Journal of Bioscience and Bioengineering VOL. 127 No. 1, 30e37, 2019 www.elsevier.com/locate/jbiosc Development of GFP-based high-throughput screening system for directed evolution of glucose oxidase Gordana Kovacevic,1,2,* Raluca Ostafe,3 Ana Marija Balaz,4 Rainer Fischer,3 and Radivoje Prodanovic1 Faculty of Chemistry, University of Belgrade, Studentski Trg 12-16, 11000 Belgrade, Serbia,1 Innovation center of the Faculty of Chemistry, University of Belgrade, Studentski Trg 12-16, 11000 Belgrade, Serbia,2 Institute of Molecular Biotechnology, RWTH Aachen University, Worringerweg 1, 52074 Aachen, Germany,3 and Institute of Chemistry, Technology and Metallurgy, University of Belgrade, Njegoseva 12, 11000 Belgrade, Serbia4 Received 7 April 2018; accepted 1 July 2018 Available online 20 July 2018 Glucose oxidase (GOx) mutants with higher activity or stability have important role in industry and in the develop- ment of biosensors and biofuel cells. Discovering these mutants can be time-consuming if appropriate high-throughput screening (HTS) systems are not available. GOx gene libraries were successfully screened and sorted using a HTS system based on GOx activity dependent fluorescent labeling of yeast cells with tyramids and quantification of the amount of expressed enzyme by yeast enhanced green fluorescent protein (yGFP) tagging and flow cytometry. For this purpose, we expressed wild type and a mutant GOx as a chimera with the yGFP to confirm differences in catalytic activity between wild-type and mutant GOx. Fluorescence of yGFP is preserved during expression of chimera, and also after the oxidative enzymatic reaction. We have obtained a 2.5-fold enrichment in population of cells expressing active enzyme, and percentage of enzyme variants with enzymatic mean activity higher than wild type activity was increased to 44% after a single round of GOx gene library sorting. We have found two mutants with 1.3 and 2.3-fold increase in Vmax values compared to the wtGOx. By simultaneous detection of protein expression level and enzyme activity we have increased the likelihood of finding GOx variants with increased activity in a single round of flow cytometry sorting. Ó 2018, The Society for Biotechnology, Japan. All rights reserved. [Keywords: Glucose oxidase; Yeast surface display; High-throughput screening; Yeast enhanced green-fluorescent protein; Directed evolution] Glucose oxidase (GOx, b-D-glucose:oxygen 1-oxidoreductase, EC place in microdroplets that are then sorted according to their 1.1.3.4) is industrially important enzyme, used in food preservation, fluorescence intensity by fluorescent activated cell sorting (FACS) textile bleaching, and as an analytical reagent for glucose level (14e16). Most important aspect of directed evolution is to maintain determination (1). Recent developments led to the construction of connection between genotype and phenotype of the target enzyme GOx based logical gates (2), amperometric biosensors and biofuel in order to isolate the desired mutant. In previous work for GOx cells (3e5). GOx is a glycoprotein, consisting of two identical sub- library screening this connection is obtained through covalent units and each subunit has non-covalently bound FAD co-factor. staining of cells with enzymatic activity with fluorescein-tyramide The enzyme catalyzes the oxidation of b-D-glucose to D-glucono- that binds to tyrosine residues of cell-surface proteins (17). With lactone, using molecular oxygen as electron acceptor and producing this method it is possible to quantitatively determine cells with hydrogen-peroxide (1,6). higher activity enzyme variant, but fluorescence intensity also de- Making enzyme more fit for industrial applications is a great pends of the amount of expressed enzyme on cell surface, which challenge, and the knowledge about structureefunction relation is can lead to false selection. Further development in high- an advantage. However, sometimes the structure of the enzyme is throughput screening of GOx libraries has been the introduction not available or the property we want to alter is not easily corre- of yeast surface display of GOx and a substrate delivery system, lated to the known structure. In those instances directed evolution using b-D-octyl-glucoside and b-glucosidase for precise control of through random mutagenesis is a tool that enhances probability of the start of the reaction as well as glucose concentration. In this finding novel variant with desired property or variant with several work another novelty was normalization of fluorescence intensity improved ones. For enzymes most important property is its activity using fluorescent antibodies for c-myc epitope for quantification of and there are many reported enzymes with improved activity, the expressed protein on the cell surface (9). Even though antibody obtained through directed evolution and high-throughput binding is highly specific, labeling of cells can be time consuming as screening methods (7e13). well as inconsistent (18). A breakthrough in the screening process has been the in vitro Green fluorescent protein (GFP) is a 27 kDa