAGTCGCTTTGTTTTTATTTTTTAATGTATTTGTAACTAGTACGCAAGTTC ACGTAAAAAGGGTATGTAGAGGTTGAGGTGATTTTATGAAAAAGAATATCGCATTTCTTCTTGC ATCTATGTTCGTTTTTTCTATTGCTACAAATGCCTATGCATCCGATATCCAGATGACCCAGTCC CCGAGCTCCCTGTCCGCCTCTGTGGGCGATAGGGTCACCATCACCTGCCGTGCCAGTCAGTCCG TGTCCAGCGCTGTAGCCTGGTATCAACAGAAACCAGGAAAAGCTCCGAAGCTTCTGATTTACTC GGCATCCAGCCTCTACTCTGGAGTCCCTTCTCGCTTCTCTGGTAGCCGTTCCGGGACGGATTTC ACTCTGACCATCAGCAGTCTGCAGCCGGAAGACTTCGCAACTTATTACTGTCAGCAATCTTCTT ATTCTCTGATCACGTTCGGACAGGGTACCAAGGTGGAGATCAAACGAACTGTGGCTGCACCATC TGTCTTCATCTTCCCGCCATCTGATTCACAGTTGAAATCTGGAACTGCCTCTGTTGTGTGCCTG CTGAATAACTTCTATCCCAGAGAGGCCAAAGTACAGTGGAAGGTGGATAACGCCCTCCAATCGG GTAACTCCCAGGAGAGTGTCACAGAGCAGGACAGCAAGGACAGCACCTACAGCCTCAGCAGCAC CCTGACGCTGAGCAAAGCAGACTACGAAAAACATAAAGTCTACGCCTGCGAAGTCACCCATCAG GGCCTGAGCTCGCCCGTCACAAAGAGCTTCAACAGGGGAGAGTGTGGTGGTTCTGATTACAAAG ATGACGATGACAAATAATTAACTCGAGGCTGAGCAAAGCAGACTACTAATAACATAAAGTCTAC GCCGGACGCATCGTGGCCCTAGTACGCAAGTTCACGTAAAAAGGGTAACTAGAGGTTGAGGTGA TTTTATGAAAAAGAATATCGCATTTCTTCTTGCATCTATGTTCGTTTTTTCTATTGCTACAAAC GCGTACGCTGAGATCTCCGAGGTTCAGCTGGTGGAGTCTGGCGGTGGCCTGGTGCAGCCAGGGG GCTCACTCCGTTTGTCCTGTGCAGCTTCTGGCTTCAACTTTTCTTCTTCTTCTATACACTGGGT GCGTCAGGCCCCGGGTAAGGGCCTGGAATGGGTTGCATCTATTTCTTCTTCTTATGGCTATACT TATTATGCCGATAGCGTCAAGGGCCGTTTCACTATAAGCGCAGACACATCCAAAAACACAGCCT ACCTACAAATGAACAGCTTAAGAGCTGAGGACACTGCCGTCTATTATTGTGCTCGCACTGTTCG TGGATCCAAAAAACCGTACTTCTCTGGTTGGGCTATGGACTACTGGGGTCAAGGAACCCTGGTC ACCGTCTCCTCGGCCTCCACCAAGGGTCCATCGGTCTTCCCCCTGGCACCCTCCTCCAAGAGCA CCTCTGGGGGCACAGCGGCCCTGGGCTGCCTGGTCAAGGACTACTTCCCCGAACCGGTGACGGT

GTCGTGGAACTCAGGCGCCCTGACCAGCGGCGTGCACACCTTCCCGGCTGTCCTACAGTCCTCA GGACTCTACTCCCTCAGCAGCGTGGTGACCGTGCCCTCCAGCAGCTTGGGCACCCAGACCTACA TCTGCAACGTGAATCACAAGCCCAGCAACACCAAGGTCGACAAGAAAGTTGAGCCCAAATCTTG TGACAAAACTCACACATGCGGCCGGCCCTCTGGTTCCGGTGATTTTGATTATGAAAAGATGGCA AACGCTAATAAGGGGGCTATGACCGAAAATGCCGATGAAAACGCGCTACAGTCTGACGCTAAAG GCAAACTTGATTCTGTCGCTACTGATTACGGTGCTGCTATCGATGGTTTCATTGGTGACGTTTC CGGCCTTGCTAATGGTAATGGTGCTACTGGTGATTTTGCTGGCTCTAATTCCCAAATGGCTCAA GTCGGTGACGGTGATAATTCACCTTTAATGAATAATTTCCGTCAATATTTACCTTCCCTCCCTC AATCGGTTGAATGTCGCCCTTTTGTCTTTAGCGCTGGTAAACCATATGAATTTTCTATTGATTG TGACAAAATAAACTTATTCCGTGGTGTCTTTGCGTTTCTTTTATATGTTGCCACCTTTATGTAT GTATTTTCTACGTTTGCTAACATACTGCGTAATAAGGAGTCTTAAAGCTCCAATTCGCCCTATA GTGAGTCGTATTACAATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGT TACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGCATTAATGAATCGGCCAAC GCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCG CTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACA GAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTA AAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCG ACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGA AGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCC CTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGT TCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGT AACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTA ACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTA CGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAA AGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCA AGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTC TGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATC TTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAA CTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCG TTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCT GGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAA ACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTC TATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTT GCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTT CCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGG TCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTG CATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCA AGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAA TACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAA CTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGAT CTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGC AAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTAT TGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATA AACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTG

Translation of anti-MBP light chain (including secretion signal): atgaaaaagaatatcgcatttcttcttgcatctatgttcgttttttctattgctacaaat M K K N I A F L L A S M F V F S I A T N gcctatgcatccgatatccagatgacccagtccccgagctccctgtccgcctctgtgggc A Y A S D I Q M T Q S P S S L S A S V G gatagggtcaccatcacctgccgtgccagtcagtccgtgtccagcgctgtagcctggtat D R V T I T C R A S Q S V S S A V A W Y caacagaaaccaggaaaagctccgaagcttctgatttactcggcatccagcctctactct Q Q K P G K A P K L L I Y S A S S L Y S ggagtcccttctcgcttctctggtagccgttccgggacggatttcactctgaccatcagc G V P S R F S G S R S G T D F T L T I S agtctgcagccggaagacttcgcaacttattactgtcagcaatcttcttattctctgatc S L Q P E D F A T Y Y C Q Q S S Y S L I acgttcggacagggtaccaaggtggagatcaaacgaactgtggctgcaccatctgtcttc T F G Q G T K V E I K R T V A A P S V F atcttcccgccatctgattcacagttgaaatctggaactgcctctgttgtgtgcctgctg I F P P S D S Q L K S G T A S V V C L L aataacttctatcccagagaggccaaagtacagtggaaggtggataacgccctccaatcg N N F Y P R E A K V Q W K V D N A L Q S ggtaactcccaggagagtgtcacagagcaggacagcaaggacagcacctacagcctcagc G N S Q E S V T E Q D S K D S T Y S L S agcaccctgacgctgagcaaagcagactacgaaaaacataaagtctacgcctgcgaagtc S T L T L S K A D Y E K H K V Y A C E V acccatcagggcctgagctcgcccgtcacaaagagcttcaacaggggagagtgtggtggt T H Q G L S S P V T K S F N R G E C G G tctgattacaaagatgacgatgacaaataa S D Y K D D D D K -

