Consequences of Sequence Variants for the Expression of a Dual Targeting Novel Format Antibody Construct

Consequences of sequence variants for the expression of a dual targeting novel format antibody construct

A Thesis Submitted to The University of Manchester

for the Degree of Doctor of Philosophy

2014

Claire Gaffney CONTENTS

CONTENTS ...... 2 LIST OF FIGURES ...... 7 LIST OF TABLES ...... 10 ABSTRACT ...... 12 DECLARATION ...... 13 COPYRIGHT STATEMENT ...... 13 ACKNOWLEDGEMENTS ...... 14 DEDICATION ...... 14 ABBREVIATIONS ...... 15 CHAPTER 1: INTRODUCTION ...... 19 1.1 Introduction to biopharmaceuticals ...... 20 1.2 Antibodies as therapeutics ...... 23 1.2.1 Natural antibody structure ...... 23 1.2.2 Chimeric, humanized and fully human antibodies ...... 27 1.2.3 Novel format antibodies ...... 28 1.3 Technologies in novel format antibody generation ...... 32 1.3.1 Phage display ...... 33 1.3.2 Construction of a phage library ...... 37 1.3.3 Selection and amplification of phage against a desired antigen ...... 38 1.4 Expression systems for the production of natural and engineered antibodies ...... 41 1.4.1 HEK cells as expression hosts ...... 44 1.4.2 CHO cells as expression hosts ...... 45 1.4.2.1 Selection and amplification systems in CHO cells ...... 47 1.4.3 Cell-free protein expression ...... 49 1.5 Molecular events that affect recombinant antibody expression in mammalian cells ...... 52 1.5.1 Gene integration and transcriptional silencing ...... 54 1.5.2 Post-transcriptional processing, localization and stability of mRNA ...... 56 1.5.3 Translation and translocation to the ER ...... 58 1.5.4 Protein folding and post-translational modifications ...... 61 1.5.5 The unfolded protein response ...... 63

2 1.5.6 Protein degradation pathways ...... 65 1.5.7 Secretion ...... 67 1.5.8 Amino acid variations in antibody domains affect mAb expression ...... 68 1.6 Project summary and aims and objectives ...... 71 CHAPTER 2: MATERIALS AND METHODS ...... 75 2.1 Materials and equipment ...... 76 2.1.1 Sources of chemicals, reagents and equipment ...... 76 2.1.2 Preparation of Solutions ...... 76 2.2 Generation of novel-format antibodies ...... 77 2.2.1 Phage libraries used for the selection of anti-hen egg white lysozyme (HEWL) domain antibodies (dAbs) ...... 77 2.2.2 Passive Phage Selection ...... 78 2.2.3 Soluble phage selection ...... 79 2.2.3.1 Biotinylation of Hen Egg White Lysozyme (HEWL) for soluble selection ...... 79 2.2.3.2 Buffer exchange of biotinylated HEWL ...... 80 2.2.3.3 Soluble phage selection of anti-HEWL dAbs using biotinylated HEWL ...... 82 2.2.4 Determination of eluted phage titre ...... 83 2.2.5 Amplification of eluted phage in TG1 E.coli ...... 83 2.2.6 Precipitation of amplified eluted phage ...... 84 2.2.7 Overnight deep-well culture of selected phage-infected TG1 E.coli ...... 85 2.2.8 Determination of binding specificity of selected phage by ELISA ...... 85 2.2.9 Determination of selected phage diversity ...... 86 2.2.9.1 Colony PCR of phage-infected TG1 bacteria ...... 86 2.2.9.2 DNA purification of phage DNA from colony PCR ...... 87 2.2.10 Extraction of phage DNA from selected phage amplified in TG1 E.coli ...... 87 2.3 Generation and purification of plasmids...... 88 2.3.1 Preparation of competent DH5α E.coli ...... 88 2.3.2 Bacterial growth medium and agar selection plates ...... 88 2.3.3 Transformation of DH5α competent E.coli cells ...... 89 2.3.4 DNA preparation from bacterial and phage culture ...... 89 2.3.5 Generation of glycerol stocks ...... 89 2.3.6 Determination of DNA concentration and purity ...... 90 2.3.7 Restriction enzyme digests of plasmid DNA ...... 90 2.3.8 Agarose gel electrophoresis ...... 92

3 2.3.9 Gel purification of DNA bands from 1 [w/v] % agarose ...... 92 2.3.10 DNA ligations for plasmid generation ...... 93 2.3.11 Generation of pTT5 heavy chain novel-format antibody vectors ...... 93 2.3.12 Synthesis and cloning of CDR3 swapped dAb sequences ...... 94 2.3.13 Preparation of plasmid DNA for stable transfection ...... 94 2.3.14 DNA sequence analysis...... 95 2.3.14.1 DNA sequencing in 96-well PCR plates...... 95 2.3.14.2 DNA sequencing in 1.5ml microcentrifuge tubes ...... 96 2.4 Mammalian cell culture ...... 97 2.4.1 General cell culture techniques...... 97 2.4.1.1 Determination of cell density and viability ...... 97 2.4.1.2 Cryopreservation of cells ...... 97 2.4.1.3 Revival of cells from liquid nitrogen ...... 98 2.4.1.4 Intracellular protein extraction ...... 98 2.4.1.5 Sampling of cell culture medium ...... 98 2.4.2 HEK cell lines ...... 99 2.4.2.1 HEK2936E suspension cell maintenance ...... 99 2.4.2.2 HEK2936E suspension cell transient transfection ...... 99 2.4.2.3 Adherent HEK293 transient transfection ...... 100 2.4.3 CHO DG44 cell lines ...... 101 2.4.3.1 Adaption of CHO DG44 suspension cells to commercial media ...... 101 2.4.3.2 CHO DG44 suspension cell maintenance ...... 103 2.4.3.3 CHO DG44 stable transfection ...... 103 2.4.3.4 Batch culture of transfected polyclonal CHO DG44 suspension cells ...... 104 2.4.3.5 Treatment of CHO DG44 cells with sodium butyrate, DMSO or mild hypothermia ...... 104 2.4.3.6 Treatment of CHO DG44 cells with chemical inhibitors of protein degradation ...... 105 2.5 Protein analyses ...... 105 2.5.1 Quantification of antibody expression ...... 105 2.5.1.1 Quantification of antibody expression by Gyros ELISA ...... 106 2.5.1.2 Quantification of antibody expression by sandwich ELISA ...... 106 2.5.2 Assessment of mAbdAb functionality ...... 107 2.5.2.1 Assessment of HEWL binding by ELISA ...... 107

4 2.5.2.2 Assessment of HEWL binding by Biacore analysis ...... 108 2.5.3 Western blot analysis of protein ...... 108 2.5.3.1 SDS-PAGE ...... 108 2.5.3.2 Protein transfer ...... 109 2.5.3.3 Immunoblotting ...... 110 2.5.3.4 Stripping nitrocellulose membrane and re-probing ...... 111 2.5.3.5 Densitometric analysis of protein bands ...... 111 2.6 Analysis of mRNA ...... 111 2.6.1 RNA isolation ...... 111 2.6.2 DNAseI treatment of RNA ...... 111 2.6.3 Determining RNA quantity and purity ...... 112 2.6.4 cDNA synthesis ...... 112 2.6.5 Semi-quantitative RT-PCR of cDNA samples ...... 113 2.6.6 Densitometric analysis of mRNA bands from RT-PCR analysis ...... 113 2.7 Un-coupled in vitro translation ...... 114 2.7.1 Linearization of plasmid DNA for in vitro transcription ...... 114 2.7.2 In vitro transcription ...... 114 2.7.3 In vitro translation ...... 115 2.7.4 SDS-PAGE gel drying ...... 116 2.7.5 Autoradiography ...... 116 2.8 Computational analyses of mRNA and proteins ...... 117 2.8.1 mRNA secondary structure prediction ...... 117 2.8.2 Physicochemical property analyses...... 117 2.9 Calculations ...... 117 2.9.1 Calculation of specific productivity (Qp) ...... 117 2.9.2 Statistical Calculations ...... 118 CHAPTER 3: GENERATION OF MABDAB CONSTRUCTS USING PHAGE DISPLAY AND CLONING ...... 120 3.1 Introductory remarks ...... 121 3.2 Passive phage display selection of anti-HEWL dAbs ...... 122 3.3 Soluble phage display selection of anti-HEWL dAbs ...... 133 3.4 Generation of mAbdAb expression vectors ...... 145 3.5 Discussion ...... 153

5 CHAPTER 4: CONSEQUENCES OF SEQUENCE VARIATION ON MABDAB EXPRESSION IN MAMMALIAN EXPRESSION PLATFORMS ...... 155 4.1 Introductory remarks ...... 156 4.2 Examination of mAbdAb expression in HEK2936E cells ...... 157 4.3 Confirmation of dAb specificity ...... 161 4.4 Examination of mAbdAb expression in stable CHO pools ...... 168 4.5 Analysis of limiting stages in the expression mAbdAbs in stable CHO pools ...... 177 4.6 The role of proteolytic degradation pathways in mAbdAb expression in stable CHO pools ...... 188 4.7 Examination of mAbdAb expression in an uncoupled in vitro ...... 196 4.8 The role of the dAb CDR3 in mAbdAb expression ...... 201 4.9 Discussion ...... 208 CHAPTER 5: OPTIMIZATION STRATEGIES TO IMPROVE MABDAB EXPRESSIBILITY ...... 217 5.1 Introductory Remarks ...... 218 5.2 Effect of sodium butyrate addition on mAddAb expression in stable CHO pools ..219 5.3 Effect of mild hypothermia on mAbdAb expression in stable CHO pools...... 230 5.4 Effect of DMSO addition on mAbdAb expression in stable CHO pools ...... 238 5.5 Discussion ...... 247 CHAPTER 6: CONCLUDING REMARKS AND FUTURE PERSPECTIVES ...... 254 6.1 Introductory remarks ...... 255 6.2 Generation of a panel of mAbdAb sequence variants covering a range of expression titres ...... 256 6.3 Where is the bottleneck in mAbdAb expression in CHO cells? ...... 258 6.4 How can mAbdAb expression be improved? ...... 266 6.5 Concluding remarks ...... 269 REFERENCES ...... 271 APPENDICES ...... 289 Appendix I: Suppliers of reagents, materials and equipment ...... 289 Appendix II: Sequences identified during phage display selection ...... 295 Appendix III: Vector maps for transient, stable and in vitro expression ...... 305 Appendix V: Sensorgrams of BIAcore analysis of dAb binding to HEWL ...... 317 Appendix VI: Optimisation of RT-PCR analysis of HC, LC and B2M gene expression ...318

Word Count: 68,472

6 LIST OF FIGURES

Figure 1.1 Diagram of natural antibody IgG structure……………………………………………………………..25 Figure.1.2 Example novel antibody-based formats……………………………………………..………………….29 Figure 1.3 Diagram of filamentous phage displaying an antibody fragment as a fusion protein with the pIII coat protein……………………………………..……………………………………………..………………….34 Figure 1.4 Phage display selection process……………………………………..………………………………………39 Figure 1.5 CHO cell lineages used in biopharmaceutical production…………………………………….…46 Figure 1.7 Synthesis of glutamine is catalysed by GS……………………………………..……………………….48 Figure 1.6 Catalysis of dihydrofolate to tetrahydrofolate by DHFR………………..……………………….49 Figure 1.8 In-vitro transcription and translation reactions………………..……………………………………51 Figure 1.9 Stages of mammalian protein synthesis and limiting factors in antibody expression. ……………………………………..……………………………………………..…………………………………………………………53 Figure 1.10 Factors affecting protein translation……………………………………..…………………………....59 Figure 1.11 Signalling cascades and the unfolded protein response…………………………………….…64 Figure 1.12 Schematic diagram of a mAbdAb……………………………………..…………………………...... 72 Figure 2.1 Mass spectrometry analysis of biotinylation HEWL showing percent of species of a particular mass……………………………………..……………………………..…………………………………………………81 Figure 2.2. Adaption of DHFR-negative CHO DG44 cells to commercial media………………………102 Figure 2.3 Gel electrophoresis of in vitro transcribed mRNA………………..…………………………...... 115 Figure 3.1. Workflow diagram of passive phage selection process.…………………………………...... 123 Figure 3.2 ELISA of HEWL binding phage during passive selection.…………………………...... 129 Figure 3.3. Percentage of HEWL binding phage identified following each round of selection……………………………………..……………………………..…………………………………………………….....130 Figure 3.4 Genetic diversity of sample dAbs after each round of passive selection……………….132 Figure 3.5. Workflow diagram of soluble phage selection process………………………………………..134 Figure 3.6 ELISA of HEWL binding phage during soluble selection…………………………………………139 Figure 3.7. Percentage of HEWL binding phage identified following each round of soluble selection……………………………………..……………………………..…………………………………………………….....141 Figure 3.8. Genetic diversity of sample dAbs after each round of soluble selection………………144 Figure 3.9. Vector maps for the generation of mAbdAbs………………………………………………………147 Figure 3.10. Cloning of soluble and passive dAbs into the CEG1 pTT5 transient expression vector……………………………………..……………………………..…………………………………………………………....148 Figure 4.1 Transient HEK293 expression of unique mAbdAb sequences……………………………….158

7 Figure 4.2 HEWL specificity of unique mAbdAbs expressed in HEK293E cells……………………….162 Figure 4.3 Batch culture of CHO polyclonal cells expressing mAbdAbs…………………………………170 Figure 4.4 Expression titre and productivity of stable CHO pools…………………………………………176 Figure 4.5 Comparison of maximum yield observed for mAbdAb constructs in transient HEK and stable CHO expression……………………………………..……………………………..………………………...... 173 Figure 4.6 Semi-quantification of HC and LC mRNA by RT-PCR……………………………………………..176 Figure 4.7 Western blot analysis of intracellular and extracellular heavy and light chain protein……………………………………..……………………………..………………………...... 184 Figure 4.8 Effect of chemical inhibitors of degradation on mAbdAb expression……………………191 Figure 4.9 ELISA quantification of expression titre following treatment with chemical inhibitors of proteolytic degradation……………………………………..……………………………..………………………...... 194 Figure 4.10 In vitro translation of Alemtuzumab and a high and low expressing mAbdAb…….198 Figure 4.11 Analysis of CDR3 swapped mAbdAb constructs in HEK transient transfection……203 Figure 4.12 In vitro translation of CDR3-swapped sequences……………..………………………...... 207 Figure 5.1 Effect of Sodium butyrate addition on growth and viability in stable CHO pools….221 Figure 5.2. Effect sodium butyrate addition on heavy and light chain mRNA in stable CHO pools……………………………………..……………………………..………………………...... 224 Figure 5.3 Effect of sodium butyrate treatment on expression titre and specific productivity……………………………………..……………………………..………………………...... 226 Figure 5.4. Effect of sodium butyrate treatment on intracellular and extracellular mAbdAb expression………………………………………..……………………………..………………………...... 228 Figure 5.5 Effect of mild hypothermia on CHO cell growth and viability…...... 231 Figure 5.6 Effect of mild hypothermia on mAbdAb titre and productivity…...... 233 Figure 5.7 Effect of mild hypothermia mAbdAb protein expression…...... 236 Figure 5.8 Effect of DMSO addition on growth and viability of CHO cell pools...... 240 Figure 5.9 Effect of DMSO addition on mAbdAb expression and productivity...... 243 Figure 5.10 Effect of DMSO addition on intracellular and extracellular mAbdAb expression…244 Figure 6.1 Proposed mechanisms for mAb assembly and potential misfolding of mAbdAb structures………………………………………..……………………………..………………………...... 260 Figure 6.2 Schematic representation of optimised mAbdAb transcriptional unit…………………..268 Figure A2.1 Sequence alignments of predicted amino acid sequence of the 50 unique dAbs obtained from passive and soluble selection………………..………………………...... 303 Figure A3.1 Vector maps for the generation of transient pTT5 vectors…………………………………305 Figure A3.2 Vectors used in stable cell line generation………………..………………………...... 307

8 Figure A3.3 Vectors used in cell free translation………………..………………………...... 310 Figure A4.1 dAb mRNA secondary structures of a high and low expressing mAbdAb compared to the structure of Alemtuzumab VH………………..………………………...... 312 Figure A4.2 Correlation of dAb mRNA free energy and expression titre in HEK transient and CHO stable cells………………..………………………...... 313 Figure A4.3 Correlation of codon adaption index (CAI) with CHO expression titres……………….314 Figure A4.4 Physicochemical properties of dAbs correlated to mAbdAb expression in HEK transient cells………………..………………………...... 315 Figure A5.1 Example sensorgram data for BIAcore analysis of mAbdAb binding to HEWL…….317 Figure A6.1 Optimisation of RT-PCR of cDNA dilutions...... 318

9 LIST OF TABLES

Table 1.1 Antibody-based biopharmaceuticals approved for clinical use………………………………21 Table 1.2. Host cells used for the production of biopharmaceuticals, their advantages and disadvantages. …………………………..…………………………..…………………………..……………………………….42 Table 1.3. Chemical inhibitors of proteolytic degradation pathways and the peptidase or protease activity inhibited…………………………..…………………………..…………………………..………………66 Table 1.4. Location and effect of sequence variations in IgG antibodies……………………………….70 Table 2.1 Original 4G Phage Library Titres for round 1 Selection of anti-HEWL dAbs……………..78 Table 2.2. Summary of cloning, restriction enzymes used, vectors generated and their application…………………………..…………………………..…………………………..…………………………..…………91 Table 2.3 List of primers used in DNA sequencing and PCR…………………………..………………………96 Table 2.4. Antibodies used in western blot analysis of proteins, percentage of SDS-PAGE gel their blocking buffer and dilutions…………………………..…………………………..………………………..……110 Table 3.1 Enrichment of dAbs through passive phage display…………………………..…………………125 Table 3.2 Enrichment of dAbs through soluble phage display…………………………..…………………136 Table 3.3 Amino acid sequences of the CDRs of unique dAbs selected through passive and soluble phage display…………………………..…………………………..…………………………..……………………150 Table 4.1. mAbdAbs chosen for further analysis in stable CHO DG44 cells………………………….167 Table 4.2 Titre, productivity and mRNA abundance in CHO cell lines…………………………..……..182 Table 5.1. Summary of the effect of process optimisation techniques on titre and productivity of mAbdAb-expressing stable CHO cell pools…………………………..…………………………..……………248

Table A2.1. CDR sequences of randomly selected VHS dAb library phage clones during passive selection……………………………..…………………………..…………………………..……………………………………..295

Table A2.2. CDR sequences of randomly selected VHM dAb library phage clones during passive selection……………………………..…………………………..…………………………..…………………………………….296

Table A2.3. CDR sequences of randomly selected VHL dAb library phage clones during passive selection……………………………..…………………………..…………………………..…………………………………….297

Table A2.4. CDR sequences of randomly selected VHK dAb library phage clones during passive selection……………………………..…………………………..…………………………..…………………………………….298

Table A2.5. CDR sequences of randomly selected VHS dAb library phage clones during soluble selection……………………………..…………………………..…………………………..…………………………………….299

10 Table A2.6. CDR sequences of randomly selected VHM dAb library phage clones during soluble selection……………………………..…………………………..…………………………..…………………………………….300

Table A2.7. CDR sequences of randomly selected VHL dAb library phage clones during soluble selection……………………………..…………………………..…………………………..…………………………………….301

Table A2.8. CDR sequences of randomly selected VHK dAb library phage clones during soluble selection……………………………..…………………………..…………………………..…………………………………….302

11 ABSTRACT

Antibody engineering is an innovative field of research that has generated a wide range of novel antibody-based formats that both exploit and improve natural antibody properties. Novel format antibodies have the potential to offer significant advantages over natural antibodies when used as biopharmaceuticals, however these non-natural structures often pose a great challenge to the host cell used for their manufacture. Protein expression is a highly regulated process, and quality control mechanisms at each stage can result in a block, or “bottleneck” in expression. This can impact product yield, cost of goods and entry into the clinical pipeline. The molecular determinants that govern novel-format expression in host cells are poorly defined, however there is growing evidence that limited variations in both nucleotide and amino acid sequence can have a severe impact on antibody expression. Therefore this Thesis aims to investigate the consequences of sequence variation on the expression of a novel antibody format (mAbdAb) in mammalian host cells in order to determine the molecular mechanisms that govern their expression.

A diverse panel of mAbdAbs with sequence variations limited to the dAb domain were generated through phage display and cloning technologies. It was determined that amino acid variations located within the CDRs of the dAb results in a range of expression titres in both transient HEK and stable CHO expression platforms. In vitro translation of mAbdAb heavy chain proteins in rabbit reticulocyte lysates (RRL) showed no difference in expression between sequence variants, therefore cell-free translation was suggested as a potential expression platform. Examination of each stage of expression in stable CHO cells revealed that the amount of mRNA was not limiting to expression and distinct expression profiles were observed at the protein level. The majority of mAbdAb constructs showed little evidence of intracellular heavy chain polypeptide which was not altered through chemical inhibition of proteolytic degradation pathways, indicating that degradation was not responsible for poor expression. This led to the hypothesis that low titres were related to how the CHO cell utilises the heavy chain message.

12 DECLARATION

No portion of this work referred to in the Thesis has been submitted in support of an application for another degree or qualification of this or any other university or other institute of learning.

COPYRIGHT STATEMENT i. The author of this Thesis (including any appendices and/or schedules to this Thesis) owns certain copyright or related rights in it (the “Copyright”) and s/he has given The University of Manchester certain rights to use such Copyright, including for administrative purposes. ii. Copies of this Thesis, either in full or in extracts and whether in had or electronic copy, may be made only in accordance with the Copyright, Designs and Patents Act 1988 (as amended) and regulations issued under it or, where appropriate, in accordance with the licensing agreements which the University has from time to time. This page must form part of any such copies made. iii. The ownership of certain Copyright, patents, designs, trade marks and other intellectual property (the “Intellectual Property”) and any reproductions of copyright works in the Thesis, for example graphs and tables (“Reproductions”), which may be described in this Thesis, may not be owned by the author and may be owned by third parties. Such Intellectual Property and Reproductions cannot and must not be made available for use without the prior written permission of the owner(s) of the relevant Intellectual Property and/or Reproductions. iv. Further information on the conditions under which disclosure, publication and commercialisation of this Thesis, the Copyright and any Intellectual Property and/or Reproductions described in it may take place is available from the University IP Policy (see http://documents.manchester.ac.uk/DocuInfo.aspx?DocID=487), in any relevant Thesis restriction declarations deposited in the University Library, The University Library’s regulations (see http://www.manchester.ac.uk/library/aboutus/regulations) and in The University’s policy on Presentation of Theses.

13 ACKNOWLEDGEMENTS

I would like to express my sincere gratitude to my supervisors Alan Dickson and Mark

Creighton-Gutteridge, and my advisor Ray O’Keefe, for their support, patience and encouragement over the course of this project. I would also like to thank the staff at

GlaxoSmithKline for making me feel part of the team during my placement with them and for their invaluable advice. In particular I would like to thank Farhana Hussain, who helped me with the generation of novel format antibodies used in this Thesis.

A special thank you to all the members of the Dickson, Crosthwaite and Heintzen labs both past and present for making my time at Manchester both memorable and enjoyable (especially the Christmas meal, which I hope to attend again this year!). In addition, I would like to acknowledge the kind donation of materials from Dr Lisa

Swanton and Professor Stephen High and support from their lab members at the

Faculty of Life Sciences for experiments relating to the inhibition of proteolytic degradation and in vitro translations respectively.

Finally, I would like to gratefully acknowledge the Engineering and Physical Research

Council and GlaxoSmithKline for funding this research.

DEDICATION

This Thesis is dedicated to my parents, Sylvia and Mike, for their love and support and for teaching me to always aim high. And to Chris, who always believed in me.

14 ABBREVIATIONS

Abs - absorbance ACE - artificial chromosome engineering ADCC - antibody-dependent cell cytotoxicity ADCP - antibody dependent cell-mediated phagocytosis ADP - adenosine diphosphate ANOVA - analysis of variance APS - ammonium persulphate ARF - ADP-ribosylation factors ATF - activating transcription factor ATP - adenosine triphosphate B2M - beta-2-microglobulin Bcl-2 - B-cell leukaemia/lymphoma 2 BGH - bovine growth hormone BHK - baby hamster kidney BiP - immunoglobulin heavy chain binding protein BiTE - bispecific T-cell engager bp - base pairs BSA - bovine serum albumin BSE - bovine spongiform encephalopathy CAI - codon adaption index CD (i.e. CD52) - B-lymphocyte antigen CDD - complement-dependent cytotoxicity cDNA - complementary DNA CDR - complementarity determining region CERT - ceramide transfer protein CH - constant heavy chain domain CHO - Chinese hamster ovary CHOP - C/EBP homologous protein CIRP - cold-inducible RNA binding protein CL - constant light chain domain CLL - Chronic Lymphocytic Leukaemia CMV - cytomegalovirus COP I/II - coat protein complex I/II COS - CV-1 (simian) in Origin, and carrying the SV40 genetic material Cq1 - complement component 1 CTE - constitutive transport element dAb - domain antibody Dcp - mRNA decapping enzyme ddH20 - double distilled water DEPC - diethyl pyrocarbonate DHFR - dihydrofolate reductase DMEM - Dulbecco's modified eaglemedium

15 DMSO - dimethyl sulphoxide DNA - deoxyribonucleic acid dNTP - deoxyribonucleotide triphosphate DTE - difficult to express E.coli - Escherichia coli EBNA-1 - Epstein-Barr nuclear antigen 1 EDEM - endoplasmic reticulum degradation-enhancing α-mannosidase-like EDTA - Ethylenediaminetetraacetic acid eIF - elongation initiation factor ELISA - enzyme linked immunosorbent assay EPO - erythropoietin ER - endoplasmic reticulum ERAD - ER-associated degradation ERK - extracellular signal-regulated kinase Ero1 - endoplasmic reticulum oxidoreductin 1 Fab - antibody binding fragment FACS - Fluorescence-activated cell sorting Fc - fragment crystallisable FcR - Fc receptor FDA - Food and Drug Administration FWR - framework region g - gauge GAP - GTPase-activating proteins GEF - guanosine exchange factor GMP - good manufacturing practise GS - Glutamine synthetase GSK - GlaxoSmithKline GTP - guanosine triphosphate HC - heavy chain HDAC - histone deacetylase HEK - human embryonic kidney HeLa - human cell line HEWL - hen egg white lysozyme hGh - human growth hormone HPLC - high performance liquid chromatography hr - hour HRP - horseradish peroxidase HSP - heat shock protein HT - hypoxanthine IB - inclusion body Ig - immunoglobulin IRE1 - inositol-requiring enzyme 1 IRES - internal ribosomal entry site ISH - in situ hybridisation Kd - dissociation constant

16 kDa - kilodaltons

LB - Luria Bertani LC - light chain LCR - locus control region M - Molar mAb - monoclonal antibody Mbq - Mega Becquerel Met - Methionine mg - milligram min - minute ml - millilitre mM - millimolar mRNA - messenger ribonucleic acid MS - Multiple Sclerosis MSX - Methionine sulphoxide MTX - Methotrexate NaBu - sodium butyrate NBE - new biological entity NS0 - non-secreting clone 0 NURF - nucleosome remodelling factor OD - optical density OriP - origin of replication P - probability PABP - polyA binding protein P-bodies - processing bodies PBS - phosphate buffer saline pcd - picograms per cell per day PCR - polymerase chain reaction PDI - protein disulphide isomerase PEG - polyethylene glycol PERK - RNA-dependent protein kinase-like ER kinase polyA - poly adenosine PPF - prepro alpha factor PPM - parts per million PTM - post-translational modification Qp - specific productivity RACE - rapid amplification of cDNA ends RB - retinoblastoma RBM3 - RNA binding motif protein 3 rpm revolutions per minute RRL - rabbit reticulate lysate RT - reverse transcriptase RU - resonance units s - second S/MAR - scaffold/matrix attachment region 17 S6K1 - serine threonine protein kinase scFV - single chain variable domain SD - standard deviation SDS-PAGE - sodium dodecyl sulphate polyacrylamide gel electrophoresis SEAP - secreted alkaline phosphatase SEC - size exclusion chromatography SEM - standard error of the mean SG - stress granule siRNA - small interfering RNA SM - Sec1/Munc18 SNARE - Soluble N-ethylmaleimide-sensitive factor attachment receptors SP1/SP2 site-1 protease/site-2 protease SPR - surface plasmon resonance SRP - signal recognition particle ssDNA/dsDNA - single stranded/double stranded DNA SV40 - simian vacuolating virus 40 SW1/SNF - SWItch/sucrose Non-Fermentable Taq - Thermus aquaticus TBE - Tris, boric acid, EDTA TEMED - N, N, N’, N’- tetramethylethylenediamine THF - tetrahydrofolate TMB - 3, 3’, 5, 5’-tetramethybenzidine tRNA - transfer RNA TU/ml - titre units/milliliter Tween - polyxyethylene (20) sorbitan monolaurate UCOE - universal chromatin opening element UPR - unfolded protein response UTR - untranslated region V - volts v/v - volume/volume VH - variable heavy VHL - variable heavy domain long CDR3 length VHM - variable heavy domain medium CDR3 length VHS - variable heavy domain short CDR3 length VK - variable light chain κ isotype VL - variable light w/v - weight/volume XBP1 - X-box binding protein 1 xg - x gravity YO - yeastolate μ - micro

CHAPTER 1: INTRODUCTION

19 1.1 Introduction to biopharmaceuticals

Biopharmaceuticals are protein or nucleic acid-based pharmaceuticals that differ from conventional small molecule pharmaceuticals in that they are manufactured using biological processes. They have been developed for a wide variety of human disease states, and products include hormones, blood-related proteins, vaccines, fusion proteins, therapeutic enzymes and monoclonal antibodies (mAbs) (Walsh 1998). Their production is based on the principle of recombinant DNA (rDNA) technology, or the insertion of a foreign gene

(transgene) into host vector, which was developed at Stanford University in 1972 by a team led by Paul Berg (Jackson et al. 1972). Once inserted into a host cell, the recombinant gene encoded on the vector is expressed by the cell using its endogenous protein synthesis machinery, and as such is used as a “factory” for biopharmaceutical manufacture. In 1973, a team led by Herbert Boyer at Genetech performed the first successful transformation of

Escherichia coli with a recombinant DNA plasmid, and went on to produce the first human recombinant protein, human insulin (Humulin), which was approved for medical use by the federal drug administration (FDA) in 1982 (Dingermann 2008). Over the past 30 years a wide range of host expression systems have since been developed for biopharmaceutical production (Section 1.4), including insect cells (Sonoda et al. 2012), plant cultures (Hellwig et al. 2004), yeast cells (Verma et al. 1998), hybridoma cells (Kohler and Milstein 1975) and transgenic animals (Lonberg 2005). However E.coli and mammalian cell systems remain the dominant expression platforms.

Biopharmaceuticals represent the fastest growing segment of the $600billion pharmaceutical industry, with over 200 approved products approved for clinical use (Walsh 2010). In a recent

Trade Name Therapeutic Antibody Type Host Cell (Scientific Name) Indications

Prevention of blot clot Reopro® Chimeric Fab formation in heart Sp2/0 (Abciximab) surgery patients Acute Myeloid Campath-1H® Humanized Leukaemia and CHO (Alemtuzumab) IgG1 Multiple Sclerosis Cimzia® PEGylated Chrohn’s disease and (Certolizumab E.coli humanized Fab rheumatoid arthritis pegol)

Removab® Bispecific Malignant ascites in Hybridoma (Cartumaxomab) rat/mouse IgG2 metastatic cancers

Vectibix® Metastatic colorectal Human IgG2 CHO (Panitumumab) cancer

Adcetris® Hodgkin lymphoma Chimeric IgG- (Brentuximab and systemic anaplastic CHO drug conjugate vedotin) large cell lymphoma

Benlysta® Systemic lupus Human IgG1 NS0 (Belimumab) erythematosus

Herceptin® Humanized Breast cancer CHO (Trastuzumab) IgG1

Murine IgG1 Zevalin® conjugated to B-cell non-Hodgkin (Ibritumomab CHO tiuxetan for lymphoma tiuxetan) radiotherapy Transplant rejection, MabThera® Chimeric IgG1 autoimmune disease, CHO (Rituximab) Lymphoma, leukaemia

Table 1.1 Antibody-based biopharmaceuticals approved for clinical use. Adapted from

(Reichert 2012) to give an indication of the range in type, therapeutic indication and host cells used in the manufacture of antibody and antibody-based biotherapeutics currently approved for clinical use.

21 review of the market 58 new biopharmaceuticals had gained regulatory approval over a four year period for use as therapeutic drugs (Walsh 2010). Over half of these were biosimilars or biobetters, modified versions of existing approved products. Only 25 were “new biological entities” (NBEs), half of which were antibody-based biotherapeutics. In 2009 the biopharmaceutical market was valued at $99 billion (US dollars), with mAb-based products accounting for $38 billion (US dollars) alone. This indicates that mAb and mAb-based biopharmaceuticals (Table 1.1) represent both an area of intense research and a source of great commercial value.

Compared with small molecule pharmaceuticals, biopharmaceuticals are more challenging to produce due to their greater size and complexity. The vast majority of biopharmaceuticals require one or more post-translational modifications (PTMs), including glycosylation, disulphide bond formation, carboxylation, hydroxylation, amidation, sulphation and proteolytic processing. These modifications are required for their potency, stability and functional activity, and heterogeneity in

PTMs can have severe consequences such as patient immunogenicity. The choice of host has a significant impact on PTM profiles, as not all cell types are capable of performing the same modifications, thus each biopharmaceutical must be expressed in a suitable host cell system.

Protein synthesis is a highly regulated series of cellular events (Section 1.5), each of which have the potential to exert a considerable effect on recombinant protein yield and thus manufacturing costs. Furthermore, in order to gain regulatory approval, clonal cell lines that demonstrate stability over long-term culture must be developed, which is a long, labour-intensive process. In addition, biopharmaceutical development costs up to $450 million (US dollars) and can take up to

8 years before market release, compared with small pharmaceutical drugs that costs around $2 million (US dollars) and take approximately 2 years (Heinrichs 2008). Once approved, the costs of treatment using biopharmaceuticals is impacted by dose requirements and length of treatment,

22 due in part to the nature of the diseases targeted by biological drugs, such as human insulin for diabetes or antibodies for cancer therapy. In addition, the emergence of cheaper biosimilar products onto the market drives competition within the biopharmaceutical industry.

Engineered biopharmaceuticals, such as novel format antibodies, are being developed which may offset the cost of treatment and also offer therapy for previous intractable disease states. For example, bispecific antibodies are capable of targeting more than one antigen, with the second binding domain usually targeting a T-lymphocyte, thereby providing a higher cytotoxic potential in cancer therapy. However, these non-natural antibody formats can be challenging for host cells to produce, which impacts on costs, product titre and market release, and may even render these novel formats unsuitable for development. An understanding of what molecular events govern the expression of novel format antibodies would provide valuable insight into the molecular determinants for novel format antibody production in host cell systems, which could influence cost of goods and global access to innovative biopharmaceuticals.

1.2 Antibodies as therapeutics

1.2.1 Natural antibody structure

Human antibodies (Ab) or immunoglobulins (Ig) are produced by B-lymphocytes (B-cells) circulating in blood plasma in response to allergy or infection (Wood 2001 et al. 2004). There are five classes of antibody molecule; IgA, IgD, IgE, IgG and IgM, of which IgG is the most abundant in the human body and is almost without exception the only molecule to be produced in vitro for therapeutic use (Holliger and Bohlen 1999, Holliger and Hudson 2005).

IgA antibodies are dimers which are localised in the mucosa and provides protection against invading toxins, viruses and bacteria (Schroeder and Cavacini 2010). The function of IgD antibodies are less clear, but in their secreted form have been shown to respond to bacterial infection, whilst their membrane –bound form is believed to participate in B-cell differentiation

(Edholm et al. 2011). IgE isotypes are involved in the allergy response and parasitic infection, whilst IgM exists as membrane-bound monomers on native B-cells and secreted as pentamers and respond to bacterial and fungal infections (Woof and Burton 2004). IgG molecules are further subdivided into four classes based on their relative sera concentrations; IgG1 (60%),

IgG2 (25%), IgG3 (10%) and IgG4 (5%). Each subclass has a different Fc-effector function, conferred by their specific glycoprofiles, and target different antigen types (Jefferis 2007). In recombinant mAb development the choice of IgG isotype is dependent on the Fc functionality required for the intended clinical application.

Natural IgG molecules are multimeric Y-shaped proteins (Figure.1.1) consisting of two identical heavy chain and two identical light chain polypeptides, each folded into compact globular polypeptides with a molecular mass of 50-75kD and 25kD respectively (Cecilia et al. 2004,

Nelson 2010). There are two types of light chain, κ and λ, which have the same function but are encoded by different genes. Each IgG contains only one of these light chain isoforms (Wood

2001). Heavy and light chain polypeptides consist of repeating domains of approximately 110 amino acids in length. There are three constant domains on each heavy chain and one on each light chain (Wood 2001). The N-terminal end of the heavy and the light chains are the antigen binding or Fab region and consist of two variable domains on each arm of the antibody, one variable domain on the heavy chain (VH) and one on the light chain (VL). Each variable domain is comprised of three complementarity determining regions (CDRs) contained within 6

Figure 1.1. Diagram of natural antibody IgG structure. Natural IgG structure consists of repeating domains that form two heavy chain and two light chain polypeptides which are linked by disulphide bonds (S=S). The N-terminal end is the Fab region, which confers antibody specificity is conferred by the variable heavy (dark green) and variable light (light green) domains. The C-

terminal Fc region contains constant domains (red) that provide structure and recruit immune

effector cells, mediated by the glycan group ( )Y in the CH2 domain. Between the Fab and Fc regions is a proline rich section ( ) known as the hinge region, which confers flexibility to the antibody.

polypeptide loops (paratopes) that recognise and bind the epitope on the target antigen, and four framework regions (FWRs), which are polypeptide segments that form a structural scaffold for correct spatial orientation of the CDRs (Carter 2006). Finally, antibody flexibility is conferred via a proline-rich region or “hinge” between the CH1 and CH2 domains in the heavy chain polypeptide.

The Fc (fragment crystallisable) domain consists of the constant domains and is responsible for immune effector functions by recruiting neutrophils and macrophages to target cells through binding to IgG receptors (FcγRs) on their surface. Depending on the IgG isoform, effector functions include antibody dependent cell cytotoxicity (ADCC) and antibody dependent cell-mediated phagocytosis

(ADCP). Additionally, certain IgG isotypes can activate complement-dependent cytotoxicity (CDC) through binding to the complement component 1 (C1q). The Fc region also mediates antibody half- life in vivo through binding to the FcRn salvage receptor on vascular endothelial cells (Carter 2006,

Dillman 2009).

Antibodies require two types of post-translational modification for their stability and function; disulphide bond formation and N-linked glycosylation. Disulphide bonds mediate the antibody tertiary structure, and exist as interchain bonds (between the heavy and light chains and the two heavy chains) and within each domain in the form of intrachain disulphide bonds and, depending on the isotype, IgG antibodies contain 16-28 disulphide bonds (Borth et al. 2005). N-linked glycans are complex carbohydrate structures that are attached to asparagine or arginine residues at position 297 of the CH2 domain, and are required for Fc effector functions (Woof and Burton 2004, Jefferis 2007).

The natural immune response is highly adaptive, and antibody molecules evolve constantly to adapt to new pathogens through genetic recombination, somatic mutation and clonal selection of B-cells, to confer an excellent immune response (Moore et al. 2010).

1.2.2 Chimeric, humanized and fully human antibodies

Muromonab-CD3 (Orthoclone OKT3) was the first IgG to be approved for biotherapeutic applications in 1986 and was produced in hybridoma cells (Robinson 1986). This host cell type was first developed in 1975 by Kohler and Milstein through hybridizing somatic spleen cells with myeloma tumour cells both derived from immunized mice, thus generating an immortalized cell line expressing IgG antibodies (Kohler and Milstein 1975). However, the suitability of the non- human antibodies as biotherapeutics was limited due to their potential for eliciting immunogenicity in patients.

The need for reduced immunogenicity drove the development of the first antibody engineering techniques; antibody chimerisation and humanization. In antibody chimerisation the variable domains of a mouse monoclonal antibody are joined to the constant domains of a human antibody (Carter 2006, Dillman 2009) and produces antibodies that are 66% human (Morrison et al. 1984). In humanization, the CDRs of a mouse monoclonal antibody are transferred into the framework regions of a human monoclonal antibody in a process known as CDR grafting and results in antibodies that at 90-95% human (Riechmann et al. 1988). In this Thesis a humanized mAb (Alemtuzumab, Campath 1-H®, Table 1.1) forms the mAb portion of the mAbdAb format

(Figure 1.12). This antibody was humanized by grafting the CDRs of the original rat IgG2 mAb onto the framework of a human IgG1 (Osterborg et al. 2002, Dillman 2009). It targets the CD52 antigen and was originally approved for the treatment of Chronic Lymphocytic Leukaemia (CLL)

(Osterborg et al. 2002, Dillman 2009) and is currently undergoing clinical trials for the treatment of Multiple Sclerosis (MS) (Coles et al. 2008). Most recently, fully human antibodies have been developed for therapeutics using various in vitro display technologies (Section 1.3) or by engineering transgenic mice to express human antibodies (Carter 2006). 27

1.2.3 Novel format antibodies

Following on from the success of chimerisation and humanization, antibody engineering has emerged to exploit natural antibody properties such as antigen specificity and Fc receptor function to produce a range of “novel-format” antibody-based molecules for use as both diagnostic and therapeutic applications (Marvin and Zhu 2005, Nelson and Reichert 2009). These

“novel formats” can be categorized as fragments, full-sized antibodies with additional activity and antibody mimetics (Figure 1.3). There is at present a wide range of novel formats currently under investigation, therefore the following section will provide an overview of the types of structures being explored and the advantages these have over natural antibodies.

Antibody fragments exploit the modular nature of antibodies and as a result of their smaller size, these formats can offer the advantage of increased tissue penetration and access to previously unattainable antigens. Some of these novel structures were conceived based on the discovery of different naturally occurring heavy chain formats lacking in light chains, such as those found in cartilaginous fish (e.g. sharks) and camelids (e.g. camels and llamas). For example, shark antibody formats include an extended HC format consisting of 5 constant domains

(IgNARs) which provide access to epitopes buried within antigen crevices

F(ab’) Fragments sdAb scFv BiTE 2

(15kDa) (30kDa) (60kDa) (120kDa)

Antibodies

Bispecific Conjugated Dual-targeting

(150kDa) (>150kDa) (>150kDa)

Mimetics DARPin Peptide Aptamer (14 kDa) (~20 amino acids)

Figure.1.2 Example novel antibody-based formats. These include but are not limited to: single domain antibodies (V domain), single chain variable fragments (scFv) consisting of VH and VL domains linked with a polypeptide linker which can be further assembled into multimeric fragments

(triabodies and tetrabodies). BiTEs (bispecific T-cell engagers) are two conjugated scFv fragments, one specific for T-cell recruitment and the other specific for a target cell. Fab fragments do not contain the Fc region of natural antibodies. Bispecific antibodies consist of a full IgG molecule with two different Fab regions. Full sized antibodies can be chemically conjugated to various functional moieties including chemical drugs, whilst dual targeting antibodies contain a second functional binding protein. Antibody mimetics can be DNA, RNA or protein molecules that are based on antibody variable domain scaffolds. Key to Figure: variable heavy chain domains ( and ), variable light chain domains ( and ), conjugated moiety ( ), functional binding protein ( ) and peptide linker ( ).