monomer first time compartmentalization (IVC) where fluorescent enzyme assay takes isolated form jellyfish Aequorea victoria (19,20), with the tendency to form dimers at the high concentrations (21). The GFP chromo- phore is a result of autocatalytic cyclization and air-mediated * Corresponding author at: Faculty of Chemistry, University of Belgrade, Stu- dentski trg 12-16, 11000 Belgrade, Serbia. Tel.: þ381113336669. oxidation (20), and recently it has been shown that chromophore E-mail address: [email protected] (G. Kovacevic). formation affects biological pathways associated with oxidative 1389-1723/$ e see front matter Ó 2018, The Society for Biotechnology, Japan. All rights reserved. https://doi.org/10.1016/j.jbiosc.2018.07.002 VOL. 127, 2019 HIGH-THROUGHPUT SCREENING OF GLUCOSE OXIDASE 31 stress (22). Wild-type GFP absorbs light at two wavelengths, restriction site) before start codon of the yGFP. The yGFP gene was inserted in 395 nm (excitation maximum) and 475 nm, which can be explained pCTCON2 vector (provided by Dane Wittrup, Massachusetts Institute of Technology; Addgene reference no. 41843) between BamHI and XhoI restriction by existence of the two GFP chromophore forms, neutral and sites, leading to excision of c-myc epitope from the vector. anionic (23). In order to expand application of GFP in research, Glucose oxidase library First, we inserted wild-type GOx (wtGOx; accession Cormack and co-workers found a GFP mutant (S65T, F64L, known no. P13006) gene from wtGOx-pCTCON2 plasmid (45) in yGFP-pCTCON2 vector as EGFP) with shifted excitation maximum to 488 nm (24), which is using sense (ATCGCTAGCAGCAATGGCATTGAAGC) and antisense (ATCGGATCC one of the most common wavelengths used for FACS. TCCCTGCATGGAAGC) primers with NheIandBamHI restriction enzymes. With the Because of its small size, GFP is easily expressed as fusion pro- same primers we created GOx library using GeneMorph II Random Mutagensis Kit (Agilent Technologies, Santa Clara, CA, USA) and E. coli XL10Gold competent cells. tein at either N- or C-terminus, making it widely used in PCR mix contained 45 ng/mL of template (wtGOx-yGFP-pCTCON2, for low mutation biochemical and biological research (19,25). When working with frequency, 2 to 5 nucleotide mutations per gene), 2.5 ng/mLofeachprimer,andthe fusion proteins it is important for both entities to retain their rest of the components from the kit. The reaction was heated to 95Cfor2min, functions as well as proper folding. As it was shown in the work of followed by 30 cycles of 95 C for 30 s, 60 C for 30 s, 72 Cfor2min,followedby final extension at 72C for 10 min. Reaction products were digested with DpnI Wu and co-workers, they have correlated activity of the organo- enzyme for 2 h at 37 C. Purified PCR products were digested with BamHI and NheI fl phosphorus hydrolase with the GFP uorescence expressed in restriction enzymes and used as megaprimers for PCR with Phusion High-Fidelity Escherichia coli culture; even though the activity of the enzyme was polymerase (New England Biolabs, Ipswich, MA, USA). Megaprimer PCR mix reduced while fused to the GFP, it was recoverable after separation contained 450 ng of megaprimers, 50 ng of template (wtGOx-yGFP-pCTCON2), 3% of the GFP with enterokinase (19). Using split-GFP technology, DMSO and other components from the kit. Reaction was heated to 98 C for 1 min, followed by 25 cycles of 98C for 30 s, 60Cfor1min,72Cfor4min,followedby normalization of the protein expression level was employed in the final extension at 72C for 10 min. The reaction products were digested with DpnI microtiter-plate screening of small transaminase library (approxi- enzyme for 2 h at 37C and transformed to ultracompetent E. coli XL10Gold. Plasmid mately 600 clones) expressed in E. coli, in which they identified the DNA was isolated using MachereyeNagel Plasmid DNA kit (MachereyeNagel, Düren, variant with improved activity and variant with improved expres- Germany). sion level (26). Along with the use as a fusion protein marker, GFP Transformation of S. cerevisiae EBY100 cells Plasmid DNA was introduced into S. cerevisiae EBY 100 cells (provided by Dane Wittrup, Massachusetts Institute of can also be employed as an indicator of successful cloning, with Technology) as described previously (46), using a 42C heat-shock step for 1 h. Cells fl either non-recombinants that emit uorescence (27) or recombi- were grown in YNB-CAA (yeast nitrogen baseecasaminoacid) glucose medium (2% nants that do (28). (w/v) glucose) for 48 h at 27C, 160 rpm, then induced to express GOx-yGFP Using different yeast signal peptides, both GFP and EGFP have construct by transferring to YNB-CAA galactose (2% (w/v) galactose) medium fi w shown low secretion levels in yeast cells (29,30). With codon ( nal OD600 1 in galactose medium) under the same conditions for 18 h. optimization and introduction of new mutations (S65G, S72A) Flow cytometry analysis Cells expressing GOx-yGFP construct were washed three times with PBS (phosphate buffered saline) and adjusted to concentration of 2 yeast-enhanced GFP (yGFP) has been developed and used as an x108 cells/mL.