Translation of anti-MBP heavy chain-p3 (including secretion signal): atgaaaaagaatatcgcatttcttcttgcatctatgttcgttttttctattgctacaaac M K K N I A F L L A S M F V F S I A T N gcgtacgctgagatctccgaggttcagctggtggagtctggcggtggcctggtgcagcca A Y A E I S E V Q L V E S G G G L V Q P gggggctcactccgtttgtcctgtgcagcttctggcttcaacttttcttcttcttctata G G S L R L S C A A S G F N F S S S S I cactgggtgcgtcaggccccgggtaagggcctggaatgggttgcatctatttcttcttct H W V R Q A P G K G L E W V A S I S S S tatggctatacttattatgccgatagcgtcaagggccgtttcactataagcgcagacaca Y G Y T Y Y A D S V K G R F T I S A D T tccaaaaacacagcctacctacaaatgaacagcttaagagctgaggacactgccgtctat S K N T A Y L Q M N S L R A E D T A V Y tattgtgctcgcactgttcgtggatccaaaaaaccgtacttctctggttgggctatggac Y C A R T V R G S K K P Y F S G W A M D tactggggtcaaggaaccctggtcaccgtctcctcggcctccaccaagggtccatcggtc Y W G Q G T L V T V S S A S T K G P S V ttccccctggcaccctcctccaagagcacctctgggggcacagcggccctgggctgcctg F P L A P S S K S T S G G T A A L G C L gtcaaggactacttccccgaaccggtgacggtgtcgtggaactcaggcgccctgaccagc V K D Y F P E P V T V S W N S G A L T S ggcgtgcacaccttcccggctgtcctacagtcctcaggactctactccctcagcagcgtg

G V H T F P A V L Q S S G L Y S L S S V gtgaccgtgccctccagcagcttgggcacccagacctacatctgcaacgtgaatcacaag V T V P S S S L G T Q T Y I C N V N H K cccagcaacaccaaggtcgacaagaaagttgagcccaaatcttgtgacaaaactcacaca P S N T K V D K K V E P K S C D K T H T tgcggccggccctctggttccggtgattttgattatgaaaagatggcaaacgctaataag C G R P S G S G D F D Y E K M A N A N K ggggctatgaccgaaaatgccgatgaaaacgcgctacagtctgacgctaaaggcaaactt G A M T E N A D E N A L Q S D A K G K L gattctgtcgctactgattacggtgctgctatcgatggtttcattggtgacgtttccggc D S V A T D Y G A A I D G F I G D V S G cttgctaatggtaatggtgctactggtgattttgctggctctaattcccaaatggctcaa L A N G N G A T G D F A G S N S Q M A Q gtcggtgacggtgataattcacctttaatgaataatttccgtcaatatttaccttccctc V G D G D N S P L M N N F R Q Y L P S L cctcaatcggttgaatgtcgcccttttgtctttagcgctggtaaaccatatgaattttct P Q S V E C R P F V F S A G K P Y E F S attgattgtgacaaaataaacttattccgtggtgtctttgcgtttcttttatatgttgcc I D C D K I N L F R G V F A F L L Y V A acctttatgtatgtattttctacgtttgctaacatactgcgtaataaggagtcttaa T F M Y V F S T F A N I L R N K E S -

P8-STOP vector (6188bp total):

STII secretion signal = yellow Truncated gene VIII = blue Truncated gene III = purple Stop codons = Red

GAATTCCCGACACCATCGAATGGTGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGGAAGA GAGTCAATTCAGGGTGGTGAATGTGAAACCAGTAACGTTATACGATGTCGCAGAGTATGCCGGT GTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGG AAAAAGTGGAAGCGGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGC GGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAA ATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAG AACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGCAACGCGTCAGTGG GCTGATCATTAACTATCCGCTGGATGACCAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAAT GTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCCATCAACAGTATTATTTTCTCCCATG AAGACGGTACGCGACTGGGCGTGGAGCATCTGGTCGCATTGGGTCACCAGCAAATCGCGCTGTT AGCGGGCCCATTAAGTTCTGTCTCGGCGCGTCTGCGTCTGGCTGGCTGGCATAAATATCTCACT CGCAATCAAATTCAGCCGATAGCGGAACGGGAAGGCGACTGGAGTGCCATGTCCGGTTTTCAAC AAACCATGCAAATGCTGAATGAGGGCATCGTTCCCACTGCGATGCTGGTTGCCAACGATCAGAT GGCGCTGGGCGCAATGCGCGCCATTACCGAGTCCGGGCTGCGCGTTGGTGCGGATATCTCGGTA GTGGGATACGACGATACCGAAGACAGCTCATGTTATATCCCGCCGTTAACCACCATCAAACAGG ATTTTCGCCTGCTGGGGCAAACCAGCGTGGACCGCTTGCTGCAACTCTCTCAGGGCCAGGCGGT GAAGGGCAATCAGCTGTTGCCCGTCTCACTGGTGAAAAGAAAAACCACCCTGGCGCCCAATACG CAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGAC TGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACAATTCT CATGTTTGACAGCTTATCATCGACTGCACGGTGCACCAATGCTTCTGGCGTCAGGCAGCCATCG GAAGCTGTGGTATGGCTGTGCAGGTCGTAAATCACTGCATAATTCGTGTCGCTCAAGGCGCACT