(Wesolowski et al. 2009). The smallest antibody fragment is a single domain antibody (dAb), which consist of a single functional VH or VL domain and were first developed based on the camelid VHH structure. Single-chain variable fragments (scFvs) are monomers of VH and VL domains that are covalently joined by a polypeptide linker of 12 amino acids or less. The most commonly used linker is (Gly4Ser) 3, however linker design is an area of intense research

(Todorovska et al. 2001, Cecilia et al. 2004). The length and composition of the polypeptide linker determines the structure of the scFv and whether the molecule is monomeric or multimeric. A linker length of 3-5 residues causes the VH and VL domains of two scFv fragments to associate, forming a dimer or dibody, whereas a linker of 0-2 residues is used in the tribody format and the direct linkage of scFv fragments results in the formation of a tetrabody

(Todorovska et al. 2001). Peptide linkers can also be used in other novel formats, such as the dual-targeting format discussed below. Bispecific T-cell engagers (BiTEs) contain two scFv molecules, one of which targets antigens such a CD3 on T- cells and the other recognises antigens presented on the surface of a cancer cell. This confers a novel function as natural antibodies cannot activate T-cells, and this format is currently undergoing development for cancer therapy. F(ab) fragments consist of the Fab region of an antibody, and have no Fc function as they lack constant domains. This is the most explored format with respect to therapeutic activity, with a number of approved Fab fragments currently in use (Table 1.1) and

49% of the 54 antibody fragments currently in the clinical pipeline consisting solely of a Fab domain (Nelson 2010). Each type of multimeric antibody fragment can be further designed to be multivalent or multispecific to improve both antigen avidity and affinity (Cecilia et al. 2004).

Full length antibodies have also been designed to confer additional properties. Bispecific antibodies differ from normal IgGs in that they can be either homo or heterodimeric, with the variable regions on each “arm” recognizing a different antigen and thus are capable of targeting two separate antigens whilst retaining Fc activity, resulting in a tri-functional molecule with a higher potential for cell cytoxicity. The most widely used application for full- sized bispecific antibodies containing an Fc region is immunotherapy, as this class of antibody can simultaneously engage with T-lymphocytes and the target cancer cell whilst the Fc region can recruit immune effector cells such as phagocytes or natural killer (NK) cells to neutralize and destroy the cancer cell (Walsh 2010). Full length antibodies and their fragments have also been chemically conjugated to a range of exogenous functional moieties which confer additional therapeutic functions to the antibody molecule and include radioisotopes, enzymes, cytokines, toxins and PEGylated chemotherapeutic liposomes, and allow for targeted delivery of these moieties. There are 24 conjugated fragments that have entered clinical study, all of which have been developed for the treatment of various cancer forms (Nelson 2010). Dual- targeting antibodies have an additional binding moiety, such as a dAb, scFv or enzyme, attached to the full-sized antibody by means of a peptide linker, thereby conferring an additional function. The novel format antibody in this Thesis is a dual-targeting antibody consisting of an IgG1

(Alemtuzumab) with a dAb attached to the CH3 domain of each heavy chain by means of a proprietary peptide linker.

Antibody mimetics are an emerging class of non-antibody structures that mimic the antigen binding properties of natural antibodies. They are based on RNA, DNA or peptide scaffolds that maintain a framework for binding paratopes similar to CDRs (Skerra 2007). Furthermore, the composition, structure and number of recognition “loops” can be engineered to confer even

31 higher specificities and better biophysical characteristics than antibody-based molecules and as such have the potential to target previously unattainable epitopes (Hosse et al. 2006). Antibody mimetics include DARPins (designed ankyrin repeat proteins) and Aptamers (for a review of the field see (Hosse et al. 2006)).

The disadvantage of small antibody fragments is their short half-life in vivo, particularly in structures lacking the Fc region. When expressed in isolation, dAbs have also shown a high propensity for aggregation (Jespers et al. 2004). Therefore in addition to developing novel structures with unique functions antibody engineering has also focused on the customisation of pharmacological properties including half-life, affinity, avidity, thermostability and reduced aggregation, with a view of improving both product safety and efficacy.

1.3 Technologies in novel format antibody generation

Historically, antibodies were derived from the serum of immunized animals (Geyer et al. 2012).

Biopharmaceutical production of monoclonal antibodies was enabled by the development of hybridoma technology by Kohler and Milstein (Kohler and Milstein 1975), but this technique is limited in terms of patient immunogenicity, antigen affinity and the generation of novel format antibodies (He and Khan 2005). In vitro display technologies, such as phage display (Arap

2005), yeast display (Boder et al. 2012) and ribosome display (He and Khan 2005) are the dominant method of generation for antibodies and engineered antibody formats. All in vitro display techniques operate using the same basic principle; the linkage of phenotype (protein) to genotype (DNA or RNA). In display technologies using a host organism this is achieved

32 through genetic manipulation of the host to synthesize and “display” the desired protein on its surface, whilst in ribosome display mRNA lacking a stop codon is coupled to protein by means of a ribosome (He and Khan 2005). Generally, display selection methods require the generation of a DNA library, selection of display proteins against a target antigen (biopanning) and subsequent cloning of the genetic material into a recombinant expression vector for manufacture (Boder et al. 2012). The following sections focus on the selection of antibody fragments using phage display technology, as this is the method used to generate dAbs in this

Thesis.

1.3.1 Phage display

Phage display was first developed by G. Smith in 1985 (Smith 1985) and first described for its use in antibody generation in 1990 (McCafferty et al. 1990). The technology employs the use of non-lytic filamentous bacteriophage (Figure 1.3); a single stranded DNA virus than infect gram- negative bacteria to replicate (Cabilly 1999, Arap 2005). There are several species of non-lytic phage (e.g. f1, fd and M13), all of which can be used in phage display and share up to 98% genetic homology. Non-lytic phage are secreted by E.coli into the growth medium, thereby facilitating phage recovery via centrifugation and providing an efficient method of amplification during selection (Section 1.3.2).

Bacteriophage comprise of a circular plasmid of single stranded DNA surrounded by five types of coat protein; pIII, pVI, pVII, pVIII and pIX (Cabilly 1999). There are several thousand copies of the pVII coat protein, which form the main structure of the bacteriophage. The remaining coat proteins are displayed at the two ends of the bacteriophage, and their principal roles are anchoring and penetration to a host. Five copies each of pIII and pVI appear at one end of the 33 phage and 5 copies each of pVIII and pIX at the other (Sidhu 2000). In phage display technology antibody fragments or domains are displayed on the surface of bacteriophage as fusion protein with either the pIII, pVI or pVIII coat protein. This is achieved through inserting the gene of interest into a non-essential region of the coat protein gene, thereby retaining the infective ability of the phage (Pande et al. 2010).

Figure 1.3 Diagram of filamentous phage displaying an antibody fragment as a fusion protein with the pIII coat protein. Phage particles consist of ssDNA enclosed in the PVIII coat protein. The antibody genes are incorporated into the pIII gene and displayed as a fusion protein with the pIII coat protein, thus providing linkage of phenotype to genotype which is exploited during selection. Adapted from (Azzazy and Highsmith 2002).

The most commonly used coat protein for this application is pIII, which is the longest of the coat proteins and can tolerate large insertions of exogenous DNA at the 5’ end of the gene

(Pande et al. 2010). It is the linkage of phenotype displayed on the coat protein with the genotype of the encoding gene of interest that is exploited in phage display selection, whereby antibodies or fragments with specificity for a target antigen are screened from a pool of billions of potential phage, known as a phage library (Azzazy and Highsmith 2002).

1.3.2 Construction of a phage library

Phage libraries can be constructed from natural or synthetic gene sources. In the case of naturally derived phage libraries, construction begins with the isolation of the desired genes in the form of mRNA from a population of B-lymphocytes derived either from animal or human serum, which is then reverse-transcribed to cDNA and subsequently cloned into a phage or phagemid vector

(Watkins and Ouwehand 2000). “Naïve” repertoires are derived from non- immunised sources, whereas “immune” repertoires use B-lymphocytes from an immunised animal or human, thereby generating a particular bias in the repertoire (Azzazy and Highsmith 2002). Synthetic libraries are generated by random mutagenesis through PCR-based technologies using degenerate primers to engineer diversity at pre-defined sites within the CDRs or FWRs of the antibody variable domains

(Finlay and Almagro 2012). There are two common types of degenerate codons that are used for this diversification, both of which incorporate random nucleotides in the first two codon positions whilst the third position is occupied by either a G/T or G/C nucleotide (“NNK” and “NNS” codon respectively) (Finlay and Almagro 2012). This ensures that all codons and thus all amino acid residues are represented within the resulting population. This diversification can also be applied to natural repertoires to increase their diversity. As in naturally-derived libraries, the resulting DNA from synthetic diversification is then cloned into an appropriate vector.

Two types of vector can be used to generate a phage library; phage vectors (eg.fUsE5, pDOM) for the generation of smaller antibody fragments, or phagemid vectors (eg.pHEN1, pComb3) for the display of larger proteins (Baek et al. 2002, Soltes et al. 2007). Frequently, an enzymatic recognition site is engineered between the gene of interest and the coat protein to facilitate recovery of antigen-specific phage during biopanning. Once assembled the vector is transformed

37 into competent E.coli cells by various methodologies (e.g. heat shock, CaCl2 transformation or electroporation). These “infected” E.coli then synthesise phage displaying the protein of interest.

When using phagemid vectors the transformed E.coli must be infected with a helper phage (egg.

Hyperphage, Phaberge), which initiates phage replication and encapsulation of the phagemid

DNA (Azzazy and Highsmith 2002). The result is a diverse library of recombinant phages each of which display the gene of interest as a fusion with the chosen coat protein.

1.3.3 Selection and amplification of phage against a desired antigen

Selection of phage that display antibody fragments that are specific to the target antigen are isolated from a phage library through a process known as biopanning. This can be achieved using immobilised antigens (passive phage display), soluble antigens (soluble phage display) or through in vivo selection of antigens displayed on a cell (e.g. yeast or bacteria) or animal

(Azzazy and Highsmith 2002, Pande et al. 2010). Passive and soluble selections are the favoured methods of biopanning and are both used in this Thesis, therefore this Section focuses on the general procedure employed in these two techniques.

Both passive and soluble phage display follow the same basic process of biopanning (Figure

1.5), in which the target antigen is first incubated with a phage library, after which non-specific phage are washed away and bound phage displaying proteins specific to the target antigen are recovered. This is usually achieved using enzymes such as trypsin to cleave the displayed protein (phenotype) from the coat protein, thereby eluting the antigen-specific phage containing the gene of interest (genotype) (Matz and Chames 2012). Eluted phage are then

A B

Immobilised antigen i i Biotinylated antigen

Phage library ii

ii Phage library

iii v vi

Streptavidin Repeat coated x2-6 magnetic beads

v iv iii iv Magnetic rack

Figure 1.4 Phage display selection process. A. Passive phage display. i. Antigen is immobilised on a plastic surface (i.e. 96-well plate). ii. A phage library is incubated with the antigen. iii. The plate is washed to remove unbound or low affinity phage. iv. Selected phage are eluted. v.Selected phage are amplified via TG1 E.coli infection. vi. Amplified phage are used in further rounds of selection. The process (steps i – vi) are repeated 1-6 times using lower concentrations of antigen to enrich the population. B. Soluble phage display. i. Antigen is biotinylated. ii. A phage library is incubated with the biotinylated antigen in an Eppendorf tube. iii. Streptavidin coated paramagnetic beads are added to the antigen-phage mixture. iv. Phage-antigen- streptavidin complexes (i.e. selected phage) are captured on a magnetic rack and washed to remove non-specific phage. v. Selected phage are eluted. vi. Selected phage are amplified via TG1 E.coli infection. vii. Amplified phage are used in further rounds of selection. The process (steps i – vi) are repeated 1-6 times using lower concentrations of antigen to enrich the population. 39 amplified in E.coli and purified from the culture medium prior to use in the subsequent round of panning. Selection rounds are performed an average of 2-6 times with each round enriching the phage population 20-1000 fold (Watkins and Ouwehand 2000). Once selection is complete antigen-binding specificity is assessed by screening techniques such as phage ELISA, and the genetic diversity of the selected antibody population is assessed by DNA sequencing (Pande et al. 2010). Finally the gene of interest can be subcloned from the phage vector into an appropriate expression vector which can be transfected into a suitable host for production.

Passive phage display relies on the adsorption of an antigen onto a plastic surface, which partially denatures the antigen and can cause a conformational change in antigen tertiary structure that can potentially alter the binding epitope of the antigen (Shcherbakova et al.

2012). Adsorption may also occur at a particular orientation which blocks the antigen epitope entirely. As a consequence, passive selections can result in lower genetic diversity in the selected phage population and lower binding affinities (Kd) in vivo (Chames and Baty 2010).

In soluble phage display the antigen is maintained in a solution thereby maintaining its natural conformation, and as such can be used to overcome the limitations of passive phage display with respect to binding specificity to the target antigen in vivo. However, both the removal of non- specific phage and recovery of antigen specific phage are more complex. Biotinylation of the antigen is a common method used to facilitate this process. Biotin is a small chemical group which has a high affinity and specificity for avidin and streptavidin, and its size means that it is unlikely to interfere with selection (Chames and Baty 2010). Conjugation of the biotin molecule to the target antigen can be achieved in vivo (Sibler et al. 1999) or through

40 enzymatic (Saviranta et al. 1998) or chemical (Kay et al. 2009) processes in vitro. The latter can be achieved using commercially available kits, which usually comprise of biotin attached to an ester linker that enables a spatial orientation that reduces steric hindrance when binding to avidin or streptavidin. The biotin-linker is covalently linked to amine groups at specific residues of the target antigen (specifically NH2 side chain on lysine residues) (Kay et al. 2009). Successful antigen biotinylation relies on the availability of lysine residues on the target antigen, and therefore has the potential to interfere with selection if these residues are located in the binding epitope of the target antigen (Chames and Baty 2010). This can result in lower binding specificity and genetic diversity in the selected phage. As both passive and soluble display technologies each have specific advantages and limitations both methodologies are frequently employed in parallel to maximize selection.

1.4 Expression systems for the production of natural and engineered antibodies

A wide range of expression systems have been developed for the production of biopharmaceuticals, each of which offer their own distinct advantages and disadvantages

(Table 1.2). As each new biopharmaceutical product will have specific structural and post- translational modification requirements for their biological activity, the host system used for production must be chosen to meet these requirements whilst keeping production costs to a minimum.

Host Cell Advantages Disadvantages References

Lack of mammalian PTMs (Ferrer-Miralles Rapid growth rate Difficult product recovery Bacterial et al., 2009) Low production costs Different codon usage E.coli (Terpe, 2006) High product yield Difficult expression of >60kDa

proteins

Yeast Rapid growth rate Non-mammalian glycosylation (Terpe, 2006) P.pastoris Low production costs Cannot perform extensive (Verma et al., S.cerivisiae Can perform most PTMs glycosylation 1998)

Performs non-siaylated N-linked glycosylation which reduces Insect High product yield (Marchal et al., antibody half-life in vivo Sf21 Can perform most PTMs 2001) Slow growing Relatively expensive production

Unstable over long term culture (Tomita and Hybridoma Mammalian PTMs Immunogenicity issues in Tsumoto, 2011) NS0 Immortalised cells patients (Geisse et al., Relatively high production cost 1996)

Mammalian-like PTMs Slow growing Plant cells Low production costs Low product yield (Hellwig et al., N. tobaccum Good biosafety profile Protein aggregation and 2004) A. thaliana Secreted product degradation

Mammalian Human-like PTMs High production cost (Berlec and HEK Expression of highly Relatively slow growing Strukelj, 2013) HeLa complex products Lengthy cell line generation (Jayapal et al., BHK Simple product recovery Biosafety concerns 2007) CHO High product yield

Table 1.2. Host cells used for the production of biopharmaceuticals, their advantages and disadvantages. See references for a review of the host system.

42 Bacteria are an attractive expression host due to their amenability to genetic manipulation, rapid growth rate, low production cost and high product yield (Terpe 2006), but their suitability for antibody production is limited by their incapacity to perform disulphide bond formation and glycosylation (Walsh and Jefferis 2006). However, they are suitable for the expression of antibody fragments that do not require these modifications for their in vivo activity, such as dAbs and scFvs. Another disadvantage of bacterial systems is that recombinant products either accumulate in the cytoplasm, periplasmic space or as aggregates with chaperone proteins in inclusion bodies (IBs), which impact on the cost and complexity of product recovery (Terpe 2006, Ferrer-Miralles et al. 2009).

Mammalian cells are the most suitable host cell for the production of antibodies and larger antibody fragments requiring post-translational modifications, with 24 of the 28 antibodies currently on the market produced in mammalian cells (Reichert 2012). The most common mammalian cell lines are derived from human (e.g. HEK, HeLa) and hamster (e.g. BHK, CHO) tissues. These cells can be grown as monolayers in adherent culture, but are also adaptable to suspension culture and thus can be easily scaled up for industrial production. In addition, using a chemically-defined growth medium that does not contain animal or human serum reduces biosafety concerns relating to the transmission of diseases or prions such as bovine spongiform encephalopathy (BSE)(Ferrer-Miralles et al. 2009), meaning that mammalian cells have a good record of regulatory approval. Furthermore, recombinant proteins are secreted into the growth medium, resulting in simple product recovery.

Recombinant vectors are introduced into mammalian cells by either stable or transient transfection. In stable transfection the recombinant gene is integrated into the genome,

43 resulting in sustained expression of the recombinant protein, however cell line generation is time-consuming and requires the use of a selection system. In transient expression recombinant genes are maintained as a circular plasmid, resulting in more rapid production but lower yield, which cannot be sustained as the vector is not replicated during mitosis.

Transient expression is generally used for early characterisation or screening of a large number of potential drug candidates prior to stable cell line generation, and the predominant system is Human Embryonic Kidney (HEK) cells. Stable cell lines are generally required for regulatory approval and industrial-scale production, and 70% of all biopharmaceutical produced in stably- transfected Chinese Hamster Ovary (CHO) cells. As both of these cell lines are used in this Thesis, they will be discussed further in the following Sections.

1.4.1 HEK cells as expression hosts

HEK293 cells were originally derived in the 1970s from the culture of human embryonic kidney tissue transformed with adenovirus 5 DNA (Graham et al. 1977). Their ease of culture in chemically defined medium, amenability to transfection, adaptability to suspension and inherent ability to produce human post-translational modifications made them attractive hosts for recombinant protein production. Since then a number of HEK cell variants have been developed that facilitate their use in transient transfection. These include the HEK293T and HEK2936E cell lines, which have been transformed to constitutively express viral proteins such as the SV40 large T antigen or the Epstein - Barr virus nuclear antigen 1 (EBNA-1). These cell lines have a high transient expression capacity when coupled with a vector containing a viral origin of replication (OriP), which drives plasmid replication, thus preventing its loss during cell division (Codamo et al. 2011). They have also been shown to predict the expression

44 levels of biopharmaceuticals in stable CHO cells (Diepenbruck et al. 2013), making them ideal for early characterisation studies. However, as they are human derived, they present biosafety concerns as they have the potential to transmit human pathogens.

1.4.2 CHO cells as expression hosts

CHO cell lines were first derived by Puck et al. in 1957 from the ovary of a single partially inbred female hamster (Tjio and Puck 1958). In early studies these cells demonstrated adaptability to suspension culture and chemically defined media, a high capacity for expression and a relative short doubling time of approximately 14 hours (Puck et al. 1964), and were later found to be highly amenable to genetic mutations (Kao and Puck 1967, Kao et al. 1969), making them attractive hosts for biopharmaceutical production. As a result of their mutability, a number of different cell lineages have been derived (Figure 1.5) as well as selection and amplification systems based on metabolic deficiencies such as DHFR and GS

(Section 1.4.2.1) (Lewis et al. 2013). Their ease in genetic manipulation has also facilitated cell line engineering strategies to further improve the processing capacity of CHO cells (Section

1.5.10). Furthermore, the glycoprofiles derived from CHO cells have been deemed safe for clinical use, which means they have a good record of regulatory approval (Roskos et al. 2004).

As a result, extensive development has been employed to optimise this system with respect to transfection techniques, clonal selections, growth media and culture conditions (Butler

2005).

The parental diploid Chinese Hamster genome contains 22 chromosomes; however CHO cell lines are notorious for having a heterogeneous karyotype and high level of genetic instability,

C ese amster

C O ce (Puck, 1957)

C O- C O Pr - D + C O var (Kao & Puck, 1968) (Flintoff (Tobey 1962)

C O- C O - C O-M C O- (E CC) ( T CC) (DHF mutant) (Tilkins, 1991)

C O r te free (E CC) C O- C O-D D - C O- (E CC) ( laub & Chasin (Life Technologies)

C O-D D - - ( S

Figure 1.5 CHO cell lineages used in biopharmaceutical production. ECACC; European collection

of cell cultures. ATCC; American type culture collection. Adapted from (Lewis et al. 2013).

which can influence biopharmaceutical yield and stability over long-term culture (Barnes et al.

2001, Bailey et al. 2012). The CHO cell karyotype varies between cell lineages, for example

CHO DG44 cells contain 20 chromosomes (Martinet et al. 2007) whilst the ancestral CHO-K1

lineage has 21 (Derouazi et al. 2006). Despite the wide use of CHO cells in industry, the CHO

genome has only recently been established for the parental Chinese hamster (Lewis et al.

2013) and various CHO cell lines including CHO-K1 (Xu et al. 2011), CHO- DUKX (Hammond et

al. 2011), CHO DG44 and CHO-S (Lewis et al. 2013). These are now publicly available in an

online resource (www.CHOgenome.org) (Hammond et al. 2012) however work is ongoing to

sequence other CHO cell lineages.

1.4.2.1 Selection and amplification systems in CHO cells

There are two main systems for selection and amplification of transfected CHO cells; the

DHFR/MTX system and the GS/MSX selection system. The DHFR system was the first to be developed by Urlaub and Chasin in 1980 through isolation of mutants deficient in the dhfr gene (Urlaub and Chasin 1980). The dhfr gene encodes for the monomeric enzyme dihydrofolate reductase which catalyses the conversion of folic acid to tetrahydrofolate (THF)

(Figure 1.6). THF is an essential cofactor in various biosynthetic reactions including the synthesis of nucleosides (eg. purine, thymidine) and amino acids such as glycine (Urlaub and

Chasin 1980, Jayapal et al. 2007). Selection is mediated by co-transfecting a functional copy of the DHFR gene with the gene of interest into the mutant parental cell line, which is subjected to clonal selection by growing the transfected cells in media lacking in thymidine and hypoxanthine (Jayapal et al. 2007). Amplification is achieved through culturing cells in the presence of methotrexate (MTX), a tetrahydrofolate analogue and DHFR inhibitor (Urlaub et al. 1983, Kotsopoulou et al. 2010). As MTX inhibits DHFR activity, gradually increasing MTX concentrations forces cells to amplify DHFR gene copy numbers to develop a resistance to

MTX as the single exogenous gene is insufficient for cell survival. As the DHFR and gene of interest are genetically linked the gene of interest is also amplified (Jayapal et al. 2007,

Chusainow et al. 2009). Generally high gene copy correlates with high recombinant protein expression, however this is not always the case as MTX amplification can lead to further genetic instability due to chromosomal rearrangements and gene silencing (Yang et al. 2010).

MTX

DHFR

Dihydrofolate + NADPH + H Tetrahydrofolate + NADP

Figure 1.6 Catalysis of dihydrofolate to tetrahydrofolate by DHFR. Dihydrofolate reductase catalyses the conversion of dihydrofolate to tetrahydrofolate, an essential precursor for nucleoside and amino acid biosynthesis. Methotrexate (MTX) inhibits the activity of DHFR.

Glutamine synthase catalyses the conversion of glutamate and ammonia to glutamine in the presence of Mg2+ (Figure 1.7). It is and essential enzyme as it is the only biosynthetic pathway to produce glutamine (Bebbington et al. 1992, Brown et al. 1992). As in the DHFR selection system, GS is co-transfected into GS deficient cells and cultured in glutamine- free media, and amplification is achieved through cultivation with methionine sulphoximine (MSX), a GS inhibitor (Bebbington et al. 1992). Gene amplification and clonal selection occur in a similar way to the DHFR selection system. As GS utilises ammonia, this system also prevents the accumulation of toxic ammonia in the cell (Zhang et al. 2006).

MSX

Mg Glutamate + Ammonia Glutamine

Figure 1.7 Synthesis of glutamine is catalysed by GS. Glutamine synthetase (GS) catalyses the conversion of glutamate and ammonia to glutamine in the presence of magnesium ions.Glutamine is essential for purine and pyrimidine biosynthesis and is used in translation.

Methionine sulphoximine (MSX) inhibits the activity of GS.

1.4.3 Cell-free protein expression

In contrast to the cell-based expression systems described above, cell-free protein synthesis using translationally active cell lysates is currently being explored as a potential method for biopharmaceutical production. Cell-free lysates are prepared from cultured cells by removing cell membranes, nuclei, organelles and endogenous mRNA, resulting in a lysate that contains all the machinery required for in vitro translation (Brodel et al. 2014). They were originally conceived to investigate ribosomal activity and were instrumental in elucidating the genetic code, but recent advances in both scalability and manipulability of this system have highlighted their potential as a rival expression system to host cells (Whittaker 2013). Initially cell-free lysates were prepared from E.coli cells (Nirenberg and Matthaei 1961, Zubay 1973), however theoretically they can be prepared from any cell type including human (Mikami et al. 2008) and

CHO (Brodel et al. 2014). In addition, there are numerous commercially-available systems including extracts from E.coli, wheat-germ, insect and rabbit reticulocytes (Hino et al. 2008). 49

Cell-free protein synthesis can be performed as either a “coupled” reaction, where both transcription and translation occur in the same reaction from a DNA transcript, or

“uncoupled” where translation is performed from an mRNA transcript derived from either in vitro or in vivo sources (Figure 1.8). In vitro transcription, whether in a coupled or uncoupled reaction, is usually initiated using T7 RNA polymerase and therefore requires a T7 promoter upstream of the gene of interest to initiate mRNA synthesis and can be performed on PCR- derived linear templates or plasmids (Casteleijn et al. 2013). Translations can be performed in a closed (batch) system, however depletion of ATP and accumulation of waste products become limiting and the reaction time is restricted (Whittaker 2013). This can be overcome using an open system whereby essential components can be continually replenished and bi- products, such as inorganic phosphates are removed using methodologies such as filtration or dialysis (Yin et al. 2012). In addition to translation, translocation and PTMs such as glycosylation can be performed by including microsomal membranes in the reaction, which are small vesicle-like membranes formed from the endoplasmic reticulum, or through addition of specific enzymes and protein chaperones into the system (Casteleijn et al. 2013).

Cell-free synthesis allows for rapid protein generation as it precludes the need for transfection and cell line generation and can be used to synthesize proteins that are toxic to host cells or that incorporate non-natural amino acids (Casteleijn et al. 2013). Production costs are much lower as cell lysates do not require a growth medium, and protein recovery is simple as it does not require cell lysis, which can denature the protein.

i. DNA ii. Incubate with iii. Purify vi. Incubate mRNA with v. Recover and template from T7 polymerase mRNA cell lysate, ATP and purify protein PCR or plasmid and rNTPs amino acids (optional: microsomes, enzymes, chaperones)

i. Purified ii. Incubate mRNA with iii. Recover and DNA or mRNA cell lysate, ATP and purify protein transcript amino acids (optional: microsomes, enzymes,

chaperones)

Figure 1.8 In-vitro transcription and translation reactions. A. Uncoupled in vitro translation. i.

DNA templates can be derived from purified PCR amplification or plasmids. ii. DNA is then transcribed using T7 polymerase and rNTPs. iii. Resulting mRNA is then purified for use in translation. iv. Translations are performed in cell lysates and require the mRNA transcript, an energy source (ATP) and amino acids. Additional components such as microsomal membranes, radiolabelled amino acids, enzymes and chaperones can be included depending on the intended application. v. Resulting proteins are recovered directly (when not using microsomes) or by ultracentrifugation using a salt gradient to separate “membrane” fractions from “cytoplasmic” fractions. B. i. Coupled translations can be performed using a purified

DNA (PCR or plasmid derived) or mRNA template (from in vitro or in vivo sources) which is added directly to the cell lysate for translation (ii) and purified (iii) as described above.

Recently, cell lysates have been used to synthesis antibody fragments (Ali et al. 2006, Merk et al. 2012, Stech et al. 2012). Although cell-free synthesis can be used for early high-throughput screening, its use for biopharmaceutical manufacture is limited by their relatively low expression levels and process scalability (Whittaker 2013).

1.5 Molecular events that affect recombinant antibody expression in mammalian cells

Protein synthesis in mammalian cells is a highly-regulated process subdivided into a series of orchestrated molecular events, each of which can have a significant effect on recombinant protein yield (Figure 1.9). Engineered antibodies and their fragments can be particularly challenging to produce as they are not naturally expressed by any cell type, and have the potential for encountering “bottlenecks” at any stage of this process. The key factors influencing recombinant protein expression in stably-transfected mammalian cells will be discussed in further detail in the following Sections, with particular emphasis on antibodies.

Figure 1.9 Stages of mammalian protein synthesis and limiting factors in antibody expression.

Protein expression is a multi-stage process consisting of gene insertion, transcription, translation, protein folding, post-translational modifications and secretion. Factors that may influence each stage of expression in relation to recombinant antibody expression are shown in grey italics.

1.5.1 Gene integration and transcriptional silencing

In mammalian cells DNA exists within the nucleus as a nucleoprotein complex known as chromatin, which can exist in either a condensed (heterochromatin) or uncondensed form

(euchromatin). The dsDNA forms a complex with eight basic histone proteins (two copies each of

H2A, H2B, H3 and H4) that coil around and interact with the negatively charged phosphate groups in the DNA, collectively known as a nucleosome. Each nucleosome is approximately

30nm in diameter and repeat along the DNA chain in a “bead-on-string” conformation (Lodish et al. 1995). Chromatin structure can be remodelled through chemical modifications to the histone tails (methylation, acetylation, phosphorylation, ubiquitinylation, sumoylation) (Kouzarides

2007) or via interaction with ATP-dependent chromatin remodelling complexes (SW1/SNF or

NURF) (Hogan and Varga-Weisz 2007). Heterochromatin is transcriptionally inactive, as the condensed structure prevents access by the transcriptional machinery (RNA polymerases, transcription factors, co-factors), whilst the open conformation of euchromatin facilitates transcription (Hahn 1998, Conaway et al. 2005, Crusselle-Davis et al.

2007).

Exogenous DNA must first be delivered into the host cell for synthesis. This can be achieved through physical (DNA injection, electroporation or biolistic deliver) or chemical means (calcium phosphate, cationic polymers or liposomes) or through viral infection (Wurm 2004). Vector constructs are the main delivery vehicle for the gene of interest, and their type and design can have a considerable impact on recombinant protein production. The most commonly used vector system is a plasmid (circular dsDNA) although artificial chromosome engineering (ACE) has also been developed for this application (Lindenbaum et al. 2004). Vectors are usually

54 engineered to contain the gene of interest and a number of regulatory elements such as viral promoters (eg.SV40) (Subramani et al. 1981, Wurm 2004), enhancers (Kriegler 1990), drug resistance cassettes (Dingermann 2008), insulating elements (Geyer 1997) and a selection system such as GS (Bebbington et al. 1992, Brown et al. 1992) or DHFR (Kotsopoulou et al. 2010).

Integration of the recombinant gene into the host genome following transfection with a plasmid is a random event, and the locus of transgene insertion can have a profound impact on transcriptional activity, known as the “position effect” (Pikaart et al. 1998). Transcriptional silencing is caused by chromatin remodelling around the site of insertion, and can effect recombinant protein synthesis by blocking access to transcriptional machinery, resulting in lower mRNA levels and thus lower expression titres (Pikaart et al. 1998).

There are a number of methods which have been employed to counteract the position

effect, such as including regulatory elements such as Scaffold/Matrix attachments regions

(S/MARS) (Kim et al. 2004) Locus Control Regions (LCRs) (Dean 2006) and Ubiquitous

Chromatin Opening Elements (UCOEs) (Zhang et al. 2010) into the vector, thus maintaining

chromatin in an open conformation. Another approach has been to direct site integration

into areas of euchromatin or transcriptional “hotspots” using the FLP-FRT (Zhou et al. 2010)

or Cre-lox recombinase system (Feng et al. 1999). Insertion of a promoter from a highly

transcribed gene (eg. glucocorticoid receptor) or a viral promoter into the vector can also

be used to increase transcript levels and thus specific productivity (Jiang et al. 2006). In

addition, cell culture can be performed in the presence of chemical compounds such as

sodium butyrate (NaBu), that inhibit the activity of enzymes responsible for the inhibition of

histone deacetylation (iHADCs) at specific promoters and thus prevent the formation of

heterochromatin (Jiang and Sharfstein 2008).

Transgene copy number also plays a major role in recombinant protein production. In the

production of antibodies and their fragments the light chain (LC) and heavy chain (HC)

genes are frequently encoded on separate vectors, which can result in different insertion

loci and rates of HC and LC gene transcription (O'Callaghan et al. 2010). This can be

overcome using a single vector, whereby the HC and LC genes are encoded as a single

transcript with translation often mediated by an internal ribosomal entry site (IRES), which

allows control of HC: LC mRNA ratios (Ho et al. 2012). This is of particular interest in

antibody expression, as certain studies have shown that HC: LC mRNA ratios have more

influence on expression titres than gene copy number (Jiang et al. 2006).

1.5.2 Post-transcriptional processing, localization and stability of mRNA

Endogenous mammalian transcriptional units comprise of coding sequences (exons) flanked

by non-coding sequences (introns). Once transcribed, nascent mRNA must first be

processed into its mature form. This process involves the removal of introns through mRNA

splicing and addition of a 5’ untranslated region (UTR), which contains a methyl-guanosine

cap structure and a 3’ UTR polyadenlylation sequence, the latter two of which confer mRNA

stability (Proudfoot et al. 2002). Mature transcripts then fold into an energetically

favourable secondary structure (Babendure et al. 2006), which can influence translation

initiation and will be discussed in the following section. Once the mRNA has been correctly

processed, it must be exported into the cytoplasm for translation.

Recombinant genes usually comprise solely of exons, meaning that mRNA splicing is not involved in recombinant protein expression. However, recent studies in CHO cells have demonstrated that splicing may occur at cryptic sites in the coding sequence, which can have a negative impact on product titre (Bukovac et al. 2008, Wijesuriya et al. 2013). Furthermore, as the large majority of eukaryotic genes contain at least one intron (Burset et al. 2000), it has been speculated that including introns into recombinant expression vectors may facilitate improved expression. As a result, a number of studies have explored the value of including introns within the promoter and 5’ UTR (Kim et al. 2002, Mariati et al. 2010, Mariati et al.

2012) the selection marker (Xiong et al. 2005) and the recombinant gene sequence (Kalwy et al. 2006).

The stability of the mRNA transcript has been shown to influence antibody expression (Hung et al. 2010). It has been reported that LC genes are transcribed faster than HC genes, and that

HC transcripts are less stable than LC (Rodriguez et al. 2004, Jiang et al. 2006). This impacts on HC: LC mRNA ratios during translation and the availability of LC and HC polypeptides for heterodimerisation into a full antibody protein, which can result in lower antibody yield and increased antibody aggregation (Chusainow et al. 2009, Ho et al. 2013).

In mammalian cells mRNA can also be sequestered in a functionally inactive state in cytoplasmic mRNA granules. There are two distinct type of granule; stress granules and processing bodies, which differ both in function and composition (Buchan and Parker 2009).

Stress granules are formed in response to impaired translation initiation and consist of mRNA and various ribonuclear proteins including the small 40s ribosomal subunit and translation

initiation factors such as eIF2α and polyA binding protein (PABP). Processing bodies (P-bodies)

occur in response to cellular stress such as nutrient deprivation and ER-stress, and in addition

to mRNA and ribonuclear proteins also contain mRNA decay machinery. It is believed that

these two granule types are spatially distinct, but interact to confer another level of mRNA

control. mRNA granules have been studied most extensively in yeast cells in response to

nutrient starvation (Pizzinga and Ashe 2014) but have also been observed in mammalian COS-7

cells in response to extreme cold-shock (Hofmann et al. 2012).

1.5.3 Translation and translocation to the ER

Protein translation is a complex process of initiation, elongation and termination, which can be

affected by a number of factors (Figure 1.10). Translation initiation is generally considered to

be the rate limiting step in protein synthesis (Sonenberg and Hinnebusch 2009). During this

process mRNA associates with the ribosomal subunits, which is facilitated by the recruitment

of eukaryotic initiation factors (eIFs), RNA binding proteins such as the polyA-binding protein

(PABP) and a tRNA that is charged with methionine. Collectively, these factors are known as

the pre-initiation complex (Proudfoot et al. 2002). The secondary structure of mRNA can

influence translation initiation by preventing the binding of this pre-initiation complex, and

whilst this effect is more commonly associated with prokaryotic translation (Bai et al. 2014)

recent studies have shown that this can also affect eukaryotic translation initiation (Babendure

et al. 2006). Translation initiation can also be inhibited through phosphorylation of the eIF2α

protein by the S6K1 kinase, which can occur as a result of UPR activation (Section 1.5.4). Small

non-coding RNAs (e.g. siRNA, and microRNA) can provide another level of translational control

through binding to the mRNA transcript and mediating translational repression or targeting

mRNA for degradation (Wu 2009, Krol et al. 2010, Jadhav et al. 2013).

Figure 1.10 Factors affecting protein translation. Translation begins with a correctly processed mRNA which is exported into the cytoplasm. Translation initiation is often considered the rate limiting step in translation, and requires the recruitment of the 40s and

60s ribosomal subunits, eukaryotic initiation factors (eIFs) and RNA binding proteins (PABP).

Elongation proceeds through recruitment of transfer RNAs charged with an amino acid into the acceptor (A) site of the ribosome, peptide bonds are formed in the P site and used tRNAs are ejected at the E site. Secreted proteins are co-translationally translocated to the endoplasmic reticulum (ER) for folding and post-translational modification though interaction of the signal recognition protein (SRP) and the signal peptide on the emerging polypeptide.

Molecular events which may affect each stage of translation are shown in grey. 59

Once translation has been initiated, elongation may proceed. During this stage the nascent polypeptide is synthesised through recruitment of tRNAs that are charged with the appropriate amino acid for the current mRNA codon to the acceptor (A) site of the ribosome.

Both translation initiation and elongation are ATP-driven processes, and as such cellular metabolism can contribute to the expression of both endogenous and recombinant proteins and is an area of intense research (Altamirano et al. 2013).

Certain tRNAs codons and their cognate amino acid can differ between species, causing a deficit in required tRNAs which can result in premature protein synthesis termination, amino acid misincorporation or translation frameshift resulting in a biologically inactive product.

Several strategies have been conceived to overcome this problem, including site-directed replacement or co-expression of rare codons and changes made to culture conditions such as the addition of a highly-used amino acid (Terpe 2006, Ferrer-Miralles et al. 2009). Codon adaption, where rare tRNA codons are exchanged for abundant tRNA codons, is a gene optimization technique which can be used to overcome the limitations of codon usage in protein translation (Gustafsson et al. 2004, Welch et al. 2009). One potential consequence of slow translation is the recognition of the polypeptide as aberrant, resulting in co-translational degradation of the nascent polypeptide at the proteasome, which has been identified in yeast cells (Verma et al. 2013).

Proteins that are destined for the secretory pathway are translocated into the endoplasmic reticulum in a co-translational manner. The N-terminus of the emerging nascent polypeptide contains a signal sequence between 5-30 hydrophobic amino acids which is recognised and bound by the signal recognition particle (SRP) (Keenan et al. 2001). The SRP then associates with the membrane-bound SRP receptor (SR) and facilitates the association of the ribosome

and nascent polypeptide to the ER translocon in a GTP-dependent manner. The ER translocon comprises of three major proteins, Sec61α, Sec61β and Sec61γ (collectively termed the Sec61 complex) and accessory factors. Once docked with the Sec61 complex the SRP dissociates allowing the cytosolic face of the translocon to be sealed by the ribosome. At the ER-face of the translocon BiP is released from the Sec61 complex, which opens the ER face of the translocon and allows entry of the nascent polypeptide into the ER (Swanton and Bullied

2003). Following this initial delivery to the ER translation elongation proceeds, with the emerging polypeptide being delivered directly to the ER. If incorrectly localized the protein is not secreted, and may be targeted for degradation. Therefore some research groups have sought to improve this process through engineering the signal peptide (Zhang et al. 2005) and proteins in the SRP complex (Le Fourn et al. 2014).

1.5.4 Protein folding and post-translational modifications

Protein folding commences once the N-terminus of the nascent polypeptide enters the ER, and allows for protein domains to fold independently, which is thought to improve folding efficiency of multimeric proteins (Netzer and Hartl 1997). In the case of antibodies, each domain (variable and constant domains) and the heterodimerisation of the HC and LC polypeptides are stabilised by disulphide bonds. The ER provides an oxidising environment in which disulphide bond formation can occur and is mediated by oxioreductases, the most common of which is protein disulphide isomerase (PDI) (Davis et al. 2000). Once each domain is folded mAb assembly occurs via one of two proposed pathways, either through a HC-LC intermediate or via a HC2 intermediate (Figure 6.1) (O’Callaghan et al. 2010, McLeod et al.

2011). In addition, a third assembly route has been proposed that suggests these two pathways occur concomitantly (Mead et al. 2012). In antibody expression, heterodimerisation of the HC and LC polypeptides is considered to be the major bottleneck in expression (Martin et al. 1998,

Elkabetz et al. 2005, Mason et al. 2012). Although LC can be secreted freely into the culture medium, the CH1 domain of the heavy chain associates with the BiP chaperone in the ER and is only released following interaction with the LC, which displaces BiP (Leitzgen et al. 1997).

N-linked glycosylation on asparagine-297 of the antibody CH2 domain is crucial for its functionality in vivo (Carter 2006). N-linked glycans are complex carbohydrate structures that are attached by the oligosaccharyl transferase complex at a defined consensus sequence

(Nilsson and Vonheijne 1993). For N-linked glycosylation this motif is typically NXST, where X must be any amino acid but proline, however non-consensus sequences have also been identified (Valliere-Douglass et al. 2010). Following its attachment, two glucose moieties are cleaved from the oligosaccharide by the glucosidase enzymes I and II. This structure can interact with lectin chaperones within the ER such as calnexin and calreticulin, which mediate another quality control mechanism; the calnexin/calreticulin cycle (Hammond et al. 1994). In this process misfolded proteins are sequestered in the ER by the lectin chaperones and following further mannose trimming by the ER-degradation enhancing alpha- mannosidase- like proteins (EDEMs), can be targeted into proteolytic degradation pathways (Section 1.5.6)

(Lederkremer 2009) whilst correctly folded and processed proteins do not bind to lectin chaperones, and thus proceed into the Golgi for secretion (Section 1.5.7).

1.5.5 The unfolded protein response

Overexpression of a protein can elicit a physiological cellular response known as the unfolded protein response (UPR), which is activated by the members of the Hsp70 family of chaperones including BiP (GRP78) when protein synthesis exceeds the folding capacity of the

ER. This effect is mediated through signalling cascades (Figure 1.11) that are initiated by three transmembrane receptors; protein kinase RNA-like endoplasmic reticulum kinase (PERK), inositol-requiring enzyme 1 (IRE1) and X-box binding protein 1 (XBP1) (Malhotra and

Kaufman 2007). These proteins act as sensors for unfolded and misfolded polypeptides, which bind to these receptors and activate their downstream signalling cascades. In addition, the BiP chaperone binds these receptors on their ER-terminus in unstressed conditions.

When proteins aggregate in the ER BiP is released from these receptors in order to bind the misfolded protein, and thus activate the receptors and initiates the UPR response. The functional consequences of UPR activation include targeting of the misfolded protein into degradation pathways, phosphorylation of the eIF2α protein which attenuates global protein synthesis, and in severe cases can induce apoptosis (Hussain and Ramaiah 2007, Malhotra and Kaufman 2007, Khan and Schroder 2008).

The UPR is a major bottleneck in the production of many types of recombinant protein, and as a result a number of cell line engineering strategies have been conceived to improve the innate folding capacity of CHO cells through the overexpression of key regulatory proteins and transcription factors such as XBP1 and ERO1Lα (Cain et al. 2013), ATF4 (Haredy et al. 2013) and ATF6 (Khan and Schroder 2008).

Figure 1.11 Signalling cascades and the unfolded protein response. The IRE1, PERK and ATF6 sensors regulate the unfolded protein response. In unstressed conditions BiP binds to these receptors in the ER lumen preventing downstream signalling. Accumulation of unfolded proteins initiates the ER stress response and BiP binds to unfolded proteins activating IRE1, PERK and ATF6. The IRE1 protein dimerises following binding of unfolded/misfolded proteins, activating its kinase domain and RNAse activity which splices XPB1 mRNA to form a potent transcription factor. XBP1 enters the nucleus and upregulates genes for endoplasmic reticulum associated degradation (ERAD) of unfolded proteins and chaperones. PERK dimerises upon release from BiP and is activated by autophosphorylation. Its activated kinase domain then phosphorylates elongation initiation factor 2α (eIF2α) which attenuates protein translation and induces translation of the ATF4 transcription factor which regulates genes associated with anti-oxidative stress, amino acid biosynthesis, chaperones and CHOP-mediated apoptosis. When BiP releases ATF6 the 90kDa protein migrates to the Golgi where it is cleaved by S1P/S2P proteases. The resulting 50kDa transcription factor that enters the nucleus where it upregulates genes associated with XBP1, chaperones and CHOP-mediated apoptosis. 64

1.5.6 Protein degradation pathways

There are two major pathways in proteolytic degradation; lysosomal and proteasomal.

Lysosomal degradation occurs in the lysosome, a membrane-bound organelle which

contains aspartic, serine and cysteine proteases known as Calpains, Cathepsins (Brix and

Saftig 2005). Degradation via the lysosome is usually mediated by the autophagy-lysosomal

pathway (Eskelinen and Saftig 2009), however this pathway has also been implicated in ER-

stress associated degradation (ERAD) (Fujita et al. 2007). ERAD is activated in response the

EDEM trimming of glycan structures (Section 1.5.4), which targets misfolded proteins for

degradation via the addition of ubiquitin molecules. Ubiquitinylated proteins are retro-

translocated to the cytoplasm where they undergo proteolysis at the proteasome, a large

protein complex comprised of α and β subunits with chymotrypsin-like, trypsin-like and

caspase-like activity (Goldberg 2013).

Small chemical molecules have been developed that inhibit the activity of specific

degradation pathways (Table 1.3) through targeting the catalytic activity of lysosomal

proteases or subunits in the proteasome (Lee and Goldberg 1998, Kisselev and Goldberg

2001). These inhibitors have been developed both as tools for elucidating degradation

pathways in cultured cells and as drugs for the treatment of various cancers (Goldberg 2013,

Guo and Peng 2013). Both the ERAD (Vergara et al. 2010) and the autophagy/lysosomal

pathways (Kawai et al. 2007) have been identified in CHO cells, however in the context of

biopharmaceutical production ERAD is considered the primary degradation pathway due to

its activation by the UPR.

Peptidase Degradation Protease activity Inhibitor activity References pathway inhibited inhibited

(Oerlemans et al. Chymotrypsin 2008) Bortezomib* activity of the β5 None (Kisselev and 20S proteasome Goldberg 2001) Proteasomal Chymotrypsin, caspase and Lactacystin/ (Fenteany and trypsin-like None β lactone Schreiber 1998) activity of the proteasome Chymotrypsin and caspase-like Proteasomal (Goldberg 2013) activity of the Calpains and MG132* (Guo and Peng 20S proteasome Cathepsins lysosomal 2013) (β5 and β1 subunits) Plasmin, trypsin, (Aoyagi et al. 1969, Leupeptin* None papain, Baici and calpain and Gygermarazzi 1982) cathepsin B Pepsin, Lysosomal (Barrett and Dingle renin, Pepstatin A* None 1972, Tumminello cathepsin D, et al. 1993) cathepsin E Enzymes (Livesey, Tang Chloroquine None requiring an et al. 2009) acidic pH

Table 1.3. Chemical inhibitors of proteolytic degradation pathways and the peptidase or protease activity inhibited. * indicates inhibitors used in this Thesis (Section 4.6).

1.5.7 Secretion

Secretion is the final stage in protein expression whereby recombinant proteins are transported in membrane-bound vesicles which fuse to the plasma membrane and release the protein into the production medium (Peng and Fussenegger 2009). Coat protein complex II (COPII) vesicles transport proteins from the ER to the Golgi and COPI vesicles traffic proteins within the Golgi stack and to the plasma membrane (Kartberg et al. 2010).

Vesicle formation begins with the sequestration of the protein by transmembrane cargo receptors on the internal surface of the membrane to form a pit. This occurs simultaneously with binding on the external surface of the membrane of adaptins and clathrin or COPI/COPII coat proteins (Wendland 2002). The protein cargo is then internalised within the pit and the vesicle is released from the membrane via an ATP-driven process mediated by dynamin. At the target membrane vesicle fusion is regulated by SNAREs (soluble NSF (N-ethylmaleimide- sensitive factor) attachment receptors) which anchor the vesicle to the membrane with high specificity

(Robinson et al. 1998) and members of the Sec1/Munc18 (SM) protein family which catalyse this process (Peng and Fussenegger 2009). During fusion with the target membrane the vesicle is uncoated via the activity of ARFs (ADP-ribosylation factors), ARFGEFs (ARF guanine-exchange factors) and ARFGAPs (ARF GTPase-activating proteins) (Kartberg et al. 2010). In addition the ceramide transfer protein (CERT) is involved in anterograde transport from the ER to the Golgi, and loses its transfer activity following phosphorylation (Florin et al. 2009).

In biopharmaceutical production the rate through the secretory pathway can affect product titre, particularly in high producing cell lines, which is why numerous studies have focussed on cell-line engineering strategies that target the activity of secretory proteins with a view of improving secretion efficiency and cell specific productivity (Peng and Fussenegger 2009). In HEK cells overexpression of Munc18b has been shown to improve their secretory capacity for various human glycoproteins (Peng et al. 2010). Whilst in CHO cells IgG expression has been improved through co-expression of the mAb with a modified non-phosphorylatable form of the CERT protein (Florin et al. 2009).

1.5.8 Amino acid variations in antibody domains affect mAb expression

In endogenous protein expression, mutations to the nucleotide or amino acid sequence can have a severe impact on protein expression levels, as mutated proteins can be cytotoxic to the cell.

Many disease states are associated with amino acid mutations, including cystic fibrosis (Valle and Vij 2012), Gaucher’s disease (Bendikov-Bar and Horowitz 2012), muscular dystrophy (Fujita et al. 2007) and autoimmune diseases (Evsyukova et al. 2010). The functional consequences of sequence variation are numerous, and include incorrect splicing, mRNA decay, protein aggregation and/or degradation.

There is growing evidence that variations in both nucleotide and amino acid sequence have a significant impact on the expressibility of recombinant IgG antibodies in host cells. A number of independent studies have demonstrated how antibody sequence variants can result in low antibody titres in a range of industrially relevant cell lines (Wiens et al. 1997, Martin et al. 1998,

Wiens et al. 2001, McLean et al. 2005, Mason et al. 2012, Stoops et al. 2012, Pybus et al. 2014).

Sequence variations have been identified in both the constant and variable domains of IgGs

68 (Table 1.4). Despite the hypervariable nature of CDRs in the variable domains, single amino acid mutations within these regions have been shown to severely impact on expression titres (Martin et al. 1998, Pybus et al. 2014). The bottleneck in expression for the majority of these published examples is misfolding of the heavy chain leading to intracellular accumulation either within the

ER or in ER-bound inclusion bodies known as Russell bodies (Stoops et al. 2012) or are channelled into degradation pathways (McLean et al. 2005). Mason et al., (2012) observed a single nucleotide substitution resulting in an Ala > Gly amino acid variation in the FWR2 of the

VH domain resulted in lower expression in both transient and stable CHO cells. In transient expression this was attributed to poor folding whilst in stable cells a lower abundance of HC and

LC mRNA was observed. However it was postulated that the lower abundance of mRNA was related to the clonal selection process, whereby high-producing cells may result in activation of the UPR and only those cells producing HC protein at a level that can be correctly processed by the ER survive.

As novel format antibodies are based on the domains of natural IgGs it is conceivable that variations in amino acid sequence may also affect their expression. However the consequences of amino acid variations on novel format antibodies have not been so extensively studied.

Site of Expression Cell line Variation Reference variation bottleneck (Transfection)

Murine VH Wiens et al. 1997 Ile51 > Arg/Lys myeloma CDR2 Wiens et al. 2001 (Stable) Defective mAb assembly (HC to Multiple SP2/0 LC impaired) and Martin et al. 1998 variations (Stable) HC retention in the ER CHO-S 49 VH Ala > Gly FWR2 (Transient) (GGA, GGC, Mason et al. 2012 GGG and GGC HC folding/low CHO-K1 codons) abundance of HC (Stable) mRNA

VL COS-1 Ala60 > Val Block in secretion Dul and Argon 1990 CDR2 (Transient)

Prevents CH1-CL Cys > Ser disulphide bond COS-7 (Cys128, 140 and formation and Elkabetz et al. 2005 (Transient) 195) caused HC CH1 rentention Defective folding Multiple HEK and CHO and HC retention Stoops et al. 2012 variations (Transient) in Russel Bodies Prevents disulphide bonds in HC dimer HEK Pro368 > Leu CH3 formation, McLean et al. 2005 (Transient) resulting in HC retention in ER and possible ERAD

Table 1.4. Location and effect of amino acid variations in IgG antibodies in mammalian cell lines.

70 1.6 Project summary and aims and objectives

Recombinant antibody expression is a co-ordination of many complex cellular events including transcription, translation, polypeptide folding, post-translational modification and secretion. These molecular events can be considered collectively as determinants of expression. Expression bottlenecks, whereby protein production cannot pass a certain point in expression, can occur at any stage of the process and are a related these molecular determinants (Section 1.5). Studies on monoclonal antibody expression have shown that antibody expression can be limited by one or more of these expression bottlenecks.

Furthermore, through sequence variant analyses it has been shown that expression of monoclonal antibodies is affected by both nucleotide and amino acid sequences (Section

1.5.8).

Engineered antibody formats are a rapidly expanding group of biopharmaceuticals, however they can be challenging for host cells to produce. This means that novel format antibody production has the potential for higher attrition rates, influencing product development, cost of goods, entry into the clinical pipeline and market release. It is therefore important to understand the molecular mechanisms that govern poor expression of these new constructs.

CH2

CH3 CH3

Figure 1.12 Schematic diagram of a mAbdAb. The dual targeting novel format antibody in this project consists of a humanized IgG1 (Alemtuzumab, Campath) which is common to all constructs in this project. A single domain antibody (dAb) raised against hen egg white lysozyme (HEWL) by phage display technology using VH and Vk phage libraries is attached to the CH3 domain of the IgG1 via a proprietary peptide linker (purple). Sequence variations between constructs are only present in the CDR of dAbs (yellow).

72 The overall aim of my project is to investigate how sequence variations affect the expression of a dual targeting novel format antibody. In this project I have used a panel of dual-targeting novel format antibodies (mAbdAb, Figure 1.12). The mAbdAb structure consists of a humanized IgG1 antibody

(Alemtuzumab) with each unique construct containing a dAb attached at the C-terminal end of the

HC protein by means of a proprietary peptide linker. Phage display selection was used to generate the panel of dAbs specific for a common antigen (HEWL).

A better understanding of what governs the expression of mAbdAbs may help to direct future strategies to improve the expression of this novel antibody format. It may also offer general insights into what molecular determinants affect expression of other novel format antibodies in order to alleviate the cost of goods for the manufacture of engineered antibodies and thus their progression into the biopharmaceutical market. In order to achieve this aim, a number of specific objectives have been generated:

 Generate a panel of mAbdAbs which contain a common mAb (Alemtuzumab) attached to

a range of sequentially unique dAbs with specificity for a common antigen

 Determine the expressibility of these mAbdAbs in a HEK transient screen in order to

identify candidates for analysis in a CHO stable system

 Generate CHO stable cell lines expressing mAbdAb sequence variants and characterise

their expression at discrete stages of protein synthesis to investigate the functional

consequence of dAb sequence variation on mAbdAb expression

 Determine whether mAbdAb expression can be improved through employment of

industrially relevant process optimisation techniques

73 The results obtained in this Thesis are presented in the form of three discrete results Chapters, with detailed discussions appearing at the end of each Chapter. Chapter 3 concerns the generation of mAbdAb constructs, which were used throughout the remainder of this Thesis. Chapter 4 focuses on the expressibility of mAbdAb constructs in HEK transient and CHO stable expression platforms and the consequences of sequence variation on mAbdAb expression in CHO cells. Chapter 5 is an evaluation of whether mAbdAb titres can be increased through process optimization. Finally, this

Thesis concludes with an overall discussion in Chapter 6.

CHAPTER 2: MATERIALS AND METHODS

75 2.1 Materials and equipment

2.1.1 Sources of chemicals, reagents and equipment

All chemicals and reagents used were of the highest grade and were obtained from standard

sources. A full list of materials and equipment and their suppliers can be found in Appendix I.

2.1.2 Preparation of Solutions

All solutions were made up in miliQ water (ddH20) unless otherwise stated. Solutions were

sterilised in a LTE Scientific Series 250 autoclave, or by filtration through a 0.22µm filter

where autoclaving was not viable. Solutions were stored at room temperature unless

otherwise stated. Where required pH measurements were taken on a Mettler Toledo

SevenEasy S20 pH meter using a glass probe and adjusted using hydrochloric acid or sodium

hydroxide as appropriate.

76 2.2 Generation of novel-format antibodies

2.2.1 Phage libraries used for the selection of anti-hen egg white lysozyme (HEWL) domain antibodies (dAbs)

Four synthetic fully human dAb repertoires (supplied by GSK, Domantis) were used for

selection of anti-HEWL dAbs. Three libraries were based on a single human VH framework

(V3- 23 [locus] DP47 [V Base entry) with the fourth consisting of a single human VL (kappa

light chain) framework (012/02 [locus] DPκ9 [V Base entry) with NNK side chain

diversification (where N = A, T, G or C and K= G or T) pertaining to the CDRs of the dAb.

Diversification of the dAbs occurred at the positions indicated below according to the Kabat

numbering system (Johnson and Wu 2000):

Vκ:

Vκ CDR1: L28, L30, L31, L32, L34.

Vκ CDR2: L50, L51, L53.

Vκ CDR3: L91, L92, L93, L94 and L96.

13 residues randomized in total

VH:

VH CDR1: H30, H31, H33, H35.

VH CDR2: H50, H52, H52a, H53, H55 and H56.

VH CDR3: 4-12 diversified residues: e.g. H95, H96, H97, and H98 in 4G H11 and H95, H96,

H97, H98, H99, H100, H100a, H100b, H100c, H100d, H100e and H100f in 4G H19

(Ignatovich et al. 2012).

77 The VH (variable heavy chain) libraries differ in terms of the length of the CDR3. The VHS

library contains the shortest CDRs with 4 diversified residues, the VHM library contains 8

diversified residues in the CDR3 and the VHL library contains 12 diversified residues. In

contrast, the VK library consists of variable light domains with 5 diversified residues. Both

passive (Section 2.2.2) and soluble (Section 2.2.3) selections were performed in parallel with

the same phage libraries and protocols downstream of selection common to both selection

procedures (Section 2.2.4 to Section 2.2.10). All phage contaminated materials were

decontaminated in Precept (1000ppm free chlorine bleach solution).

4G Phage Library Phage Concentration TU/ml 11 VHS 2x10 11 VHM 1x10 11 VHL 1x10 11 VK 5x10

Table 2.1 Original 4G Phage Library Titres for Round 1 Selection of anti-HEWL dAbs

2.2.2 Passive Phage Selection

A Nunc Maxisorp immune test tube was coated overnight with 100μg/ml crystalline hen egg

white lysozyme in PBS (pH7.4) at 4oC with rotation. The solution was discarded and the tube

was washed 3 times in PBS and blocked for 1hr at room temperature with 4ml 2% [w/v]

MPBS (Marvel dried skimmed milk powder in PBS) on a fixed speed rotator. The blocking

solution was discarded and the tube washed as before. 1ml of phage library ((VHS, VHM, VHL

or Vk)(Table 2.1) ) was added to the tube in 2% [w/v] MPBS in a final volume of 4ml and

incubated 1hr at room temperature with rotation and a further hour in static conditions (in

78 subsequent selection rounds 100µl precipitated phage was used in place of the phage libraries (Section 2.2.6)). The supernatant was discarded and the tube washed 10 times with

4ml PBS containing 0.1% [v/v] Tween-20. Bound phage were eluted with 500μl trypsin-PBS

(50μl 10mg/ml Trypsin (T-8642 Type XIII from Bovine Pancreas) in 50mM Tris-HCl pH 7.4,

1mM CaCl2) added to 450μl PBS) at room temperature for 10min with rotation. The eluate was then used to determine eluted phage titre (Section 2.2.4). Eluates were also amplified through infection of TG1 E.coli (Section 2.2.5) and precipitated (Section 2.2.6) for use in further rounds of selection. Two further rounds of selection were performed to enrich the population of HEWL-specific phage using 100µl of resuspended precipitated phage (Section

2.2.6) from the previous selection round in place of the original phage library (Table 2.1) and lower concentrations of HEWL antigen (10µg/ml and 1µg/ml HEWL for round 2 and 3 selections respectively).

2.2.3 Soluble phage selection

2.2.3.1 Biotinylation of hen egg white lysozyme (HEWL) for soluble selection

Crystalline hen egg white lysozyme was resuspended at 1mg/ml in PBS and biotinylated using an EZ-Link Sulpho-NHS-LC-Biotin kit with 10mM biotin dissolved in DMSO. HEWL was biotinylated at room temperature for 30mins using a 4:1 challenge ratio of Biotin: HEWL.

The extent of biotinylation was assessed using a Waters Micromass Q-TOF Ultima API mass spectrometer and Mass Lynx software (Figure 2.1). Unbiotinylated HEWL in PBS (Figure 2.1

A) showed a single peak at 14297Da. After 30mins incubation with a 4:1 molar excess of biotin: HEWL (Figure 2.1 B) there were four peaks, indicating that there are four different

species within the sampled antigen population. Each peak had a mass shift of 226 mass

units, relating to the addition of a biotin molecule. The peak at 14297 indicates that there is

still some unbiotinylated product in the sample. The highest peak is at 14523 mass units,

which indicates that the predominant species within the mixed population has one biotin

molecule per HEWL. After 1hr incubation (Figure 2.1 C) five peaks were detected.

Unbiotinylated HEWL (14927 mass units) was still present within the population, but had

decreased in abundance. The predominant peaks after one hour indicated HEWL with a

single biotin molecule (14523 mass units) and two biotin molecules (14748 mass units).

There are two further peaks of less abundance in the population relating to HEWL with

three (14974) and four (15201 mass units) biotin molecules. In the first two peaks of Figure

2.1 B and all the peaks in Figure 2.1 C there is an additional peak attached to the right of

each species which is an additional 16 mass units, suggesting that oxidation is occurring

during the reaction. There is also a smaller peak to the left which relates to the loss of 17

mass units, which could suggest the loss of an amine group or water during the reaction.

The optimum level of antigen biotinylation is between 1 and 2 biotin molecules per antigen,

and ideally there should be a mixed population of biotin molecules and the lysine residue to

which the biotin is attached. For this reason biotinylation was performed for 30mins under

the conditions stated above and the surplus biotin was then removed by buffer exchange

into PBS (Section 2.2.3.2).

2.2.3.2 Buffer exchange of biotinylated HEWL

Biotinylated HEWL (Section 2.2.3.1) was inserted between the membranes of a 3,500 MWCO

Slide-A-Lyser Dialysis cassette using a 2ml syringe mounted with a 21g needle. The cassette was inserted into a polystyrene float, placed into a large beaker containing PBS and incubated for 2hrs at 4oC under agitation. The cassette was transferred into fresh PBS and incubated a 80

A unbio lysozyme 14296

100 %

0 mass 14250 14500 14750 15000 15250 15500 15750 B B-lys 4:1

14523 100 14519

14297

14749 %

14314 14976 0 mass 14250 14500 14750 15000 15250 15500 15750

C B-lys 4:1

14523 100 14748

% 14297 14974 14539 14766 14314 14992 14732 15201

0 mass 14250 14500 14750 15000 15250 15500 15750

Figure 2.1 Mass spectrometry analysis of biotinylation HEWL showing percent of species of a particular mass. Hen egg white lysozyme was biotinylated and analysed by mass spectrometry as described in Section 2.2.3.1 and buffer exchanged into PBS (Section 2.2.3.2). A. Unbiotinylated

HEWL in PBS. B. HEWL after 30mins with 10mM biotin at a ratio of 4:1 biotin: HEWL. C. HEWL after 1hr with 10mM biotin at a ratio of 4:1 biotin: HEWL. 81 further 2hrs and the process was repeated. After the third incubation the biotinylated HEWL solution was removed from the cassette into a fresh microcentrifuge tube using a 2ml syringe and

21g needle. The biotinylated HEWL was used in soluble phage selection (Section 2.2.2.3). The same biotinylated HEWL was used for all subsequent soluble selections (Section 2.2.3.3).

2.2.3.3 Soluble phage selection of anti-HEWL dAbs using biotinylated HEWL

1ml phage library ((VHS, VHM, VHL or Vk) (Table 2.1)) was blocked for 1hr at room temperature with

2% [w/v] MPBS in a final volume of 1.5ml in a 2ml microcentrifuge tube (in subsequent selection rounds 100µl precipitated phage was used in place of the phage libraries (Section 2.2.6)). The blocked phage was then supplemented with 1000nM biotinylated HEWL and rotated for 1hr at room temperature. 100µl streptavidin-coated paramagnetic Dynabeads were washed once in 0.1%

[v/v] Tween-20 in PBS, captured on a magnetic rack washed again with PBS and blocked on rotation in 2% [w/v] MPBS for 1hr at room temperature. The blocked streptavidin-coated paramagnetic beads were captured on the magnetic rack, the supernatant removed and the HEWL-phage mix was added to the beads and rotated at room temperature for 5min. The HEWL-phage-biotin mix was washed 8 times in 1ml 0.1% [v/v] PBST and once with 1ml PBS followed by elution with 500μl

1mg/ml Trypsin (T-8642 Type XIII from Bovine Pancreas in 50mM Tric-HCl pH 7.4, 1mM CaCl2) added to 450μl PBS) using a KingFisher™mL Magnetic Particle Processor. The eluate was then used to determine eluted phage titre (Section 2.2.4). Eluates were also amplified through infection of

TG1 E.coli (Section 2.2.5) and precipitated (Section 2.2.6) for use in further rounds of selection. Two further rounds of selection were performed to enrich the population of HEWL-specific phage using

100µl of resuspended precipitated phage (Section 2.2.6) from the previous selection round in place of the original phage library (Table 2.1) and lower concentrations of biotinylated HEWL antigen

(100nM and 10nM biotinylated HEWL for round 2 and 3 selections respectively) and streptavidin- coated paramagnetic beads (50µl and 25µl in rounds 2 and 3 respectively).

2.2.4 Determination of eluted phage titre

Eluted phage titre was determined after each round of selection to monitor successful selection.

Each phage library was assayed independently. A 10-fold dilution series (10-1 to 10-6) of eluted phage (VHS, VHM, VHL or Vk) in PBS (from Section 2.2.2 for passive and Section 2.2.3.3 for soluble selection) was prepared in a 96well microtitre plate and 10μl of each dilution used to infect 90μl

TG1 E.coli (OD600 nm of 0.4) in 2xTY medium (16g Tryptone, 10g Yeast Extract, 5g NaCl in 1L H2O).

The infected E.coli was incubated 30min at 37oC in an incubator and 10μl of each infection was spotted onto dried 9cm diameter agar selection dishes (2xTY with TYE, 15μg/ml tetracycline). Agar plates were then tipped to a 45o angle to allow the spots to form lanes. Plates were inverted and incubated overnight at 37oC in an incubator and eluted phage titre was determined by counting the number of colonies (at a dilution factor where individual colonies were visible) and titre was defined using the following calculation:

Number of colonies in spot x dilution factor x 10 x 100 = eluted phage titre TU/ml

2.2.5 Amplification of eluted phage in TG1 E.coli

A single colony of TG1 E.coli was picked from a 9cm Minimal Medium plate and grown overnight

83 at 37oC with shaking at 250rpm in 5mL 2xTY medium. The overnight culture was subcultured at a

1:5 ratio in 2xTY medium and grown to log phase (OD600 nm of 0.4). 1.75ml TG1 E.coli (OD600 of

0.4) was added to 250μl eluted selected phage (Section 2.2.2 and Section 2.2.3) and incubated for 30min at 37oC. The cultures were centrifuged at 11,600xg for 1min and the bacterial pellet was resuspended in 200μl 2xTY and plated onto two 9cm diameter agar selection dishes (2xTY with TYE, 15μg/ml tetracycline). Plates were inverted and incubated in an incubator overnight at

37oC. The following day the 9cm petri dishes were washed with 1.8ml 2xTY + 15% [v/v] glycerol, loosened with a glass spreader and 100μl was used to inoculate 50ml 2xTY supplemented with

15μg/ml tetracycline in a 250ml vented shake flask. The remaining phage- infected TG1 E.coli glycerol stock was stored at -80oC. Flasks were incubated overnight at 37oC shaking at 250rpm.

2.2.6 Precipitation of amplified eluted phage

The overnight culture (from Section 2.2.5) was centrifuged at 3,300xg for 15min and 40ml supernatant was transferred to a 50ml falcon containing 10ml PEG NaCl (20% [w/v] PEG, 2.5

M NaCl) and incubated on ice for 1hr (the bacterial pellet was stored at -20oC). The tubes were centrifuged at 3,300xg for 30min at 4oC and the supernatant was discarded. The pelleted precipitate was resuspended in 1.8ml PBS and centrifuged at 13,000xg for 10min.

The supernatant was transferred to a fresh tube and 200μl 50% [v/v] glycerol was added and this mixture (precipitated phage solution) was stored at -20oC and the bacterial pellet was discarded. The titre of resuspended precipitated phage was then determined to confirm successful phage amplification using a spectrophotometer at OD260 at a dilution of 1/100 in

PBS and titre estimated using the calculation below and 100μl of resuspended

84 precipitated phage were used in round 2 and 3 of selections instead of the phage library in order to enrich the population of HEWL-binding phage.

11 OD260 x 100 (dilution) x 2.2x10 = precipitated phage titre TU/ml

2.2.7 Overnight deep-well culture of selected phage-infected TG1 E.coli

Once eluted phage titre was determined (Section 2.2.4), 22 individual colonies from each agar plate (one per phage library (VHS, VHM, VHL and Vk) for passive and soluble selection) were picked and grown in 200μl 2xTY (supplemented with 15μg/ml tetracycline) in 96 deep well culture plates. Culture plates were sealed with a gas permeable adhesive seal and grown overnight in a humidified atmosphere at 37oC and shaking at 250rpm. Deep well plates were then centrifuged at 1,800xg for 10min at 4oC. The supernatants containing phage were assayed for binding specificity by phage ELISA (Section 2.2.8) and bacterial pellets were used for colony PCR with subsequent DNA sequencing to determine sequence diversity (Section 2.2.10).

2.2.8 Determination of binding specificity of selected phage by ELISA

96well Nunc Maxisorp assay plates coated overnight at 4oC with 100μl per well of HEWL in PBS at the same concentration used for selection (100μg/ml, 10μg/ml and 1μg/ml HEWL or 1000nM,

100nM and 10nM biotinylated HEWL for passive and soluble selections, rounds 1, 2 and 3 respectively). The HEWL coated 96well Nunc Maxisorp plate and a fresh, non-coated control plate were washed 3 times in PBS then blocked for 1hr at room temperature in 2% [w/v] milk in

PBS (MPBS). The plates were then washed 3 times with PBS and incubated for 1hr at room

85 temperature with 150μl bacterial supernatants (from Section 2.2.7)/well in 4% [w/v] MPBS. The plates were washed 5 times with 0.1% [v/v] PBST (0.1% Tween-20 in PBS) and incubated at room temperature for 1hr after the addition of 50μl anti-M13 phage-HRP conjugate secondary antibody (diluted 1/4000 in 2% [w/v] MPBS)/well. Plates were then washed 5 times in 0.1% [v/v]

PBST and 2 subsequent times in PBS alone. Plates were incubated for 5mins at room temperature with 50μl SureBlue 1-Component TMB Microwell peroxidise solution/well. The reaction was stopped by addition of 100μl 1M sulphuric acid/well and plates were read immediately at 450nm on a Spectromax M5 molecular devices plate reader (using Softmax Pro 5.1 software). Positive phage binders were identified when the result on the HEWL-coated plate was three times greater than the corresponding result on the non-coated plate.

2.2.9 Determination of selected phage diversity

2.2.9.1 Colony PCR of phage-infected TG1 bacteria

Phage DNA was amplified by colony PCR after each round of selection for use in DNA sequencing.

Bacterial pellets (from Section 2.2.7) were resuspended in the residual medium in the wells and 1μl

E.coli suspension was diluted with 49μl molecular biology grade water. Using 96well PCR plates each well contained 10µl 10x Reaction buffer, 4µl each of forward (DOM006) and reverse

(DOM057) 10µM primers (Table 2.3), 5µl of 10mM dNTP mix, 1µl Taq polymerase (1 U/µl), 1µl diluted E.coli suspension in a final volume of 100µl. PCR parameters were as follows: denaturation at 95oC for 10min, 30 cycles of denaturing (94oC, 30s), annealing 55oC, 30s) and elongation (72oC

30s) and a final extension at 72oC for 10min. PCR products (4μl) were migrated for 8min on a 48- well 1% [w/v] agarose E-Gel and 10μl Low-range LQR quantifiable DNA ladder was used to ensure

DNA amplification was successful. PCR products were then purified (Section 2.2.9.2) and subjected to DNA sequencing (Section 2.3.14.1). 86

2.2.9.2 DNA purification of phage DNA from colony PCR

After completion of PCR reactions, 96 well plates (Section 2.2.9.1) were supplemented with 30μl molecular biology grade water per well and the entire volume of each well was transferred to 96- well Millipore Purification plates. The Millipore plates were then placed on a vacuum manifold and products were purified by washing 2 times with 100μl molecular biology grade water. Plates were removed from the vacuum and DNA was eluted by gravity flow into a fresh 96well plate using 40μl Molecular Biology grade water/well and incubated for 5min at room temperature on a plate shaker at 800rpm. DNA was then sequenced by a dedicated sequencing lab (GSK,

Stevenage) as described in Section 2.3.14.1 and sequence diversity calculated as the percentage of unique sequences identified.

2.2.10 Extraction of phage DNA from selected phage amplified in TG1 E.coli

DNA was prepared after round 3 passive and round 2 soluble phage selections and 100µl of eluted phage-infected TG1 E.co.li glycerol stock (Section 2.2.4) was used to inoculate 50ml 2xTY medium supplemented with 15μg/ml tetracycline in a 250ml vented shake flask. Flasks were incubated overnight at 37oC shaking at 250rpm. DNA was extracted using a Qiagen Maxiprep Kit in accordance with manufacturer’s instructions and used for subsequent cloning into the pTT5 transient vector (Section 2.3.11).

2.3 Generation and purification of plasmids

2.3.1 Preparation of competent DH5α E.coli

A 5µl portion of stock competent DH5α was used to inoculate 200ml SOB medium (2% [w/v] tryptone, 0.5% [w/v] yeast extract, 10mM NaCl, 2.5mM KCl in ddH20, autoclaved and supplemented once cold with 1% [v/v] 2M Mg solution (1M MgSO4-7H20) and 0.22µm sterile filtered) in a 2L flask and incubated at 18oC with shaking at 250rpm. Once culture density had

o reached OD600nm 0.4-0.6 cells were centrifuged in sterile tubes at 3600xg for 15min at 4 C.

Supernatant was discarded and the pellet was resuspended in 1/3 volume ice cold transformation buffer (10mM PIPES, 15mM CaCl2-2H20, 55mM MnCl2-4H20, 250mM KCl, pH 6.7) and incubated 10mins on ice. Cells were centrifuged again at 3600xg, and the pellet was resuspended in 1/12.5 volume ice cold transformation buffer, supplemented with 7% [v/v]

DMSO and incubated on ice for 10mins. Aliquots (500µl) were transferred to ice cold 1.5ml microcentrifuge tubes and frozen immediately in liquid nitrogen. After 1hr the competent cells were stored at -80oC.

2.3.2 Bacterial growth medium and agar selection plates

Bacterial cells used for the generation of plasmids were grown in Luria Bertani (LB) broth (1%

[w/v] tryptone, 0.5% [w/v] yeast extract and 0.5% [w/v] NaCl), which was autoclaved and supplemented with 50µg/ml ampicillin once cooled to 55oC, unless otherwise stated. Bacterial cells were cultured overnight at 37oC and 250rpm in flasks with a 10x excess volume (e.g. 5ml grown in 50ml flask). Selection plates consisted of the same LB basal medium supplemented with

1.5% [w/v] agar and poured into 9cm Petri dishes under aseptic environments.

2.3.3 Transformation of DH5α competent E.coli cells

DH5α competent E. coli cells (Section 2.3.1) were thawed on ice and 10μl DNA (from ligations

(Section 2.3.10)) was added to 100µl DH5α competent E.coli cells and incubated on ice for

30min. Cells were then transformed by heat shock at 42oC for 45sec and incubated on ice for a further 5min. 300μl SOC medium (SOB medium supplemented with 0.02M Glucose) was added to the transformed E.coli and incubated for 1hr at 37oC and shaking at 250rpm. 100μl transformed E.coli were then plated onto 9cm LB agar plates, the plates were inverted and incubated overnight at 37oC in a static incubator. Individual colonies were used to inoculate 5ml of LB medium and DNA prepared by Qiagen Miniprep kit (Section 2.3.4).

2.3.4 DNA preparation from bacterial and phage culture

DNA was prepared from overnight bacterial or phage cultures using either a QIAprep 96 Turbo,

Qiaprep spin miniprep or Qiagen HiSpeed plasmid maxiprep extraction kit (depending on the amount of DNA required) as per manufacturer’s instructions.

2.3.5 Generation of glycerol stocks

Overnight bacterial cultures for DNA isolation were used to make glycerol stocks prior to centrifugation by mixing equal volumes of bacterial culture with LB medium supplemented with

30% [v/v] glycerol and stored at -80oC.

2.3.6 Determination of DNA concentration and purity

DNA concentrations were quantified using the Thermo Scientific NanoDrop™ 1000

Spectrophotometer according to manufacturer’s instructions. Purity was assessed using the

A260nm/A280nm ratio and ratios greater than 1.8 were considered sufficiently pure for further use.

2.3.7 Restriction enzyme digests of plasmid DNA

Restriction digests of plasmid DNA were routinely performed in a final volume of 40µl using 1-

10µg of DNA, 2µl each of appropriate restriction enzymes (Table 2.2), 4µl of appropriate buffer (1 x final concentration) and incubated for 2hrs at 37oC. For enzymes using non-compatible buffers sequential digests were performed for 1hr each at 37oC (55oC for BsiWI). Plasmid DNA to be used as the backbone in future ligation procedures was incubated for a further 30mins with 1µl CIP

(calf intestine phosphatase). A summary of expression vector cloning can be found in Table 2.2.

(Full vector maps can be found in Appendix III).

Vector Resulting Backbone Restriction Format Insert Vector Construct Name Vector Enzymes Application (Description)

CEG1 HindIII MJM SJC208 (Alemtuzumab HC SpeI with dAb acceptor site) pTT5 HindIII CEG2 MAO111 SJC209 BsiWI (Alemtuzumab LC) HEK2936E HindIII CEG3 Transient MAO112 SJC208 SpeI (Alemtuzumab HC)

SalI CEG1 VH/ Vk pDOM4 CEG1_(dAb number) NotI

MNB001 CEG1_(dAb CEG4_(dAb number) RSV RLD number)

HEK293 MNB002 CEG2 HindIII CEG5 Transient RLN EcoRI

CHODG44 MNB001 CEG6 CEG6 Stable RLD

CEG4_(dAb pcDNA3.1+ CEG7_(dAb number) number) HindIII pcDNA3.1+ EcoRI in-vitro CEG4 CEG8

Table 2.2. Summary of cloning, restriction enzymes used, vectors generated and their application.

Backbone and insert vectors were digested with the restriction enzymes indicated (Section 2.3.7).

Digested products were migrated on a 1% agarose gel (Section 2.3.8) and the appropriate vector or insert band (determined based on its molecular weight) was gel purified (Section 2.3.9) prior to ligation (Section 2.3.10) and subsequent transformation into E.coli (Section 2.3.3). All constructs were subject to DNA sequencing (Section 2.3.14) prior to use for their intended application. The dAb number refers to the numbering system for dAbs isolated in Chapter 3 (Table 3.3).

2.3.8 Agarose gel electrophoresis

Agarose gel electrophoresis was performed either using the Invitrogen E.gel system alongside a

Low Range or High Range Quantitative DNA ladder according to manufacturer’s instructions or using agarose gels made up from agarose powder. For the latter, agarose was dissolved by heating in 1X TBE (0.89 M Tris, 0.89 M boric acid and 10 mM EDTA) to a final concentration of

1% [w/v] or 2% [w/v] (depending on the application). The mixture was cooled to ~55oC and supplemented with 1% [v/v] SafeView DNA stain before pouring into a Bio-Rad DNA electrophoresis tank and inserting the combs. Electrophoresis was performed at 100V in 1X TBE sufficient to cover the gel alongside DNA ladder Hyperladder I or V (depending on the application).

2.3.9 Gel purification of DNA bands from 1 [w/v] % agarose

Products from enzymatic digests (Section 2.3.7) were migrated on a 1% [w/v] agarose gel alongside an appropriate DNA ladder. Expected bands (backbone or insert, as determined by size) were excised from the gel using a clean razorblade on a transilluminator. DNA was purified from gel slices using a Qiagen gel purification kit according to manufacturer’s instructions and eluted in 30µl molecular biology grade water. Eluates were re-applied to the column and eluted for a second time to increase DNA recovery. Concentrations quantified using a Nanodrop before use in ligations (Section 2.3.10).

2.3.10 DNA ligations for plasmid generation

Products from gel purifications (Section 2.3.9) were routinely ligated using a 3-fold and 6-fold

Molar excess of insert DNA to backbone as determined by the following calculation:

Size of insert (base pairs) x 150ng (backbone DNA) = ng of insert required for 1:1 ligation

Size of backbone (base pairs)

Ligations were performed at room temperature for 10mins using Instant Sticky end Ligase, according to manufacturer’s instructions and 10µl of ligation mix used in transformation of competent DH5α E.coli (Section 2.3.3).

2.3.11 Generation of pTT5 heavy chain novel-format antibody vectors

Phage DNA (prepared in Section 2.2.10) from each of the four phage libraries (Table 2.1) and both passive and soluble selection (Section 2.2.2 and 2.2.3.3 respectively) was used to generate mAbdAb constructs in the pTT5 vector CEG1 (Table 2.2). Phagemid vector pDOM and CEG1 DNA were digested overnight at 37oC using 10µg DNA, 10µl buffer, 5µl each SalI and NotI enzymes and 10µl BSA in a final volume of 100µl. The CEG1 backbone was then dephosphorylated for

30mins at 37oC with CIP. Digested products were migrated on a 1% [w/v] agarose gel and the insert band (~500bp) pertaining to a mixed population of dAbs (e.g. passive VHS) was excised and gel-purified (Section 2.3.9) and ligated into CEG1 backbone (Section 2.3.10). Transformations were performed as described in Section 2.3.3 and colonies were assessed using a QPix 400 automated colony picker and discrete colonies picked into a deep

96-well plate containing 200µl LB selection medium (Section 2.3.2) and grown overnight at 37oC,

250rpm. DNA was extracted using a QIAprep 96 Turbo kit (Section 2.3.4) and DNA sequencing was performed as described in Section 2.3.14.1 using DDE013 as the forward and DDE001 as the reverse primer. Unique dAb sequences identified through DNA sequence analysis (Section

2.3.14.1) were consolidated to a single 96-well plate (from glycerol stocks) and fresh DNA was prepared using a QIAprep 96 Turbo kit. Resulting DNA was then used for transient HEK2936E expression (Section 2.4.2.2).

2.3.12 Synthesis and cloning of CDR3 swapped dAb sequences

The nucleotide sequences of a high (H014) and low (H092) expressing mAbdAb from the VH library (Table 2.1) were swapped at nucleotide position 280 of framework region 3 to generate two new dAb sequences. The resulting dAb nucleotide sequences were generated using the

GeneArt gene synthesis service. dAb sequences supplied in GeneArt vectors were then subcloned into the RLD vector (Table 2.2) using the restriction enzymes SalI and NotI (Table 2.2) as described in Section 2.3.7.

2.3.13 Preparation of plasmid DNA for stable transfection

A total of 30µg DNA (15µg each of heavy and light chain RSV vectors (Table 2.2) was used per stable transfection. Plasmid DNA was linearized overnight at 37oC in a final volume of 400µl, using 40µl of 10x buffer and 4µl each of BSA and AdhI single cutting enzyme. After linearization

DNA was purified by phenol: chloroform: isoamylalcohol (PCI) (25:24:1 [v/v]) purification. An equal volume of PCI solution was added to the digestion and mixed vigorously for 1min.

The sample was centrifuged for 1min at 8,928xg in a microcentrifuge and the aqueous layer was transferred to a fresh tube. Sodium acetate (0.1 volumes) and 100% ethanol (2.5 volumes) was added and the mixture was incubated at -20oC for 1hr. DNA was then harvested by centrifugation for 30mins at 16,162xg at 4oC, the supernatant discarded and the pellet was washed in 70% [v/v] ethanol and re-centrifuged for 1min. The supernatant was removed in a tissue culture cabinet and the pellet was allowed to air-dry for 5mins before resuspension in 30µl of molecular biology grade water. DNA quantity and quality was assessed (Section 2.3.6) and 15µg of DNA used per transfection.

2.3.14 DNA sequence analysis

DNA sequencing was performed by one of two methods using the primers detailed in Table 2.3.