CCCGTTCTGGATAATGTTTTTTGCGCCGACATCATAACGGTTCTGGCAAATATTCTGAAATGAG CTGTTGACAATTAATCATCGGCTCGTATAATGTGTGGAATTGTGAGCGGATAACAATTTCACAC AGGAAACAGCCAGTCCGTTTAGGTGTTTTCACGAGCACTTCACCAACAAGGACCATAGATTATG AAAAAGAATATCGCATTTCTTCTTGCATCTATGTTCGTTTTTTCTATTGCTACAAATGCCTATG CATAATAATGATGAGGTGGAGGATCCGGAGGAGGCGCCGAGGGTGACGATCCCGCAAAAGCGGC CTTTAACTCCCTGCAAGCCTCAGCGACCGAATATATCGGTTATGCGTGGGCGATGGTTGTTGTC ATTGTCGGCGCAACTATCGGTATCAAGCTGTTTAAGAAATTCACCTCGAAAGCAAGCTGATAAA CCGATACAATTAAAGGCTCCTTTTGGAGCCTTTTTTTTTGGAGATTTTCAACGTGAAAAAATTA TTATTCGCAATTCCTTTAGTTGTTCCTTTCTATTCTCACTCCGCTGAAACTGTTGAAAGTTGTT TAGCAAAACCCCATACAGAAAATTCATTTACTAACGTCTGGAAAGACGACAAAACTTTAGATCG TTACGCTAACTATGAGGGTTGTCTGTGGAATGCTACAGGCGTTGTAGTTTGTACTGGTGACGAA ACTCAGTGTCTAGCTAGAGTGGCGGTGGCTCTGGTTCCGGTGATTTTGATTATGAAAAGATGGC AAACGCTAATAAGGGGGCTATGACCGAAAATGCCGATGAAAACGCGCTACAGTCTGACGCTAAA GGCAAACTTGATTCTGTCGCTACTGATTACGGTGCTGCTATCGATGGTTTCATTGGTGACGTTT CCGGCCTTGCTAATGGTAATGGTGCTACTGGTGATTTTGCTGGCTCTAATTCCCAAATGGCTCA AGTCGGTGACGGTGATAATTCACCTTTAATGAATAATTTCCGTCAATATTTACCTTCCCTCCCT CAATCGGTTGAATGTCGCCCTTTTGTCTTTAGCGCTGGTAAACCATATGAATTTTCTATTGATT GTGACAAAATAAACTTATTCCGTGGTGTCTTTGCGTTTCTTTTATATGTTGCCACCTTTATGTA TGTATTTTCTACGTTTGCTAACATACTGCGTAATAAGGAGTCTTAATCATGCCAGTTCTTTTGG CTAGCGCCGCCCTATACCTTGTCTGCCTCCCCGCGTTGCGTCGCGGTGCATGGAGCCGGGCCAC CTCGACCTGAATGGAAGCCGGCGGCACCTCGCTAACGGATTCACCACTCCAAGAATTGGAGCCA ATCAATTCTTGCGGAGAACTGTGAATGCGCAAACCAACCCTTGGCAGAACATATCCATCGCGTC CGCCATCTCCAGCAGCCGCACGCGGCGCATCTCGGGCAGCGTTGGGTCCTGGCCACGGGTGCGC ATGATCGTGCTCCTGTCGTTGAGGACCCGGCTAGGCTGGCGGGGTTGCCTTACTGGTTAGCAGA ATGAATCACCGATACGCGAGCGAACGTGAAGCGACTGCTGCTGCAAAACGTCTGCGACCTGAGC AACAACATGAATGGTCTTCGGTTTCCGTGTTTCGTAAAGTCTGGAAACGCGGAAGTCAGCGCCC TGCACCATTATGTTCCGGATCTGCATCGCAGGATGCTGCTGGCTACCCTGTGGAACACCTACAT CTGTATTAACGAAGCGCTGGCATTGACCCTGAGTGATTTTTCTCTGGTCCCGCCGCATCCATAC CGCCAGTTGTTTACCCTCACAACGTTCCAGTAACCGGGCATGTTCATCATCAGTAACCCGTATC GTGAGCATCCTCTCTCGTTTCATCGGTATCATTACCCCCATGAACAGAAATTCCCCCTTACACG GAGGCATCAAGTGACCAAACAGGAAAAAACCGCCCTTAACATGGCCCGCTTTATCAGAAGCCAG ACATTAACGCTTCTGGAGAAACTCAACGAGCTGGACGCGGATGAACAGGCAGACATCTGTGAAT CGCTTCACGACCACGCTGATGAGCTTTACCGCAGGATCCGGAAATTGTAAACGTTAATATTTTG TTAAAATTCGCGTTAAATTTTTGTTAAATCAGCTCATTTTTTAACCAATAGGCCGAAATCGGCA AAATCCCTTATAAATCAAAAGAATAGACCGAGATAGGGTTGAGTGTTGTTCCAGTTTGGAACAA GAGTCCACTATTAAAGAACGTGGACTCCAACGTCAAAGGGCGAAAAACCGTCTATCAGGGCTAT GGCCCACTACGTGAACCATCACCCTAATCAAGTTTTTTGGGGTCGAGGTGCCGTAAAGCACTAA ATCGGAACCCTAAAGGGAGCCCCCGATTTAGAGCTTGACGGGGAAAGCCGGCGAACGTGGCGAG AAAGGAAGGGAAGAAAGCGAAAGGAGCGGGCGCTAGGGCGCTGGCAAGTGTAGCGGTCACGCTG CGCGTAACCACCACACCCGCCGCGCTTAATGCGCCGCTACAGGGCGCGTCCGGATCCTGCCTCG CGCGTTTCGGTGATGACGGTGAAAACCTCTGACACATGCAGCTCCCGGAGACGGTCACAGCTTG TCTGTAAGCGGATGCCGGGAGCAGACAAGCCCGTCAGGGCGCGTCAGCGGGTGTTGGCGGGTGT CGGGGCGCAGCCATGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTAACTATGCGGC ATCAGAGCAGATTGTACTGAGAGTGCACCATATGCGGTGTGAAATACCGCACAGATGCGTAAGG AGAAAATACCGCATCAGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTC GGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGA TAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCG TTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTC

100

AGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGT GCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGC GTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGC TGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCT TGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGC AGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTA GAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAG CTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATT ACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGT GGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGAT CCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGAC AGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAG TTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGC TGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCC GGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTT GCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTGC AGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCA AGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCG TTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCT TACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGA GAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAACACGGGATAATACCGCGCCAC ATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGAT CTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCT TTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAA TAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTA TCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGG GTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACAT TAACCTATAAAAATAGGCGTATCACGAGGCCCTTTCGTCTTCAA

P3-STOP Vector:

Since the P3-STOP backbone is virtually identical to P8-STOP, only the modified portion of the phagemid is being shown. There are two versions of P3-STOP: one with the STII secretion signal and one without the STII secretion signal. The P3-STOP with the STII secretion signal was used to clone in the anti-MBP scFV alone to create the 1.10 anti-MBP scFv. The P3-STOP without a secretion signal was used to clone in the anti-MBP scFv with a PelB signal included to create the 6.31 anti-MBP scFv.