2.3.14.1 DNA sequencing in 96-well PCR plates

Forward and reverse sequencing was performed in separate reactions. 96well sequencing plates were set up with each well containing 15μl of DNA, 1µl (10mM) of forward (DDE013) or reverse

(DDE001) primer and 1.5µl DMSO per well in a final volume of 20µl in molecular biology grade water. Sequences were aligned in DNA Lasergene 8 SeqMan and Megalign programmes.

2.3.14.2 DNA sequencing in 1.5ml microcentrifuge tubes

Forward and reverse sequencing was performed in separate reactions. Samples were prepared in 1.5ml microcentrifuge tubes with 50-100ng/µl of plasmid DNA in 15µl molecular biology grade water supplemented with 2µl 10µM forward or reverse primer (Table 2.3) and sequenced using the Eurofins commercial sequencing service. Sequences were aligned in Snapgene and Bioedit programmes.

Primer name Direction Sequence DOM006 Forward 5’ ATGGTTGTTGTCATTGTCGGCGCA 3’

DOM057 Reverse 5’ ATGAGGTTTTCGTAAACAACTTTC3’

DDE001 Forward 5’ GCACGAGGCCCTGCACAATCACTA 3’

DDE013 Reverse 5’ TCCCGATCCCCAGCTTTGCT 3’ VH/VL FW Forward 5’ GCTTCACCTTCACCGACTTC 3’

VH RV Reverse 5’ TGCAAGTCAGGCTCAGGGTCTG 3’

VL RV Reverse 5’ ATGGTCACCCTATCGCCCACTG 3’

B2M FW Forward 5’ ATATGCCTGCAGAGTTACACACACTC 3’ (beta-2-macroglobulin)

B2M RV Reverse 5’ GCCATTACTATTTCCGTGTGCATGA 3’ (beta-2-macroglobulin)

Table 2.3 List of primers used in DNA sequencing and PCR

2.4 Mammalian cell culture

2.4.1 General cell culture techniques

2.4.1.1 Determination of cell density and viability

Viability of CHO DG44 suspension cells was determined by trypan blue exclusion using either the Countess® automated cell counter or ViCell automated cell counter. ViCell cell counts were performed using 1ml of sampled cells according to manufacturer’s instructions. Cell counts using the Countess® were achieved by loading 10µl of mixed sample (cell sample mixed at a 1:1 ratio with Trypan Blue (1% [v/v]) into a Countess slide and cell densities exceeding 4x106 were diluted 1:10 in PBS prior to loading.

2.4.1.2 Cryopreservation of cells

Cells in exponential growth phase were counted and 1.2x107 cells were sampled into a 15ml falcon tube and centrifuged for 5min at 200xg. The cell pellet was resuspended in 1.6ml freezing medium (culture medium supplemented with 10% [v/v] DMSO (Sigma Aldrich, UK)) and frozen in cryotubes overnight in a Mr.Frosty box at -80oC before transfer into liquid nitrogen for long term storage.

2.4.1.3 Revival of cells from liquid nitrogen

Cryopreserved cells were removed from liquid nitrogen and thawed briefly in a 37oC water bath before being transferred to 30ml of warmed medium in a 50ml falcon tube. Cells were centrifuged for 5min at 200xg, the cell pellet resuspended in 10ml of warmed medium and a sample was taken for counting (Section 2.4.1.1). Cells were then subcultured to the appropriate density (as described in cell-line specific sections) and routinely subcultured as described for one week prior to starting experimental procedures (to allow cells time to equilibrate).

2.4.1.4 Intracellular protein extraction

Intracellular protein was extracted by harvesting 1x107 cells at 200xg for 5mins and the cell pellet was washed in 5ml PBS and re-centrifuged. The pellet was resuspended in 1ml 2x sample buffer (0.13 M Tris, 4% [w/v] SDS, 0.14 mM bromophenol blue, 20% [v/v] glycerol) and lysed 5 times using a 21g needle and a further 5 times by a 25g needle and 500µl aliquots were generated. Protein samples were stored at -80oC and multiple freeze-thaw of samples was avoided.

2.4.1.5 Sampling of cell culture medium

Medium samples were taken routinely at the same time as cell density and viability determination (Section 2.4.1.1). For suspension cell lines medium was sampled and

98 centrifuged at 200xg for 5mins to pellet cells and the medium was transferred to a fresh microcentrifuge tube. Medium samples from adherent cell lines were sampled directly into microcentrifuge tubes. Aliquots were made (200µl) and stored at -80oC, and multiple freeze- thaw cycles were avoided.

2.4.2 HEK cell lines

2.4.2.1 HEK2936E suspension cell maintenance

HEK2936E suspension cells (supplied by GSK, under license from the NRC, Canada) were

o cultured at 37 C 5% CO2 in a humidified shaking incubator at 130rpm in Freestyle™ 293 medium and were subjected to subculture every 3-4 days to a density of 0.5x106 cells/ml.

2.4.2.2 HEK2936E suspension cell transient transfection

HEK2936E suspension cells were diluted to a density of 1.75x106 cells/ml and were plated into a 96 well low-evaporation non-coated flat-bottom plate and stored at 34oC in a humidified incubator on an Heidolph Titremax® plate shaker at 1050rpm. DNA complexes were prepared in Opti-MEM® medium in a second non-coated flat-bottom plate using 100µl Opti-MEM®/well with inclusion of 1µg total pTT5 DNA (Table 2.2) at a ratio at 1:1 (heavy chain: light chain) using pTT5 constructs (described in Section 2.3.11) and incubated at room temperature for 5mins.

Proprietary transfection reagent GEM103D (GSK, Stevenage) was added to each well at a ratio of 4:1 (GEM103D: DNA) and plates were placed on a shaker at 1050rpm for 30s to mix. Plates were incubated at room temperature for 30mins to allow complexes to form and then 100µl

DNA-complex mix from each well was added onto the prepared cells. Plates were sealed using Titre-Top plate sealers and these were incubated for 72hrs in a humidified incubator at

37oC on a heidolph titremax plate shaker at 1050rpm. Cells were then pelleted by centrifugation at 200xg for 5mins and supernatants were transferred to a fresh non-coated

96-well plate. Antibody titre was assessed using a Gyrolab™ xP workstation (Section 2.5.1.1) and antigen specificity measured by binding ELISA (Section 2.5.2.1) and Biacore analysis

(Section 2.5.2.2). Transfections were performed in triplicate. Vehicle only, alemtuzumab only

(CEG3, Table 2.2) and proprietary high and low expressing GSK mAbs were included as transfection controls.

2.4.2.3 Adherent HEK293 transient transfection

Adherent HEK293 cells were used to assess the expression of CDR3 swapped sequences (Section

2.3.12) in RSV vectors (Table 2.2). HEK293 cells in a T75 flask (gift of Dr Lisa Swanton, Faculty of

Life Sciences, University of Manchester) were subcultured in 12-well culture plates at a density of

2x105/well in 0.5ml of DMEM (+glutamine) supplemented with 10% [v/v]FBS and incubated

o overnight at 37 C, 5% CO2 in a humidified incubator. For each transfection reaction 3µl 293-

Fectin™ was diluted in 50µl Opti-MEM® medium, mixed, and incubated for 5mins at room temperature. DNA (RSV vectors, Table 2.2) was prepared separately using 0.5µg each of heavy and light chain (1µg total) in 50µl Opti-MEM® and mixed gently with 293- Fectin™ to make 100µl in total per transfection. Reactions were incubated for 30mins at room temperature to allow complexes to form. DNA-reagent complexes were added to cells and incubated for 48hrs at 37oC,

5% CO2 in a humidified incubator. Medium samples were taken (Section 2.4.1.5) and intracellular extractions were performed by addition of 500µl 2x sample buffer (Section 2.4.1.4) to each well.

Vehicle only and alemtuzumab only (CEG6, Table 2.2) controls were included in each transfection. 100

2.4.3 CHO DG44 cell lines

2.4.3.1 Adaption of CHO DG44 suspension cells to commercial media

DHFR-negative CHO DG44 host suspension cells (supplied by GSK) were grown in 125ml shake

o flasks incubated at 37 C 5% CO2 in a humidified shaking incubator at 130rpm and maintained in G68 medium, a production medium proprietary to GSK. Cells were subcultured every 3-

4days to a density of 0.5x106 cells/ml. During media adaptions the growth and viability of cells were monitored over 4 subculture events in one of four medium types; CD CHO, CD DG44, CD

OptiCHO and CD OptiCHO supplemented with 0.5gYeastolate feed/L (1% [w/v] Yeastolate dissolved in ddH20, 0.22µM sterile filtered) (OptiCHO +YO) with each medium tested in triplicate. All media were supplemented with Glutamax (1% [v/v]) and Hypoxanthine (HT) supplement to a final concentration of 1X. To adapt to a new medium 12.5x106 cells were sampled from day 4 culture in G68 medium and were centrifuged for 5mins at 200xg. The supernatant was discarded and cells resuspended in 25ml of the new medium type to a final cell density of 0.5x106 cells/ml and maintained as described above. Cell density and viability were measured before each subculture as described in Section 2.4.1.1 (Figure 2.2). CD

OptiCHO supplemented with Yeastolate feed, was selected for all subsequent CHO cell experiments, as it showed the highest density and viability on passage 4 compared with the other media. Henceforth this medium is referred to as medium with HT (for host cells) and medium without HT (for transfected cells).

101

Figure 2.2. Adaption of DHFR-negative CHO DG44 cells to commercial media. DHFR-negative CHO

DG44 cells were cultured as described in Section 2.4.3.1 and cell density (A) and viability

(B) were measured before each subculture event as described in Section 2.4.1.1. Error bars represent standard error of the mean of three biological replicates. Key to graph: G68 ( ), CD

OptiCHO ( ), CD OptiCHO + 0.1% [v/v] Yeastolate feed ( ), CD CHO ( ),

CD DG44 ( ). 102

2.4.3.2 CHO DG44 suspension cell maintenance

DHFR-negative CHO DG44 host suspension cells were cultured in medium with HT and subcultured every 3-4days to a density of 0.5x106 cells/ml. Transfected polyclonal cells were cultured in medium without HT and subcultured every 3-4days to a density of 0.2x106 cells/ml.

o All cells were maintained in 125ml vented shake flasks and incubated at 37 C 5% CO2 in a humidified shaking incubator at 130rpm.

2.4.3.3 CHO DG44 stable transfection

DHFR-negative CHO DG44 host suspension cells were used to generate stable polyclonal cell lines using RSV vectors (Table 2.2). Cells were counted and, for each transfection, 1.2x107 cells were centrifuged for 5mins at 200xg. The supernatant was discarded, the cell pellet washed in

10ml warmed PBS and the suspension was centrifuged for a further 5mins at 200xg. The resultant cell pellet was resuspended in 800µl pre-warmed PBS and transferred to an electroporation cuvette. RSV vectors (Table 2.2) linearized with AdhI enzyme (Section 2.3.13) were added to the cuvette (15µg each of linearized heavy chain and light chain plasmid) and cells were electroporated using a Bio-Rad Gene Pulser XCell electroporation system at

0.38volts/25uF for 5s. Cuvettes were incubated on ice for 5mins and contents were transferred to T75 flasks that contained 9ml of warmed host medium. Flasks were incubated for 48hrs at

37oC, 5% CO2 in a humidified incubator. After 48hrs cells were harvested at 200xg for 5min and resuspended in selection medium and incubated for 2-3 weeks at 37oC, 5% CO2 in a humidified incubator. Cell density and viability were monitored every 3-4 days until cell

103 viability was >75% and cell density began to increase, at which point a further 5ml of selection medium was added to each flask. Once cells reached a viability of >90% cells were adapted to a shaking environment by transfer into 125ml shake flasks at 1x106 cells/ml. Transfections were performed in duplicate for each construct and a set of four controls (water-only rather than

DNA transfected) were performed alongside each transfection, two were resuspended in medium with HT to monitor recovery and two in medium without HT to confirm that transfection was successful.

2.4.3.4 Batch culture of transfected polyclonal CHO DG44 suspension cells

Batch cultures were generated by subculturing cells as described in Section 2.4.3.2 (host and polyclonal cell lines) in 50ml of medium without HT in 125ml shake flasks and incubated at

o 37 C 5% CO2 in a humidified shaking incubator at 130rpm. Cell density and viability were measured every day (Section 2.4.1.1) until cell viability reached <20%. Samples were taken throughout culture as described in Sections 2.4.1.4, 2.4.1.5 and 2.6.1 (for intracellular, medium and RNA samples respectively).

2.4.3.5 Treatment of CHO DG44 cells with sodium butyrate, DMSO or mild hypothermia

Batch cultures were set up in as described in Section 2.4.3.5 and the following treatments were performed independently. Sodium butyrate was added at a final concentration of 2mM on day

3 of batch culture. DMSO treatment was performed on day 4 of batch culture with addition of

DMSO to a final concentration of 1% [v/v]. Mild hypothermia was induced on day 4 104 of batch culture by transferring batch cultures to a 32oC incubator. Cell densities and viabilities were assessed as described (Section 2.4.1.1) daily for sodium butyrate treatment and every 2 days for DMSO and hypothermia treatments, until cell viability reached <20% and medium was sampled (Section 2.4.1.5) for subsequent analyses. Intracellular samples were taken for DMSO and sodium butyrate treatments (Section 2.4.1.4) and RNA samples (Section 2.6.1) were taken for sodium butyrate treated cells only at 24hrs post treatment for subsequent analyses.

2.4.3.6 Treatment of CHO DG44 cells with chemical inhibitors of protein degradation

CHO DG44 host and transfected cells at day 5 of batch culture (Section 2.4.3.5) were counted

(Section 2.4.1.1) and plated into 12 well plates at a density of 1.5x107 cells/ml. The following chemical inhibitors (at the final concentration noted in parentheses) were added directly to the wells: Bortizumab (50nM), MG132 in DMSO (10µM) or Leupeptin (0.5mM) combined with

Pepstatin A (1µg/ml) (Bortizumab, Leupeptin and Pepstatin were a gift of Dr Lisa Swanton,

Faculty of Life Sciences, University of Manchester). Plates were incubated for 6hrs at 37oC 5%

CO2 in a humidified shaking incubator at 200rpm. Cell cultures were harvested by centrifugation at 200xg for 5mins. Intracellular and medium samples were taken for subsequent analyses (Section 2.4.1.4 and 2.4.1.5 respectively).

2.5 Protein analyses

2.5.1 Quantification of antibody expression

Two ELISA-based methods were used for quantification of antibody and novel-format antibody expression.

105

2.5.1.1 Quantification of antibody expression by Gyros ELISA

A skirted 96-well PCR plate was prepared with 100µl of undiluted medium sample per well, with each sample tested in duplicate. A standard curve was prepared using a proprietary antibody (supplied by GSK) ranging from 250µg/ml to 0.244µg/ml diluted in Freestyle™ 293E medium and added to a second skirted 96-well plate. Affibody Biotin capture antibody was diluted to 0.1mg/ml in PBST (0.1% [v/v] tween-20 in PBS) and F(ab)2 anti-human kappa light chain Alexa 647 detection antibody was diluted to 75nM in Rexxcip F diluent and both were added to the second PCR plate containing the standards. All plates were then sealed with

Gyros plate sealers and loaded into a Gyrolab xP workstation. Quantifications performed using a Gyrolab Bioaffy CD (Bioaffy 20 HC) according to manufacturer’s instructions.

2.5.1.2 Quantification of antibody expression by sandwich ELISA

Nunc 96-well flat-bottom immunoassay plates were coated overnight at 4oC with 100µl goat anti-human IgG Fcƴ fragment specific capture antibody/well (at a final concentration of

1µg/ml). Capture antibody was discarded and wells were blocked for 1hr at room temperature by addition of 150µl 3% [w/v] milk in PBS (blocking buffer)/well. The blocking buffer was discarded and 100µl of sample buffer (3% [w/v] milk in PBS, diluted 1:6 in 0.1% [v/v] tween20 in PBS) was added to each well. An IgG standard curve (with 100µl/well) was prepared in sample buffer and tested in duplicate on each plate starting with a concentration of

12.5ng/100µl. Medium samples (Section 2.4.1.5) were diluted as necessary in sample buffer

(typically 1 in 100) and 100µl of sample was added per plate well in triplicate. Standards and

106 samples were then incubated for 1hr at room temperature and, discarded, and wells were washed 3 times in wash buffer (0.1% [v/v] PBS-tween20) and blotted dry. The plate was then incubated with detection antibody (100µl/well, goat anti-human Fab-HRP diluted 1:15000 in sample buffer) for 45mins at room temperature. Detection antibody was discarded and the plates washed 3 times in wash buffer and once in PBS only and blotted dry. Development solution (1 TMB (3,3’,5,5’ tetramethyl benzidine chromogen) tablet in 12ml TMB diluent solution (50mM dibasic sodium phosphate, 25mM citric acid, pH5.2) supplemented with 5µl

[v/v] hydrogen peroxide) was added to the wells (100µl/well) and incubated for 5min at room temperature. The reaction was stopped by addition of 100µl 1M hydrochloric acid/well and absorbance was measured immediately at 450nm on a BioTek Power340 plate reader using

Gen5 software.

2.5.2 Assessment of mAbdAb functionality

2.5.2.1 Assessment of HEWL binding by ELISA

96well Nunc Maxisorp assay plates coated overnight at 4oC with 100μl per well of HEWL at a concentration of 100μg/ml in PBS. Plates were washed 3 times in PBS then blocked for 1hr at room temperature in 2% [w/v] milk in PBS (MPBS). The plates were then washed as before and incubated for 1hr at room temperature with 100μl/ well of supernatants harvested from transient HEK2936E culture (Section 2.4.2.2). The plates were washed 5 times with 0.1% [v/v]

PBST (0.1% Tween-20 in PBS) and incubated at room temperature for 1hr after the addition of

100μl/well goat anti-human Fab-HRP antibody diluted 1:15000 in 2% PBS. Plates were then washed 5 times in 0.1% [v/v] PBST and 2 subsequent times in PBS alone. Plates were incubated for 5mins at room temperature with 50μl SureBlue 1-Component TMB Microwell peroxidise

107 solution/well. The reaction was stopped by addition of 100μl 1M sulphuric acid/well and plates were read immediately at 450nm on a Spectromax M5 molecular devices plate reader (using

Softmax Pro 5.1 software). Positive HEWL binding was defined as a result three times greater than the medium-only control sample.

2.5.2.2 Assessment of HEWL binding by Biacore analysis

Biacore analysis was performed using supernatants harvested from transient HEK2936E transfections (Section 2.4.2.2) using a Biacore™ 4000 system and a CM5 chip coated with

1mg/ml of HEWL in PBS. Culture supernatants were introduced to the chip undiluted and resonance measured using the Biacore™ 4000 Evaluation Software 1.0.

2.5.3 Western blot analysis of protein

Samples taken during cell culture (intracellular, Section 2.4.1.4 and medium, Section 2.4.1.5) were subjected to western blot analysis to identify heavy chain and light chain protein species.

2.5.3.1 SDS-PAGE

SDS-PAGE gel casting and migration was achieved using a Bio-Rad mini gel system and plates with 1.5mm spacers. The separating and stacking gels were made up sequentially. Different percentage separating gels (8-16%) were used depending on the protein studied (Table 2.4) and consisted of 3.75ml of separating buffer (1.5 M Tris, 0.4% [w/v] SDS, pH 8.8) and relative percentages of Protogel (30% [w/v] acrylamide, 0.8% [w/v] bisacrylamide) and water. Once the

108 separating gel was set it was overlaid with the stacking gel and the combs were inserted. A 4% stacking gel was used for all gels and was made from a mixture of 1.6ml Protogel (30% [w/v] acrylamide, 0.8% [w/v] bisacrylamide), 2.5ml stacking buffer (0.5 M Tris, 0.4% [w/v] SDS, pH

6.8) and 6ml water. Immediately prior to pouring into the glass plates, polymerisation for both the separating and stacking gel was initiated with the addition of ammonium persulphate

(0.15µg/ml, final concentration) and 0.1% [v/v] TEMED. Medium samples (Section 2.4.1.5) were mixed 1:1 with 2x sample buffer. Intracellular samples which were lysed directly in sample buffer (Section 2.4.1.4) were not diluted prior to loading. Samples tested under reducing conditions were prepared in sample buffer supplemented with 1.8% [v/v] β- mercaptoethanol. All sample-buffer mixtures were incubated at 95oC for 5mins before loading and samples were loaded alongside pre-stained broad-range molecular weight marker.

Electrophoresis was performed in running buffer (0.5 M Tris, 0.2% [w/v] SDS, 0.4 M Glycine) at

60V until bromophenol blue entered the separating gel, then the voltage was increased to

200V until the dye front reached the bottom of the gel.

2.5.3.2 Protein transfer

At the cessation of migration the SDS-PAGE gel was gently liberated from the glass plates, the stacking gel was discarded and the separating gel portion was equilibrated for 5min in transfer buffer (25mM Tris, 190mM glycine, 20% [v/v] methanol, pH 7.4) to prevent gel drying. Extra thick filter paper and BioTraceTM NT nitrocellulose membrane were cut to size and also incubated for 5min at room temperature in transfer buffer. Protein from gels was transferred to nitrocellulose on a Bio-Rad Semi-Dry electroblotter, with transfer at 15V for 35min. To confirm successful protein transfer, membranes were incubated for 5min with Ponceau-S

(0.5% [w/v] Ponceau-S in 1% [v/v] glacial acetic acid) and the excess washed with water.

109 Protein transfer was confirmed then membranes were washed for 5min in 0.1% [v/v] tween-20 in PBS before blocking and immunoblotting (Section 2.5.3.3).

2.5.3.3 Immunoblotting

After protein transfer membranes were incubated overnight at 4oC with blocking buffer in PBS or 0.1% [v/v] PBS-Tween 20 (see Table 2.4 for antibody specific blocking buffers) to minimise non-specific binding. Membranes were washed for 5mins in 0.1% (v/v) tween-20 in PBS (PBST) and incubated for 1hr at room temperature in 10ml antibody in blocking buffer (Table 2.4).

Membranes were washed 3x 5min and incubated for 1hr at room temperature with primary antibody in blocking buffer (Table 2.4). Membranes were washed again as above and incubated for 1hr with secondary antibody in blocking buffer (Table 2.4). At the end of the incubation, the antibody solution was removed and membranes washed as above before scanning on Li-Cor Odessy scanner. All incubations were performed under agitation.

Antibody Percentage Gel Primary/Secondary Blocking Buffer Dilution Goat anti-human Secondary 5% [w/v] 12.5% 1:15000 IgG (H+L) IRDye800CW (direct conjugate) MPBST Mouse anti-ERK2 12.5% Primary 3% [w/v] MPBS 1:1000 (6H3)monoclonal Mouse anti-Ubiquitin 8% Primary 3% [w/v] MPBS 1:1000 (P4D1) monoclonal Donkey anti-mouse Secondary 5% [w/v] 8 or 12.5% 1:15000 IRDye800CW (to ERK/Ub) MPBST

Table 2.4. Antibodies used in western blot analysis of proteins, percentage of SDS-PAGE gel their blocking buffer and dilutions. MPBS buffer indicates Marvel milk powder in PBS, MPBST indicated Marvel milk powder in PBS supplemented with 0.1% [v/v] Tween-20.

110

2.5.3.4 Stripping nitrocellulose membrane and re-probing

Membranes were stripped using stripping buffer (35mM Tris, 02. %, [w/v] SDS, 1% [v/v] β- mercaptoethanol, pH 6.7) for 15mins at 50oC in a water bath. Membranes were washed in

3x10min PBST and blocked overnight in blocking buffer (Table 2.4) before re-probing (Section

2.5.3.3).

2.5.3.5 Densitometric analysis of protein bands

Intensity of protein bands were quantified by densitometric analysis using Image J quantification software.

2.6 Analysis of mRNA

2.6.1 RNA isolation

RNA was extracted from 1x107 cells using a Qiagen RNeasy mini kit according to manufacturer’s instructions and eluted in 100µl in RNAse free water. Aliquots of 50µl were made and stored at -80oC and repeated freeze-thaw cycles were avoided.

2.6.2 DNAseI treatment of RNA

RNA samples (Section 2.6.1) were treated with DNAseI to remove contaminating genomic

DNA. A total of 1µg of RNA was diluted in DEPC-treated water (ddH2O treated overnight with

111 0.05% [v/v] diethylpyrocarbonate to inactivate RNAse enzymes) and 1µl each 10x DNAse reaction buffer and DNAseI enzyme in a total volume of 10µl and incubated for 30mins at

37oC. The reaction was stopped by addition of 1µl of stop solution (0.2mM EDTA) and the mixture was heated at 70oC for 10mins and then kept on ice. Once RNA quality and purity were determined (Section 2.6.3), DNAseI treated RNA was used for cDNA synthesis

(Section2.6.4).

2.6.3 Determining RNA quantity and purity

RNA concentration was quantified following DNAseI treatment using a Thermo Scientific

NanoDrop™ 1000 Spectrophotometer according to manufacturer’s instructions. Purity was assessed from the A230nm/A260nm and A260nm/A280nm ratios. Samples with ratios greater than 1.6 and 2, respectively, were considered as satisfactory for further analyses.

2.6.4 cDNA synthesis

Reverse transcription (RT) of RNA to cDNA was achieved using a Bioline Tetro cDNA synthesis kit. Reactions mixtures contained 5µg of RNA, 4µl 5x RT buffer, 1µl Oligo (dT) 18, 1µl 10mM dNTP mix, 1µl Ribosafe RNase Inhibitor and 1µl Tetro Reverse Transcriptase (200U/µl) made up to a final volume of 20µl with DEPC-treated water. "Negative" RT reactions were made for each RNA sample with mixtures as described above but without addition of Tetro Reverse

Transcriptase.

112 2.6.5 Semi-quantitative RT-PCR of cDNA samples

Reverse-transcription PCR was performed on cDNA samples (Section 2.6.4) using the Bioline

BioTaq kit. PCR reactions were set up in 0.2ml PCR tubes as follows: 5µl (10x) NH4 reaction buffer, 2.5µl (50mM) MgCl2, 2µl each of 10µM forward and reverse primers (VH, VL or B2M,

Table 2.3), 1µl 100mM dNTP mix, 0.5µl BioTaq and 1µl cDNA in a final volume of 50µl in molecular biology grade water. PCR parameters were as follows: denaturation at 94oC for

10min, 30 cycles of denaturing (94oC, 10s), annealing (58oC, 10s) and elongation (72oC 20s) and a final extension at 72oC for 10min. Products were separated on a 2% [w/v] agarose gel

(Section 2.3.8).

2.6.6 Densitometric analysis of mRNA bands from RT-PCR analysis

mRNA bands were quantified by densitometric analysis using Image J quantification software.

Heavy chain and light chain mRNA products were normalised relative to B2M density, which was used as an expression control.

113 2.7 Un-coupled in vitro translation

2.7.1 Linearization of plasmid DNA for in vitro transcription

DNA templates were generated through enzymatic digestion of pcDNA3.1+ vectors (Table

2.2). Restriction digests of plasmid DNA were performed using 8µg DNA and 4µl each of restriction buffer and SacI enzyme in a final volume of 40µl for 2hrs at 37oC. Plasmids were purified using a Qiagen PCR purification kit according to manufacturer’s instructions and eluted in 40µl molecular biology grade water.

2.7.2 In vitro transcription

Linearised pcDNA3.1+ vectors (Section 2.7.1) were used as templates to direct mRNA production in in vitro transcription reactions. Reaction mixtures were set up in microcentrifuge tubes as follows: 20µl 5x Promega Transcription Buffer, 10µl 100mM DDT,

1µl Promega RNAsin, 10µl rNTP mix, 4µl Promega T7 RNA polymerase (1 U/µl) and 40µl linearized DNA template (Section 2.7.1) in a total volume of 100µl. Reactions were incubated for 2hrs at 37oC. The resulting mRNA was then purified using a Qiagen RNA extraction kit according to manufacturer’s instructions and eluted using 50µl RNAse free water. The quantity and quality of the resulting mRNA preparations were determined using a Nanodrop

(Section 2.3.6) and 5µl of eluate was examined on a 1% [w/v] agarose gel (Section 2.3.8) to confirm transcription (Figure 2.3).

114

H 0 Alem H014 H09 2 2

Figure 2.3 Gel electrophoresis of in vitro transcribed mRNA. mRNA was transcribed in vitro from linearized pcDNA3.1+ vectors (Section 2.7.1) using T7 RNA polymerase and purified using a Qiagen RNA extraction kit as described in Section 2.7.2. A 5μl sample of eluted mRNA was run on a 1% agarose gel (Section 2.3.8). Products were confirmed in all but the H20 control sample, which was the product of in vitro transcription in the absence of DNA template.

2.7.3 In vitro translation

Translation reactions were set up in 1.5ml microcentrifuge tubes as follows: 22.2µl Promega nuclease treated Rabbit Reticulate Lysates, 0.6µl Promega amino acid mixture minus methionine, 1.9µl 35S-Methionine (0.9225 MBq), 2.3µl Promega Canine Pancreatic Microsomal

Membranes (microsomes) and 3µl RNA template (Section 2.7.2). Translation reactions were incubated at 30oC for 30min. Microsomes were then pelleted by centrifugation by transferring the reaction to 80µl of HSC (750 mM sucrose, 500 mM KOAc, 5 mM Mg(OAc)2, 50 mM HEPES-

KOH, pH 7.9) at 100,000xg for 10mins. The supernatant (cytoplasmic fraction) was transferred to a fresh microcentrifuge tube and the microsome pellet (membrane fraction) was resuspended in 20 µl LSC (100 mM sucrose, 100 mM KOAc, 5 mM Mg (OAc) 2, 50 mM HEPES- 115 KOH pH 7.9, and 1 mM DTT). Samples were mixed 1:1 with 2x SDS PAGE sample buffer (0.13 M

Tris, 4% [w/v] SDS, 0.14 mM bromophenol blue, 20% [v/v] glycerol) supplemented with 1.8%

[v/v] β-mercaptoethanol and incubated for 5mins at 95oC. 20µl of each sample was subjected to electrophoretic separation on 10% SDS-PAGE gel (Section 2.5.3.1). Prepro-alpha factor (PPF) mRNA (a gift from Professor Stephen High, Faculty of Life Sciences, University of Manchester) was used as a glycosylation control and run on a separate 16% SDS-PAGE gel as the expected product was 19kDa compared with >60kDa for mAb and mAbdAb products.

2.7.4 SDS-PAGE gel drying

Upon termination of electrophoresis, SDS-PAGE gels (Section 2.7.3) were liberated from glass plates and incubated for 10mins in fixing solution (20% [v/v] methanol 10% [v/v] glacial acetic acid). Gels were then placed on Whatman® paper (grade GRB003) and vacuum-dried on a

Biorad 583 gel dryer at 65oC (for 2hrs).

2.7.5 Autoradiography

Dried SDS-PAGE gels (Section 2.7.4) were placed in an Autoradiography Exposure Cassette with a Fujifilm Phosphor imaging plate. The following day screens were scanned using a

Typhoon FLA7000IP Phosphoimager.

116 2.8 Computational analyses of mRNA and proteins

2.8.1 mRNA secondary structure prediction

Secondary structure of mRNA was predicted using RNAstructure, Version 5.6 webserver developed by the Mathews Lab at the University of Rochester Medical centre which is available at :

(http://rna.urmc.rochester.edu/RNAstructureWeb/Servers/Predict1/Predict1.html). DNA sequences generated a maximum of three predicted structures per nucleotide sequence. The minimum free energy required to fold the structure was then plotted as a regression analysis in Excel against expression as measured by ELISA (Section 2.5.1).

2.8.2 Physicochemical property analyses

Physicochemical properties of amino acid sequences were analysed using Protean Software

(DNAstar Lasergene). Predicted properties were then plotted as a regression analysis in Excel against the expression values as measured by ELISA (Section 2.5.1).

2.9 Calculations

2.9.1 Calculation of specific productivity (Qp)

Cell specific productivity of polyclonal CHO DG44 cell lines (Section 2.4.3.4) were calculated as follows:

117

pg/cell/day = [(P1 – P2) / (X1 – X2)] / (T1 – T2)

P1=Production (µg/ml) at first point of analysis

P2= Production (µg/ml) at the second point of analysis

6 X1= Viable cell density (× 10 /ml) at the first point of analysis

6 X2= Viable cell density (× 10 /ml) at the second point of analysis

T1= Day of the first point of analysis

T2= Day of second point of analysis

2.9.2 Statistical Calculations

Data in this Thesis is represented as mean ± standard deviation (SD) or standard error of the mean (SEM) as appropriate, which was calculated as follows:

Standard deviation (SD) = (√ (∑ (x – m2) / (n – 1))

x = observed value

m = mean of n observations

n-1 = degrees of freedom

Standard error mean (SEM) = (SD / √ n)

n = number of independent observations

118 Sandwich ELISA quantifications (Section 2.5.1.2) were assessed using a standard curve. Linear regression of the standard curve was plotted in Microsoft Excel and linear coefficients with a value of >0.98 were considered to be accurate.

ANOVA (One-way or two-way) or two-tailed paired sample t-tests were performed where appropriate using GraphPad Prism 6 Software to determine whether differences in samples were statistically significant. Data was considered statistically significant when p < 0.05.

119

CHAPTER 3: GENERATION OF MABDAB CONSTRUCTS USING PHAGE DISPLAY AND CLONING

120 3.1 Introductory remarks

The first objective in this Thesis was to generate a panel of dual-targeting novel format antibodies (mAbdAbs) to be used as the model protein system throughout this Thesis, and is the focus of this Chapter. The approach used followed the hit generation process in use at

GSK. The mAbdAb construct consisted of a monoclonal antibody (mAb) heavy chain, attached to a single domain antibody (dAb) via a short proprietary peptide linker at the Fc region of the mAb. Initial screens of this novel antibody format at GSK showed relatively poor expression in a proportion of their lead target molecules, and it was proposed that mAbdAb expression is governed by the sequence of the dAb. Therefore, in this project a common mAb

(Alemtuzumab, Campath 1H) and peptide linker were used, and variation between constructs was restricted to the dAb. Sequence variation was achieved through phage display selection of dAbs towards a common target antigen hen egg white lysozyme (HEWL) and subsequent cloning of selected dAbs into the transient heavy chain expression vector (CEG1) at the 3’ end of the peptide linker to form a mAbdAb fusion protein.

Four dAb phage libraries (three VH dAb libraries; VHS, VHM and VHL and one VL; VK, described in Section 2.2.1) were used in independent selections. This was to ensure that no single framework (e.g. VHS) was favoured during selection, thus maintaining a high level of genetic diversity within the selected dAbs, and so that both VH and VL domains were available for study. Also, two phage display approaches were used (passive and soluble) for the selection of anti-HEWL dAbs. Whilst passive phage display is a simple technique, it relies on the adsorption and thus partial denaturation of the target antigen, but can result in the selection of a wider range of genetically diverse dAbs. In contrast, soluble phage display allows the

121 antigen to remain in a natural conformation by means of antigen biotinylation, meaning that selected dAbs may have a higher specificity (Kd) for the antigen, but this approach may result in less genetic diversity (Matz and Chames 2012). Thus employing both approaches allowed for identification of both a wide genetic diversity and high antigen specificity and, additionally, allowed assessment of the extent to which selection approach and dAb library format impacts on expression.

This Chapter focuses on the comparative success of passive and soluble phage display selection of anti-HEWL dAbs, through evaluation of elution titres, binding ELISA and genetic diversity throughout the selection process. Following selections, the number, diversity and sequence of mAbdAbs generated through cloning into the CEG1 transient expression vector is discussed as the output of this Chapter.

3.2 Passive phage display selection of anti-HEWL dAbs

Four synthetic dAb libraries (Section 2.2.1), three based on the VH framework (VHS, VHM, VHL) and one on the VL framework (VK) (Ignatovich et al. 2012), were used independently for passive selection. Using four dAb libraries was chosen to maximise diversity of dAb framework and sequence after selection, whilst performing independent selections ensured that no selection bias was derived from a specific framework (e.g. VHS). Three successive rounds of passive selection were performed (Figure 3.1) on HEWL-coated immunotubes using a 10-fold decrease in HEWL concentration per selection round (from 100µg/ml to 1µg/ml).

Decreasing the antigen concentration increased the selection pressure for phage displaying

122

Figure 3.1. Workflow diagram of passive phage selection process. Three successive rounds of selection were performed in HEWL-coated immunotubes (Section 2.2.2). Eluted phage were amplified in TG1 E.coli (Section 2.2.5) and precipitated (Section 2.2.6) and the resuspended precipitated phage used as the input for the following selection round.

Quality controls for the selection process were included at key stages of selection (dashed boxes) and performed as described in Section 2.2.4 (Elution titre), Section 2.2.8 (Binding

ELISA), Section 2.2.9 (DNA sequencing), and 2.2.6 (Amplified phage titre).

123 dAbs with a higher binding specificity (Kd) for the HEWL antigen, and thus enriched the population of phage displaying dAbs with a higher affinity for HEWL. Enrichment success was determined after each round of selection by measuring the elution titre (output phage)

(TU/ml) and calculating the fold increase in elution titre over the first round (Table 3.1). After the first round of selection there was a decrease in elution titre for all four phage libraries

11 5 from 10 TU/ml (dAb library, input phage) to 10 TU/ml in the VHS, VHM and VK libraries and

6 10 in the VHL library. This decrease in phage titre is consistent with previous studies (Heinis et al. 2001, Lin et al. 2008, Liu et al. 2013) and indicates successful selection, as only a fraction of the phage library is expected to contain phage display dAbs specific for the HEWL antigen.

Eluted phage from the first round of selection were amplified, precipitated using PEG-NaCl and resuspended in PBS to generate the input phage for the following round. At this point precipitated phage titre was assessed to confirm successful amplification by TG1 E.coli and to ensure relative consistency in input phage titre. Resuspended precipitated phage titre should exceed the original phage titre to ensure maximal genetic diversity and thus selection efficiency in the following round (Coomber 2002). After the first round all but one of the resuspended precipitated phage titres exceeded the titre of the original corresponding library,

12 reaching 10 TU/ml in the VHS, VHL and VK dAb libraries. The sole exception was the VHM dAb library, which maintained the same order of magnitude (1011 TU/ml) as the original library titre, but as it was several order of magnitude larger than the output titre and equivalent to the original library titre, it was deemed sufficient for further use. Resuspended precipitated phage titre increased again for all phage libraries after the second round of selection to 1013

TU/ml, which again exceeds the original library titres and thus was used in round 3 selections.

Precipitation titres were not evaluated following round 3 selection as phage DNA was

124

Selection Input phage Output (eluted) phage Fold Library Round (TU/ml) (TU/ml) enrichment* 1 2x1011 1x105 - 11 8 VHS 2 1.9x10 1x10 1100 3 1.4x1012 3.7x109 37000 1 1x1011 2.5x105 - 10 7 VHM 2 8x10 5x10 200 12 9 3 1.4x10 3.2x10 12800 1 1x1011 1.05x106 - 11 7 VHL 2 2.1x10 3.5x10 35 3 1.3x1012 3.6x109 3600 1 5x1011 7x105 - 11 7 VK 2 2.5x10 8x10 114 3 1.7x1012 3.1x109 4429

Table 3.1 Enrichment of dAbs through passive phage display. Three successive rounds of passive phage display selection (Section 2.2.2) were performed using the dAb libraries described in Section 2.2.1 (Round 1 Input Phage). Eluted phage titre (Output phage) was determined after each round of selection as described in Section 2.2.4. Eluted phage were amplified in TG1 E.coli (Section 2.2.5), precipitated (Section 2.2.6) and resuspended precipitated phage titre calculated (Section 2.2.6). 100µl of resuspended precipitated phage was then used for the subsequence round of selection (Round 2 and 3 input phage). *Fold enrichment = input phage titre/output phage titre after round 1 selection.

125 extracted from TG1 E.coli cultures and used for subsequent cloning into expression vectors

(Section 3.4). Precipitation titres did not exceed 1013 TU/ml, which is likely to be the result of

TG1 E.coli reaching maximal density through the culture period due to the exhaustion of nutrients in the 2xTY broth.

A total of 100µl of resuspended precipitated phage from the previous round were used as the input phage for the following round, thus maintaining in input phage titre of similar magnitude to the previous round and similar diversities between dAb libraries (Matz and Chames 2012).

Output titre (Table 3.1) increased for all four dAb libraries after the second round of selection with a consistent elution titre of 107 TU/ml for all phage libraries. Fold enrichment values after round 2 selection varied between the dAb libraries, with VHS showing the highest enrichment

(1100-fold), the VHM and VK libraries showing modest enrichment (100-fold and 114-fold respectively) and the VHL library showing the lowest enrichment of 35-fold. After the third round of selection output titres increased further to 109 TU/ml for all phage libraries, which is slightly higher but still comparable to previous studies (Heinis et al. 2001, Liu et al. 2013). Fold enrichment values increased considerably for all phage libraries to 3700-fold for VHS, 12800- fold for VHM, 3600-fold for VHM and 4429-fold for VK. Previous studies have observed fold enrichment values between 15-fold and 2000-fold (Heinis et al. 2001, Dorai et al. 2009, Liu et al. 2013), thus these enrichment values indicate successful enrichment of the phage population towards dAbs specific to the HEWL antigen. As amplification of eluted phage results in a phage population with many duplicates, it is usually not desirable to perform more than 3 rounds of selection as this will impact on genetic diversity in the resulting anti-HEWL dAb population, leading to fewer unique dAbs being isolated for study. It is also conceivable that amplified phage are not those with the strongest binding affinity for HEWL but instead

126

have gained some competitive advantage over other phage in the population. It is for this reason that HEWL binding specificity was assessed after each round of selection by sandwich

ELISA (Figure 3.2) and the four dAb libraries were panned separately.

Phage ELISAs were performed on a sample of 22 randomly selected clones taken from elution titre plates for each dAb library and after each round of selection (Figure 3.2). After the first round none of the VHS clones and 2 out of 22 (9%) of phage clones for VHM, VHL and VK tested positive for HEWL binding (Figure 3.3 A). Following the second round of selection there was a sharp increase in HEWL-specific phage for all dAb libraries. The VHS library had the greatest number of positive hits (96%), with 91% of VHM, 86% of VHL and 77% of VK clones testing positive for HEWL binding. This confirms the enrichment success for phage displaying HEWL- specific dAbs, which was indicated by the elution titres in Table 3.1. The number of HEWL- specific phage increased again for all phage libraries to 100% positive hits in the VHS and VHL libraries and 96% for the VHM and VK libraries (Figure 3.3 B). One previous study (Hussack et al.

2012) demonstrated that 94% of their clones (16 out of 17) tested positive for their desired antigen after four rounds of biopanning, whilst another (Lin et al. 2008) detected only 44% (40 out of 90) positive binders after four rounds of selection. Thus after three rounds of passive selection HEWL-specific dAbs had been enriched in the phage population.

In order to study the consequences of sequence variation on mAbdAb expression it was desirable to have a panel of unique sequence dAbs to study, therefore sequence diversity was assessed on a random sample of 22 clones after each round of selection (Table 3.3). After round 1 selection all the dAb libraries each clone sequence had a unique amino acid sequence,

127

Figure 3.2 ELISA of HEWL binding phage during passive selection. Phage ELISAs were perfomed as described in Section 2.2.8 on a sample of 22 randomly selection colonies per dAb library taken from elution titre plates (Section 2.2.4). Each sample was tested simultaneously on two microtitre plates, the first coated with the same concentration of HEWL used for the selection round and the second on a non-coated microtitre plate and the fold difference between coated and non-coated absorbance values was calculated. Controls were 2xTY medium only samples tested with M13-HRP antibody (negative) and anti-lysozyme antibody

(positive). Positive binders were classified when results from the HEWL-coated ELISA plate more than three times greater than the corresponding colony on the non-coated ELISA plate

(grey dotted line). A. Round 1 B. Round 2 C. Round 3. Key to Figure: Negative control ( ),

Positive control ( ), VH phage ( ), VH phage ( ), VH phage ( ),V phage ( ). S M L K

128

129

A dAb Library Positive Hits Negative Hits % HEWL binders VHS 0 22 0 VH 2 20 9 Round 1 M VHL 2 20 9

VK 2 20 9

VHS 21 1 96 VH 20 2 91 Round 2 M VHL 19 3 86

VK 17 5 77

VHS 22 0 100 VH 21 1 96 Round 3 M VHL 22 0 100

VK 21 1 96

100

0 VHS VHM VHL Vk

Figure 3.3. Percentage of HEWL binding phage identified following each round of selection.

Phage ELISAs were perfomed as described in Section 2.2.8 on a sample of 22 randomly selection colonies per dAb library taken from elution titre plates (Section 2.2.4). Positive hits were classified as a result on the HEWL-coated ELISA plate that is over three times higher than the corresponding colony on the non-coated ELISA plate. A. Table of positive and negative hits from phage ELISAs for each dAb library after each round of selection. B. Percentage of positive HEWL-binding phage after each round of selection. Key to figure: Round 1 ( ), Round 2 ( ), Round 3 ( ) selection.

130

In order to study the consequences of sequence variation on mAbdAb expression it was meaning the genetic diversity in the sample population was 100%. For each dAb library

(except the VHS library) fewer than 22 sequence reads were identified, indicating a poor sequencing reaction. This could be a result of poor PCR amplification of phage DNA during colony PCR (Section 2.2.9.1) leading to a low DNA concentration and failed sequencing reaction.

After the second round of selection genetic diversity decreased for all dAb libraries. In the VHS library only 17 of 22 (77%) clones were unique (Appendix II), with four predominant clones identified (i.e. multiple clones having identical amino acid sequences). Only 17 of the 22 clones tested for the VHM library returned sequence alignments, of which 16 (94%) were unique with one DNA sequence detected in 2 clones. There were very few sequence reads detected for the

VHL library (11 of 22) of which 10 (91%) were unique, with one predominant clone. For the VK library 19 of 21 (90%) sequence reads were unique and two predominant sequences were detected. The comparatively low diversity observed in the VHS library is likely the result of the higher fold enrichment of this phage library.

Sequence diversity decreased further for all four dAb libraries following the third selection round. The VHS and VHL libraries both had 10 unique sequences of 22 detected reads (45% diversity) with 6 and 5 predominant clones in the VHS and VHL libraries respectively. The VK library had a slightly higher diversity (10 of 21 (48%)) and 6 predominant clones whilst the VHM library showed the highest retained sequence diversity after selection with 12 of 22 (55%) unique sequences and 5 predominant clones. In a similar study where three rounds of passive selection was performed against the HEWL antigen using one dAb library, 21 clones were sequenced, of which only 6 (29%) were unique (Jespers et al. 2004). 131

Sequence Reads Unique Sequences % Unique

VHS 22 22 100 VH 20 20 100 Round 1 M VHL 15 15 100

VK 19 19 100

VHS 22 17 77 VH 17 16 94 Round 2 M VHL 11 10 91

VK 21 19 90

VHS 22 10 45 VH 22 12 55 Round 3 M VHL 22 10 45

VK 21 10 48

B 100

20 % Unique sequences % Unique

0 VHS VHM VHL Vk

Figure 3.4 Genetic diversity of sample dAbs after each round of passive selection. DNA from a sample of 22 randomly selected clones from elution titre plates (Section 2.2.4) was prepared for each dAb library after each round of selection as described in Section 2.2.9, subject to DNA sequence analysis (Section 2.3.14.1) and aligned in DNAstar lasergene 8. A. Table of sequence reads identified, unique sequences and % of unique sequence reads. B. Percentage of unique sequences after each round of selection as a measure of dAb library diversity. Key to figure:

Round 1 ( ), Round 2 ( ), Round 3 ( ) selection. 132

Thus after three successive rounds of panning with the HEWL antigen all dAb libraries showed high binding specificity for HEWL (96-100%) whilst retaining genetic diversity (45-55%) within the phage populations. As such, this passive selection approach can be considered successful and comparable to the work of previous groups (Jespers et al. 2004, Lin et al. 2008, Hussack et al. 2012, Liu et al. 2013). Therefore, DNA was extracted from the bacterial pellet of TG1 E.coli amplified phage from round 3 selection and used for subcloning into a transient expression vector (Section 3.4).

3.3 Soluble phage display selection of anti-HEWL dAbs

Whilst passive phage display is a relatively simple process that is often successful, a recent comparative study on passive and soluble selection with the same antigen has shown that passive selection yields a greater genetic diversity in the resulting phage, soluble selections yields higher specificities (Kd) for the target antigen after the same number of selection rounds (Shcherbakova et al. 2012). It has been suggested that immobilising the target antigen on a plastic surface may result in a conformational change in the antigen, which may alter or mask the binding epitope, thus influencing selection and binding in vivo (Matz and Chames

2012). For this reason it is often desirable to perform both types of selection procedure to ensure the selection of both highest affinity binding proteins and largest genetic diversity.

Furthermore, it was of interest to determine whether the selection procedure used for dAb isolation had any effect on the expression of mAbdAbs.

133

Figure 3.5. Workflow diagram of soluble phage selection process. Three successive rounds of soluble selection (Section 2.2.3.3) were performed independently for each dAb library using biotinylated HEWL (Section 2.2.3.1), which was incubated with the dAb library in microcentrifuge tubes. Streptavidin coated paramagnetic beads (Dynabeads) were pre- incubated in 2% milk in PBS and washed before incubating with the phage-HEWL mixture and then HEWL-phage-bead complexes were captured on a KingFisher™mL Magnetic Particle Processor and unbound phage washed. Bound phage were eluted, amplified in TG1 E.coli (Section 2.2.5) and precipitated (Section 2.2.6) and the resuspended precipitated phage used as the input for the following selection round. Quality controls for the selection process were included at key stages of selection (dashed boxes) and performed as described in Section 2.2.4 (Elution titre), Section 2.2.8 (Binding ELISA), Section 2.2.9 (DNA sequencing), and 2.2.6 (Amplified phage titre).

134

The same four synthetic dAb libraries used in studies described in Section 3.2 (Ignatovich et al. 2012) were also used in soluble selection (soluble selection studies were performed in parallel with the passive selection). Again, three successive rounds of selection (Figure 3.5) were performed using decreasing concentrations (1000nM to 10nM) of biotinylated HEWL antigen (Section 2.2.3.1) to enrich the HEWL-specific dAbs, and enrichment success determined in the first instance by eluted (output) phage titre.

After the first round of soluble selection the output titres decreased in all four dAb libraries

11 5 (Table 3.2). The VHM and VK libraries decreased from 10 TU/ml to 10 TU/ml, consistent with the results obtained for passive selections (Table 3.1). However the VHS and VHL libraries decreased to 104 TU/ml, which is lower than expected but still comparable to previous studies

(Watanabe et al. 2002). After the second round elution titres increased for two dAb libraries

6 that exhibited the poorest elution titres in round 1 selection, to 10 TU/ml for the VHS library

5 and 10 for the VK library. These elution titres then remained constant for both dAb libraries after the third round of selection, suggesting that maximum enrichment may have been reached after two rounds of selection. The VHL library elution titres also remained constant after round 2 selection, but increased to 106 TU/ml after the third round of selection.

Surprisingly, the VHM library showed a decrease in elution titre after two selection rounds, from 105 to 104 TU/ml, however this decrease in elution titre has been observed before

(Stocker et al. 2008) and did not affect further rounds of selection in that study.

6 Indeed the elution titre after round 3 selection for the VHM library increased to 10 TU/ml.

Although elution titres had increased to between 105 and 106 TU/ml for all the dAb libraries after three rounds of selection, they were of a lower order of magnitude than corresponding

135

Input phage Output (eluted) phage Fold Library Round (TU/ml) (TU/ml) enrichment* 1 2x1011 9.5x104 - 11 6 VHS 2 9.5x10 1x10 11 3 7.5x1011 2.7x106 28 1 1x1011 2.2x105 - 11 4 VHM 2 8.2x10 8.5x10 0.4 11 6 3 6.9x10 4x10 18 1 1x1011 5x105 - 11 5 VHL 2 6.8x10 1.5x10 0.3 3 9x1011 3.5x106 7 1 5x1011 7x104 - 10 5 VK 2 7.3x10 6.5x10 9 3 7.8x1011 6x106 86

Table 3.2 Enrichment of dAbs through soluble phage display. Three successive rounds of soluble phage display selection (Section 2.2.3.3) were performed using the dAb libraries described in Section 2.2.1 (Round 1 Input Phage). Eluted phage titre (Output phage) was determined after each round of selection as described in Section 2.2.4. Eluted phage were amplified in TG1 E.coli (Section 2.2.5), precipitated (Section 2.2.6) and resuspended precipitated phage titre calculated (Section 2.2.6). 100µl of resuspended precipitated phage was then used for the subsequent round of selection (Round 2 and 3 input phage). *Fold enrichment = Output phage titre/output phage titre after round 1 selection.

136 elution titres from the passive selection approach, which consistently reached 109 TU/ml after the same number of selection rounds. This also resulted in more modest fold enrichment values obtained from soluble selections, which reached a maximum of 86-fold enrichment (VK library) after three rounds, compared to a maximum enrichment of 37000-fold (VHS library) after three selection rounds.

The differences observed in elution titre and fold enrichment between the two selection techniques can be attributed to lower HEWL antigen concentrations used in the soluble selection process (1000nM compared to 100µg/ml HEWL in round 1) that may have been limiting, but could also be a result of the biotinylation of the HEWL antigen (Section 2.2.3.1,

Figure 2.1). The biotinylated HEWL used for these selections was the product of a 4:1 challenge ratio of Biotin: HEWL, which was performed for 30mins at room temperature (Figure 2.1 B).

However, this reaction was incomplete, as determined by the presence of a mass peak of

14297, a species that corresponds to the mass of unbiotinylated HEWL (Figure 2.1 A). The presence of unbiotinylated HEWL during selections will have an effect on the elution titre, as specific dAbs displayed on the phage will still bind unbiotinylated HEWL in solution, but will not be captured by the magnetic beads and thus will be lost during the stringent washing steps. A longer incubation time for HEWL biotinylation of 1hr was performed in order to address this issue (Figure 2.1 C), but resulted in the addition of more biotin molecules (up to four) as well as undesirable off-target chemical reactions such as oxidation and deamination, which is why the shorter incubation time was chosen for use in selections. Finally, as mentioned at the start of this section, it has been proposed that using biotinylated antigens further increases selection pressure, as it replicates the native conformation of the antigen more effectively, thus resulting in fewer selected phage with a greater antigen specificity (Shcherbakova et al. 2012).

This was tested in the first instance by phage binding ELISA.

137

After the first round none of the colonies tested in any of the dAb libraries were positive for

HEWL binding (Figure 3.6 A). However, as only two of the four dAb libraries after the first round of passive selection showed only 2 out of 22 binders each (Figure 3.3 A), this result is still comparable with the passive approach. Following the second round of selection there was an increase in HEWL-specific phage in all four dAb libraries, with the VK library showing the highest increase with 20 out of 22 (91%) of the colonies testing positive for HEWL. The other dAb libraries shower a more modest increase of 18% for VHS, 9% for VHM and 41% for VHL, all of which were less than the outcomes obtained during passive selection (77-96% positive binders). The number of positive binders then increased after the third round of selection for all but the VK library, which decreased to 36% positive binders, indicating that enrichment had been reached after two rounds of selection and that this further round was counterproductive.

None of the other libraries attained 100% binding specificity, the other libraries attained 100% binding specificity, with only 50%, 73% and 68% of clones testing positive for HEWL in the VHS,

VHM and VHL libraries respectively.

This could suggest that the soluble selection of the HEWL antigen is not as effective as passive selection, which could be caused by biotinylation of lysine residues in the binding epitope of

HEWL or the loss of those HEWL-specific dAbs bound to unbiotinylated HEWL in the solution as previously discussed. It may also be a result of the specificity of the ELISA method, which used immobilised HEWL that could differ in conformation to the soluble HEWL used in selection.

Previous studies (Blanc et al. 2014) have obtained similar binding specificities (70%) after three rounds of soluble selection and Shcherbakova et al. (2012), showed that passive selections can result in the selection of phage specific for the plastic surface used in selection, not the target

138

Figure 3.6 ELISA of HEWL binding phage during soluble selection. Phage ELISAs were perfomed as described in Section 2.2.8 on a sample of 22 randomly selection colonies per dAb library taken from elution titre plates (Section 2.2.4). Each sample was tested simultaneously on two microtitre plates, the first coated with the same concentration of HEWL used for the selection round and the second on a non-coated microtitre plate and the fold difference between coated and non-coated absorbance values calculated. Controls were 2xTY medium only samples tested with: M13-HRP antibody (negative) and anti-lysozyme antibody (positive).

Positive binders were classified as a result on the HEWL-coated ELISA plate that is over three times higher than the corresponding colony on the non-coated ELISA plate (grey dotted line).

A. Round 1 selection B. Round 2 selection C. Round 3 selection. Key to Figure: Negative control

( ), Positive control ( ), VHS phage ( ), VHM phage ( ), VHL phage ( ), VK phage ( ).

139

140

A dAb Library Positive Hits Negative Hits % HEWL binders VHS 0 22 0

VHM 0 22 0 Round 1 VHL 0 22 0

VK 0 22 0

VHS 4 18 18

VHM 2 20 9 Round 2 VHL 9 13 41

VK 20 2 91

VHS 11 11 50

VHM 16 6 73 Round 3 VHL 15 7 68

VK 8 14 36

100

40 % HEWL Binders % HEWL

0 VHS VHM VHL Vk

Figure 3.7. Percentage of HEWL binding phage identified following each round of soluble selection.

Phage ELISAs were perfomed as described in Section 2.2.8 on a sample of 22 randomly selection colonies per dAb library taken from elution titre plates (Section 2.2.4). Positive binders were classified as a result on the HEWL-coated ELISA plate that is over three times higher than the corresponding colony on the non-coated ELISA plate. A. Table of positive and negative hits from phage ELISAs for each dAb library after each round of selection. B.Percentage of positive HEWL-binding phage after each round of selection. Key to figure: Round 1 ( ), Round 2 ( ), Round 3 ( ) selection. 141 antigen, despite stringent wash steps. Therefore, the higher percentage of positive clones in passive selection may be a result of non-specific phage.

It is not possible to determine from the phage ELISA used whether dAbs from soluble selection had a higher binding affinity for HEWL than passively selected dAbs, as this method is not sufficiently quantitative as it does not measure association and dissociation rates of binding.

Also, because these dAbs are to be used in fusion with Alemtuzumab, dAb binding specificity may alter drastically in the context of the whole molecule, particularly with regards to avidity.

Therefore, further analysis of functionality was performed on the final mAbdAb constructs from both passive and soluble selection and will be discussed in Chapter 4. However, it can be tenuously inferred that soluble dAbs do have a higher binding specificity than passively selected dAbs as higher binding values were consistently obtained from soluble dAbs.

Once again DNA sequencing was performed after each round of selection on a sample of 22 randomly selected clones, in order to monitor genetic diversity of the selected phage (Figure

3.8). Poor reads were obtained after the first round of selection, however it was possible to distinguish that each sequence was unique for all dAb libraries as each sequence resulted in a unique contig during alignment in DNAstar, meaning diversity after the first round was 100%.

After the second round diversity decreased dramatically in VK dAb library, with only 4 out of 22

(18%) unique sequences identified with one predominant clone being identified in 19 of the sequence reads (Appendix II). This data is consistent with the binding specificity of 91% after the second round, which indicated enrichment had been reached. The other dAb libraries also decreased in diversity to 45% in VHS (10 out of 22) with 3 predominant clones, 90% in VHM (19 out of 21) with one predominant clone, and 65% in VHL (11 out of 17) with three predominant

142 clones. There was a marked decrease in diversity for all dAb libraries after the third round of selection. The VHS library decreased to 25% (3 out of 12) with two predominant clones, the

VHM library decreased to 43% (9 out of 21) with one predominant clone and the VHL library decreased to 19% (4 out of 21) with one predominant clone. The VK library showed the lowest diversity, with only 15% diversity (3 out of 20) with all three unique clones resulting in multiple reads.

The objective of phage display from an industrial point of view is to obtain relatively few binders with the highest specificity (Kd) for the target antigen for further development into the clinical pipeline and, as a result, published articles rarely focus on the diversity of sequences obtained after selection. However one group (Hussack et al. 2012) cited that out of 106 sequenced clones only 17 contained unique sequences (16%) after four rounds of passive selection, which is lower than the diversity obtained in all dAb libraries for both selection procedures. As the main aim of this Thesis is to investigate how sequence ultimately affects expression, it was more desirable to have a wide range of sequentially diverse dAbs over high binding specificities. Therefore, to meet the requirements of this project, the precipitated phage from the second round of selection was used for subsequent cloning into expression vectors (Figure 3.9 and Figure 3.10).

143

A Sequence Reads Unique Sequences % Diversity VHS 21 21 100 VH 19 19 100 Round 1 M VHL 19 19 100

VK 21 21 100

VHS 22 10 45 VH 21 19 90 Round 2 M VHL 17 11 65

VK 22 4 18

VHS 12 3 25 VH 21 9 43 Round 3 M VHL 21 4 19

VK 20 3 15

B 100 90

70 60 50 40

30 % Unique sequences % Unique 20 10 0 VHS VHM VHL VK

Figure 3.8. Genetic diversity of sample dAbs after each round of soluble selection. DNA from a sample of 22 randomly selected clones from elution titre plates (Section 2.2.4) was prepared for each dAb library after each round of selection as described in Section 2.2.9, subject to DNA sequence analysis (Section 2.3.14.1) and aligned in DNAstar lasergene 8. A. Table of sequence reads identified, unique sequence reads and % of unique sequence reads. B. Percentage of unique sequences after each round of selection as a measure of dAb library diversity. Key to figure: Round 1 ( ), Round 2 ( ), Round 3 ( ) selection.

144

3.4 Generation of mAbdAb expression vectors

Following phage display selection of dAbs specific to HEWL, dAb DNA contained within the pDOM4 phage vector (Figure 3.8 A) from round 3 passive and round 2 soluble selections were cloned (Figure 3.10) into the CEG1 transient pTT5 expression vector (Figure 3.8 B) in order to generate mAbdAb constructs. The CEG1 vector consists of Alemtuzumab (Campath 1-H), a humanized anti-CD52 IgG1 antibody, a short proprietary peptide linker and a dAb acceptor site, which results in a mAbdAb fusion protein under the control of a single promoter (RSV) with a single signal peptide sequence located at the 5’ end of the mAb. This cloning procedure was performed independently for each library (8 digests in total) using DNA containing the entire population of amplified phage from the desired selection round, so that maximum number of unique sequences could be obtained from discrete DH5α E.coli colonies picked from cloning plates.

A total of 50 unique sequences were identified of which 39 were generated using the VH libraries (VHS, VHM, and VHL) and 11 from the VK library (Figure 3.11). Of the 39 VH dAbs, 27 were generated through passive and 12 through soluble selection. Only one unique sequence was identified through soluble selection for the VK library, with the remaining 10 generated through passive selection. This reflects the data collected during the selection process, which indicated lower genetic diversity in dAbs derived through soluble expression, and resulted in fewer unique sequences identified after cloning.

Within the sequences themselves there are a few consensus residues, shown in bold, namely tyrosine (Y) and methionine (M) in the CDR1 and isoleucine (I) and glycine (G) in the CDR2 of 145

VH dAbs. The variable domains (VH and VL) of antibodies contain six hypervariable loops within the three CDRs which pertain to the binding paratope of the variable region (Carter

2006). Therefore these conserved residues can be considered framework residues connecting the hypervariable regions. Indeed the VK dAbs also contain consensus sequences; isoleucine

(I) and leucine (L) in the CDR1, Serine (S) in the CDR2 and proline (P) in the CDR3. The CDR3 of the VH dAbs varies in length, and as such no consensus sequences could be identified.

It is interesting to note the high frequency of glutamate (E) residues in the VH dAbs, which is highly conserved the final position of the CDR1 (14 dAbs) and in the first position of the CDR3

(9 dAbs). There is also a high frequency of serine (S) in the first position of the CDR1 (8 dAbs) and threonine (T) in the first position of the CDR2 (10 dAbs). These residues appear in VH dAbs from all libraries and both selection approaches and could relate to lysozyme binding. In their work Jespers et al., (2004) also observed that specific residues occurred with high frequency at conserved positions in the CDRs of selected dAbs, such as lysine (K) in the first position of the CDR3 of dAbs selected for human serum albumin (Jespers et al. 2004) .

There were also a number of mutations within the framework regions of certain dAbs, which can be found in the full sequence alignments in Appendix II (Figure A2.1). The variation in amino acids within each dAb was calculated as a function of the dAb length and the full mAbdAb construct. There was an 11 to 17% variation in amino acids within the dAb, which equates to a 2-4% variation in the entire mAbdAb structure. Thus it can be stated that for

146

Figure 3.9. Vector maps for the generation of mAbdAbs. A. pDOM4 phagemid vector containing dAbs selected through phage passive and soluble phage display (Ignatovich et al.

2012). B. CEG1 vector map containing Alemtuzumab (IgG1) and a dAb acceptor site 3’ of a short proprietary peptide linker.

147

A bp Sal I Not I Sal I/Not I 10,000

4,000

2,000

800 400

B bp VHS VHM VHL VK

2,000

800

400

200 C bp VHS VHM VHL VK

2,000

800

400

200

Figure 3.10. Cloning of soluble and passive dAbs into the CEG1 pTT5 transient expression vector. Vectors were digested with SalI and NotI enzymes as described in Section 2.3.11 and gel purified as described in Section 2.3.9 A. 1% [w/v] agarose gel (Section 2.3.8) of CEG1 vector

(Figure 3.6 B) digested with SalI only, NotI only and SalI/NotI with CIP treatment. The backbone band at 5854bp after SalI/NotI digestion was excised and gel purified for cloning. B. 1% agarose gel (Section 2.3.8) of pDOM4 vectors (Figure 3.6 A) containing VHS, VHM, VHL and VK dAbs from passive (Section 2.2.2) digested with SalI/NotI. The dAb bands at ~400bp were excised and gel purified for cloning. C. 2% agarose gel (Section 2.3.8) of gel purified dAbs.

148 these mAbdAbs, amino acid variations were contained at discrete locations within the dAb and variations between mAbdAb sequences were minimal. However, there are a number of publications where only a single nucleotide or amino acid variation in one domain of a normal monoclonal antibody has been shown to result in a poor expression (Dul and Argon 1990,

Wiens et al. 2001, Mason et al. 2012). Despite the low percentage of variation in the mAbdAbs generated for this project, there are still a large number of amino acid variations, which means identification of specific residues that impact on mAbdAb expression could be challenging. An alternative approach to generating dAbs through phage display, which resulted in this wide range of sequences, would have been single point mutations on one dAb of interest. However, due to the sensitive nature of this novel format at the time in terms of intellectual property, it was necessary to create an “academic” panel of mAbdAbs to study.

This meant that there was no previous data on the expression of this particular mAbdAb, and as such, a mutational approach was not feasible. Also, as this was a preliminary study on determinants for mAbdAb expression, more data could be obtained from a wider range of sequence variants derived from phage display. Furthermore, phage display is the method used by both GSK and other research groups in the identification of new lead targets for clinical trials, and as such, following this approach to generate the dAbs for this project meant that further conclusions on whether phage selection approach and dAb library also impact on the expressibility of the mAbdAb format.

The phage display and cloning approaches used in this Chapter have resulted in generation of

50 unique mAbdAb constructs (Figure 3.11) with variations in amino acids contained largely within the CDRs of the dAb and some evidence of conserved residues and CDR3 sequence.

Thus, a panel of sequentially diverse mAbdAbs have been generated in order to investigate the determinants of expression for the mAbdAb construct.

149

Table 3.3 Amino acid sequences of the CDRs of unique dAbs selected through passive and soluble phage display. dAbs derived from phage display selection were numbered according to the GSK dAb numbering system. Amino acid variation was derived from the number different amino acids identified in the CDR and framework of the dAb, expressed as a percentage of the amino acid length of the dAb and mAbdAb. * indicate identical CDR3 sequences in unique dAbs.

150

Amino acid Amino Acid Sequence variation (%) dAb Full Library dAb No Selection CDR1 CDR2 CDR3 only mAdAb H014 Passive GLYDMV SIKRDGNV HEWAVKFTRYPG 17 4 H020 Passive SKYTMF SINASGAH GHSQQ 12 3 H025 Passive YDYSME GITADGVY EPML 11 2 H018 Passive ARYTME TISPAGRT EPAI* 11 2 H017 Passive GAYQME TISPSGSN EPMI 11 2 H032 Passive ARYSMY SIDSYGGQ GKSQK 12 3 H006 Passive SRYGMQ EIDVHGMR SGPD 11 2 H007 Passive SRYPMY EISDKGEL IGGM 11 2 H008 Passive SNYSME SIDAQGRL EPAQ 12 3 H009 Passive SRYDME TISRHGTH EPAT 11 2 VHS H010 Passive PVYEMS TISKSGKM RGRP 13 3 H012 Passive SEYSMQ AITPHGFA DDAA 11 2 H068 Passive SYYDMG SITYDGHV FYSYSA 13 3 H114 Passive TAYKMA SITKHGTH ESETS 13 3 H080 Soluble QDYYMM SIGIDGSV FGRKG 12 3 H081 Soluble AKYNMY GIESDGTT ERRP 12 3 H092 Soluble YGYGMR SISPGGKY DGDNR 12 3 H085 Soluble ARYVMN TITPDGNS NWRYSE 13 3 H101 Soluble NAYNMQ RIDPDGQR PSVDKL 13 3 H098 Soluble GWYHME QIDPTGQT MGTSE 12 3 H042 Passive KAYTME SITGQGLN EPAI* 11 2 H015 Passive KRYDMG TISPTGQA DNYRYVPSR 15 3 H019 Passive NEYDMA TIDMSGKY LGQRVSTE 14 3 H029 Passive FDYSMG YIGPQGQP SSMSPYTLH 15 3 H050 Passive NPYWMG AINPVGND RKYKHRG ** 14 3 H031 Passive GMYHME TIGPSGMY RKYKHRG ** 14 3 H049 Passive DYYEMT SIEPGGLD RGPASFS 13 3 VHM H035 Passive AGYQMA SIGPSGGF HRHLGSVT 14 3 H047 Passive EDYDMV TISAFGAT PPWTENG *** 13 3 H048 Passive DVYTME TISPGGSF EPAN 11 2 H078 Passive SMYTME SISPGGHS PPWTENG *** 14 3 H105 Soluble RYYEMG LITHDGNV MVDDPGR 14 3 H095 Soluble HWYRMG DISADGAK TNPYNYNA 13 3 H109 Soluble HSYGME HISADGGF YSLTNNDDL 15 3

151

Amino acid Amino Acid Sequence variation (%) Full Library dAb No Selection CDR1 CDR2 CDR3 dAb only mAdAb H093 Passive TQYSMA SILAHGSL YTSAHTNGPQ 15 3 H100 Passive TDYAMD RIDQWGLF VTFTPFMFGG 15 3

VHL H086 Soluble GWYDMK SINMSGDR DFPI 12 3 H082 Soluble DYYEMA AISARGHS YTSLNKNGDQ 15 4 H091 Soluble PYYRME HIDPTGYM PSLWKKPAGLS 16 4 K001 Passive NIRTWLH RVSQ VHSYPY 14 3 K005 Passive FISNGLN GIST WAAFPY 12 2 K003 Passive DIWLALN GVSE DAHFPS 12 2 K004 Passive SIKDKLN HGSI RRRHPK 12 2 K007 Passive NIEDLLL WASE RYYEPF 12 2

VK K010 Passive SIGRALE NSSY YKLRPL 13 3 K012 Passive PIGRELM RGSR FWDYPI 13 3 K013 Passive TIMDMLN WASH HYQYPL 13 3 K015 Passive NIDRNLE NSSW HSRRPL 12 2 K016 Passive NIRRSLQ DSSD DSMWPY 14 3 K017 Soluble NIEDLLS WGSN DYVFPL 12 2

152

3.5 Discussion

Two independent phage selection approaches, using four dAb libraries, were employed to generate a range of sequentially diverse HEWL-specific dAbs. After three rounds of selection using a decreasing concentration of HEWL to enrich the phage population, the passive selection approach resulted in a higher fold enrichment towards HEWL-specific dAbs (up to

3700-fold, Table 3.1) as compared to the soluble selection approach (up to 86-fold, Table 3.2), with higher elution titres observed consistently in the passive selection approach. Binding specificity for the HEWL antigen increased after each round of selection for both selection procedures, indicating that both approaches were successful. However, the percent of positive HEWL-binding phage in the sample population for passive selection was higher for all dAb libraries and all selection rounds (Figure 3.3) as compared to dAbs from soluble selection

(Figure 3.7) although soluble selection resulted in apparently higher binding specificities for

HEWL (Figure 3.6).

Genetic diversity of the selected phage was assessed after each round of selection through

DNA sequencing to ensure that a wide range of sequentially diverse dAbs could be isolated following cloning into the transient expression vector CEG1 (Figure 3.9 B). Genetic diversity decreased as expected after each round of selection for all dAb libraries and both selection approaches. Higher percentage diversities were obtained after three rounds of passive selection (Figure 3.4) compared to soluble selection (Figure 3.8) in the sample populations tested. As this project aims to investigate the effect of dAb sequence on the expression of the mAbdAb construct it was desirable to have a high genetic diversity, therefore round 3 passive and round 2 soluble DNA was extracted from the TG1 E.coli cultures (used to amplify eluted phage) for subsequent cloning into the CEG1 vector (Figure 3.10).

153

The cloning procedure employed was to use a DNA extract containing a mixed population of dAbs from the desired selection round in order to maintain a high level of genetic diversity in the resulting mAbdAb population. A total of 50 unique dAbs were identified following cloning (Figure 3.11), with 37 dAbs derived from passive selection and 13 from soluble selection. Thus it appears that the passive selection approach was more successful for the identification of a wider diversity of anti-HEWL dAbs than the soluble approach. Of the passively selected dAbs, 14 were obtained from the VHS dAb library, 11 from the VHM, 2 from VHL and 10 from the VK dAb library. This could be indicative of the relative cloning success of the different dAb libraries, which was performed independently. Of the dAbs generated through soluble phage display, 6 were obtained from the VHS library, 3 each from the VHM and VHL libraries and only 1 unique dAb was identified from the VK library. This reflects the low genetic diversities observed after round 2 soluble selection and further indicates the relative cloning success of the different libraries.

Thus this Chapter has described the generation of a panel of mAbdAbs (Figure 3.11) with a common mAb and linker and range of unique sequence dAbs. Chapter 4 focuses on the characterisation of expression for these constructs to identify the limiting stages in mAbdAb expression.

154

CHAPTER 4: CONSEQUENCES OF SEQUENCE VARIATION

ON MABDAB EXPRESSION IN MAMMALIAN EXPRESSION

PLATFORMS

155

4.1 Introductory remarks

In Chapter 3 a panel of 50 unique sequence mAbdAbs were generated in order to study the consequences of sequence variation on mAbdAb expression, which is the main objective for

Chapter 4. Sequence variation was achieved through phage display selection of dAbs towards a common target antigen (HEWL) and the selected dAbs were subsequently cloned into the transient pTT5 transient heavy chain vector (CEG1) to generate mAbdAb constructs.

Previous studies from other laboratories have shown that expression titres in transient HEK systems correlated well with those obtained in stable CHO systems (Diepenbruck et al. 2013), therefore initial characterisation of expressibility was performed on all 50 unique constructs using a HEK transient system. Binding ELISA and Biacore analyses were then performed to confirm that mAbdAbs contained dAbs specific to the target antigen (HEWL).

Sequence variants exhibited a range of expression titres and HEWL binding was confirmed in

30 of the 50 mAbdAbs tested. Using this information, a subset of 20 mAbdAb constructs that displayed a range of expression and contained HEWL specific dAbs were then chosen for further characterisation in a CHO stable platform and cloned into a vector system which was suitable for stable expression (RSV; CEG4 mAbdAb HC, CEG5 LC, and CEG6 Alemtuzumab HC

(Appendix Figure A3.2)).

Stable CHO pools were first characterised in terms of growth properties, expression titre and specific productivity during batch culture. The maximum yield obtained in the HEK transient system was then compared to those obtained with stable CHO cells to determine whether the expression platform used affects mAbdAb expression and to confirm the validity of use of the 156

HEK transient screening process. Next, CHO cell lines were characterised in terms of intracellular HC and LC mRNA and protein abundance, and compared to extracellular protein abundance to determine which stage of expression is limiting in their expression, and whether this was uniform for all constructs. Finally, this Chapter concludes with an examination of two key factors which may influence mAbdAb expression titres; translation and proteolytic degradation, through use of in vitro translation and chemical inhibitors which have the potential to target degradation pathways.

4.2 Examination of mAbdAb expression in HEK2936E cells

The fifty unique mAbdAb constructs generated in Chapter 3 were initially characterised in a small scale transient expression assessment in HEK2936E suspension cells. This was performed in order to identify constructs that covered a range of expression prior to use in a stable CHO system. HEK293 transfectants showed a range of expression (between 0.2µg/ml and 24.1µg/ml) for mAbdAb constructs (Figure 4.1). None of the mAbdAbs exceeded the expression of Alemtuzumab alone (26.6µg/ml) or the high expressing control mAb

(37.2µg/ml). Of the 50 mAbdAbs tested, 16 showed lower expression values than were obtained for the low mAb control (2.7µg/ml) and were considered to be poor expressers.

Eight mAbdAbs showed relatively good expression (over 12µg/ml) compared to Alemtuzumab with two (H014 and H049) showing relatively high expression values of 24.1µg/ml and

18.7µg/ml respectively. The remaining 26 mAbdAbs showed medium to low expression of

3µg/ml to 12µg/ml relative to Alemtuzumab.

157

Figure 4.1 Transient HEK293 expression of unique mAbdAb sequences. dAbs were isolated through passive (Section 2.2.2) and soluble (Section 2.2.3) selection using four libraries (VHS,

VHM, VHL and VK) and cloned into the CEG1 expression vector (Section 2.3.11) to generate mAbdAbs (Figure 3.11). HEK293E suspension cells were transiently transfected as described in

Section 2.4.2.2 and antibody expression measured at 72hrs by Gyros quantification (Section

2.5.1.1). Proprietary low expressing and high expressing IgG1 mAbs and Alemtuzumab alone were used as expression controls. Expression was considered poor if values were equal to or below the poor expressing mAb control (red dotted line). Key to figure: Low IgG control ( ),

Alemtuzumab IgG ( ), High IgG control ( ). mAbdAbs containing VHS dAbs from passive ( ) and soluble ( ) selection, VHM dAbs from passive ( ) and soluble ( ) selection, VHL dAbs from passive ( ) and soluble ( ) selection and VK dAbs from passive ( ) and soluble ( ) selection. Error bars = standard error of the mean of three biological replicates, each with two technical replicates.

158

159

Monoclonal antibody titres of 17-80mg/L have been reported by other laboratories (Liu et al.

2008) using transiently transfected HEK293 cells, whilst titres up to 400mg/L have been reported using antibody codon and process optimization (Vink et al. 2014). For novel format antibodies, however, much lower titres (ranging from 0.5-16mg/L) have been reported by several groups investigating scFv, Fab, scFv-Fc and BiTE formats in transient HEK cells (Braren et al. 2007, Nettleship et al. 2008, Schubert et al. 2011, Diepenbruck et al. 2013, Tiller et al.

2013). One group (Jaeger et al. 2013) has reported expression titres of 14mg/L for an scFv-Fc format in adherent HEK cells, which they were able to increase to a maximum yield of

600mg/L for this molecule using an optimised vector and fed-batch process. Finally, one group using a platform similar to the one used in this study achieved titres of 20-136mg/L for

Fc-dAb fusion proteins, albeit in larger culture volumes (up to 800ml) (Zhang et al. 2009). Thus the titres observed in this study are comparable to published work.

The next task was to ascertain whether dAb library (VHS, VHM, VHL and VK, Section 2.2.1) or selection approach (passive or soluble) used to select the dAb impacted on mAbdAb expression titres. mAbdAbs derived from each dAb library exhibited a range of expression titres, with some dAbs from each library showing relatively high expression values (24.1µg/ml in VHS, 18.7µg/ml in VHM, 14.5µg/ml in VHL and 12.6µg/ml in VK mAbdAbs). In terms of selection approach higher titres were observed for VHS and VHM mAbdAbs derived through passive selection, whilst for the VHL and VK mAbdAbs achieved higher titres in constructs generated by soluble selection. However, statistical analysis through one-way ANOVA determined that neither the dAb library (P = 0.3545) nor the selection method (P = 0.6573) used to generate the dAb significantly affected mAbdAb titre.

160

Following these results, a number of in silico analyses were performed on the 50 unique mAbdAbs in order to investigate whether poor expression could be related to nucleotide and amino acid sequence and related structural consequences. These analyses included mRNA secondary structure prediction, codon adaption index, hydrophobicity and amino acid content. The results of these analyses are found in Appendix IV, but no discernible pattern of linkage to expression was observed in any of the analyses. It was concluded that sequence alone (or the approaches used here) cannot be used to predict expression using this method.

4.3 Confirmation of dAb specificity

The purpose of phage display used in Chapter 3 was to select dAbs specific to the HEWL antigen out of a large population (1011) of potential binders, which was monitored through selection by phage ELISA (Figure 3.3 and Figure 3.7). To confirm whether these 50 unique mAbdAbs contained dAbs specific for the HEWL antigen, binding was assessed by two methods; binding ELISA and Biacore analysis (Figure 4.2), using the supernatants harvested during HEK expression. HEWL binding was initially measured by sandwich ELISA (Section

2.5.2.1). Whilst this method is not quantitative, it is comparable to the phage ELISAs used to monitor binding during selection, as the only difference is the detection antibody used.

A total of 40 mAbdAbs (80%) showed positive binding for HEWL (Figure 4.2 A), 10 showed negative HEWL binding, indicated by absorbance values below 0.1 Abs450nm (H012, H085,

H101, H080, H098, H042, H035, H105, H086 and K016) and seven more showed low absorbance

161

Figure 4.2 HEWL specificity of unique mAbdAbs expressed in HEK293E cells. mAbdAbs were expressed in HEK293E cells as described in Section 2.4.2.2 and supernatants obtained at the end of culture used to measure HEWL binding. A. Binding ELISAs (Section 2.5.2.1) were performed on HEWL-coated plates using an anti-Fab-HRP detection antibody. dAbs were considered HEWL-positive binders if the absorbance was three times higher than the medium only control sample (red dotted line). Error bars = standard error of the mean of three biological replicates, each with two technical replicates. B. Biacore analysis was performed as described in Section 2.5.2.2 and dAbs were considered HEWL-positive binders over the minimum resonance unit threshold (50 RU). Key to figure: mAbdAbs containing VHS dAbs from passive ( ) and soluble ( ) selection, VHM dAbs from passive ( ) and soluble ( ) selection,

VHL dAbs from passive ( ) and soluble ( ) selection and VK dAbs from passive ( ) and soluble

( ) selection.

162

163 values below 0.2 Abs450nm (H017, H007, H081, H048, K005, K003 and K016). Braren et al.

(2007) employed a similar ELISA method to the one used in this study to confirm specificity of scFv- based formats expressed in HEK cells and obtained values of 1 to 1.2 (Abs405nm) for positive binders, however this was using 6 lead targets, all of which were identified as positive binders. Other published studies (Jespers et al. 2004, Hussack et al. 2012) used phage ELISA to determine binding specificity, and have reported between 14 and 94% specificity to the target antigen. Thus, the 80% binding specificity obtained from this ELISA method is comparable to previous studies. Of the 10 negative HEWL binders, 6 were generated through soluble phage selection using VH dAb libraries (VHS, VHM and VHL). This reflects the data observed for soluble phage ELISA in Chapter 3 (Figure 3.7) where the percentage of positive binders in each population was low for round 2 selection (18% of VHS, 9% of VHM and 41% of VHL dAbs), and indicated that enrichment towards the target antigen had not been reached. However round 2 selection outputs were chosen to generate mAbdAbs due to the low genetic diversity observed in round 3 selection (Figure 3.8).Therefore non-binders identified here are likely the result of poor HEWL specificity originally identified during selection. The four remaining non-binders were generated through passive selection with one derived from the VHs library (H012), two from the VHM library (H042 and H035) and one from the VK library (K016). Although these libraries showed a high percentage of HEWL positive binders (Figure 3.3 (96-100%)) after round

3 selection, only a small sample population (22 phage per library) were tested after each round. Therefore it is possible that a few non-binders were present in the selected population used for cloning into the mAbdAb vector.

These results were validated by Biacore analysis, which is a method based on the different principle of surface plasmon resonance (SPR). In this method, binding was measured as a function of resonance units (RU), which gives an indication of whether binding occurs and thus 164 can be related to ELISA. A total of 2728 units of HEWL were immobilised on the BIAcore chip and representative sensorgram data can be found in Appendix V. Fewer mAbdAbs showed positive HEWL binding from Biacore analysis as compared to the ELISA, with an average RU of

1474 (range 69.0 (H009) – 6572.5 (H109)). A total of 30 positive binders (60%) were detected with an RU value above the threshold (50 RU), compared to 40 positive binders (80%) measured by ELISA. Although RU values are rarely discussed in publications one group

(Hussack et al. 2012) used a Biacore system to test 4 VL dAbs and observed values of 173-221

RU. The 10 non-binders identified using the ELISA method were also found to be non-binders in Biacore analysis. A further 10 mAbdAbs were identified as non-binders through Biacore analysis, of which one (H048) showed a very low absorbance value (0.111) in ELISA and can be considered comparable. The remaining 9 non-binders from Biacore analysis (H050, H049,

H100, H082, H091, K010, K012, K013 and K015) were identified as positive binders in ELISA, 7 of which were derived through passive phage display.

Shcherbakova et al. (2012) have shown that passive selection can result in phage that bind to the plastic surface used during selection, and therefore it is possible that these dAbs are not

HEWL-specific, and were false-positives in the ELISA method. The remaining two non-binders were derived from the soluble VHL library. Although no conclusions could be drawn as to the nature of these differences, it is possible that these dAbs are specific to the soluble form of

HEWL used for selection, and that immobilisation of HEWL onto the dextran surface of the

Biacore chip altered the conformation of HEWL and thus binding of the dAb. Although some differences in HEWL binding were observed between the two approaches 30 out of 50 (60%) were identified as HEWL-specific in both procedures.

165

It has been suggested that soluble phage display results in higher binding specificities for the target antigen but less genetic diversity than passive selection (Matz and Chames 2012).

On this basis, and to maximise genetic diversity, both soluble and passive phage display were used in this study. In agreement with this theory the highest observed binding value was obtained from soluble selection using the VHM dAb library (H109, 6572.5 RU) with one other library (VK) showing the highest binding from soluble selection (K017, 1661.7 RU). In contrast, two of the libraries (VHS and VHL) showed higher RU values (4965.3 RU for VHS and 298.4 RU for VHL) in dAbs generated through passive selection.