P3-STOP with the STII secretion signal:

STII secretion signal = Yellow Truncated gene III = Red NcoI site = CCATGG (highlighted in yellow) XbaI site = TCTAGA (highlighted in yellow)

101

AAACAGCCAGTCCGTTTAGGTGTTTTCACGAGCACTTCACCAACAAGGACCATAGATTATGAAA AAGAATATCGCATTTCTTCTTGCATCTATGTTCGTTTTTTCTATTGCTACAAATGCCTATGCAT CCATGGNNNNNNNNTCTAGAAGTGGTTCCGGTGATTTTGATTATGAAAAGATGGCAAACGCTAA TAAGGGGGCTATGACCGAAAATGCCGATGAAAACGCGCTACAGTCTGACGCTAAAGGCAAACTT GATTCTGTCGCTACTGATTACGGTGCTGCTATCGATGGTTTCATTGGTGACGTTTCCGGCCTTG CTAATGGTAATGGTGCTACTGGTGATTTTGCTGGCTCTAATTCCCAAATGGCTCAAGTCGGTGA CGGTGATAATTCACCTTTAATGAATAATTTCCGTCAATATTTACCTTCCCTCCCTCAATCGGTT GAATGTCGCCCTTTTGTCTTTAGCGCTGGTAAACCATATGAATTTTCTATTGATTGTGACAAAA TAAACTTATTCCGTGGTGTCTTTGCGTTTCTTTTATATGTTGCCACCTTTATGTATGTATTTTC TACGTTTGCTAACATACTGCGTAATAAGGAGTCTTAATCATGCCAGTTCTTTTGGCTAGCGCCG CCCTATACC

NNNNNNNN = GAAGCGGG(NE0698-16->20)* = GAAGCGGC (NE0698-21->25) = GAAGCGGT (NE0698-26->30)

*NE0698-16->20: Blue = book number, Red = Page number, Orange = aliquot numbers

Translation of Sequence Starting from Secretion Signal: atgaaaaagaatatcgcatttcttcttgcatctatgttcgttttttctattgctacaaat M K K N I A F L L A S M F V F S I A T N gcctatgcatccatggnnnnnnnntctagaagtggttccggtgattttgattatgaaaag A Y A S M X X X S R S G S G D F D Y E K atggcaaacgctaataagggggctatgaccgaaaatgccgatgaaaacgcgctacagtct M A N A N K G A M T E N A D E N A L Q S gacgctaaaggcaaacttgattctgtcgctactgattacggtgctgctatcgatggtttc D A K G K L D S V A T D Y G A A I D G F attggtgacgtttccggccttgctaatggtaatggtgctactggtgattttgctggctct I G D V S G L A N G N G A T G D F A G S aattcccaaatggctcaagtcggtgacggtgataattcacctttaatgaataatttccgt N S Q M A Q V G D G D N S P L M N N F R caatatttaccttccctccctcaatcggttgaatgtcgcccttttgtctttagcgctggt Q Y L P S L P Q S V E C R P F V F S A G aaaccatatgaattttctattgattgtgacaaaataaacttattccgtggtgtctttgcg K P Y E F S I D C D K I N L F R G V F A tttcttttatatgttgccacctttatgtatgtattttctacgtttgctaacatactgcgt F L L Y V A T F M Y V F S T F A N I L R aataaggagtcttaa N K E S -

* In each case, XXX = GSG

P3-STOP without STII secretion signal:

STII secretion signal = Yellow Truncated gene III = Red NcoI site = CCATGG (highlighted in yellow) XbaI site = TCTAGA (highlighted in yellow)

102

AAACAGCCAGTCCGTTTAGGTGTTTTCACGAGCACTTCACCAACAAGGACCATAGATTCCATGG NNNNNNNNTCTAGAAGTGGTTCCGGTGATTTTGATTATGAAAAGATGGCAAACGCTAATAAGGG GGCTATGACCGAAAATGCCGATGAAAACGCGCTACAGTCTGACGCTAAAGGCAAACTTGATTCT GTCGCTACTGATTACGGTGCTGCTATCGATGGTTTCATTGGTGACGTTTCCGGCCTTGCTAATG GTAATGGTGCTACTGGTGATTTTGCTGGCTCTAATTCCCAAATGGCTCAAGTCGGTGACGGTGA TAATTCACCTTTAATGAATAATTTCCGTCAATATTTACCTTCCCTCCCTCAATCGGTTGAATGT CGCCCTTTTGTCTTTAGCGCTGGTAAACCATATGAATTTTCTATTGATTGTGACAAAATAAACT TATTCCGTGGTGTCTTTGCGTTTCTTTTATATGTTGCCACCTTTATGTATGTATTTTCTACGTT TGCTAACATACTGCGTAATAAGGAGTCTTAATCATGCCAGTTCTTTTGGCTAGCGCCGCCCTAT ACCTTGTCTGCCTC

NNNNNNNN = GAAGCGGG (NE0698-01->05) = GAAGCGGC (NE0698-06->10) = GAAGCGGT (NE0698-11->15)

*NE0698-01->05: Blue = book number, Red = Page number, Orange = aliquot numbers

P3-STOP vector with 1.10 scFv (6526bp total):

STII secretion signal = Yellow FLAG tag = 1st Green Anti-MBP VL = 1st Blue Linker C3 = Red Ant-MBP VH = 2nd Blue IGHG1 Hinge Region = 2nd Green Dimerization Domain = Grey Truncated gene III = purple