Based on these results a panel of mAbdAbs (Table 4.1) were chosen based on their variable expression titres and positive HEWL binding, and subcloned into the RSV stable vector system

(Appendix Figure A3.2) for further analysis in a stable CHO system (Section 4.3). Candidates were also chosen that covered all four dAb libraries and both selection procedures to determine whether these factors influenced expression in a stable CHO platform. One of the mAbdAbs (H012) was chosen as it did not show HEWL-binding in either functionality assay, and as such was included in the event that HEWL binding impacted on expressibility in CHO cells. Finally, H093 was chosen as the only mAbdAb from the VHL library that showed HEWL binding in both functionality assays. However this construct failed to ligate into the RSV vector, and therefore H082, which showed the highest absorbance value (0.914) in the binding ELISA was chosen as a substitute. The K017 construct was chosen as the only representative of the Vk dAb library isolated through soluble phage selection.

166

mAbdAb HEK Expression Binding ELISA Biacore Number (µg/ml) (Abs 450nm) Binding to lysozyme (RU) H014 24.11 0.777 1585.3 K017 12.56 0.131 1661.7 K005 12.01 0.133 105.9 H095 11.56 0.371 1192.4 H109 10.96 0.596 6572.5 K001 8.25 0.233 402.7 H081 7.71 0.147 1769 K003 7.40 0.197 539.5 H093 7.04 0.346 298.4 H008 6.64 0.669 3895.2 H012 4.02 0.071 -196.1 H007 3.98 0.126 4233 K004 3.97 0.493 1419 K007 3.73 0.382 93.5 H047 2.18 0.368 163.5 H092 1.89 0.672 300.1 H020 1.09 0.320 802.5 H025 0.71 0.534 1456.2 H009 0.66 0.269 69.9 H082 0.30 0.914 -108.3 H032 0.23 0.660 1077.9

Table 4.1. mAbdAbs chosen for further analysis in stable CHO DG44 cells. Expression was measured by Gyros quantification (Section 2.5.1.1), binding ELISA was performed as described in Section 2.5.2.1 and Biacore analysis was performed as described in Section 2.5.2.2. mAbdAb number is defined by the dAb numbers assigned in Table 3.3.

167

4.4 Examination of mAbdAb expression in stable CHO pools

A DHFR negative CHO DG44 cell line was used as the host to generate stable mAbdAb expressing cell lines using the stable vector system (Appendix Figure A3.2), where both the heavy and light chain genes were under the control of an RSV promoter. As with HEK transient expression,

Alemtuzumab was included as a mAb expression control. To minimise the effect of gene insertion site and clonal variation, transfected cell lines were maintained as a heterogeneous pool following transfection recovery.

A total of 19 mAbdAbs (Table 4.1) and Alemtuzumab alone were transfected into the DHFR negative

CHO host. All transfectants generated cells that were able to grow, with the exception of sequence

K017, which, after multiple transfection attempts, failed to recover following transfection and was therefore omitted from further study. All transfected cell lines were assessed over a 10 day batch culture and cell density and viability measured daily (Figure 4.3). None of the cell lines exhibited poor growth characteristics and cell densities of between 18x106 and 33x106 cells/ml were observed in all transfected cell lines. Densities in excess of 10x106 cells/ml, considered to be high density culture

(Wurm 2004) have been reported previously in batch culture (Combs et al. 2011) with perfusion cultures in disposable WAVE bioreactors reaching up to 2x108 cells/ml (Clincke et al. 2013). Thus the cell densities achieved in this batch culture system can be considered very high. DHFR negative host cells were seeded at a higher density (0.5x106 compared to 0.2x106 in transfected cell lines) and reached more modest cell densities of 4.5x106, however they maintained higher viability (35%) on day 10 of culture compared with transfected cell lines (0-20%). Hydrolysate feeds, such as the yeastolate used here, have been used to increase cell growth and productivity in CHO cells (Mosser et al. 2013) and may have contributed to the high cell densities observed in culture.

168

Host cells showed an exponential growth phase of 4 days, reached maximal density on day 5 of culture, and showed a slow decline of 5 days. Transfected cell lines, however, showed an extended exponential growth phase of 7 days, reaching maximal cell density on day 7 or 8 of culture and declined rapidly over 1-2 days. The rapid decline in cell density and viability observed in the transfected cell lines has been discussed previously (Wurm 2004) and has been attributed to faster depletion of nutrients and accumulation of waste products in the culture flask caused by high cell densities. The differences observed in cell densities and growth phase between the host and transfected cell lines may be due to the re-introduction of the DHFR gene present on the heavy chain vector. Although hypoxanthine (HT) supplement is added to the host cell medium to compensate for the lack of DHFR enzyme, it has been reported that this is not sufficient to support efficient metabolism and consequently growth properties of DHFR negative

CHO host cells (Florin et al. 2011). Reintroduction of the DHFR gene may result in more efficient

CHO cell metabolism that the HT supplement provides, and therefore supports higher cell densities than DHFR negative host cell lines.

169

Figure 4.3 Batch culture of CHO polyclonal cells expressing mAbdAbs. Cells were transfected as described in Section 2.4.3.3 and batch cultures performed as described in Section 2.4.3.4.

Cell density and viability were measured daily using the Countess ® (Section 2.4.1.1). Key to figure: non-transfected CHO DG44 host, mAb-c, H014-c, H020-c,

H025-c, H032-c, H007-c, H008-c, H009-c, H012-c, H047-c,

H081-c, H092-c, H095-c, H109-c, H082-c, K001-c, K005-c,

K003-c, K004-c, K007-c. Error bars = standard deviation of 4 biological replicates, each with technical duplicates.

170

171

Following analysis of growth characteristics, expression titres were quantified by sandwich ELISA using supernatants sampled every 2 days throughout culture (Figure 4.4). Alemtuzumab without the dAb or linker showed a steady increase in titre throughout culture, reaching a maximum yield of 68.3µg/ml and specific productivity of 1.17 pg/cell/day (pcd) (Figure 4.4).

Expression was detected in 13 of the 19 unique mAbdAbs. A range in titres (0µg/ml to

24.9µg/ml) was also observed for CHO stable pools, which is comparable to the range in titre observed in HEK transient expression (0.2 to 24μg/ml). Unlike transient expression, where a number of constructs showed similar expression titres to Alemtuzumab, none of the mAbdAbs in the stable CHO pools approached the titre observed for the mAb alone, and the highest expressing mAbdAb cell line was H014-c, with a maximum yield of 24.9µg/ml. Furthermore, no expression was detected in 7 of the mAbdAb cell lines (H020-c, H009-c, H081-c, H092-c, H082-c and K007-c), whilst expression was detected for every construct in HEK transient cells. Specific productivities in mAbdAb expressing cell lines ranged from 0.03 – 0.78pcd and correlated well with expression titres (R2 = 0.9056, data not shown).

Titres ranging from 100-400mg/L have been reported by Ye et al. (2010) in mAb expressing stable CHO pools using FACS cell sorting, MSX gene amplification and inclusion of a UCOE element in the vector (Ye et al. 2010). Whilst in non-amplified CHO pools, Ho et al. (2013) observed IgG1 titres ranging from 14-79mg/ml, which they were able to increase to a maximum yield of 380mg/ml using stepwise MTX amplification (Ho et al. 2013). Although mAbdAb titres appear low relative to Alemtuzumab, similar titres (ranging from 1.8-

16mg/L) for novel format antibodies (Fab and scFv-Fc) have been observed by previous groups using either HEK or CHO stable pools (Braren et al. 2007, Schaefer and Plueckthun

2012). Specific productivities ranging from 0.02-1.2pcd have been previously reported in comparative non-amplified CHO cell pools (Chusainow et al. 2009, Ho et al. 2012), which is 172

Figure 4.4 Expression titre and productivity of stable CHO pools. DHFR negative CHO DG44 cells were stably transfected as described in Section 2.4.3.3 and batch cultures performed as described in Section 2.4.3.4. Expression titre was quantified every 2 days by sandwich ELISA

(Section 2.5.1.2) and specific productivity calculated during exponential growth phase (day 2 - day 6) as described in Section 2.9.2. A. Antibody (mAb and mAbdAb) expression titres over culture time in CHO stable pools. Key to Figure: Day 2 ( ), Day 4 ( ), Day 6 ( ), Day 8 ( ),

Day 10 ( ). B. Specific productivity (Qp) for mAb and mAbdAb expressing CHO cell lines. Error bars = Standard deviation of two biological replicates each with three technical replicates.

Data presented is the average of two independently transfected cell lines.

173

174 similar to the range in Qp observed in the transfectant pools used in this study. Thus the control mAb titre and productivity is comparable to previous studies. Finally, linear regression analysis was employed to ascertain correlations between peak cell density and yield or peak cell density and productivity, however no correlation between growth and expression was observed (data not shown).

End of culture expression titres from CHO stable pools were then compared to those from transient HEK expression (Figure 4.5) to determine whether the HEK transient system used was predictive of titres obtained in stable CHO pools. Only six mAbdAb constructs showed no difference in the expression titres obtained in the two expression platforms. The control mAb

(Alemtuzumab) and two mAbdAb constructs (K005 and H007) showed an increase in titre obtained from stable CHO expression, whilst the remaining mAbdAb constructs showed a lower titre in CHO stable as compared to HEK transient cells. Analysis by two-way ANNOVA determined that the difference in expression titres observed between the two cell lines (HEK compared with CHO) was statistically significant (P =0.0023). This suggests that the transient

HEK expression may not be the most suitable platform for screening mAbdAb sequence variants prior to stable CHO cell generation. Although the majority of mAbdAb constructs exhibited differences in expressibility in the two platforms, both platforms resulted in low mAbdAb titres compared to that of Alemtuzumab. This suggests that expression from these constructs is determined more by sequence of the construct than the expression platform used.

175

Figure 4.5 Comparison of maximum yield observed for mAbdAb constructs in transient

HEK and stable CHO expression. HEK2936E suspension cells were transiently transfected as described in Section 2.4.2.2 and antibody expression measured at 72hrs by Gyros quantification (Section 2.5.1.1). DHFR negative CHO DG44 cells were stably transfected as described in Section 2.4.3.3, batch cultures performed as described in Section 2.4.3.4 and antibody expression measured on day 10 of batch culture by sandwich ELISA (Section

2.5.1.2). Key to Figure: Transient HEK2936E titre ( ), stable CHO titre ( ).

176

4.5 Analysis of limiting stages in the expression mAbdAbs in stable CHO pools

Having established that the mAbdAbs tested exhibited a range of expression in the CHO stable system, the next task was to identify how various constructs expressed at the stages of transcription, translation and secretion. First, mRNA expression was assessed for each cell line by RT-PCR and semi-quantified by densitometric analysis (Figure 4.6). RT-PCR primers were designed within the variable region of both the heavy and light chain genes, using a common forward primer within the signal peptide for VH and VL genes, and gene-specific reverse primers. Beta-2-microglobulin was included as a housekeeping gene, and the primers for this gene were designed to span two exons, so that only mature mRNA would be detected.

For the B2M reaction a single band of the expected size (~200bp) was identified in every cell line including the host control, indicating that reverse transcription of mRNA to cDNA was successful, and that B2M was a suitable control. For the heavy chain (HC) RT-PCR reaction the expected product size for HC mRNA was ~148bp, and this was detected at comparable levels in all cell lines, suggesting that the amount of HC mRNA was not limiting in the expression of these constructs. However as the primers were located at the 5’ end of the HC transcript it is not possible to determine whether the full length HC transcript was present. Therefore it is only possible to confirm the presence but not the quality of the HC transcript. The expected size for the LC product is ~143bp. A strong band of the expected size was detected in 10 of the cell lines, 6 cell lines showed evidence of a very faint band at this molecular weight, whilst no such band could be identified in four of the cell lines (H020-c, H025-c, H047-c and H082-c).

The difference in LC abundance observed between cell lines may be a consequence of using a dual vector system, where different selection markers were present on the HC and LC vectors 177

(DHFR and neomycin respectively). Finally, a second band (~50bp) was detected in the products of the HC and LC reactions, which is likely to relate to primer dimers amplified during the reaction. Finally, a negative control (-RT) was included in each RT-PCR reaction

(VH, VL and B2M) and no band was detected in the products derived from these reactions.

This control cDNA was derived using RNA extracted from the H014-c cell line in a reverse- transcription reaction where the reverse-transcriptase enzyme was substituted for molecular grade water and as such the detection of a band from this control would indicate the contamination of genomic DNA. As no band was detected in any of the reactions, this indicates that no genomic contamination.

As RT-PCR is not a truly quantitative method for studying mRNA abundance, validation was attempted through quantitative real-time PCR (qRT-PCR). Although quantitative data could be obtained for the housekeeping gene (B2M), it was not possible to quantify HC and LC message due to low exceptionally high Ct values. Therefore, optimization was attempted with respect to cDNA concentration and number of amplification cycles using various primer pairs designed along the length of both the HC and LC message. Despite these optimization strategies Ct values remained high. This suggests that the amount of recombinant message

(HC and LC) in stable CHO pools is very low relative to the endogenous B2M housekeeping gene, perhaps as a consequence of using heterogeneous transfectant pools, and may be responsible for the low specific productivities observed (Figure 4.4). Furthermore, in RT-PCR analysis, B2M was amplified over 25 cycles whereas HC and LC was amplified over 30 cycles, which further indicates the lower abundance of recombinant message (HC and LC) compared to endogenous (B2M).

178 Densitometric analysis was performed on the HC and LC bands for RT-PCR analysis and was used to calculate the abundance of HC relative to LC (HC: LC ratio) (Table 4.2). The

Alemtuzumab expressing CHO cell line (mAb-c) showed an equal abundance of HC and LC message and the highest observed titre (68.3μg/ml). Four mAbdAb expressing cell lines

(H014- c, H007-c, H109-c and K007-c) showed a comparable HC abundance relative to LC

(0.9-1.1: 1), five cell lines (H092-c, K001-c, K004-c, H012-c and H009-c) showed a slight excess of HC mRNA compared LC (1.4-3.3: 1 HC: LC), and one cell line (H081-c) showed a slight excess of LC mRNA (0.7: 1). The remaining nine cell lines showed a much higher abundance of

HC relative to LC (4.7-58-9: 1).

The effect of HC: LC ratio on mAb expression has been shown to affect mAb expression titres

(Schlatter et al. 2005, Chusainow et al. 2009, Ho et al. 2013, Pybus et al. 2014), both in terms of DNA ratio during transfection and observed mRNA ratios in transfected cell lines, however conclusions differ as to whether an excess of HC or LC results in higher expression titres, whilst other studies observed no correlation between mRNA abundance and expression titre in CHO cell lines (Lattenmayer et al. 2007, Reisinger et al. 2008). In agreement with the latter, mAbdAb cell lines showed no discernible linkage between HC: LC abundance and titre or productivity, suggesting that the bottleneck in mAbdAb expression lies downstream of transcription. However the low abundance of LC message would introduce another variable in this study, and for this reason the 9 cell lines which showed very high HC abundance relative to LC message were not used for further examination of bottlenecks in mAbdAb expression.

However, as expression was detected by ELISA quantification for a number of these cell lines

(e.g. K005-c, 16.1μg/ml) western blot analysis (Figure 4.7) was performed to validate the results obtained through ELISA (Figure 4.4).

179 Figure 4.6 Semi-quantification of HC and LC mRNA by RT-PCR. Batch cultures were performed as described previously (Figure 4.3). RNA was isolated from CHO cell pools on day 6 of batch culture (exponential phase) as described in Section 2.6.1, and reverse transcribed to cDNA

(Section 2.6.4) following DNAse I treatment (Section 2.6.2). RT-PCR analysis was performed as described in Section 2.6.5 and migrated on a 2% [w/v] agarose gel (Section 2.3.8). Heavy and light chain bands were semi-quantified using Image J densitometric analysis software (Section

2.6.6) and normalised to beta-2-macroglobulin (B2M) which was used as a control. A.

Representative 2% [w/v] agarose gel electrophoresis of variable heavy chain, variable light chain and B2M RT-PCR products. B. Semi-quantitation of HC and LC mRNA expression levels normalised to B2M. Key to Figure: Variable heavy chain (VH) mRNA, variable light chain

(VL) mRNA, B2M mRNA. VH mRNA normalised to B2M, VL mRNA normalised to B2M.

Error bars = Standard deviation of four technical replicates.

180

181

Titre Cell specific productivity mRNA abundance Cell line (µg/ml) (pg/cell/day) (HC:LC) mAb-c 68.3 1.17 1.0 H014-c 24.9 0.78 1.1 K005-c 16.1 0.10 7.1† K003-c 9.6 0.10 9.3† H008-c 6.0 0.05 6.8† H007-c 5.8 0.04 1.1 K004-c 3.5 0.04 1.8 H095-c 2.8 0.04 17.2† H109-c 2.3 0.04 0.9 H047-c 2 0.04 58.9† H012-c 1.8 0.03 1.8 K001-c 1.4 0.03 1.7 H025-c 1.2 0.02 30.5† H032-c 0.3 0.003 8.9† H081-c 0 0 0.7 K007-c 0 0 0.9 H092-c 0 0 1.4 H009-c 0 0 3.3 H082-c 0 0 4.7† H020-c 0 0 30.3†

Table 4.2 Titre, productivity and mRNA abundance in CHO cell lines. Titre and productivity were assessed as described previously (Figure 4.4) and HC and LC mRNA measured by densitometric analysis as described previously (Figure 4.6). † indicates cell lines with low LC mRNA abundance compared to HC.

182 As HC and LC mRNA abundance did not appear to be the limiting factor in expression for 10 cell lines, the next task was to determine whether protein could be detected for these cell lines both intracellularly and in the medium (supernatant). Western blot analysis (Figure 4.7) was performed initially under reducing conditions (samples treated with β-mercaptoethanol) to identify distinct polypeptide chains, followed by non-reducing conditions to examine protein folding.

The expected size for the heavy chain polypeptide was ~50kDa for Alemtuzumab (HC), and a band of this approximate weight was identified both intracellularly and in the supernatant of the mAb-c cell line (Figure 4.7). For the mAbdAb constructs, the expected size of the heavy chain polypeptide was ~65kDa, due to linkage of the dAb (~15kDa) by means of the short peptide linker, which was designed to be translated as a single polypeptide (HC-dAb). The HC- dAb polypeptide was detected in the supernatant for 6 of the mAbdAb expressing cell lines

(H014-c, H007-c, K004-c, H109-c, H012-c and K001-c), indicating that the full length HC-dAb polypeptide was secreted. HC-dAb polypeptide was observed intracellularly for these 6 cell lines and one other (H081-c), which showed evidence of intracellular HC-dAb polypeptide that was not detected in the medium. The three remaining mAbdAb expressing cell lines (H009,

K007 and H092) showed no evidence of HC-dAb polypeptide either inside or outside the cell, which may suggest that the HC-dAb polypeptide for these constructs is either not translated or degraded. These results are consistent with the ELISA, as expression was detected in the 6 cell lines showing extracellular HC-dAb and no expression was detected in the four cell lines where no HC-dAb was detected in the medium.

183 Figure 4.7 Western blot analysis of intracellular and extracellular heavy and light chain protein. Generation of stable cell lines and batch cultures were performed as described previously (Figure 4.3). Intracellular protein was extracted on day 6 of batch culture (2.4.1.4) and extracellular samples taken on day 10 of culture (Section 2.4.1.5). SDS-PAGE electrophoresis was carried out as described in Section 2.5.3.1 and proteins transferred to nitrocellulose membrane (Section 2.5.3.2) and probed with goat anti-human H+L IgG (Section

2.5.3.3). Intracellular western blots were stripped (Section 2.5.3.4) before re-probing with ERK antibody. Data is representative of 3 technical repeats of two biological samples. A. Western blot analysis under reducing conditions. B. Western blot analysis under non-reducing conditions. C. Western blot analysis under reducing conditions of cell lines expressing low abundance of LC mRNA relative to HC (Table 4.2).

184 185 The expected size for LC polypeptide is ~25kDa, and a band of this molecular weight was identified in the supernatant of all 11 cell lines under reducing conditions, but was only detected inside the cell for the two highest expressing cell lines (H014-c and mAb-c). The presence of LC polypeptide in the medium, even in those mAbdAb cell lines where HC-dAb polypeptide was not detected, indicates that LC can be secreted independently of HC.

Unlike the HC polypeptide, which is usually sequestered by the BiP chaperone protein and is only released upon pairing with LC (Leitzgen et al. 1997), heterodimerisation to the HC is not a prerequisite for LC secretion and thus can be expressed freely into the medium (Dul et al. 1996, Bhoskar et al. 2013).

Western blot analysis was performed under non-reducing conditions to determine whether folding intermediates could be identified. Five bands were identified in the supernatant of the mAb-c cell line, suggesting the presence of intermediates such as LC only (~25kDa), HC only or

LC dimer (~50kDa) and a HCLC heterodimer (~80kDa) in addition to the expected full sized mAb (~150kDa), which is consistent with mAb folding patterns observed in published work

(Bhoskar et al. 2013). The mAbdAb expressing cell lines also exhibited multiple protein bands in the supernatant. A band of ~25kDa (free LC) was identified in all cell lines, and a second band at ~50kDa in 7 mAbdAb cell lines, which may suggest a LC homodimer. In four cell lines

(H014-c, H007-c, K004-c and H109-c) a band was observed at ~65kDa, which may suggest the presence of free HC-dAb polypeptide. Only one cell line (H014-c) showed evidence of a band at ~130kDa which may suggest a HC-dAb2 homodimer. The expected size of the fully folded mAbdAb is ~190kDa, which could be the remaining high molecular weight band identified above the 175kDa marker in all of the mAbdAb cell lines. However a faint band of this molecular weight was also identified in cell lines which have previously shown no

186 expression (e.g. H092-c) and the non-transfected host, which could suggest non-specific detection of unresolved protein.

In the intracellular samples, the mAb-c cell line showed two clear bands, one at ~50kDa pertaining to the HC only polypeptide and one at ~150kDa, pertaining to fully folded mAb. Two bands were observed in three of the mAbdAb expressing cell lines (H109-c, H012-c and H081- c) at ~65kDa (HC-dAb) and >175kDa, with the band at >175kDa also detected in a further 2 cell lines (H007-c and K004-c). For cell line H014-c, which was the only mAbdAb cell line to show evidence of intracellular LC polypeptide under reducing conditions, one further band was identified at ~100 kDa, which may indicate a folding intermediate such as a HC-dAb homodimer or HC-dAb-LC heterodimer. Consistent with the results obtained for western blot analysis under reducing conditions, the four remaining cell lines showed no evidence of protein bands. Whilst the presence of the higher molecular weight band >175kDa in 6 mAbdAb cell lines may suggest that fully folded mAbdAb is present within the cell, further analyses of specific protein bands through chromatographic techniques (HPLC, SEC) would be required to confirm this.

Taken together, the results obtained through RT-PCR and western blot analyses indicate that whilst both HC and LC message is present in all cell lines, differences can be observed at the protein level, with the majority of the mAbdAb cell lines exhibiting poor HC-dAb polypeptide abundance both inside and outside the cell. This suggests that the bottleneck in expression for these constructs may occur between translation and secretion, either through inefficient or lack of HC-dAb translation or degradation of the HC-dAb product. Thus the following sections

187 aim to investigate the molecular events which may contribute to this assessment, starting with proteolytic degradation.

Finally, the 9 cell lines that exhibited low abundance of LC mRNA during RT-PCR analysis

(Figure 4.6) were examined separately by western blot analysis under reducing conditions.

Consistent with the low mRNA abundance observed for these cell lines, no LC polypeptide was detected in the medium, whilst a faint band at ~25kDa was detected intracellularly for one cell line (K005-c). HC-dAb polypeptide was detected both intracellularly and in the medium for 6 cell lines, suggesting that HC-dAb is secreted independently of LC, whilst in the remaining 3 cell lines (H082-c, H020-c and H032-c) no of HC-dAb was observed. This is consistent with ELISA quantification, where no expression was detected for cell lines H082-c and H020-c and very low expression (0.3μg/ml) was detected in cell line H032-c.

Furthermore, as the ELISA method utilises an anti-Fab detection antibody, expression titres observed in these cell lines is likely due to detection of the HC-dAb polypeptide.

4.6 The role of proteolytic degradation pathways in mAbdAb expression in stable CHO pools

During recombinant protein expression misfolded proteins located in the ER may be degraded through the UPR activated ERAD pathway, which channels proteins to the proteasome (Plantier et al. 2002, Fujita et al. 2007). Misfolded proteins may also be trafficked into the lysosomal degradation pathway, however this mechanism is less well defined. In order to investigate whether this mechanism may be responsible for poor mAbdAb

188 expression three mAbdAb expressing CHO cell lines (H014-c, H012-c and H092-c) which showed a range in expression titres (Figure 4.4) and exhibited different expression profiles at the protein level (Figure 4.7), were subject to a series of studies using chemical inhibitors capable of targeting both proteasomal and lysosomal degradation pathways (Table 1.3). As ubiquitinylation is this main process by which proteins are targeted for degradation

(Hofmann and Falquet 2001), the accumulation of polyubiquitinylated proteins was used to determine whether degradation had been inhibited through treatment with these chemicals.

Furthermore, as chemical inhibitors of degradation also have the potential to induce apoptosis (Kisselev and Goldberg 2001, Castino et al. 2002, Guo and Peng 2013) treatment was limited to a 6hr incubation, after which both intracellular and supernatant samples were harvested for analysis.

Cells were cultured for 5 days in shake flasks prior to plating into 12-well plates at a density of

3x107 cells/well and cultured for 6hrs in the presence or absence of inhibitors. mAbdAb expression was initially assessed by western blot analysis of intracellular and supernatant samples and intracellular protein was quantified by densitometric analysis (Figure 4.8). All cell lines, including non-transfected host, showed an increase in polyubiquitinylated proteins following treatment with each of the chemical inhibitors, indicating that degradation was successfully inhibited. However the amount of polyubiquitinylated protein varied between cell lines and the inhibitor used, suggesting sensitivity to these inhibitors was cell line specific.

Cell line H012-c showed the greatest increase in ubiquitinylated products following treatment with Leupeptin & Pepstatin A and Bortezomib, whereas H014 showed the greatest ubiquitinylation following MG132 treatment.

189

None of the inhibitors tested resulted in the expression of HC-dAb polypeptide (~60kDa) for cell line H092-c, suggesting that the lack HC-dAb is either not the result of degradation or that the correct pathway has not been inhibited in this study. In contrast, H012-c intracellular HC- dAb polypeptide abundance increased in response to both MG132 (2.9-fold) and Bortezomib treatment (2.7-fold), and to a lesser degree for Leupeptin and Pepstatin (1.6-fold), suggesting that this mAbdAb construct may be subject to both proteasomal and lysosomal degradation.

Intracellular LC abundance also increased in cell line H012-c following treatment with MG132

(3.3-fold), Leupeptin and Pepstatin (2.7-fold) and Bortezomib (1.8-fold). This might indicate that LC is also subject to degradation, however as increased LC abundance correlates with increase HC-dAb abundance, this might suggest that increased intracellular LC is observed as a result of increased assembly prior to secretion. Cell line H014-c showed no difference in HC- dAb band intensity in any of the inhibitors used, however this mAbdAb expresses well compared to other mAbdAb constructs.

Cell lines H012-c and H092-c showed a low abundance of LC polypeptide in the supernatant sample compared with previous western blot analyses (e.g. Figure 4.7), which could be due to the earlier sampling time of day 5 compared with day 10 as product accumulates in the medium over the culture period (Figure 4.4). H012-c showed a slight increase in HC-dAb polypeptide in the supernatant following MG132 treatment, which is consistent with the intracellular HC-dAb increase, however no such increase was observed in the supernatant following treatment with the other inhibitors. HC-dAb and LC polypeptide could only be detected at high levels in cell line H014-c, which reflects the higher titres achieved by this cell line, however no increase in either polypeptide was observed following inhibitor treatments, which is consistent with intracellular results. 190

Figure 4.8 Effect of chemical inhibitors of degradation on mAbdAb expression. Stable CHO cell lines were cultured up to day 5 in batch culture (Section 2.4.3.4) and used to seed 12-well plates at a density of 1.5x106 cells/ml. Cells were maintained for 6hrs in culture in the presence or absence of chemical inhibitor (MG132, Leupeptin and Pepstatin A (combined) or

Bortezomib) as described in Section 2.4.3.6. Intracellular and supernatant samples were taken

(Section 2.4.1.4 and Section 2.4.1.5) after 6hrs of inhibitor treatment. Data is representative of

2 technical repeats of four biological samples. A. Western blot analysis of intracellular and supernatant samples under reducing conditions. SDS-PAGE electrophoresis and western blot analysis were performed as described previously (Figure 4.7) and protein bands were quantified by densitometric analysis using Image J quantification software (Section 2.5.4). B.

Quantification of fold increase observed for intracellular HC-dAb polypeptide. C. Quantification of fold increase observed for intracellular LC polypeptide. Key to Figure: No inhibitor ( ),

MG132 ( ), Leupeptin & Pepstatin A ( ),Bortezomib (BZ)( ). Error bars = standard deviation of three technical replicates.

191

192

Supernatant samples were then quantified by sandwich ELISA (Figure 4.9). Consistent with the western blot analysis, no expression was detected in cell line H092-c for any of the inhibitors tested (data not shown). In contrast with the western blot analysis, a significant increase in titre was observed for cell line H014-c in response to all three inhibitor treatments (P = <0.0001, one-way ANOVA). Cell line H012-c showed an increase in titre following MG132 treatment and the combined action of Leupeptin and Pepstatin A and although Bortezomib showed no increase titre the increase in titres following treatment with inhibitors was significant (P = 0.0003, one-way ANOVA). This may suggest that multiple degradation pathways (proteasomal and lysosomal) may influence the expression of mAbdAbs in stable CHO cells. It should be noted, however, that mAbdAb titres did not exceed that of the mAb only construct (68μg/ml) even in the presence of inhibitors. These results suggest that whilst proteolytic degradation may be one factor in poor mAbdAb expression, it may not be the only molecular event involved. The role of degradation could be further explored by treating cells with cycloheximide, which inhibits protein synthesis.

Following the addition of cycloheximide protein samples can be taken at regular intervals and used for western blot analysis as described previously (Figure 4.7) to determine the rate of degradation through densitometric analysis of protein bands.

193

Figure 4.9 ELISA quantification of expression titre following treatment with chemical inhibitors of proteolytic degradation. Treatment with chemical inhibitors was performed as described previously (Figure 4.8) and ELISA quantification of culture supernatants was performed as described (Figure 4.4). Key to Figure: No inhibitor ( ), MG132 ( ), Leupeptin & Pepstatin A ( ), Bortezomib (BZ) ( ). Error bars represent standard error of the mean of four biological replicates, each with two technical replicates.

194

195

4.7 Examination of mAbdAb expression in an uncoupled in vitro translation system

Three mAbdAb expressing CHO cell lines (H092-c, K007-c and H109-c) showed no evidence of intracellular HC-dAb polypeptide in western blot analysis (Figure 4.7) and no expression titre in ELISA quantification (Figure 4.4). One cell line (H092-c) also showed no evidence of HC-dAb polypeptide following treatment with chemical inhibitors of proteolytic degradation (Figure

4.8). Therefore an in vitro translation system was employed to investigate whether translation or translocation could be limiting in this expression of this construct. In addition to the H092 construct, Alemtuzumab and mAbdAb H014 were chosen as expression controls. The heavy chain gene for each construct was subcloned into the pcDNA3.1+ expression vector (Appendix

Figure A3.3), which contains a T7 promoter site required for in vitro transcription of mRNA using a T7 RNA polymerase (Arnaud-Barbe et al. 1998). A mammalian cell lysate (Rabbit

Reticulocyte Lysate (RRL)) was used as a comparative model to the HEK and CHO mammalian expression platforms employed earlier in this Chapter to translate in vitro generated mRNA templates. Canine microsomes were included in this system to replicate the ER environment

(Yu et al. 1989) in order to study whether translocation and glycosylation of mAbdAbs may influence mAbdAb expression. Following translation, cytoplasmic and microsomal fractions were isolated through centrifugation using a sucrose gradient (Section 2.7.3) in order to study translation and translocation separately. Finally, prepro-alpha-factor (PPF), which contains three glycosylation sites and therefore was used as a glycosylation control (Julius et al. 1984).

A single band with a molecular weight of ~19kDa was identified in the cytoplasmic fraction (C), pertaining to the non-glycosylated form of PPF (Figure 4.10). This band was also identified in

196 the microsomal fraction indicating that it was successfully translocated into the ER-like membrane. A second strong band of ~28kDa was identified in the microsomal fraction of PPF, which suggests the addition of three glycan groups each of which have a theoretical mass of

1- 3kDa(Harvey 2005). Two much fainter bands at ~22kDa and ~25kDa were also identified in the membrane fraction indicating partially modified intermediates containing 1 and 2 glycan groups respectively. An early study using a yeast in vitro system to translate PPF observed a similar pattern and confirmed that the higher molecular weight bands detected at 22, 25 and

28kDa were the result of glycosylation by means of incubation with Endoglycosidase H

(Waters et al. 1988). Thus the system employed here is capable of both translocation and glycosylation, and is therefore a suitable method of studying these expression stages as potential determinants for mAbdAb expression.

Alemtuzumab showed a single band in the cytoplasmic fraction of ~50kDa indicating successful translation of the heavy chain polypeptide. A single band of the expected size of ~65kDa was identified in the cytoplasmic fraction of both mAbdAb constructs, indicating that full-length

HC-dAb polypeptide can be translated in both of these constructs using an in vitro mammalian cell lysate. Both Alemtuzumab and the two mAbdAb constructs showed bands of the same weight (50kDa and 65kDa respectively) in the microsomal fraction, which indicates that translocation into the ER-like membrane occurs in all three constructs. An additional band with a molecular weight ~53kDa was detected in the membrane fraction of Alemtuzumab, which contains a single N-linked glycosylation site in the CH2 domain (Asn-297) that is highly conserved amongst the IgG1 subclass of monoclonal antibodies (Walsh and Jefferis 2006).

This suggests that Alemtuzumab is capable of both translocation into an ER-like membrane and

197

Figure 4.10 In vitro translation of Alemtuzumab and a high and low expressing mAbdAb. A.

CDR sequences of dAbs in mAbdAb constructs. DNA sequencing was performed following cloning into the pcDNA3.1+ vector (Section 2.3.14.2) and protein sequence predicted in

Bioedit. Residues in non-canonical glycosylation are highlighted (underlined). Vectors were linearized (Section 2.7.1) prior to in vitro transcription and purification of mRNA (Section

2.7.2) the products of which were used for in vitro translation using rabbit reticulate lysates in the presence of 35S-Methionine and canine microsomes (Section 2.7.3). Cytoplasmic (C) and microsome (M) fractions were isolated by centrifugation using a sucrose gradient and separated by SDS-PAGE electrophoresis which were vacuum-dried on a Biorad 583 gel dryer

(Section 2.7.4) prior to overnight autoradiography and scanned on a Typhoon FLA7000IP

Phosphoimager (Section 2.7.5). B. in vitro translation of Prepro-alpha-factor (PPF). C. in vitro translation of Alemtuzumab, H014 and H092. Data is representative of four independent translations.

198

199 glycosylation. mAbdAb construct H092 also shows on additional band in the microsomal fraction with a molecular weight of ~68kDa, indicating the addition of a glycosylation group, which is likely to occur at the same site as Alemtuzumab. The same two bands (~65 and

68kDa) were also detected for construct H014-c, however an additional band of ~71kDa was evident. This might suggest that H014 contains an additional glycosylation site, which would likely occur in one of the CDRs in the dAb, as this is where H014 and H092 differ. Finally a number of lower molecular weight bands were identified in both the cytoplasmic and membrane fractions of H014 and H092. These bands are likely related to incomplete translation products and not degraded protein. The rabbit reticulate lysates used here were obtained from Promega and were supplemented with exogenous hemin, which facilitates translation by inhibiting phosphorylation of the eIF2α factor, but is also an inhibitor of the 19S proteasome (Hoffman and Rechsteiner 1996, Carlson et al. 2005).

The consensus sequence for N-linked glycosylation is NXS/T where X must not be proline

(Bause and Hettkamp 1979), and no such sequence was identified in either H014 or H092.

However a recent study (Valliere-Douglass et al. 2010) has identified N-linked glycosylation at non-consensus sequences within mAbs, including glycosylation on glutamine residues and reverse consensus (S/TXN) N-linked glycosylation. The reverse consensus sequence SMN is present in the CDR1 of H014 and therefore could be a potential site for non- canonical N- linked glycosylation, however further investigation would be required to confirm this.

Taken together, these results show that mAb and mAbdAb heavy chain polypeptides can be translated using in vitro generated mRNA template and rabbit reticulate lysates. Furthermore,

200 each construct showed evidence of translocation into an ER-like membrane and post- translational modification which is likely the result of N-linked glycosylation.

4.8 The role of the dAb CDR3 in mAbdAb expression

The overall aim of this Thesis was to investigate how sequence variations in the dAb CDRs affect mAbdAb expression. Due to the number of amino acid differences between dAbs in mAbdAb constructs (up to 17% of the dAb, Figure 3.11) it was not possible to identify specific residues that might influence expression. The variation between dAb constructs was limited to the CDRs, with CDR3 of dAbs generated using the VH libraries (VHS, VHM and VHL) showing the greatest variation in length (4-12 amino acids) compared with CDR1 (4 amino acids) and

CDR2 (6 amino acids). CDR1 and CDR2 also contained residues that were common throughout the VH dAbs (Figure 3.11). Furthermore, one group (Pybus et al. 2014) identified that poor expression of certain mAbs was influenced by sequence features of the CDR3 in both the LC and HC protein, resulting in inefficient HC-LC assembly that could be overcome through overexpression of LC. Thus the CDR3 was chosen for further investigation.

Two mAbdAbs which showed consistently high (H014) and low (H092) expression in both the

HEK transient (Table 4.1 ) and CHO stable (Table 4.2) platforms were chosen to represent the two extremes in mAbdAb expression and CDR3 length (12 and 5 amino acids respectively) for two mAbdAbs derived from the same dAb library (VHS) during selection. In a process similar to

CDR grafting (Xiong et al. 2014) the nucleotide sequence of the dAb was swapped at nucleotide position 280 of framework region 3 to generate two new dAb sequences (H014-

092 and H092-014, Figure 5.11) and synthesised using the Invitrogen GeneArt® service. The

201 resulting dAb genes were subcloned into the CEG4 HC vector (Figure A4.2 B) and used to transiently transfect adherent HEK293 cells. Expression titres were initially quantified by ELISA followed by western blot analysis of both intracellular and extracellular protein (Figure 4.11).

Finally, Alemtuzumab was included as an expression control, consistent with the HEK2936E platform.

As was observed for transient expression in HEK2936E suspension cells (Figure 4.1) mAbdAb

H014 showed a similar expression titre (17μg/ml) to Alemtuzumab (19μg/ml) whilst H092 showed relatively poor expression (2.0μg/ml) (Figure 5.11). Alemtuzumab and construct H014 both showed a lower titre whilst H092 showed a similar titre than was observed in the

HEK2936E platform (Table 4.1). However the cell line, vector, medium and transfection reagents all differed from the HEK2936E platform used in Section 4.2, which may explain the lower titre observed in the mAb and H014. In Section 4.2 a HEK2936E suspension cell line expressing the viral EBNA-1 protein was used in conjunction with a vector containing an

EBNA- 1 OriP to facilitate sustained expression, whilst this platform uses a HEK293T adherent cell line and the same vector used for stable CHO transfections and was not optimised for high transient expression titres.

For the new constructs H014-092 (which contains the CDR3 of H092) resulted in a lower expression titre of 1.3μg/ml (15-fold decrease) compared to H014, whilst its counterpart,

H092-014 (which contains the CDR3 of H014) showed an increase in titre to 12μg/ml (5-fold increase) compared with H092. Statistical analysis by two-way ANOVA determined that the

CDR3 has a significant effect on the expression titre of these two mAbdAb constructs

(P = < 0.0001). This result suggests that sequence elements of the CDR3 of the dAb influence

202

Figure 4.11 Analysis of CDR3 swapped mAbdAb constructs in HEK transient transfection. Two new dAb genes were generated as described in Section 2.3.12 and subcloned into the CEG4 stable expression vector. DNA sequencing was performed as described in Section 2.3.14.2 and dAb protein sequences predicted in Bioedit. SDS-PAGE and western blot analysis was performed as described previously (Figure 4.7). A. Sequence alignments of dAbs. The red square indicates the CDR3. B. ELISA quantification of HEK culture supernatants. C.

Representative western blot analysis under reducing conditions. Key to Figure: Alemtuzumab titre ( ), H014 titre ( ), H014-092 titre ( ), H092 titre ( ), H092-014 titre ( ). Error bars = SEM of four biological replicates, each with 2 technical replicates. * Indicates statistically significant difference as determined by two-way ANOVA (P= <0.05).

203

204 mAbdAb expressibility in these two constructs. However as construct H092-014 did not match the expression titre of H014, this may indicate that the CDR3 of the dAb may not be the only CDR to affect expression. To strengthen this conclusion it would be beneficial to study the individual effect of each CDR on expression to first determine whether the CDR3 has the greatest effect on titre. This could be followed be studying the role of CDRs in combination (CDR1 and CDR3, CDR1 and CDR2, CDR2 and CDR3) to determine whether sequence elements of CDRs have a synergistic effect on titre.

These results were validated by western blot analysis. Consistent with the ELISA result, HC (~50kDa) and LC (~25kDa) polypeptides were detected at high levels for Alemtuzumab both intracellularly and in the supernatant. For construct H014 two HC bands were identified, a strong band at ~50kDa and a fainter band at the expected size of ~60kDa. This result suggests that the high expression titre obtained for H014 in HEK transient expression is a result of a truncated HC product which lacks the dAb. It may explain why Alemtuzumab and H014 titres are similar in HEK transient expression, whereas Alemtuzumab titres are 2-fold greater that H014 in CHO stable expression (Figure 4.5), where no truncation of the H014 HC-dAb was detected (Figure 4.7). However as western blot analysis was not performed on HEK2936E supernatants it is not possible to determine whether this effect is common to both HEK transient transfections or specific to the HEK transient system used here. One previous study (Mason et al. 2012) also observed truncation of the HC product in the transient expression of mAb sequence variants, and postulated that clipping of the HC polypeptide could occur in response to slow HC folding, however the precise cause for this effect remained unexplained. It is unclear why construct H014-092 showed no evidence of HC or HC-dAb polypeptide either intracellularly or in the medium, which does not correlate with the ELISA. H092 showed a HC- dAb band of the expected size, which was much fainter than other HC or HC-dAb bands. An intense band was observed intracellularly for the HC-dAb band of H092-014, and whilst

205 the intensity was less in the supernatant, was still greater than that of H092. Furthermore, this may suggest that the loss of dAb product in H014 is not related to the CDR3 sequence.

In Section 4.6 it was suggested that H014 possesses a non-canonical glycosylation site in the

CDR1 of the dAb. Therefore, as H014 and H014-092 only differ in the CDR3, they were used in order to further investigate this claim. The HC-dAb gene for each construct was subcloned into the CEG7 vector (Figure A4.3 B) and used for in vitro translation (Figure 5.12 C). A single

HC- dAb polypeptide of the expected size was obtained for all mAbdAb constructs in the cytoplasmic fraction. As was observed previously, three bands were observed in the membrane (microsomal) fraction of H014. H014-092 also shows 3 bands in the membrane fraction, which indicates that the glycosylation site must occur prior to the CDR3 and further supports the theory the CDR1 contains a reverse consensus glycosylation site. Furthermore,

H092 and H092-014 both showed one HC-dAb band in the cytoplasm and two in the membrane fraction.

These results indicate that the CDR3 of the dAb domain plays an important role in the expressibility of these two mAbdAb constructs in transient HEK cells. However a larger data set would be required to determine whether this effect is applicable to all mAbdAb constructs.Initially this could be performed by grafting the CDR3 of construct H014 onto other low- expressing mAbdAbs (e.g. H020, H025, H009, H082 and H032). Furthermore, as stable

CHO cells are the preferred host for mAbdAb expression, these results would have to be corroborated in the stable CHO platform. If the CDR3 of H014 was confirmed to have a similar effect in other mAbdAb constructs and both transient HEK and stable CHO platforms this may direct further research into the predictability of mAbdAb expression based on sequence

206

Figure 4.12 In vitro translation of CDR3-swapped sequences. The heavy chain of the two new constructs (H014-092 and H092-014) were subcloned into the pcDNA3.1+ vector (Figure A3.3) as described in Table 2.2. Vectors were linearized (Section 2.7.1) prior to in vitro transcription and purification of mRNA (Section 2.7.2) the products of which were used for in vitro translation using rabbit reticulate lysates in the presence of 35S-Methionine and canine microsomes (Section 2.7.3). Cytoplasmic (C) and microsome (M) fractions were isolated by centrifugation using a sucrose gradient and separated by SDS-PAGE electrophoresis which were vacuum-dried on a Biorad 583 gel dryer (Section 2.7.4) prior to overnight autoradiography and scanned on a Typhoon FLA7000IP Phosphoimager (Section 2.7.5).

207 features of the dAb CDR3, such as those employed by (Pybus et al. 2014) to predict expressibility of mAb sequence variants based on the physicochemical and biochemical features the of the CDR3 in both the VL and VH domains.

4.9 Discussion

The focus of this Chapter was to identify potential bottlenecks in mAbdAb expression. An initial screen in transient HEK cells was used to identify candidates for further analysis in a stable CHO system. mAbdAb sequence variants showed a range of expressibility (0.2µg/ml to

24.1µg/ml) (Figure 4.1) and it was determined by one-way ANOVA that selection method

(passive or soluble) and dAb library (VHS, VHM, VHL or VK) used in Chapter 3 to isolate dAbs did not significantly affect mAbdAb expression. Specificity for the dAb target antigen (HEWL) was then determined by binding ELISA and validated by Biacore analysis (Figure 4.2). The ELISA method identified 40 HEWL-specific mAbdAbs, whilst the Biacore method identified 30, however these mAbdAbs were consistently HEWL-positive using both methodologies. Thus

60% of mAbdAbs were confirmed to contain HEWL-specific dAbs, which confirms that the selection procedures employed in Chapter 3 were successful. Based on this information, a subset of 19 mAbdAbs that exhibited a range of expression titres in the HEK transient platform and contained HEWL-positive dAbs were chosen for further analysis in a CHO stable cells (Table 4.1).

Batch culture of stable transfectant pools showed that CHO growth properties were not affected by mAbdAb expression, as all recombinant cell lines exhibited similar growth and

208 viability profiles and reached densities in excess of 10x106 cells/ml (Figure 4.3). Expression was then quantified by ELISA and was used to calculate cell specific productivity (Qp) of mAb and mAbdAb expressing CHO cell lines (Figure 4.4). Cell specific productivities of 0.03 – 1.17pcd were observed in stable CHO cell lines, and comparable to one previous study of mAb expression in non-amplified stable CHO pools (Ho et al. 2012).

The range in mAbdAb expression titres in the stable CHO cells was comparable to the range in titre observed in the HEK transient platform, however a 2.6-fold increase in titre was observed for Alemtuzumab and 13 of the 19 mAbdAbs showed a difference (2 increase and 11 decreased) in expression titre obtained in stable CHO cells. This result may suggest that the

HEK transient system used here was not reliable for predicting the expression achieved in stable CHO cells. Multiple factors could contribute to the differences observed in titre between the two expression platforms.

In the HEK transient platform the vector used contained a different promoter (CMV) to stable

CHO pools (RSV), and the choice of promoter has been shown to impact greatly on expression titres (Tornoe et al. 2002, Schlabach et al. 2010, Brown et al. 2014). Mason et al. (2013) showed through comparative analysis of mAb sequence variants under the control of the same promoter that CHO transient and stable expression is governed by a common bottleneck (folding and assembly) which manifests differently depending on the transfection method. In CHO transient expression they determined that misfolded HC accumulated within the cell, whilst in CHO stable cells, low HC and LC mRNA abundance was responsible for poor expression, and postulated that these differences arise during stable cell line generation. They argued that as accumulation of

209 misassembled HC can be cytotoxic and trigger apoptosis only those cells that exhibit low expression (as a result of lower transgene levels) and therefore better survival characteristics are selected, resulting in a low expression phenotype (Mason et al. 2012). Although Dipenbruck et al. (2013) showed that HEK transient expression titres are predictive of those obtained in CHO, this was using identical vectors and clonal cell lines, whereas the transfectant pools in this study contain a heterogeneous population of high and low producing clones. Furthermore, Dipenbruck et al. (2013) expressed a non-glycosylated BiTE antibody format, whereas the mAbdAb constructs used in this study contain a single glycosylation site in the CH2 domain of the mAb

(Asn-297), which is required for functional activity and secretion. In vitro translation of mAbdAb constructs (Figure 4.10) indicated that mAbdAbs have the potential for further glycosylation within the CDR of the dAb, which was suggested to occur at non-canonical glycosylation sites

(e.g. the reverse consensus sequence SMN), which is non-essential for mAbdAb functionality. It has been established that glycosylation patterns vary between HEK and CHO cells (Suen et al.

2010, Croset et al. 2012), and it is possible that the lower expression observed for 11 mAbdAb constructs in stable CHO pools could relate to differences in post-translational processing of the dAb in the two host cell types.

During stable transfection recombinant genes are randomly integrated within the CHO genome (Davies and Reff 2001), and the site of transgene insertion can have a profound effect on expression titres particularly over long-term culture (Barnes et al. 2001, Yang et al.

2010, Bailey et al. 2012). This effect has been attributed to transcriptional silencing following

DNA methylation at CpG rich sequences (Pikaart et al. 1998). Various methodologies have been developed in order to address this issue using cis-acting element such as UCOEs in the expression vector (Section 1.5.1), however all of these approaches require the time-

210 consuming process of clonal selection from thousands of potential candidates to generate a homogeneous cell line. Therefore, in this study transfected cells were maintained in a heterogeneous pool, thereby minimising the effect of gene locus on mAbdAb expression as a variable. Although polyclonal cell lines exhibit lower titres and productivity than clonal cell lines (Ye et al. 2010, Ho et al. 2013, Kober et al. 2013) and are not suitable for use in GMP production due to their heterogeneity, they have been shown to have both reproducible expression (Ye et al. 2010) and stability over long term culture (Matasci et al. 2011). Here, two polyclonal cell lines were generated for each mAbdAb construct and showed reproducible expression titres. In transient transfection the transgene is not integrated into the genome, therefore transcriptional silencing does not affect transient protein expression.

It is conceivable that the dAb sequence could influence gene stability in stable CHO pools if

CpG islands were located in the dAb sequence.

RT-PCR analysis was employed to ascertain whether poor mAbdAb expression in CHO pools was the result of low mRNA abundance (Figure 4.6). All cell lines exhibited similar abundance of HC mRNA, however differences in LC abundance were observed between cell lines, which was attributed to using a dual-vector system under the control of different selection markers.

One way to overcome this variability might be through using a single vector system with the

HC and LC genes linked by an IRES element, such as the one employed by Ho et al. (2013).

However, as mRNA was detected in relative abundance in all stable CHO cell lines it is unlikely that transcriptional silencing affects mAbdAb expression and therefore suggests that the bottleneck occurs downstream of transcription.

211

Validation of mRNA expression levels was attempted through real-time quantitative PCR.

However, despite optimization of cDNA concentration, cycle parameters and primer pairs, it was not possible to obtain quantitative data for HC and LC mRNA and it was suggested that low transgene mRNA abundance relative to endogenous mRNA (e.g. B2M) may have been a contributing factor. Stepwise methotrexate (MTX) amplification has been shown to improve mAb expression titres and specific productivity in CHO cell pools (Chusainow et al. 2009, Ho et al. 2013) through amplification of transgene copy numbers and thus mRNA abundance.

Although this approach may have improved transgene mRNA abundance and may have allowed for quantitative PCR analysis, gene amplification can lead to cell line instability over long term culture due to chromosomal rearrangements and gene silencing (Chusainow et al.

2009), and therefore may have introduced another variable in this system that might have influenced mAbdAb expressibility.

Western blot analysis revealed that mAbdAb expressing CHO stable pools exhibited different expression profiles in terms of HC and LC polypeptide abundance both intracellularly and in the supernatant (Figure 4.7). However, one factor which was consistent in all poor-expressing mAbdAbs was the absence of intracellular LC polypeptide as it was readily expressed into the medium. This might suggest that the rate of transit through the secretory system is much faster for the LC than the HC-dAb polypeptide, meaning that LC secreted too quickly for proper HC- dAb-LC assembly to occur. During mAb folding and assembly, all HC and LC domains fold independently the exception of the CH1 domain of HC polypeptide, which remains unfolded and associated with the BiP chaperone in the ER until it has correctly assembled with the LC protein

(Bhoskar et al. 2013). Misassembled HC may trigger the unfolded protein response (UPR), which channels the unfolded HC into proteolytic degradation pathways (Plantier et al. 2002, Fujita et

212 al. 2007), but has shown the potential to trigger the formation of Russell Bodies (Corcos et al.

2010, Stoops et al. 2012), which are cellular inclusions bodies of aggregated HC polypeptides and ER resident proteins. This might be the cause for poor expression in one construct (H081), which showed high intracellular HC-dAb polypeptide abundance that was not secreted into the medium, however further analysis by immunocytochemistry using antibodies to detect both the

HC-dAb and ER chaperones such as BiP would be required to confirm this.

A recent study on “difficult to express” (DTE) mAbs, Pybus et al., (2014) showed that poor assembly was responsible for low mAb titres, and that increasing LC availability through controlling HC: LC gene ratios during transfection to favour excess LC could improve titres up to 3-fold (Pybus et al. 2014). Another study demonstrated that multicistronic vectors, where

LC appears in the first cistron and HC in the second, linked by an IRES element, results in higher intracellular LC abundance, increased mAb expression titres and improved cell specific productivities (Ho et al. 2012). Therefore, increasing LC availability could be investigated either in a transient system or stable CHO system to overcome this potential bottleneck in mAbdAb assembly. Furthermore, as the mAbdAb construct contains an additional variable domain (VH or VK dAb), it is conceivable that the LC could assemble with the dAb VH, or that the VK domain could assemble with the VH of the mAb, with potential consequences including aggregation and degradation.

Proteolytic degradation was investigated through treatment with chemical inhibitors that have the potential to inhibit proteasomal and lysosomal degradation pathways (Table 4.3). Three mAbdAb cell lines (H014-c, H012-c and H092-c) were chosen based on their divergent protein

213 expression profiles (Figure 4.7) and titres (Table 4.2). Two of these cell lines (H014-c and H012- c) showed a significant increase in titre following treatment with two inhibitor treatments

(MG132 and Leupeptin and Pepstatin A), and the H014-c cell line also showed significantly higher titre after Bortezomib treatment. This might indicate that mAbdAb degradation could be mediated by Calpains and Cathepsins, as these are common targets for MG132,

Leupeptin and Pepstatin, whereas Bortezomib specifically blocks proteasomal degradation at the β5 subunit, which may be involved to a lesser extent. However the H092-c cell line showed no increase in HC-dAb polypeptide or titre in response to any of the inhibitors. This might suggest that the H092 construct is not translated, or that another degradation pathway might be in effect. One potential pathway that is not studied here is co- translational degradation, which occurs due to stalling of mRNA on ribosomes and activation of ubiquitin-mediated degradation of the nascent polypeptide and degradation of the aberrant mRNA (Verma et al. 2013, Comyn et al. 2014). However co- translational degradation has been studied in yeast expression systems, and has yet to be determined in

CHO expression platforms. Alternatively, an inducible system could be employed in mAbdAb expression, such as those employed in previous studies (Zhao et al. 2012, Sheikholeslami et al. 2013), whereby transgene expression is induced once cells reached the desired density and growth phase, thereby minimising the induction of UPR activity. Activation of the UPR was not studied in this Thesis, however this could be achieved through characterisation of key genes that are modulated in response to UPR activation (Figure 1.14), such as BiP, ATF4,

XBP1 and ERO1-L at the both the mRNA and protein level by qPCR and western blot analysis, or through use of a non-invasion UPR monitoring system such as the one developed by (Du et al. 2013). This would provide information as to whether ER-stress and UPR activity affect mAbdAb expression in CHO cells.

214

In vitro expression using a mammalian cell lysate (rabbit reticulocytes) was used to investigate translation as a potential bottleneck in mAbdAb expression (Figure 4.10). Canine microsomes were included in the reaction to study whether translocation and glycosylation of HC-dAb may influence expression. The LC was not included in the translation of HC-dAb in this system as no chaperones were present in the lysates used, however it would be interesting to study whether fully folded mAbdAbs can be expressed in a CHO-based lysate which includes chaperones such as PDI and BiP. No differences were observed in the translation or translocation of all three molecules (Alemtuzumab, H014 and H092), suggesting that these processes do not affect expression. However the cell-free system differs from the host cell systems in that mRNA was derived in vitro and added directly to ribosomes. This might suggest that correct processing and subsequent localisation of HC mRNA transcripts may influence expression in host cells.

Cellular transport of mRNA transcripts is mediated by nucleocytoplasmic export receptors and can be influenced by mRNA processing (Aihara et al. 2011). Once exported into the cytoplasm mRNA can be sequestered into translationally inactive cytoplasmic structures including stress granules (SGs) or processing bodies (PBs) that can mediate mRNA degradation (Section 1.5.2).

The formation of these granules can occur in response to eIF2α phosphorylation in response to nutrient starvation or ER-stress, or stalling of the ribosome during translation (Anderson and Kedersha 2006). This effect has been studied most extensively in yeast cells (Pizzinga and

Ashe 2014) and has yet to be reported in CHO cells, however in mAbdAb expression it is conceivable that the HC mRNA transcript may be recognised as aberrant as these contain an additional VH or VL domain at the 3’ end of the transcript. Alternatively, slow translation rates

215 caused by the long HC mRNA transcript may result in ribosomal pausing and subsequent channelling of stalled ribosomes, mRNA and associated translation factors into SGs or PBs. In the first instance mRNA localisation could be performed by cell fractionation and RT-PCR analysis of HC mRNA in nuclear and cytoplasmic extracts, or alternatively by in situ hybridisation (ISH) using a cDNA probe specific to the HC mRNA transcript and visualised by microscopy. The latter could be combined with immunocytochemistry using antibodies directed against key proteins located within SGs (e.g. eIF2α, 40s ribosomal subunit, PABP) or

PBs (e.g. Dcp1, Dcp2, eIF4E) to determine whether mRNA is sequestered in the cytoplasm

(Buchan and Parker 2009).

In conclusion, this Chapter showed that mAbdAb sequence variants show a range in expressibility in both a HEK transient and CHO stable platforms, although the choice of expression platform significantly affected expression titres. The amount of HC mRNA did not appear to be limiting in mAbdAb expression, however distinct profiles in intracellular and extracellular HC-dAb and LC polypeptide abundance was detected at the protein level. It was further determined that although proteolytic degradation may play a role in the expression of some mAbdAb constructs, it was not the major bottleneck in mAbdAb expression. It has therefore been suggested that poor mAbdAb expression is related to how the cell utilises the

HC message. The following Chapter focuses on the application of industrially relevant process optimization techniques to improve productivity and titre of mAbdAb expressing CHO cell lines.

216

CHAPTER 5: OPTIMIZATION STRATEGIES TO IMPROVE MABDAB EXPRESSIBILITY

217

5.1 Introductory Remarks

The limiting stages of mAbdAb expression were examined in Chapter 4 through characterisation of 19 stably transfected CHO pools, each expressing a sequentially unique mAbdAb construct. All mAbdAbs exhibited lower expression titres and productivities than the control mAb (Alemtuzumab) cell line (Table 4.2). It was determined that transgene mRNA levels were not the major bottleneck in mAbdAb expression (Figure 4.6), whilst western blot analysis of intracellular and extracellular polypeptides (HC-dAb and LC) revealed that sequence variants exhibited different expression profiles in terms of intracellular and extracellular protein abundance (Figure 4.7). It was suggested that the stages of translation and mAbdAb assembly may both contribute to the low expression titres observed. The focus of this Chapter is to assess whether titre and productivity of the mAbdAb transfected CHO cell pools from

Chapter 4 can be improved through process optimization techniques that are commonly employed in the industrial manufacture of monoclonal antibodies.

Three process optimization techniques were chosen for this study; treatment with sodium butyrate (NaBu), induction of mild hypothermia (32oC culture) and addition of dimethyl sulphoxide (DMSO) to culture medium. Three exemplar mAbdAb expressing CHO cell lines generated in Chapter 4 were used for each series of studies. For NaBu treatment and induction of mild hypothermia the same three cell lines (H014-c, H012-c and H092-c) that showed a range in titre and productivity (Table 4.2) were chosen to investigate whether these process optimization techniques can enhance expression of mAbdAbs exhibiting different expression profiles. As DMSO has been shown to act as a chemical chaperone capable of enhancing secretion of aggregated proteins (Hwang et al. 2011), the non-expressing cell line (H092- c) was substituted for a cell line (H081-c) which showed the highest intracellular accumulation 218 of HC-dAb polypeptide compared with other cell lines. Each process optimization technique was employed during batch culture of stable CHO pools, and the effects of each approach characterised in terms of growth, titre, productivity and protein expression profiles analysed through western blot analysis. As NaBu is a known inhibitor of histone deacetylases and is thought to improve Qp through increased transgene mRNA levels (Jiang and Sharfstein 2008), the effect of NaBu treatment on HC and LC mRNA abundance was also determined through RT-

PCR analysis.

This Chapter concludes with an evaluation of the relative success of each optimization strategy, and how these results can be used to further improve mAbdAb expression titres.

5.2 Effect of sodium butyrate addition on mAddAb expression in stable CHO pools

Sodium butyrate is short-chain fatty acid which inhibits histone deacetylases, resulting in better gene availability for transcription and thus elevated HC and LC mRNA expression (Jiang and Sharfstein 2008). One recent study (Hong et al. 2014) also cited improved assembly of mAbs, due to elevated expression of BiP protein in cells supplemented with 0.1- 4mM NaBu, which resulted in up to a 5-fold increase in Qp. However, there are no reports on the effect of

NaBu addition in the context of novel format antibody expression.

NaBu addition has also been shown negatively affect cell growth and viability in a dose dependent manner (Chen et al. 2011). Therefore, in this study 2mM sodium butyrate was 219 added on day 3 of batch cultures as a compromise between growth inhibition and specific productivity, and cell density and viability measured daily (Figure 5.1). All cell lines exhibited significantly lower cell densities and viabilities (P = <0.05) following NaBu treatment. Cell line

H014c showed the greatest sensitivity to NaBu, indicated by the lowest viability (65%).

Previous groups have suggested that growth inhibition is caused by a shift in cell cycle towards the G1 phase (Chen et al. 2011, Lee and Lee 2012) whilst loss of viability is triggered by apoptotic cell death (Kim and Lee 2001, Kim et al. 2003, Lee and Lee 2012). Furthermore, different sensitivities to NaBu have been observed in clonal cell lines expressing the same mAb (Jiang and

Sharfstein 2008).

The abundance of HC and LC mRNA for control and NaBu treated cells was determined by semi-quantitative RT-PCR (Figure 5.2) and used to calculate fold change of mRNA abundance in

NaBu treated cells. All cell lines exhibited an increase in both HC and LC mRNA abundance, whilst no increase in B2M product was observed, which may indicate that only recombinant genes are upregulated by NaBu or may be due to the apparent saturation of the B2M product even in non- treated conditions. Sodium butyrate selectively targets class I and II histone deacetylases (Sunley and Butler 2010) and has been shown to upregulate the expression of recombinant genes under the control of specific promoters including CMV and SV40 (Kim and

Lee 2001).

220

Figure 5.1 Effect of Sodium Butyrate addition on growth and viability in stable CHO pools.

Batch cultures were set up as described (Section 2.4.3.4) and 2mM NaBu added to flasks on day

3 of culture (Section 2.4.3.5) as depicted by the dotted grey line. Cell density (A) and viability (B) was measured daily using a Countess© automated cell counter (Section 2.4.1.1). Key to Figure:

H104-c control, H014-c 2mM NaBu, H012-c control, H012-c 2mM

NaBu, H092-c control, H092-c 2mM NaBu. Error bars = standard deviation of four technical replicates. * indicates statistically significant difference as measured by two-tailed paired t-test (P = 0.05).

221

222

Fold increases ranging from 2.6 to 4.9-fold for the HC mRNA and 3.4 to 4.7-fold increase in LC mRNA, were observed in all recombinant cell lines, which is consistent with previous studies

(Jiang and Sharfstein 2008). Two cell lines (H014-c and H092-c) showed a similar fold increase for both HC (5.6 and 4.9-fold respectively) and LC mRNA (3.9 and 4.5-fold respectively), whilst cell line H012-c showed the lowest fold increase for both HC (2.6-fold) and LC (3.4-fold) mRNA compared to other cell lines, but the highest sensitivity in terms of growth and viability (Figure

5.1), which may have contributed to this observation. Finally, the presence of a second band with an approximate weight of 50bp may relate to the presence of primer dimers amplified during the PCR reaction.

Expression titres were determined by ELISA following NaBu addition and used to calculate specific productivity (Qp) (Figure 5.3). Two cell lines (H014-c and H012-c) showed a significant increase (P = <0.05) in titre. Cell line H014-c expressed 19.4μg/ml in untreated conditions and

23.4μg/ml in response to NaBu addition, whilst H012-c expressed at 1.3μg/ml in untreated compared to 2.9μg/ml in treated conditions. The third cell line (H092-c) showed no expression in either condition. It should be noted that cell supernatants were used for this and as such do not adjust for the lower cell densities in the NaBu treated samples. For this reason, Qp was calculated for control and NaBu treated samples. Cell line H014-c increased from 0.5 to 1.6pcd

(3.5-fold) and H012-c from 0.07 to 0.36pcd (4.9-fold). This increase is consistent with the increase in mAb productivity observed by other laboratories (Hong et al. 2014). However, the titres and productivities are slightly lower than those observed in Chapter 4 (Table 4.2).

This was due to the earlier time point used for ELISA quantification (Day 10 in Chapter 4 compared with Day 5 here) and the difference in days used to calculate Qp (Day 2 to 6 in

Chapter 4 and Day 3 to 5 here).

223

Figure 5.2. Effect sodium butyrate addition on heavy and light chain mRNA in stable CHO pools. Batch cultures and NaBu treatment were performed as described previously (Figure 5.2).

RNA extraction, RT-PCR analysis and band density quantifications were performed as described previously (Figure 4.6). A. Representative 2% [w/v] agarose gel electrophoresis of variable heavy chain, variable light chain and B2M RT-PCR products. B. Semi-quantitation of fold change in HC and LC mRNA expression normalised to B2M. Key to Figure: VH no NaBu ( ), VH 2mM NaBu

( ), VL no NaBu ( ), VL 2mM NaBu ( ). Error bars = Standard deviation of three technical replicates.

224

225

Figure 5.3 Effect of sodium butyrate treatment on expression titre and specific productivity. NaBu treatment was performed as described previously (Figure 5.2). ELISA quantifications were performed on day 5 supernatants as described in Section 2.5.1.2 and specific productivities calculated (day 3 to day 5) as described in Section 2.9.1. A. ELISA quantification of supernatant samples. Key to Figure:

Day 5 titre no NaBu ( ), day 5 titre with 2mM NaBu ( ). Error bars represent SEM of two biological and three technical replicates. B. Cell specific productivities. Key to Figure: Qp no NaBu ( ), Qp with

2mM NaBu ( ), Fold increase in Qp ( ).* indicates statistically significant difference as measured by two-tailed paired t-test (P = 0.05).

226

Western blot analysis (Figure 5.4) was performed to validate the results obtained through

ELISA quantification. Consistent with the ELISA, cell lines H014-c and H012-c showed an increase in HC-dAb polypeptide (~65kDa) in the medium following treatment with 2mM NaBu, whilst no HC-dAb was detected for cell line H092-c, indicating that the increase in HC mRNA

(Figure 5.2) did not affect the expression of this construct. LC polypeptide (~25kDa) was detected at similar relative abundance in the medium in non-treated versus treated conditions, however intracellular LC polypeptide abundance increased for all three cell lines when cultured with NaBu, which might suggest the intracellular LC polypeptide is involved in mAbdAb assembly.

Whilst a significant increase in titre and productivity was observed in two cell lines (H014-c and

H012-c) when treated with 2mM NaBu, this process optimization technique had no effect on the non-expressing cell line (H092-c) and did not result in a “rescued” phenotype whereby mAbdAb cell lines showed similar titres to the mAb-c cell line from Chapter 4 (68μg/ml). These results may further suggest that mRNA is not correctly utilised by the cell, particularly with respect to the lowest expressing cell lines, as an increase in HC and LC mRNA did not result in increased protein synthesis. As suggested in the previous Chapter (Section 4.9) this may be due to an aberrant mRNA transcript, nuclear mRNA localisation or sequestered mRNA in stress or processing granules within the cytoplasm.

227

Figure 5.4. Effect of NaBu treatment on intracellular and extracellular mAbdAb expression.

NaBu treatment was performed as described previously (Figure 5.2). Intracellular (Section

2.4.1.4) and supernatant (Section 2.4.1.5) samples were taken on day 5 of culture. SDS-PAGE electrophoresis and western blot analysis were performed as described previously (Figure 4.7).

Protein bands were quantified by densitometric analysis using Image J quantification software

(Section 2.5.4) A. Representative western blot analysis under reducing conditions. B.

Quantification of intracellular and supernatant HC and LC protein bands. Key to Figure: intracellular HC no NaBu ( ), intracellular HC with 2mM NaBu ( ), extracellular HC no NaBu ( ), extracellular HC with 2mM NaBu ( ), intracellular LC no NaBu ( ), intracellular LC with 2mM

NaBu ( ), extracellular LC no NaBu ( ), extracellular LC with 2mM NaBu ( ). Error bars = range of 3 technical replicates

228

229

5.3 Effect of mild hypothermia on mAbdAb expression in stable CHO pools

Culturing CHO cells in mildly hypothermic conditions (28-34oC) following an initial incubation at

37oC (termed biphasic culture) has been used previously to improve the yield of recombinant proteins (Yoon et al. 2006, Chen et al. 2011) with one group citing up to a 38-fold increase in chimeric Fab yield (Schatz et al. 2003). Culturing cells in sub- physiological conditions inhibits cell cycle progression and thus cell densities, increases transgene mRNA abundance, alters metabolism and has been shown improve cellular folding capacity (Wulhfard et al. 2008,

Masterton et al. 2010, Gomez et al. 2012). The same three CHO cell lines (H014-c, H012-c and

H092-c) chosen for NaBu treatment were also used to investigate whether induction of mild hypothermia (32oC) can be used to improved mAbdAb expression.

As low temperature culture can result in cell growth inhibition (Chen et al. 2011), batch cultures were initially cultured at 37oC and mild hypothermia induced on day 4 of culture by moving culture flasks to a 32oC incubator, and cell density and viability measured every 2 days.

All cell lines exhibited lower cell densities and an extended culture period when cultured at

32oC as compared to 37oC culture (Figure 5.7). Cell lines H014-c and H012-c exhibited a culture period of 16 days and similar profiles in terms of viability, however H012-c maintained a higher viability than H014-c. The H092-c also exhibited an extended culture period, but showed a more rapid decline in cell viability and thus a shorter culture period of 14 days. This extension to cell culture longevity is consistent with previous studies

230

Figure 5.5 Effect of mild hypothermia on CHO cell growth and viability. Batch cultures were grown at 37oC and mild hypothermia induced in half of the cultures by moving to a 32oC incubator on day 4 (grey dotted line) (Section 2.4.2.5). Cell density (A) and viability (B) was measured every two days using a Countess© automated cell counter (Section 2.4.1.1). Key to

Figure: H14-c 37oC, H014-c 32oC, H012-c 37oC, H012-c 32oC,

H092-c 37oC, H092-c 32oC. Error bars represent standard error of the mean of three biological replicates, each with two technical repeats. * indicates statistically significant difference as measured by two-tailed paired t-test (P = 0.05).

231

232

Figure 5.6 Effect of mild hypothermia on mAbdAb titre and productivity. Cell culture under hypothermic conditions (32oC) was performed as described previously (Figure 5.5) and expression titres were quantified by ELISA (Section 2.5.1.2) every 2 days during culture.

Specific productivities were calculated (day 2 to day 6) as described previously (Figure 4.4).

A. Maximum yield (titre μg/ml) obtained from 37oC (Day 10 culture) and 32oC (Day 16 culture). B. Specific productivity (Qp) at 37oC, 32oC and fold change in Qp. C. Comparison of cell line H014-c expression titre at 37oC and 32oC during culture. D. Comparison of cell line

H012-c expression titre at 37oC and 32oC during culture. Key to Figure: A. Titre from 37oC culture (day 10 ( )) and 32oC culture (day 16 ( )). B. Qp at 37oC ( ), 32oC ( ) and fold change in Qp ( ). C. H014-c titre at 37oC ( ) and 32oC ( ). D. H012-c titre at 37oC

( ) and 32oC ( ). Error bars = Standard deviation of three biological replicates, each with three technical replicates.

233

234

(Trummer et al. 2006, Kumar et al. 2008) and has been attribute to a shift in growth phase towards G1 (Masterton et al. 2010, Chen et al. 2011).

ELISA quantification (Figure 5.6) was used to determine whether lower culture resulted in higher mAbdAb yield, and was used to calculate specific productivities. Two cell lines (H012-c and H014-c) exhibited significantly higher end of culture titres at 32oC compared to 37oC (P =

<0.05). The H014-c cell line expressed at 23µg/ml at 37oC and 33µg/ml at 32oC (1.4-fold increase), whilst cell line H012-c titres increased from 1.9µg/ml on day 10 culture at 37oC and

2.9µg/ml on day 16 at 32oC (1.5-fold increase). In contrast cell line H092-c showed no expression at either culture temperature. Consistent with increased titre, H014-c and H012-c cell lines also showed a significant increase in specific productivities (1.4-fold and 1.5-fold respectively). However, as 32oC culture resulted in extended culture longevity, comparative analysis of titre increase during culture was performed on cell lines H014-c and H012-c (Figure

5.6 C and D respectively). This indicated that the higher titres observed at 32oC related to the longer culture period achieved at this temperature.

Western blot analysis (Figure 5.7) was performed on end of culture supernatants in order to validate the results obtained through ELISA quantification. All cell lines exhibited an increase in

LC polypeptide abundance in following 32oC culture. Consistent with the increase in titre observed through ELISA quantification, cell line H012-c showed an increase in HC-dAb polypeptide abundance in the medium at 32oC compared with 37oC, whilst a more modest increase was observed for cell line H014-c. Furthermore, cell line H092-c showed no evidence of HC-dAb polypeptide at either culture temperature.

235

Figure 5.7 Effect of mild hypothermia mAbdAb protein expression. Cell culture under hypothermic conditions (32oC) was performed as described previously (Figure 5.5). SDS-PAGE electrophoresis, western blot analysis and densitometric analysis of band intensity were performed as described previously (Figure 4.7). Western blot analysis was performed on end of culture supernatants from A. Representative western blot of end of culture supernatants at 32oC culture (day 16 (day 14 for H092)) and 37oC culture (day 10). B. Semi-quantification of fold increase observed for HC-dAb and LC polypeptides. Key to Figure: LC polypeptide intensity at

37oC ( ) and 32oC ( ), HC-dAb polypeptide intensity at 37oC ( ) and 32oC ( ). Error bars = standard deviation of 3 technical replicates.

236

237 Taken together these results indicate that hypothermic culture can increase culture longevity, which resulted in improved titre and productivity of two mAbdAb cell lines. However, similar to

NaBu treatment, one cell line (H092-c) showed no difference in mAbdAb expression.

5.4 Effect of DMSO addition on mAbdAb expression in stable CHO pools

Supplementation of culture medium with 0.5-3% [v/v] DMSO has been shown to improve productivity of various recombinant proteins including mAbs and fusion proteins in both CHO and Hybridoma cell lines (Ling et al. 2003, Rodriguez et al. 2005, Li et al. 2006) and has also been used as a chemical chaperone to aid secretion of aggregated proteins (Hwang et al. 2011).

The precise mechanism by which DMSO exerts such effects has yet to be fully elucidated, however, it has been reported that elevated transcription rates of recombinant genes (Wang et al. 2007), growth inhibition (Kim et al. 2011) and regulation of various chaperone proteins known to affect secretion (Li et al. 2006) may all contribute to this response. Two independent studies (Liu et al. 2001, Li et al. 2006) determined that 1-2% [v/v] DMSO is the optimal concentration for enhanced titre and productivity in CHO cells, but that 2% [v/v] DMSO significantly affected cell growth and viability. Therefore 1% [v/v] DMSO was chosen for this study and added on day 4 of batch cultures to minimise its effect on cell density and viability.

Three cell lines were chosen for this study, two of which (H014-c and H012-c) were also studied with respect to NaBu treatment and mild hypothermia. Cell line H081-c was included in place of

H092-c, to determine whether DMSO can act as a chemical chaperone to aid secretion of this mAbdAb construct, which exhibited high intracellular abundance of HC-dAb accumulation

(Figure 4.7).

238

The addition of 1% [v/v] DMSO on day 4 of culture resulted in a significant reduction in cell density and viability for all three cell lines (Figure 5.8). However, changes to cell density did not affect cell culture longevity. Lower cell densities in response to DMSO addition have been observed before (Rodriguez et al. 2005) and has been linked to G1 cell cycle arrest (Fiore et al.

2002), whilst lower viabilities have been attributed to activation of apoptosis (Kim et al. 2011).

Lower maximal cell densities were observed for two cell lines (H012-c and H081-c) in this experiment compared with those obtained in Chapter 4 (Figure 4.3). However in the previous batch culture cell density and viability were measured daily, and peak cell density was observed on day 7 of culture for these two cell lines. In this study cell density and viability were measured every two days during culture, however the densities observed on day 6 and 8 of culture were consistent with those obtained previously (Figure 4.3).

Expression titres were measured every 2 days throughout culture by ELISA (Figure 5.6) and used to calculate cell specific productivities. Only one cell line (H014-c) showed a significant increase in both product titre (25.8 to 31.8µg/ml) and specific productivity (0.7 to 1.2 pg/cell/day) following treatment with DMSO, which relates to a 1.2-fold increase in titre and

1.7-fold increase in productivity. In contrast, cell lines H012-c and H081-c showed no increase in titre or productivity. To confirm this result, both intracellular and supernatant samples were subject to western blot analysis (Figure 5.7).

239 Figure 5.8 Effect of DMSO addition on growth and viability of CHO cell pools. Batch cultures were set up as described in Section 2.4.3.4 and 1% [v/v] DMSO was added on day 4 of culture as described in Section 2.4.3.5 and depicted by the grey line. Cell density (A) and viability (B) was measured every 2 days during culture using a Countess® automated cell counter (Section

2.4.1.1). Key to Figure: H104-c no DMSO, H014-c 1% DMSO, H012-c no

DMSO, H012-c 1% DMSO, H081-c no DMSO, H081-c 1% DMSO. Error bars =

Standard deviation of two biological replicates, each with two technical replicates. * indicates statistically significant difference as measured by two-tailed paired t-test (P = 0.05).

240

241 Consistent with the results obtained through ELISA (Figure 5.6), no HC-dAb was detected in the supernatant of cell line H081-c in both control and DMSO treated culture. Cell line H012-c showed low HC-dAb abundance in the medium, which was not increased in response to DMSO addition. Only cell lines H014-c showed an increase in HC-dAb polypeptide in the medium in

DMSO treated conditions. The LC polypeptide was detected in the medium for all three cell lines, but only cell line H014-c showed an increase in LC abundance following DMSO treatment.

In the intracellular samples all three cell lines showed evidence of HC-dAb polypeptide, all of which showed a slight increase in HC-dAb in response to DMSO addition. LC polypeptide was detected in all three cell lines, however very low abundance of LC was detected intracellularly in cell lines H012-c and H081-c compared with H014-c and only H014-c showed an increase in intracellular LC product when treated with DMSO.

It has previously been reported that DMSO can act as a chemical chaperone to improve the secretion of certain recombinant proteins (Hwang et al. 2011), however this effect has not been studied with respect to mAb or novel-format antibodies. As cell line H081-c showed evidence of intracellular HC-dAb that was not secreted into the medium, this cell line was chosen to investigate whether a similar effect could be observed in this type of recombinant product. The lack of increase in the medium for the HC-dAb product for cell lines H081-c and

H012-c, which also showed evidence of intracellular HC-dAb accumulation, following DMSO treatment indicates that DMSO did not act as a chemical chaperone to improve secretion of mAbdAb constructs.

242

Figure 5.9 Effect of DMSO addition on mAbdAb expression and productivity. DMSO treament was performed as decribed previously (Figure 5.8) and ELISA quantifications performed on day 10 culture supernatants as described (Section 2.5.11). A. Day 10 ELISA quantifications. B. Specific productivities

(Day 2 – 6) and fold change in Qp. Key to Figure: Day 10 titre with no DMSO treatment ( ), day 10 titre with 1% DMSO ( ), Qp with no DMSO ( ), Qp with 1% DMSO ( ), fold change in Qp ( ). Error bars represent standard deviation of three biological replicates, each with two technical replicates. * indicates statistically significant difference as measured by two-tailed paired t-test (P = 0.05).

243 Figure 5.10 Effect of DMSO addition on intracellular and extracellular mAbdAb expression. DMSO treatment was performed as described previously (Figure 5.8).

Intracellular samples were taken on day 6 of culture (Section 2.4.1.4) and supernatant samples were taken on day 10 of culture (Section 2.4.1.5). SDS-PAGE electrophoresis and western blot analysis were performed as described previously (Figure 4.7). Protein bands were quantified by densitometric analysis using Image J quantification software (Section

2.5.4) A. Representative western blot analysis under reducing conditions. B. Quantification of intracellular and supernatant HC and LC protein bands. Key to Figure: intracellular HC no DMSO ( ), intracellular HC with 1% DMSO ( ), extracellular HC no DMSO ( ), extracellular HC with 1% DMSO ( ), intracellular LC no DMSO ( ), intracellular LC with 1%

DMSO ( ), extracellular LC no DMSO ( ), extracellular LC with 1% DMSO ( ). Error bars = range of three technical replicates.

244

245

One group (Liu et al 2001) observed that whilst DMSO increased the titre of two proteins (β- galactosidase and a fusion protein) expressed in CHO cells, no such increase was observed for mAb titres. The moderate increase (1.2-fold) in titre observed for cell line H014-c was lower than previous studies on mAb titres in CHO (Ye et al. 2009) and Hybridoma cells (Ling et al.

2003), both of which observed a 2-fold increase in titre. These results suggest that 1% [v/v]

DMSO addition is not an effective method of improving mAbdAb expression titres.

Although the mechanisms underlying the stimulatory effect on DMSO on recombinant protein production remain unclear, there is some evidence that DMSO addition improves transcription of certain genes, resulting in increased mRNA availability for protein synthesis (Wang et al.

2007). This effect was also observed in 3T3 fibroblasts, and contrary to the effect of NaBu on transcription, was found to occur independently of histone modifications (Ishiguro and

Sartorelli 2004). Whilst another study observed increased acetylation of the CMV promoter in a dose-dependent manner following DMSO addition in stable CHO cells, which would result in a more favourable chromatin structure for transcription (Radhakrishnan et al. 2008). In an in vitro system DMSO addition also improve mRNA transcription rate, which coincided with an alteration of T7 RNA polymerase to a more compact structure and improved initiation of transcription (Chen and Zhang 2005). As analysis of HC and LC mRNA abundance was not performed on DMSO stimulated CHO cultures it is not possible to determine whether elevated

HC and LC gene transcription occurred in this study. This would have provided further evidence that increasing transgene mRNA availability does not improve mAbdAb titres.

246

5.5 Discussion

The purpose of this Chapter was to investigate whether mAbdAb titre and productivity can be improved through employment of three industrially relevant process optimization techniques.

Two non-expressing cell lines (H092-c and H081-c) showed no change in titre or productivity in response to NaBu treatment, hypothermic culture shift (where H092-c was studied) or DMSO treatment (where H081-c was studied). However significant increases in both product titre and cell specific productivity (Qp) were observed in cell lines H014-c and H012-c in response to

NaBu treatment and hypothermic culture, whilst only cell line H014-c showed a significant increase following DMSO treatment (summarised in Table 5.1).

The greatest fold change in Qp for these two cell lines was observed in response to NaBu treatment, with Qp fold increases of 3.4-fold and 4.7-fold for cell line H014-c and H012-c respectively (Table 5.1). This is consistent with previous reports on the effect of NaBu on mAb

Qp, where increases of 2-5-fold in productivity have been observed (Jiang and Sharfstein 2008,

Hong et al. 2014). In terms of the effect of NaBu on titre, conflicting results have been reported. Whilst some groups have observed a 2 to 4-fold increase in mAb titre (Mimura et al.

2001, Kim and Lee 2002) others have reported decreased titre (Hong et al. 2014) and one group observed both increased and decreased titre in response to NaBu in a clone dependent manner

(Jiang et al. 2006). Thus the more modest fold increase observed in mAbdAb titres (1.2 to 2.2- fold) were consistent with previous reports.

247

H014-c H012-c

Max cell density Titre Qp Max cell density Titre Qp (x106 cells/ml) (μg/ml) (pcd) (x106 cells/ml) (μg/ml) (pcd) Untreated 14.5 ± 1.6 19.4 ± 1.6 0.46 ± 0.09 13.8 ± 1.2 1.3 ± 0.3 0.07 ± 0.005 2mM NaBu 3.9 ± 1.2 23.4 ± 2.3 1.58 ± 0.29 4 ± 1.4 2.9 ± 0.7 0.33 ± 0.09 Fold Change 3.7 1.2 3.4 3.5 2.2 4.7 o 37 C 19.5 ± 2.1 23.5 ± 1.7 0.65 ± 0.06 26.8 ± 1.4 1.8 ± 0.2 0.06 ± 0.005 32oC 20.6 ± 1.5 33.3 ± 1.1 0.93 ± 0.05 25.3 ± 1.6 2.9 ± 0.3 0.08 ± 0.002 Fold Change 1.1 1.4 1.4 0.9 1.6 1.3 Untreated 19.9 ± 0.9 23.7 ± 2.2 0.76 ± 0.06 20.9 ± 1.4 1.8 ± 0.3 0.07 ± 0.002 1% [v/v] DMSO 11.5 ± 1.7 28.2 ± 2.1 1.34 ± 0.08 14.3 ± 0.5 1.7 ± 0.2 0.07 ± 0.003 Fold Change 1.7 1.2 1.8 1.5 0.9 0

Table 5.1. Summary of the effect of process optimization techniques on titre and productivity of mAbdAb-expressing stable CHO cell pools. Data presented is average ± standard deviation of three replicates.