103

GAAGCTGTGGTATGGCTGTGCAGGTCGTAAATCACTGCATAATTCGTGTCGCTCAAGGCGCACT CCCGTTCTGGATAATGTTTTTTGCGCCGACATCATAACGGTTCTGGCAAATATTCTGAAATGAG CTGTTGACAATTAATCATCGGCTCGTATAATGTGTGGAATTGTGAGCGGATAACAATTTCACAC AGGAAACAGCCAGTCCGTTTAGGTGTTTTCACGAGCACTTCACCAACAAGGACCATAGATTATG AAAAAGAATATCGCATTTCTTCTTGCATCTATGTTCGTTTTTTCTATTGCTACAAATGCCTATG CATCCGATTACAAAGATGACGATGACAAAGGCGGTGGCGATATCCAGATGACCCAGTCCCCGAG CTCCCTGTCCGCCTCTGTGGGCGATAGGGTCACCATCACCTGCCGTGCCAGTCAGTCCGTGTCC AGCGCTGTAGCCTGGTATCAACAGAAACCAGGAAAAGCTCCGAAGCTTCTGATTTACTCGGCAT CCAGCCTCTACTCTGGAGTCCCTTCTCGCTTCTCTGGTAGCCGTTCCGGGACGGATTTCACTCT GACCATCAGCAGTCTGCAGCCGGAAGACTTCGCAACTTATTACTGTCAGCAATCTTCTTATTCT CTGATCACGTTCGGACAGGGTACCAAGGTGGAGATCAAAGGTACTACTGCCGCTAGTGGTAGTA GTGGTGGCAGTAGCAGTGGTGCCGAGGTTCAGCTGGTGGAGTCTGGCGGTGGCCTGGTGCAGCC AGGGGGCTCACTCCGTTTGTCCTGTGCAGCTTCTGGCTTCAACTTTTCTTCTTCTTCTATACAC TGGGTGCGTCAGGCCCCGGGTAAGGGCCTGGAATGGGTTGCATCTATTTCTTCTTCTTATGGCT ATACTTATTATGCCGATAGCGTCAAGGGCCGTTTCACTATAAGCGCAGACACATCCAAAAACAC AGCCTACCTACAAATGAACAGCTTAAGAGCTGAGGACACTGCCGTCTATTATTGTGCTCGCACT GTTCGTGGATCCAAAAAACCGTACTTCTCTGGTTGGGCTATGGACTACTGGGGTCAAGGAACCC TGGTCACCGTCTCCTCGGCCGACAAAACTCACACATGCGGCCGGCCCTCTGGTTCCGGTGATTT TGATTATGAAAAGATGGCAAACGCTAATAAGGGGGCTATGACCGAAAATGCCGATGAAAACGCG CTACAGTCTGACGCTAAAGGCAAACTTGATTCTGTCGCTACTGATTACGGTGCTGCTATCGATG GTTTCATTGGTGACGTTTCCGGCCTTGCTAATGGTAATGGTGCTACTGGTGATTTTGCTGGCTC TAATTCCCAAATGGCTCAAGTCGGTGACGGTGATAATTCACCTTTAATGAATAATTTCCGTCAA TATTTACCTTCCCTCCCTCAATCGGTTGAATGTCGCCCTTTTGTCTTTAGCGCTGGTAAACCAT ATGAATTTTCTATTGATTGTGACAAAATAAACTTATTCCGTGGTGTCTTTGCGTTTCTTTTATA TGTTGCCACCTTTATGTATGTATTTTCTACGTTTGCTAACATACTGCGTAATAAGGAGTCTTAA TCATGCCAGTTCTTTTGGCTAGCGCCGCCCTATACCTTGTCTGCCTCCCCGCGTTGCGTCGCGG TGCATGGAGCCGGGCCACCTCGACCTGAATGGAAGCCGGCGGCACCTCGCTAACGGATTCACCA CTCCAAGAATTGGAGCCAATCAATTCTTGCGGAGAACTGTGAATGCGCAAACCAACCCTTGGCA GAACATATCCATCGCGTCCGCCATCTCCAGCAGCCGCACGCGGCGCATCTCGGGCAGCGTTGGG TCCTGGCCACGGGTGCGCATGATCGTGCTCCTGTCGTTGAGGACCCGGCTAGGCTGGCGGGGTT GCCTTACTGGTTAGCAGAATGAATCACCGATACGCGAGCGAACGTGAAGCGACTGCTGCTGCAA AACGTCTGCGACCTGAGCAACAACATGAATGGTCTTCGGTTTCCGTGTTTCGTAAAGTCTGGAA ACGCGGAAGTCAGCGCCCTGCACCATTATGTTCCGGATCTGCATCGCAGGATGCTGCTGGCTAC CCTGTGGAACACCTACATCTGTATTAACGAAGCGCTGGCATTGACCCTGAGTGATTTTTCTCTG GTCCCGCCGCATCCATACCGCCAGTTGTTTACCCTCACAACGTTCCAGTAACCGGGCATGTTCA TCATCAGTAACCCGTATCGTGAGCATCCTCTCTCGTTTCATCGGTATCATTACCCCCATGAACA GAAATTCCCCCTTACACGGAGGCATCAAGTGACCAAACAGGAAAAAACCGCCCTTAACATGGCC CGCTTTATCAGAAGCCAGACATTAACGCTTCTGGAGAAACTCAACGAGCTGGACGCGGATGAAC AGGCAGACATCTGTGAATCGCTTCACGACCACGCTGATGAGCTTTACCGCAGGATCCGGAAATT GTAAACGTTAATATTTTGTTAAAATTCGCGTTAAATTTTTGTTAAATCAGCTCATTTTTTAACC AATAGGCCGAAATCGGCAAAATCCCTTATAAATCAAAAGAATAGACCGAGATAGGGTTGAGTGT TGTTCCAGTTTGGAACAAGAGTCCACTATTAAAGAACGTGGACTCCAACGTCAAAGGGCGAAAA ACCGTCTATCAGGGCTATGGCCCACTACGTGAACCATCACCCTAATCAAGTTTTTTGGGGTCGA GGTGCCGTAAAGCACTAAATCGGAACCCTAAAGGGAGCCCCCGATTTAGAGCTTGACGGGGAAA GCCGGCGAACGTGGCGAGAAAGGAAGGGAAGAAAGCGAAAGGAGCGGGCGCTAGGGCGCTGGCA AGTGTAGCGGTCACGCTGCGCGTAACCACCACACCCGCCGCGCTTAATGCGCCGCTACAGGGCG CGTCCGGATCCTGCCTCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACACATGCAGCTCCC GGAGACGGTCACAGCTTGTCTGTAAGCGGATGCCGGGAGCAGACAAGCCCGTCAGGGCGCGTCA

104

GCGGGTGTTGGCGGGTGTCGGGGCGCAGCCATGACCCAGTCACGTAGCGATAGCGGAGTGTATA CTGGCTTAACTATGCGGCATCAGAGCAGATTGTACTGAGAGTGCACCATATGCGGTGTGAAATA CCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGCGCTCTTCCGCTTCCTCGCTCACTGACT CGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTT ATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGG AACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACA AAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCC CCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCC TTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGT AGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTT ATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCC ACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGC CTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTT CGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTT GTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTA CGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAA AAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATAT GAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTC TATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTT ACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCA GCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCA TCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAA CGTTGTTGCCATTGCTGCAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGC TCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCT CCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGC AGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTAC TCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAACAC GGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGG GCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCC AACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAA ATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCA ATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAG AAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTCTAAGAAA CCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCACGAGGCCCTTTCGTCTTCAA scFv 1.10 translation: atgaaaaagaatatcgcatttcttcttgcatctatgttcgttttttctattgctacaaat M K K N I A F L L A S M F V F S I A T N gcctatgcatccgattacaaagatgacgatgacaaaggcggtggcgatatccagatgacc A Y A S D Y K D D D D K G G G D I Q M T cagtccccgagctccctgtccgcctctgtgggcgatagggtcaccatcacctgccgtgcc Q S P S S L S A S V G D R V T I T C R A agtcagtccgtgtccagcgctgtagcctggtatcaacagaaaccaggaaaagctccgaag S Q S V S S A V A W Y Q Q K P G K A P K cttctgatttactcggcatccagcctctactctggagtcccttctcgcttctctggtagc L L I Y S A S S L Y S G V P S R F S G S cgttccgggacggatttcactctgaccatcagcagtctgcagccggaagacttcgcaact R S G T D F T L T I S S L Q P E D F A T

105 tattactgtcagcaatcttcttattctctgatcacgttcggacagggtaccaaggtggag Y Y C Q Q S S Y S L I T F G Q G T K V E atcaaaggtactactgccgctagtggtagtagtggtggcagtagcagtggtgccgaggtt I K G T T A A S G S S G G S S S G A E V cagctggtggagtctggcggtggcctggtgcagccagggggctcactccgtttgtcctgt Q L V E S G G G L V Q P G G S L R L S C gcagcttctggcttcaacttttcttcttcttctatacactgggtgcgtcaggccccgggt A A S G F N F S S S S I H W V R Q A P G aagggcctggaatgggttgcatctatttcttcttcttatggctatacttattatgccgat K G L E W V A S I S S S Y G Y T Y Y A D agcgtcaagggccgtttcactataagcgcagacacatccaaaaacacagcctacctacaa S V K G R F T I S A D T S K N T A Y L Q atgaacagcttaagagctgaggacactgccgtctattattgtgctcgcactgttcgtgga M N S L R A E D T A V Y Y C A R T V R G tccaaaaaaccgtacttctctggttgggctatggactactggggtcaaggaaccctggtc S K K P Y F S G W A M D Y W G Q G T L V accgtctcctcggccgacaaaactcacacatgcggccggccctctggttccggtgatttt T V S S A D K T H T C G R P S G S G D F Gattatgaaaagatggcaaacgctaataagggggctatgacc… D Y E K M A N A N K G A M T …

Features Region

LacIq promoter 2152

LacIq 871169

Ptac promoter 14121439

Secretion signal (E.coli enterotoxin ST2) 15341602

Anti-MBP scFv 15342415

Truncated p3 24162880

Base1206-2066 of pBR322 starting at NheI site 29013763

F1 origin 37644235

Base2067-4363 of pBR322 42366526

AmpR 54676328

106

APPENDIX B:

The ImMunoGeneTics (IMGT) Numbering System

The IMGT numbering system was originally created by Dr. Marie-Paule Lefranc in 1989 and is a freely accessible sequence database online at http://imgt.cines.fr/ (current as of February 11, 2011). The IMGT numbering system differs from the older Kabat method and is based on aligments of over 5000 sequences to generate specific rules for both framework and CDR residues[38]. The IMGT numbering system can be easily used for any immunoglobulin domain, any immunoglobulin chain and for a large number of species.

In general, the numbering of the variable domain is divided into seven streches and relies on key landmark residues (Table B-1). Since the numbering system is based on alignments of thousands of sequences, not all positions have a corresponding residue for a particular V-domain sequence.

Table B-1: Numbering of immunoglobulin variable domain residues

Region* Positions Key Residues (positions)

FR1 1-26 1st Cysteine (always 23)

CDR1 27-38 -

FR2 39-55 Conserved Tryptophan (always 41)

CDR2 56-65 -

FR3 66-104 Hydrophobic amino acid (89)

2nd Cysteine (always 104)

CDR3 105-117 -

FR4 118-129 Phenylalanine or Tryptophan (always 118)

*FR = Framework, CDR = complementarity determining region

The numbering of CDRs depends entirely on their length and the rules are provided at the following IMGT URL (I have included the tables from the site for completeness): http://imgt.cines.fr/textes/IMGTScientificChart/Numbering/IMGTIGVLsuperfamily.html

107

Table B-2:CDR1 numbering. Table B-3: CDR2 numbering.

Table B-4: CDR3 numbering for lengths of up to 13.

Table B-5: CDR3 numbering for lengths greater than 13.

108

Numbering of the anti-MBP template

Based on the IMGT rules, I have included the numbering of the anti-MBP template (up to the first residue of FR4) for future reference. The CDRs are colored in Red (CDR1), Yellow(CDR2) and Blue(CDR3).

Anti-MBP VL: gatatccagatgacccagtccccgagctccctgtccgcctctgtgggcgatagggtcacc D I Q M T Q S P S S L S A S V G D R V T 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 atcacctgccgtgccagtcagtccgtgtccagcgctgtagcctggtatcaacagaaacca I T C R A S Q S V S S A V A W Y Q Q K P 21 22 23 24 25 26 27 28 29 36 37 38 39 40 41 42 43 44 45 46 ggaaaagctccgaagcttctgatttactcggcatccagcctctactctggagtcccttct G K A P K L L I Y S A S S L Y S G V P S 47 48 49 50 51 52 53 54 55 56 57 65 66 67 68 69 70 71 72 74 cgcttctctggtagccgttccgggacggatttcactctgaccatcagcagtctgcagccg R F S G S R S G T D F T L T I S S L Q P 75 76 77 78 79 80 83 84 85 86 87 88 89 90 91 92 93 94 95 96 gaagacttcgcaacttattactgtcagcaatcttcttattctctgatcacgttcggacag E D F A T Y Y C Q Q S S Y S L I T F G Q 97 98 99 100 101 102 103 104 105 106 107 108 109 114 115 116 117 118

Anti-MBP VH: gaggttcagctggtggagtctggcggtggcctggtgcagccagggggctcactccgtttg E V Q L V E S G G G L V Q P G G S L R L 1 2 3 4 5 6 7 8 9 11 12 13 14 15 16 17 18 19 20 21 tcctgtgcagcttctggcttcaacttttcttcttcttctatacactgggtgcgtcaggcc S C A A S G F N F S S S S I H W V R Q A 22 23 24 25 26 27 28 29 30 35 36 37 38 39 40 41 42 43 44 45 ccgggtaagggcctggaatgggttgcatctatttcttcttcttatggctatacttattat P G K G L E W V A S I S S S Y G Y T Y Y 46 47 48 49 50 51 52 53 54 55 56 57 58 59 62 63 64 65 66 67 gccgatagcgtcaagggccgtttcactataagcgcagacacatccaaaaacacagcctac A D S V K G R F T I S A D T S K N T A Y 68 69 70 71 72 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 ctacaaatgaacagcttaagagctgaggacactgccgtctattattgtgctcgcactgtt L Q M N S L R A E D T A V Y Y C A R T V 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 cgtggatccaaaaaaccgtacttctctggttgggctatggactactggggtcaaggaacc R G S K K P Y F S G W A M D Y W G Q G T 109 110 111 111.1 111.2 111.3 112.3 112.2 112.1 112 113 114 115 116 117 118

109

IMGT alignment URLs (as of February 11, 2011):

All human VH alleles: http://imgt.cines.fr/textes/IMGTrepertoire/Proteins/protein/human/IGH/IGHV/Hu_IGHVallgene s.html

All human CH alleles: http://imgt.cines.fr/textes/IMGTrepertoire/Proteins/protein/human/IGH/IGHC/Hu_IGHCallgenes .html

All human kappa chain VL alleles: http://imgt.cines.fr/textes/IMGTrepertoire/Proteins/protein/human/IGK/IGKV/Hu_IGKVallgene s.html

All human kappa chain CL alleles: http://imgt.cines.fr/textes/IMGTrepertoire/Proteins/protein/human/IGK/IGKC/Hu_IGKCallgenes .html

110

APPENDIX C: OLIGONUCLEOTIDE TABLES

Table C-1: Oligonucleotides for sequencing and modifying clones from the Library F work

Oligo Description Oligonucleotide DNA Sequence (5’3’) ID

HP19 Forward primer for sequencing VL from TGTAAAACGACGGCCAGTCTGTCATAAAGTTGTCACG Library F vector G

HP20 Reverse primer for sequencing VL from CAGGAAACAGCTATGACCCCTTGGTACCCTGTCCG Library F vector

HP21 Forward primer for sequencing VH from TGTAAAACGACGGCCAGTGGACGCATCGTGGCCCTA Library F vector

HP22 Reverse primer for sequencing VH from CAGGAAACAGCTATGACCCCTTGGTGGAGGCCGAG Library F vector tgtgacaaaactcacacaggtggctctcatcatcacc HP18, Introduces a 6xHis-Amber STOP tag to atcaccactagggcggtggctctggttccggtgattt HP18- the C-terminal end of any Fab t 2

Table C-2: Oligonucleotides for the construction and sequencing of Library G

Oligo Description Oligonucleotide DNA Sequence (5’3’) ID

NE049 Removal of CH1 from Library F template ACCGTCTCCTCGGCCGACAAAACTCACACA

Introduce EcoRI site 5’ of f1 origin in ATAATGGTTTCTTAGGAATTCGTGCTCGTCAAAGCA NE050 pCW-MBP vectors

Introduce EcoRI site 3’ of f1 origin in TAACGTTTACAATCAGAATTCGGTGGCACTTTTCGG NE051 pCW-MBP vectors

Introduce EcoRI site 5’ of f1 origin in CCGAAAAGTGCCACCGAATTCTGATTGTAAACGTTA pCW-MBP vectors (anneals to NE052 complementary strand)

Introduce EcoRI site 3’ of f1 origin in TGCTTTGACGAGCACGAATTCCTAAGAAACCATTAT pCW-MBP vectors (anneals to NE053 complementary strand)

Replace p8-STOP vector secretion CAAGGACCATAGATTCCATGGGATCAGGATCTAGATC signal and geneVIII with NcoI and XbaI TGGTTCCGGTGAT NE054 cloning sites

Replace p8-STOP vector geneVIII with ACAAATGCCTATGCATCCATGGGATCAGGATCTAGAT NE055 NcoI and XbaI cloning sites CTGGTTCCGGTGAT

Cloning pCW-MBP-1.10 Fab (Forward GGCCCATGGGATCCGATATCCAGATGACCC NE056 Primer)

111

Cloning pCW-MBP-1.10/6.31 Fabs GGCTCTAGACTATGTGTGAGTTTTGTCACAAG NE057 (Reverse Primer)

Cloning pCW-MBP-6.31 Fab (Forward GGCCCATGGGAATGAAATACCTGCTGCCGA Primer) NE058

Sequencing 1.10/6.31 VLs in p8-STOP GTAAAACGACGGCCAGTTCATCGGCTCGTATAATGTG NE059 vector (Forward Primer)

Sequencing 1.10/6.31 VLs in p8-STOP CAGGAAACAGCTATGACGTACTTTGGCCTCTCTGGG NE060 vector (Reverse Primer)

Sequencing 1.10/6.31 CLs in p8-STOP GTAAAACGACGGCCAGTGACGGATTTCACTCTGACC NE061 vector (Forward Primer)

Sequencing 6.31 CL in p8-STOP vector CAGGAAACAGCTATGACAGACTCCACCAGCTGAACC NE062 (Reverse Primer)

Sequencing 1.10 CL in p8-STOP vector CAGGAAACAGCTATGACCCTCAACCTCTAGTTACCC NE063 (Reverse Primer)

Sequencing the spacer between the GTAAAACGACGGCCAGTCTGAGCAAAGCAGACTACG 1.10/6.31 Light and Heavy Chains NE064 (Forward Primer)

Sequencing 1.10 VH in p8-STOP vector GTAAAACGACGGCCAGTACTCGAGGCTGAGCAAAGC NE065 (Forward Primer)

Sequencing 6.31 VH in p8-STOP vector GTAAAACGACGGCCAGTCTGAGCAAAGCAGACTACG NE066 (Forward Primer)

Sequencing 1.10/6.31 VHs in p8-STOP CAGGAAACAGCTATGACGGGAAGTAGTCCTTGACCA NE067 vector (Reverse Primer)

Sequencing 1.10/6.31 CH1s in p8- GTAAAACGACGGCCAGTTAAGAGCTGAGGACACTGC NE068 STOP vector (Forward Primer)

Sequencing 1.10/6.31 CH1s in p8- CAGGAAACAGCTATGACGCGACAGAATCAAGTTTGCC NE069 STOP vector (Reverse Primer)

Replaces cloning site between secretion AATGCCTATGCATCCGATATCCAGATGACC NE070 signal and VL for 1.10 Fab with a serine

Removes NcoI site from p8-STOP with CAAGGACCATAGATTATGAAATACCTGCTG NE071 6.31 Fab/scFv constructs

Removes Amber STOP from 1.10/6.31 GACAAAACTCACACATCTAGATCTGGTTCC NE072 Fab/scFv constructs in p8-STOP

Removes Amber STOP and introduces GACAAAACTCACACATGCGGCCGGCCCTCTAGATCTG dimerization domain in 1.10/6.31 GTTCC NE073 Fab/scFv constructs in p8-STOP

112

Introduces dimerization domain and GACAAAACTCACACATGCGGCCGGCCCTAGTCTAGAT NE074 Amber STOP into p8-STOP constructs CTGGTTCC

Replace p8-STOP vector secretion CAAGGACCATAGATTCCATGGGATCAGGATCTAGAAG signal and geneVIII with NcoI and XbaI TGGTTCCGGTGATTT NE075 cloning sites

Replace p8-STOP vector geneVIII with ACAAATGCCTATGCATCCATGGGATCAGGATCTAGAA NE076 NcoI and XbaI cloning sites GTGGTTCCGGTGATTT

Replace p8-STOP vector secretion CAAGGACCATAGATTCCATGGGAAGCGGGTCTAGAAG signal and geneVIII with NcoI and XbaI TGGTTCCGGTGATTT NE077 cloning sites

Replace p8-STOP vector secretion CAAGGACCATAGATTCCATGGGAAGCGGCTCTAGAAG signal and geneVIII with NcoI and XbaI TGGTTCCGGTGATTT NE078 cloning sites

Replace p8-STOP vector secretion CAAGGACCATAGATTCCATGGGAAGCGGTTCTAGAAG signal and geneVIII with NcoI and XbaI TGGTTCCGGTGATTT NE079 cloning sites

Replace p8-STOP vector geneVIII with ACAAATGCCTATGCATCCATGGGAAGCGGGTCTAGAA NE080 NcoI and XbaI cloning sites GTGGTTCCGGTGATTT

Replace p8-STOP vector geneVIII with ACAAATGCCTATGCATCCATGGGAAGCGGCTCTAGAA NE081 NcoI and XbaI cloning sites GTGGTTCCGGTGATTT

Replace p8-STOP vector geneVIII with ACAAATGCCTATGCATCCATGGGAAGCGGTTCTAGAA NE082 NcoI and XbaI cloning sites GTGGTTCCGGTGATTT

Adds FLAG to C-terminus of 1.10 CL AACAGGGGAGAGTGTGGTGGTTCTGATTACAAAGATG NE083 ACGATGACAAATAATTAACTCGAGGC

Adds FLAG to C-terminus of 6.31 CL AACAGGGGAGAGTGTGGTGGTTCTGATTACAAAGATG NE084 ACGATGACAAATAAGGATCCATCGAT

Removes XbaI at end of 1.10/6.31 GACAAAACTCACACATAGTCTGGTTCCGGTGATTTT NE085 constructs

Removes Amber STOP and XbaI at the GACAAAACTCACACATCTGGTTCCGGTGATTTT NE086 end of 1.10/6.31 constructs

Replaces Amber STOP and XbaI of GACAAAACTCACACATGCGGCCGGCCCTCTGGTTCCG 1.10/6.31 constructs with dimerization GTGATTTT NE087 domain

Removes XbaI and adds dimerization GACAAAACTCACACATGCGGCCGGCCCTAGTCTGGTT NE088 domain at end of 1.10/6.31 constructs CCGGTGATTTT

Changes Alanine back to Valine in 1.10 CGTGCCAGTCAGTCCGTGTCCAGCGCTGTAGCC NE089 VL CDR1 (SASSASVSSA)

Introduce N-terminal FLAG to1.10 scFv AATGCCTATGCATCCGATTACAAAGATGACGATGACA NE090 AAGGCGGTGGCGATATCCAGATGACC

113

Introduce N-terminal FLAG to 6.31 scFv CCGGCGATGGCCTCCGATTACAAAGATGACGATGACA NE091 AAGGCGGTGGCGATATCCAGATGACC

Introduces unmethylated XbaI site into ACTCACACATCTAGAAGTGGTTCCGGTGATTT NE092 1.10/6.31 scFv constructs

Sequencing Library G scFv clones GTAAAACGACGGCCAGTACACAGGAAACAGCCAGTC instead of NE059 (Forward Primer) – anneals 46nt upstream of VL STII NE103 secretion signal

Sequencing Library G scFv clones GTAAAACGACGGCCAGTGATATCCAGATGACCCAGTC instead of NE059 (Forward Primer) – NE104 anneals to N-terminus of VL ACCAAGGTGGAGATCAAAGGTACTACTGCCGCTAGTG Replaces CL and spacer region GTAGTAGTGGTGGCAGTAGCAGTGGTGCCGAGGTTCA upstream of VH with C3 linker for scFv GCTGGTGGAG

HP93

*NE054-055 did not work because a GATC methylation site is present at the XbaI restriction site. Oligos NE075-076 were designed to rectify this issue but a second methylation site was present. Consequently, Oligos NE077-082 were designed to remove the methylation site by using different codon combinations for the G-S-G linker between restriction sites.

Table C-3: Oligonucleotides for the construction and sequencing of chimeric IgGs against RasGAP and Crk#1 SH3 domains

Oligo Description Oligonucleotide DNA Sequence (5’3’) ID

NE060 Sequencing of IgG VL(Reverse Primer) CAGGAAACAGCTATGACGTACTTTGGCCTCTCTGGG

NE061 Sequencing IgG CL (Forward Primer) GTAAAACGACGGCCAGTGACGGATTTCACTCTGACC

NE062 Sequencing IgG CL (Reverse Primer) CAGGAAACAGCTATGACAGACTCCACCAGCTGAACC

NE065 Sequencing IgG VH (Forward Primer) GTAAAACGACGGCCAGTACTCGAGGCTGAGCAAAGC

NE067 Sequencing IgG VH (Reverse Primer) CAGGAAACAGCTATGACGGGAAGTAGTCCTTGACCA

NE068 Sequencing IgG CH1 (Forward Primer) GTAAAACGACGGCCAGTTAAGAGCTGAGGACACTGC

Replaces gene III with a STOP codon and GAGCCCAAATCTTGTTGAGAATTCGGAAGTGGAAGTGGAAG NE096 EcoRI/NcoI multiple cloning site TGGAAGTCCATGGAGCTCCAATTCGCCC

Amplification of murine IgG1 Fc for GGCGGCGAATTCCAGGGATTGTGGTTGTAAGC NE097 cloning (Forward Primer)

114

Amplification of murine IgG1 Fc for GGCGGCCCATGGGGGATCATTTACCAGGAGAG NE098 cloning (Reverse Primer)

Removal of STOP codon, EcoRI site and GAGCCCAAATCTTGTGGTTGTAAGCCTTGC Glycine/Serine filler between CH1 and NE099 cloned murine IgG1 Fc

Removal of downstream NcoI site from CACTCTCCTGGTAAAGGTGGCTCTCATCATCACCATCACCA cloned murine IgG1 Fc and introduction of CTGAAGCTCCAATTCGCCC NE100 C-terminal 6xHis Tag

Anneals to middle of murine IgG1 Fc for CAGGAAACAGCTATGACCGAAGTAAGAGCCATCTGTG sequencing of N-terminal half of Fc (Reverse Primer) - Can also be used to sequence CH1 as the reverse primer to NE101 NE068

Anneals to middle of murine IgG1 Fc for GTAAAACGACGGCCAGTAGGTGCACACAGCTCAGA sequencing of C-terminal half of Fc NE102 (Forward Primer)

Forward primer to clone IgGs from PhoA GGCGGCCCATGGCCTCCGATATCCAGATGACCCA vector to SGC IPTG-inducible vector NE111 (introduces N-terminal NcoI site)

Reverse primer to clone IgGs from PhoA GGCGGCAAGCTTTTATTAGTGGTGATGGTGATGATGAG vector to SGC IPTG-inducible vector NE112 (introduces C-terminal HindIII site)

Replaces HindIII site within IgGs with CCAGGAAAAGCTCCGAAACTCCTGATTTACTCGGCA different nucleotides that code for the same residues so that IgG DNA is not NE113 cleaved during cloning

Forward primer for sequencing IgGs GTAAAACGACGGCCAGTcacaggaaacaggatcagc NE114 ligated in the new SGC vector

Reverse primer for sequencing IgGs CAGGAAACAGCTATGACgacgagcacctaagaaacc NE115 ligated in the new SGC vector

Sequencing of scFv VL (Forward Primer) TGTAAAACGACGGCCAGTCTGTCATAAAGTTGTCACGG – anneals to upstream region in Library F HP19 vector HP153

Sequencing of N-terminal half of murine TGTAAAACGACGGCCAGTAGCTTGGGCACCCAGACC Fc (Forward Primer) - anneals to CH1 HP23 upstream of Fc

Sequencing of C-terminal half of murine CAGGAAACAGCTATGACCCCCAGTCACGACGTTGTA Fc (Reverse Primer) – anneals to downstream region in Library F vector HP24 HP153