Of the three process optimization techniques used in this study, NaBu had the greatest inhibitory effect on cell growth, which may have contributed to increased Qp and explain the cause for low increase in titre. The cytotoxic effects of NaBu treatment have been observed previously (Sung et al. 2004, Chen et al. 2011, Hong et al. 2014) with apoptosis and a shift in cell cycle towards the G1 phase both cited as possible factors contributing to this effect. A number of approaches have been investigated to overcome the apoptotic effects of NaBu treatment, including cell line engineering to overexpress anti-apoptotic genes such as

Bcl-2 (Kim and Lee 2001) or Caspase-2 antisense RNA to inhibit the induction of apoptosis (Kim

248 and Lee 2002), and combining sodium butyrate treatment with reduced culture temperate conditions (Hong et al. 2014). Alternatives to sodium butyrate include valporic acid (Backliwal et al. 2008, Yang et al. 2014), pentanoic acid (Liu et al. 2001) and sodium 4-phenylbutyrate

(Yam et al. 2007), all of which have been shown to have less of a cytotoxic effect than NaBu, but are not as widely used for industrial biotherapeutic production.

Sodium butyrate is a known inhibitor of histone deacetylases, which results in hyperacetylation of histones and improves gene accessibility through maintaining a more open chromatin structure, thus increasing transgene mRNA expression (Jiang and Sharfstein 2008). In accordance with this model, both HC and LC mRNA abundance increased in response to NaBu treatment (Figure 5.2) and is likely to have contributed to the observed increase in mAbdAb titre and productivity. NaBu also affects the expression of numerous endogenous genes, including cyclin dependent kinase inhibitors (such as p16 and p21), which results in the dephosphorylation of the retinoblastoma (RB) protein, a key regulator of cell cycle progression

(Sunley and Butler 2010). As a result, improved mAb titres are likely achieved through diverting cellular metabolism away from growth and into protein synthesis. In addition, NaBu has been shown to improve mAb folding through upregulation of the BiP chaperone (Hong et al. 2014).

However, sodium butyrate has been shown to affect product quality by affecting glycosylation patterns and protein charge, resulting in increased product heterogeneity and reduced biological activity (Sung et al. 2004, Hong et al. 2014). It has been demonstrated that NaBu affects glycosylation through regulation of enzymes for N-linked glycosylation at the genetic level (Lee et al. 2014), whilst differences in protein charge is caused by NaBu induced oxidative

249 stress (Hong et al. 2014). Furthermore, clonal variation to NaBu treatment has been observed in cell lines producing the same mAb (Jiang and Sharfstein 2008) and was also observed in this study for stable CHO pools expressing mAbdAb sequence variants.

Cell line H014-c showed the greatest increase in titre in response to hypothermic culture, where the titre achieved from 32oC culture was 9.8μg/ml (1.4-fold) higher than the titre at

37oC. However, the extended cell culture longevity observed at lower culture temperature (16 day culture compared to 10 days at 37oc) was the likely source for this increase. This was confirmed in Figure 5.6, where analysis of titre every 2 days during culture revealed that comparable titres were achieved up to day 10 culture at 37oC and 32oC for both the H014-c and

H012-c cell lines. Lower culture temperature also affected the growth profiles of all cell lines, with cells reaching maximal density on day 8 culture at 37oC and day 10 culture at 32oC (Figure

5.5), however no significant difference in maximal cell density was observed. Thus the modest fold increases in Qp can be explained by the lower cell densities observed at 32oC on day 6 culture, as Qp was calculated during the exponential phase (days 2 to 6) of culture.

The precise mechanism by which modulations in culture temperature affect cell productivity remains to be elucidated. Controlling proliferation through growth inhibition, mediated in a similar fashion to NaBu treatment through CKI (p21 and p53) upregulation, is considered to play a role in this effect (Kaufmann et al. 1999, Bi et al. 2004). Whilst altered cell metabolism, lower oxygen consumption, slower nutrient depletion and a concomitant decrease in waste product accumulation have also been implicated (Yoon et al. 2003, Kumar et al. 2008).

Furthermore, cultivation at lower temperatures is thought to delay the onset of apoptosis

(Moore et al. 1997). Fox et al., (2005) also observed increased transgene mRNA levels in 250 response to sub-physiological culture conditions (Fox et al. 2005), which has been linked to increased mRNA stability (Fujita 1999). Proteomic analysis of the effect of hypothermia on CHO cells also revealed the induction of “cold shock” genes (Kaufmann et al. 1999). Cold stress has been shown to regulate the activity of approximately 20 genes (Sonna et al. 2002), however only two of these genes have been characterized; cold-inducible RNA binding protein (CIRP) and RNA binding motif protein 3 (RBM3), both of which contain RNA binding motifs and are share up to 80% sequence homology (Kaufmann et al. 1999, Al-Fageeh et al. 2006, Sunley and

Butler 2010). Overexpression of CIRP at 37oC has been shown to have a direct influence on protein synthesis and thus expression titres through modulating mRNA levels, possibly through affecting mRNA stability (Tan et al. 2008), whilst RBM3 is thought to facilitate ribosome subunit association with mRNA transcripts and through post-translational regulation of microRNAs

(Dresios et al. 2005). In terms of product quality, no significant difference in glycosylation patterns (Yoon et al. 2003) and lower product aggregation (Rodriguez et al. 2005) have been observed.

DMSO treatment resulted in a modest increase in titre (1.2-fold) for one cell line (H014-c), whilst the fold change in Qp was directly proportional to the fold change observed in cell density and significance values obtained for titre and productivity were only just below the P <0.001 threshold

(P = 0.0008). Furthermore, western blot analysis revealed that contrary to the work of (Hwang et al. 2011), DMSO did not act as a chemical chaperone to improve secretion of intracellular HC-dAb polypeptides that are found in high abundance (Figure 5.10).In contrast to (Hwang et al. 2011),

(Ma et al. 2008) observed increased product aggregation following DMSO treatment, however these two studies involved different recombinant proteins (Flag-Tagged COMP-Angiopoietin 1 and hepatitis B surface antigen respectively) suggesting that the effects of DMSO are dependent on

251 the recombinant protein studied. Numerous studies have observed a 2 to 7-fold increase in protein expression following DMSO addition in CHO cells (Liu et al. 2001, Rodriguez et al. 2005,

Wang et al. 2007), although none of these studies were using mAbs or novel format antibodies.

Antibody expression in response to DMSO addition has been studied in hybridoma cells with contrasting results. (Ling et al. 2003) observed a 2-fold increase in mAb expression, whilst (Liu et al. 2001) observed no difference in mAb titres. DMSO addition was the least effective in terms of improving mAbdAb titre and productivity, therefore would not be considered an appropriate optimization technique for mAbdAb expression in stable CHO cells.

Each of the optimization techniques employed in this Chapter have the potential to improve the availability of mRNA for translation. Sodium butyrate provides a more open chromatin structure for transcription by inhibiting certain histone modifications (Jiang and Sharfstein

2008), mild hypothermia has been linked with improved mRNA stability (Wulhfard et al. 2008), and DMSO is thought acetylate certain promoters such as CMV and alter RNA polymerase structure to improve initiation of transcription (Ishiguro and Sartorelli 2004).

Increased transgene mRNA abundance was only studied with respect to NaBu treatment and did not affect the lowest expressing cell line (H092-c). Given the potential for each process optimization technique to improve mRNA availability, it would have been beneficial to determine mRNA abundance in each of these techniques.

It was suggested in Chapter 4 (Section 4.9) that the bottleneck in mAbdAb expression arises from how the cell utilises HC mRNA, and that mRNA localisation either within the nucleus or in cytoplasmic stress granules may be responsible. This argument is further substantiated with the observation that elevated HC and LC mRNA in response to NaBu does not correlate with

252 increased expression in cell line H092-c and has a limited effect on titre for cell lines H012-c and

H014-c. Stress granules are formed following the stalling of translation initiation caused by cellular stress (including ER-stress) or detection of an aberrant mRNA transcript and the phosphorylation of the eIF2α factor. This could be circumvented by using a genetically engineered CHO cell line that expresses a non-phosphorylatable mutant form of eIF2α which has been shown to improve translation in transiently transfected CHO cells (Underhill et al.

2003, Underhill et al. 2006). Alternatively this could be achieved through targeting the kinases responsible for eIF2α phosphorylation through genetic manipulation or use of chemical inhibitors such as hemin, which is used treat commercially available cell-free extracts to improve in vitro translation. However as translational control is imperative for maintaining cellular health apoptosis may be upregulated in response to inhibition of eIF2α phosphorylation. Therefore anti-apoptotic strategies, such a Bcl-2 overexpression, could be used in conjunction with the above strategies to minimise this potential effect.

In conclusion, mild hypothermia and sodium butyrate addition are two potential strategies to improve mAbdAb expression in stable CHO cells and have the potential for further improvements in titre and productivity if applied in combination. However, higher titres approaching those obtained from the Alemtuzumab construct in Chapter 4 (Table 4.2) are only likely to be achieved through targeting the underlying bottleneck in expression, which could be achieved through the use of genetically engineered cell lines.

253

CHAPTER 6: CONCLUDING REMARKS AND FUTURE PERSPECTIVES

254

6.1 Introductory remarks

Novel format antibodies have the potential to offer many advantages over natural antibodies in their use as biopharmaceuticals (Section 1.2.3). However these novel structures can pose a great challenge to the host cell used for their manufacture, impacting on both the cost of goods and their entry into the clinical pipeline. Therefore, a greater understanding of molecular events that determine their expression would be of great value in the development this class of therapeutics.

The aim of this project was to investigate how sequence variation affects the expressibility of a dual targeting novel format antibody (mAbdAb) in mammalian cell culture. Initial studies by

GlaxoSmithKline suggested the sequence elements of the dAb in the mAbdAb construct exerted more influence over expression titres in transiently transfected HEK cells than sequences of the mAb components. Therefore, in this study variation between constructs was limited to this domain (dAb) (Figure 1.12). In order to achieve this aim, a number of specific objectives were generated and were outlined in Section 1.6. The results obtained in this

Thesis have been presented in the form of three discrete results Chapters, with detailed discussions appearing at the end of each Chapter. This Chapter will evaluate the extent to which the objectives set out in Section 1.6 were achieved, and will suggest future avenues of research that would be of value in both elucidating the molecular mechanisms influencing predictability in the expression titres of mAbdAb.

255

6.2 Generation of a panel of mAbdAb sequence variants covering a range of expression titres

The first objective was to generate a panel of mAbdAbs that contained a common mAb

(Alemtuzumab) attached to a range of unique dAbs with amino acid mutations located typically within the CDR and specificity for the HEWL antigen. This was achieved in Chapter 3 through the use of two phage selection approaches (passive and soluble) to select for dAbs specific to the HEWL antigen from a phage library containing a population of 1011 potential binders. Four different framework libraries (VHS, VHM, VHL and VK) were used in independent selections to prevent framework bias during selection and to ensure a high degree of genetic diversity. The output from these selections were cloned into a vector containing

Alemtuzumab (Figures 3.9 and 3.10) and linkage between the mAb HC and the dAb was achieved by means of a proprietary peptide linker located within the vector as a fusion peptide at the C-terminus of the CH3 domain of Alemtuzumab, thus ensuring that variation between constructs was isolated to the dAb. This resulted in a panel of 50 mAbdAbs of unique sequence with 12-17% variation within the CDRs of the dAb, relating to a 2-4% variation across the whole mAbdAb construct (Table 3.3).

The next objective was to determine the expressibility of these mAbdAbs and to confirm the specificity of the dAbs towards the HEWL antigen used in selection in order to identify candidates for analysis of expression bottlenecks in the preferred expression platform (stably transfected CHO cells). HEK2936E cells were chosen for this study as they are capable of relatively high titres, a property that is partly facilitated by constitutive expression of the

EBNA-1 viral protein that drives plasmid replication (Section 1.4.1). Although CHO cells are now being developed as transient hosts following platform optimization (vector, medium, 256 process and cell line engineering) (Codamo et al. 2011, Daramola et al. 2014), a suitable CHO transient system was not available at the start of this project, therefore, HEK cells were chosen as a substitute. mAbdAb constructs exhibited a range of expression (0.2– 24.1μg/ml) in transiently transfected HEK2936E suspension cells, with none of the constructs able to exceed the titre observed in the Alemtuzumab control (26.6μg/ml) (Figure 4.1). Statistical analysis showed that the selection method (passive or soluble) or library (VHS, VHM, VHL or VK) used to generate mAbdAb constructs did not significantly affect expression titres in HEK transient cells (One-way ANOVA).

dAb specificity for the HEWL antigen was confirmed for 29 of the 50 mAbdAbs (Figure 4.1) using two methods based on different principles (binding ELISA and Biacore), indicating that phage display selection was successful in isolating HEWL-specific dAbs. Thus the second objective was achieved and a subset of 19 mAbdAbs, which exhibited a range of expression titres and contained HEWL-specific dAbs (with the exception of one construct, H012) were chosen for further analysis in the stable CHO system (Table 4.1).

There are no other publications specifically relating to the expression bottlenecks during mAbdAb synthesis as this is a novel molecule, and there is a general lack of published studies on novel antibody formats in terms of the molecular bottlenecks encountered in their expression. However expression titres obtained from novel format antibodies are generally lower than mAbs in mammalian platforms (Braren et al. 2007, Zhang et al. 2009, Diepenbruck et al. 2013, Jaeger et al. 2013).

257

6.3 Where is the bottleneck in mAbdAb expression in CHO cells?

The third objective of this project was to characterise the expression of mAbdAb sequence variants in stably transfected CHO cells in order to determine the limiting stage of mAbdAb expression. This was achieved in Chapter 4 through examination of mRNA and intracellular and extracellular protein. The range in titre observed in stable CHO pools (0-24μg/ml) was comparable to the titres observed in transient HEK cells (0.3-24μg/ml). Direct comparison of titres from specific constructs (Figure 4.5) showed that no significant difference in titre was observed for 6 constructs, however 13 constructs showed a significant difference (2 increased and 11 decreased) in the absolute expression titre between the two platforms in a two-tailed paired t-test (P =<0.05), indicating that the sequence of the dAb exerts more influence over mAbdAb titres than the expression system used. However, as all mAbdAb constructs expressed poorly compared to Alemtuzumab it is also conceivable that structural characteristics of the mAbdAb format are responsible for the generally poor titres achieved for this novel format antibody in both expression platforms, and that sequence variations in the dAb domain compound this effect. This could be investigated by using a common dAb, from a low- expressing construct identified in this Thesis (e.g. H092), attached to various high- expressing mAbs, and measuring the expression titre of each new construct. Alternatively, the effect of the dAb on expression could be investigated by creating a fusion protein whereby the proprietary linker and dAb domain from a poor-expressing mAbdAb is linked to the C-terminus of a readily expressed protein such as human growth hormone (hGh), or to a reporter protein such as firefly luciferase or GFP. However, as these fusion proteins would be distinctly different in structure from the mAbdAb, it may not be possible to draw a direct comparison to bottlenecks encountered during mAbdAb expression.

258

It was determined by RT-PCR analysis (Figure 4.6) that HC message was expressed in relative abundance in all cell lines, and as such the amount of HC mRNA was not limiting to expression. Furthermore, through studying the effect of sodium butyrate addition on mAbdAb expression (Section 5.2) it was evident that increasing the abundance of HC and LC mRNA did not yield mAb-like titres from mAbdAb constructs, which for example would have required up to a 30- fold increase in the H012-c construct. NaBu treatment also had no effect on a non-expressing construct (H092). At the protein level the majority of mAbdAb constructs exhibited low HC- dAb polypeptide abundance both intracellularly and in the medium (Figure

4.7). The common factor in poor mAbdAb expression was the lack on intracellular LC polypeptide in all but the control mAb and highest expressing mAbdAb (H014), and it was suggested that mAbdAb assembly could be the limiting stage in expression (Section 4.10). The role of intracellular LC availability could be studied initially by re-transfecting CHO cell lines with LC.

Protein folding is a crucial regulatory step in mAb synthesis, with a large number of publications identifying HC to LC assembly as the key bottleneck in expression, particularly with respect to mAb sequence variants (Leitzgen et al. 1997, Elkabetz et al. 2005, McLean et al. 2005, Mason et al. 2012,

Stoops et al. 2012, Pybus et al. 2014). There are two proposed routes for mAb assembly (Figure 6.1) in addition a third route has been proposed which combines these two pathways (Mead et al.2012).

However the mAbdAb HC is structurally different from that of the mAb HC and therefore it is feasible that a different folding mechanism may occur. Folding intermediates are stabilised by disulphide bonds between the variable domains, and as the mAbdAb HC contains an additional variable domain (VH or VK) it is conceivable that a number of unfavourable folding intermediates might occur (Figure 6.1), which may prevent the correct assembly of HC- dAb to LC.

259

Figure 6.1 Proposed mechanisms for mAb assembly and potential misfolding of mAbdAb structures. There are two proposed mechanisms for mAb assembly, the first operates via a HC2 intermediate (A) and the second operates via a HCLC intermediate (B). Adapted from

(O'Callaghan, McLeod et al. 2010) and (McLeod, O'Callaghan et al. 2011). The expected mAbdAb structure (C) may fold by a similar mechanism, or unfavourable interactions could occur whereby a VH dAb may assemble with the VH of Alemtuzumab (D), or the LC may assemble with the dAb

(E) or self-assembly may occur between the VH of Alemtuzumab with the dAb (F). Key to Figure: variable heavy ( ), variable light ( ), constant heavy ( ), constant light ( ), dAb ( ), hinge region ( ). Dashed lines represent interaction by disulphide bond formation. 260

In studies where assembly is cited as the bottleneck in mAb synthesis intracellular retention of HC is generally observed, and this was not the case in the majority of mAbdAbs studied here, which showed very little intracellular HC-dAb polypeptide. One functional consequence of poor assembly could be UPR activation and subsequent degradation of the HC polypeptide through ERAD. The role of proteolytic degradation in CHO cells was examined using chemical inhibitors with the potential to inhibit lysosomal and proteasomal degradation pathways

(Section 4.5), however it was concluded that although degradation may play a role in mAbdAb expression, either the correct pathway had not been efficiently targeted or that degradation was not the major limiting factor. Degradation could be further studied by treating cells with cycloheximide, which inhibits translation, followed by taking intracellular protein samples over a time-course for use in western blot analysis. Conventional pulse-chase methodology could be used, however as the radiolabelled amino acids used for this experiment would equally be incorporated into host proteins therefore immunoprecipitation could be employed to isolate the HC-dAb polypeptide prior to SDS-PAGE analysis.

Collectively, these results suggest that the major bottleneck in expression arises from how the cell utilises the HC mRNA, as the LC polypeptide was readily expressed into the culture medium. There are a number of other factors associated with mRNA which can affect expression titres (Section 1.5.2) which were not explored in the scope of this Thesis. These factors include mRNA processing, secondary structure, nuclear export to the cytoplasm and the formation of stress granules in the cytoplasm that sequester mRNA.

An uncoupled in vitro transcription/translation system was used to investigate the role of transcription and translation in two exemplar mAbdAb constructs (H014 and H092) that

261 exhibited consistently high or low expression respectively in both HEK transient and CHO stable expression, with simultaneous comparison to the Alemtuzumab control (Section 4.6).

Both mAbdAb constructs were readily expressed in cell-free lysates (Figure 4.10), which may indicate that, contrary to the above statement, translation is not the major bottleneck in mAbdAb expression. However, there are a number of differences between the host cell and in vitro systems that might contribute to this observation and implicate post-transcriptional regulation and translation in poor expression.

Firstly, cell-free translations were performed using mRNA transcripts that were synthesised in vitro using a T7 RNA polymerase. This is a highly-defined system consisting solely of the components necessary for reverse-transcription of the DNA template to mRNA, namely T7

RNA polymerase and ribonucleotides. As a result, certain post-translational modifications are not replicated in this system. Polyadenylation of the mRNA transcript will still occur, as this is encoded in the bovine growth hormone (BGH) polyA sequence, which lies at the 3’ end of the transcriptional unit and is therefore transcribed by the T7 RNA polymerase. However mRNA splicing and 5’ capping does not occur in vitro, as this is mediated in host cells by the spliceosome (Will and Luhrmann 2011, Cvitkovic and Jurica 2013) and capping enzymes

(Schroeder et al. 2000) respectively, none of which were present in the in vitro transcription reaction.

In production of biopharmaceuticals there is some evidence that cryptic splice sites may occur within the coding sequence of recombinant mRNA, which results in poor expression titres in

CHO cells (Bukovac et al. 2008, Wijesuriya et al. 2013). As the primers for RT- PCR analysis in

262 this project were designed at the 5’ end of the HC gene to ensure detection it was not possible to determine whether splicing at cryptic sites had occurred in the CHO host. Given that the mAb construct (Alemtuzumab) was expressed to a relatively high titre in stable CHO pools, it would be reasonable to assume that any cryptic mRNA splice sites would be localised within the dAb sequence, as this is the only variation between constructs.

There are several methods that could be employed to ascertain the length of the HC mRNA transcript. In the first instance this could be studied by DNA sequencing of cDNA transcripts, which would indicate the length of the HC transcript, however this technique would not provide information as to the extent of splicing (i.e. what percentage of HC transcripts are spliced). Northern blotting of total RNA is another technique that could be applied to study splice variants, by using a gene-specific cDNA probe designed to hybridise with the BGH polyadenylation sequence, which lies downstream of the dAb and is consistent in all the mAbdAb constructs. These results could be validated by RT-PCR analysis through designing the reverse primer at the same location as the cDNA probe, and when combined with semi- quantitation by densitometric band analysis, could also be used to assess the extent of HC splicing. Rapid Amplification of cDNA Ends (RACE) could also be used to determine the length of the transcript (Wijesuriya et al. 2013). Alternatively, using nuclear extracts from cultured cells to perform in vitro transcription has been developed to study mRNA processing in vitro

(Folco and Reed 2014, Webb and Hertel 2014). Nuclear extracts could be derived from CHO cells and used either to transcribe the DNA template directly or to process mRNA transcripts derived from the in vitro transcription system above. The resulting mRNA transcripts could then be visualised by northern blotting to detect potential splice variants, or used in cell-free translations to determine whether translation occurs.

263

Secondly, in cell-free translations in vitro mRNA transcripts were added directly to the ribosomes, meaning that mRNA export does not influence in vitro translations. One of the consequences of incorrect splicing can be localization of the mRNA in the nucleus, meaning that mRNA will not associate with ribosomes and thus preventing protein synthesis. In cellular expression the mRNA cap is also involved in mRNA export and in translation initiation. mRNA localization could be performed through cell fractionation to separate the nucleus from the cytoplasm and RNA extracted for RT-PCR or northern blotting. This could also be performed on fixed cells by in situ hybridisation (ISH) using gene-specific RNA probes conjugated to a fluorophore, an antibody or biotin and visualised by microscopy. Although live cell mRNA localisation is also possible (Yoshimura et al. 2012) this type of visualisation may be challenging in suspension cells.

If nuclear localisation of HC mRNA was determined as the limiting factor in mAbdAb synthesis a constitutive transport element (CTE) could be used to increase mRNA export into the cytoplasm in host cell systems. CTE is a cis-acting element derived from type D simian retroviruses that can be included in the expression cassette of recombinant genes and it recruits the heterodimeric Tap-p15 nucleocytoplasmic export receptor directly to the mRNA

(Teplova et al. 2011). This approach has been used successfully in human cell lines expressing the luciferase reporter, SEAP or EPO (Aihara et al. 2011) and titres were enhanced further with co-expression of the Tap-p15 protein. However Aihara et al., (2011) observed that the

CTE element had a negative effect on expression titres in hamster cell lines (CHO and BHK), and it was suggested that a simian-derived CTE might not be recognised by the hamster Tap protein. However this could be overcome by engineering a CHO cell to overexpress the human Tap-p15 protein or generating a new CTE based on retroviruses capable of infecting hamsters.

264

Translation initiation (Section 1.5.3) is often considered to be the rate-limiting step in translation and is a process that can be influenced by the secondary structure of mRNA, particularly local structures around the start codon (Zhang et al. 2005, Babendure et al. 2006,

Bai et al. 2014). Examination of mRNA structure was performed on the dAb domains of mAbdAbs (Figure A4.1) and the predicted minimum free energy (∆ G) showed a mild correlation with both HEK and CHO expression titres when compared with the predicted free energy required to fold the Alemtuzumab VH or VL domain (for VH and VK dAbs respectively)

(Figure A4.2). As all mAbdAb constructs contained the same mAb, mRNA structure analysis was limited to the dAb domain, which is at the 3’ end of the mRNA transcript. As a consequence these results do not report on the mRNA structure near the start codon.

However, it is conceivable that interactions between the 3’ and 5’ ends of mAbdAb mRNA may occur, thus influencing local structure around the start codon. Cell free translations would also be influenced by mRNA structure, however the transcript differs at the 5’UTR as it does not contain a 5’ cap, which might influence the mRNA structure and the type of translation initiation.

In eukaryotes translation initiation can occur in either a cap-dependent or cap-independent manner, however the former is considered to be more efficient (Merrick 2004, Malys and

McCarthy 2011). In the cell-free system translation must have been initiated in a cap- independent manner, whilst in host cells expression was likely to occur in a cap-dependent manner. Inclusion of an IRES element at the 5’ end of the HC mRNA transcript could be added to constructs for host cell expression as this cis-acting element precludes the need for cap- dependent synthesis through mediating direct interaction with the 40s ribosomal subunit

(Komar and Hatzoglou 2011). Conversely, cap-dependent synthesis could be studied in vitro 265 through the use of nuclear extracts or inclusion of methyl transferases in the transcription reaction (Grudzien et al. 2004).

The HC mRNA transcript could also be sequestered in the cytoplasm at stress granules, which may form as a result of cellular stress or pausing of the ribosome if the mRNA was perceived as aberrant. This effect has been studied extensively in yeast in response to nutrient starvation (Pizzinga and Ashe 2014) and has been shown in COS-7 cells in response to extreme hypothermia (below 10oC) (Hofmann et al. 2012) but has yet to be established in

CHO cells. However the sequestration of HC mRNA in stress granules (SGs) could explain both the low abundance of HC-dAb polypeptide and poor expression titres. Stress granules could be visualised in CHO cells through combined application of in situ hybridisation (ISH) using a fluorescently-tagged cDNA probe specific to the HC mRNA and immunocytochemistry using antibodies specific for proteins such as the 40s subunit and eIF2α, which are also present in

SGs (Buchan and Parker 2009). As SG formation is often associated with cap-dependent synthesis due to the presence of initiation factors such a polyA binding protein (PABP) in SGs it is conceivable that IRES-mediated translation of the HC transcript could be used to circumvent SG formation if this was determined as the cause for poor mAbdAb expression.

6.4 How can mAbdAb expression be improved?

The final objective of this Thesis was to determine whether industrially relevant optimization techniques can be used to improve mAbdAb expression titres. This was examined in Chapter 5 through the investigation of three commonly-used process optimization techniques; NaBu

266 treatment, culture under mildly hypothermic conditions and DMSO addition. Improvements in mAbdAb expression were found to be both process and sequence dependent (Table 5.1).

However, as none of these approaches were able to elicit mAb-like titres it was concluded that process optimization techniques that modulate the cell culture environment have a limited ability to improve mAbdAb expressibility, and that higher titres can only be achieved through targeting the bottleneck in mAbdAb expression.

In the previous Section a number of strategies were highlighted that could be used to overcome potential bottlenecks in the export and translation of the HC mRNA transcript.

These could be employed as part of a platform optimization strategy, which could be more effective than using single process optimization techniques in isolation. The expression vector could be optimised through inclusion of both a CTE and IRES element in the transcriptional unit to mediate mRNA export and translation initiation. Furthermore, both the HC and LC genes could be encoded on a single multicistronic mRNA transcript under the control of a single promoter (Figure 6.2) with the LC positioned in the first cistron and HC translation initiated through the IRES element. Positioning the LC in the first cistron has previously been shown to improve mAb titres by improving the availability of LC polypeptide for correct assembly (Ho et al. 2012, Ho et al. 2013) and could therefore be used in mAbdAb synthesis to overcome potential bottlenecks arising downstream of translation related to protein folding.

An IRES element may also help overcome the formation of stress granules caused by pausing during cap-dependent translation initiation.

The new vector construct could be combined with a genetically engineered host cell line with enhanced mRNA export and protein folding capacity. Overexpression of the human Tap-p15 267 mRNA export protein would facilitate export using an existing CTE element if using a CHO cell line, however a HEK cell line could be used in conjunction with current CTE elements. The formation of stress granules has been associated with phosphorylation of the eIF2α initiation factor, therefore overexpression of an eIF2α factor that has a mutated phosphorylation site could be used to circumvent this bottleneck, but may have to be used in conjunction with an apoptotic resistant CHO cell line as eIF2α phosphorylation is essential to cellular homeostasis and in preventing the intracellular accumulation of cytotoxic proteins. Overexpression of ER proteins such as XBP-1 and Ero1-lα has been used previously to increase the folding capacity

Figure 6.2. Schematic representation of optimised mAbdAb transcriptional unit. A single transcriptional unit consisting of the promoter, light chain gene (LC) and heavy chain-dAb gene (HC, dAb). The BGH (bovine growth hormone) polyadenylation sequence would confer mRNA stability, whilst the CTE (constitutive transport element) would mediate mRNA export. Translation of the HC gene would operate under the control of the IRES (internal ribosomal entry site) element.

CHO cells and resulted in up to a 6.1-fold increase in mAb expression (Cain et al. 2013), and could be employed in either HEK or CHO host cells. These platform optimizations could then be employed alongside the process optimizations investigated in this Thesis to further improve mAbdAb titres.

268

Alternatively, in-vitro translation using cell-free extracts offers an attractive method for mAbdAb expression, as bottlenecks arise from how the cell processes an engineered antibody. Cellular quality control processes are not replicated within the simple translational machinery contained within cell-free lysates and as such translation can proceed without these constraints and it precludes the need for lengthy cell line generation. However, commercially available lysate systems are relatively expensive and do not match the high expression titres of mammalian cell lines. CHO cell lysates can be generated in the lab from

CHO cell culture (Brodel et al. 2014) and expression titres up to 1g/L have recently been reported for scFv and IgG antibodies in a scalable E.coli cell lysate system (Yin et al. 2012).

Furthermore, it is possible to include chaperones involved in folding and disulphide bond formation in the cell free system (Shimizu et al. 2005) so that fully folded and post- translationally modified proteins can be translated. However further optimization of cell free extracts in terms of scalability, lot to lot variation and regulatory approval must first be addressed before this expression system can be used for industrial applications (Carlson et al.

2012, Casteleijn et al. 2013).

6.5 Concluding remarks

In conclusion, this work has provided valuable insight into the bottlenecks encountered during mAbdAb synthesis in stable CHO cells, which have not be studied previously. It has been demonstrated that variations in amino acid sequence within the CDRs of the dAb domain can affect mAbdAb expression titres in both transient HEK and stable CHO cells, however as all mAbdAb constructs express poorly compared to the mAb control it has been suggested that the mAbdAb structure may exert more influence over their expressibility than sequence

269 variations contained within the dAb domain. Analysis of discrete stages of mAbdAb expression in stable CHO cells has implicated inefficient usage of mAbdAb HC mRNA as the key factor influencing their expressibility in this system. Future research should focus on the precise molecular mechanisms that governs this observation as a basis for optimizing mAbdAb expression. To this end, specific experimental procedures have been suggested during the course of this discussion that might help to elucidate these mechanisms and improve mAbdAb expression.

270

REFERENCES

Aihara, Y., N. Fujiwara, T. Yamazaki, T. Kambe, M. Nagao, Y. Hirose and S. Masuda (2011). "Enhancing recombinant protein production in human cell lines with a constitutive transport element and mRNA export proteins." Journal of Biotechnology 153(3-4): 86-91. Al-Fageeh, M. B., R. J. Marchant, M. J. Carden and C. M. Smales (2006). "The cold-shock response in cultured mammalian cells: Harnessing the response for the improvement of recombinant protein production." Biotechnology and Bioengineering 93(5): 829-835. Ali, M., K. Hitomi and H. Nakano (2006). "Generation of monoclonal antibodies using simplified single-cell reverse transcription-polymerase chain reaction and cell-free protein synthesis." Journal of Bioscience and Bioengineering 101(3): 284-286. Altamirano, C., J. Berrios, M. Vergara and S. Becerra (2013). "Advances in improving mammalian cells metabolism for recombinant protein production." Electronic Journal of Biotechnology 16(3). Anderson, P. and N. Kedersha (2006). "RNA granules." Journal of Cell Biology 172(6): 803-808. Aoyagi, T., S. Miyata, M. Nanbo, F. Kojima, Matsuzak.M, M. Ishizuka, T. Takeuchi and H. Umezawa (1969). "Biological activities of leupeptins." Journal of Antibiotics 22(11): 558. Arap, M. A. (2005). "Phage display technology - Applications and innovations." Genetics and Molecular Biology 28(1): 1-9. Arnaud-Barbe, N., V. Cheynet-Sauvion, G. Oriol, B. Mandrand and F. Mallet (1998). "Transcription of RNA templates by T7 RNA polymerase." Nucleic Acids Research 26(15): 3550- 3554. Azzazy, H. M. E. and W. E. Highsmith (2002). "Phage display technology: clinical applications and recent innovations." Clinical Biochemistry 35(6): 425-445. Babendure, J. R., J. L. Babendure, J. H. Ding and R. Y. Tsien (2006). "Control of mammalian translation by mRNA structure near caps." Rna-a Publication of the Rna Society 12(5): 851-861. Backliwal, G., M. Hildinger, I. Kuettel, F. Delegrange, D. L. Hacker and F. M. Wurm (2008). "Valproic acid: A viable alternative to sodium butyrate for enhancing protein expression in mammalian cell cultures." Biotechnology and Bioengineering 101(1): 182-189. Baek, H., K. H. Suk, Y. H. Kim and S. Cha (2002). "An improved helper phage system for efficient isolation of specific antibody molecules in phage display." Nucleic Acids Research 30(5). Bai, C., X. Wang, J. Zhang, A. Sun, D. Wei and S. Yang (2014). "Optimization of the mRNA secondary structure to improve the expression of interleukin-24 (IL-24) in Escherichia coli." Biotechnology letters 36(8): 1711-1716. Baici, A. and M. Gygermarazzi (1982). "The slow, tight-binding inhibition of cathepsin-b by leupeptin - a hysteretic effect." European Journal of Biochemistry 129(1): 33-41. Bailey, L. A., D. Hatton, R. Field and A. J. Dickson (2012). "Determination of Chinese hamster ovary cell line stability and recombinant antibody expression during long-term culture." Biotechnology and Bioengineering 109(8). Barnes, L. M., C. M. Bentley and A. J. Dickson (2001). "Characterization of the stability of recombinant protein production in the GS-NS0 expression system." Biotechnology and Bioengineering 73(4): 261-270. Barrett, A. J. and J. T. Dingle (1972). "Inhibition of tissue acid proteinases by pepstatin." Biochemical Journal 127(2): 439-&. Bause, E. and H. Hettkamp (1979). "Primary structural requirements for N-glycosylation of peptides in rat-liver." Febs Letters 108(2): 341-344. 271

Bebbington, C. R., G. Renner, S. Thomson, D. King, D. Abrams and G. T. Yarranton (1992). "High- level expression of a recombinant antibody from myeloma cells using a glutamine- synthetase gene as an amplifiable selectable marker." Bio-Technology 10(2): 169-175. Bendikov-Bar, I. and M. Horowitz (2012). "Gaucher Disease Paradigm: From ERAD to Comorbidity." Human Mutation 33(10): 1398-1407. Bhoskar, P., B. Belongia, R. Smith, S. Yoon, T. Carter and J. Xu (2013). "Free Light Chain Content in Culture Media Reflects Recombinant Monoclonal Antibody Productivity and Quality." Biotechnology Progress 29(5): 1131-1139. Bi, J. X., J. Shuttleworth and M. Ai-Rubeai (2004). "Uncoupling of cell growth and proliferation results in enhancement of productivity in p21(C1P1)-arrested CHO cells." Biotechnology and Bioengineering 85(7): 741-749. Blanc, C., M. Zufferey and P. Cosson (2014). "Use of In Vivo Biotinylated GST Fusion Proteins to Select Recombinant Antibodies." Altex-Alternatives to Animal Experimentation 31(1): 37-42. Boder, E. T., M. Raeeszadeh-Sarmazdeh and J. V. Price (2012). "Engineering antibodies by yeast display." Archives of Biochemistry and Biophysics 526(2): 99-106. Borth, N., D. Mattanovich, R. Kunert and H. Katinger (2005). "Effect of increased expression of protein disulfide isomerase and heavy chain binding protein on antibody secretion in a recombinant CHO cell line." Biotechnology Progress 21(1): 106-111. Braren, I., K. Greunke, O. Umland, S. Deckers, R. Bredehorst and E. Spillner (2007). Comparative expression of different antibody formats in mammalian cells and Pichia pastoris. Brix, K. and P. Saftig (2005). "Lysosomal proteases: Revival of the sleeping beauty." Medical Intelligence Unit: 50-59. Brodel, A. K., A. Sonnabend and S. Kubick (2014). "Cell-free protein expression based on extracts from CHO cells." Biotechnology and bioengineering 111(1): 25-36. Brown, A. J., B. Sweeney, D. O. Mainwaring and D. C. James (2014). "Synthetic promoters for CHO cell engineering." Biotechnology and bioengineering 111(8): 1638-1647. Brown, M. E., G. Renner, R. P. Field and T. Hassell (1992). "Process-development for the production of recombinant antibodies using the glutamine-synthetase (GS) system." Cytotechnology 9(1-3): 231-236. Buchan, J. R. and R. Parker (2009). "Eukaryotic Stress Granules: The Ins and Outs of Translation." Molecular Cell 36(6): 932-941. Bukovac, S. W., R. D. Bagshaw, B. A. Rigat, J. W. Callahan, J. T. R. Clarke and D. J. Mahuran (2008). "Cryptic splice site in the complementary DNA of glucocerebrosidase causes inefficient expression." Analytical Biochemistry 381(2): 276-278. Burset, M., I. A. Seledtsov and V. V. Solovyev (2000). "Analysis of canonical and non-canonical splice sites in mammalian genomes." Nucleic Acids Research 28(21): 4364-4375. Butler, M. (2005). "Animal cell cultures: recent achievements and perspectives in the production of biopharmaceuticals." Applied Microbiology and Biotechnology 68(3): 283- 291. Butler, M. and A. Meneses-Acosta (2012). "Recent advances in technology supporting biopharmaceutical production from mammalian cells." Applied Microbiology and Biotechnology 96(4): 885-894. Cabilly, S. (1999). "The basic structure of filamentous phage and its use in the display of combinatorial peptide libraries." Molecular Biotechnology 12(2): 143-148. Cain, K., S. Peters, H. Hailu, B. Sweeney, P. Stephens, J. Heads, K. Sarkar, A. Ventom, C. Page and A. Dickson (2013). "A CHO cell line engineered to express XBP1 and ERO1-L has increased levels of transient protein expression." Biotechnology Progress 29(3): 697-706. Carlson, E., N. Bays, L. David and W. R. Skach (2005). "Reticulocyte lysate as a model system to study endoplasmic reticulum membrane protein degradation." Methods in Molecular Biology 301: 185-205.

272

Carlson, E. D., R. Gan, C. E. Hodgman and M. C. Jewett (2012). "Cell-free protein synthesis: Applications come of age." Biotechnology Advances 30(5): 1185-1194. Carter, P. (2006). "Potent Antibody Therapeutics by Design." Nature Reviews Immunology 6: 343-357. Casteleijn, M. G., A. Urtti and S. Sarkhel (2013). "Expression without boundaries: Cell-free protein synthesis in pharmaceutical research." International Journal of Pharmaceutics 440(1): 39-47. Castino, R., D. Pace, M. Demoz, M. Gargiulo, C. Ariatta, E. Raiteri and C. Isidoro (2002). "Lysosomal proteases as potential targets for the induction of apoptotic cell death in human neuroblastomas." International Journal of Cancer 97(6): 775-779. Cecilia, A., A. Roque and M. A. Taipa (2004). "Antibodies and genetically engineered related molecules: Production and purification." Biotechnology Progress 20(3): 639-654. Chames, P. and D. Baty (2010). Antibody Engineering. Chen, F., T. Kou, L. Fan, Y. Zhou, Z. Ye, L. Zhao and W.-S. Tan (2011). "The combined effect of sodium butyrate and low culture temperature on the production, sialylation, and biological activity of an antibody produced in CHO cells." Biotechnology and Bioprocess Engineering 16(6): 1157-1165. Chen, Z. Q. and Y. Zhang (2005). "Dimethyl sulfoxide targets phage RNA polymerases to promote transcription." Biochemical and Biophysical Research Communications 333(3): 664-670. Chusainow, J., Y. S. Yang, Y. H. M. Yeo, P. C. Toh, P. Asvadi, N. S. C. Wong and M. G. S. Yap (2009). "A Study of Monoclonal Antibody-Producing CHO Cell Lines: What Makes a Stable High Producer?" Biotechnology and Bioengineering 102(4): 1182-1196. Clincke, M.-F., C. Molleryd, Y. Zhang, E. Lindskog, K. Walsh and V. Chotteau (2013). "Very high density of CHO cells in perfusion by ATF or TFF in WAVE bioreactor. Part I. Effect of the cell density on the process." Biotechnology Progress 29(3): 754-767. Codamo, J., T. P. Munro, B. S. Hughes, M. Song and P. P. Gray (2011). "Enhanced CHO Cell- Based Transient Gene Expression with the Epi-CHO Expression System." Molecular Biotechnology 48(2): 109-115. Coles, A., A. Compston, K. Selmaj, S. Lake, S. Moran, D. Margolin, K. Norris and P. Tandon (2008). "Alemtuzumab vs. Interferon Beta-1a in Early Multiple Sclerosis." New England Journal of Medicine 359: 1786-1801. Combs, R. G., E. Yu, S. Roe, M. B. Piatchek, H. L. Jones, J. Mott, M. L. Kennard, D. L. Goosney and D. Monteith (2011). "Fed-Batch Bioreactor Performance and Cell Line Stability Evaluation of the Artificial Chromosome Expression Technology Expressing an IgG1 in Chinese Hamster Ovary Cells." Biotechnology Progress 27(1): 201-208. Comyn, S. A., G. T. Chan and T. Mayor (2014). "False start: Cotranslational protein ubiquitination and cytosolic protein quality control." Journal of Proteomics 100: 92-101. Conaway, R. C., S. Sato, C. Tomomori-Sato, T. T. Yao and J. W. Conaway (2005). "The mammalian Mediator complex and its role in transcriptional regulation." Trends in Biochemical Sciences 30(5): 250-255. Coomber, D. W. J. (2002). "Panning of antibody phage-display libraries." Methods in Molecular Biology. Antibody phage display: Methods and protocols 178: 133-145. Corcos, D., M. J. Osborn, L. S. Matheson, F. Santos, X. Zou, J. A. Smith, G. Morgan, A. Hutchings, M. Hamon, D. Oxley and M. Brueggemann (2010). "Immunoglobulin aggregation leading to Russell body formation is prevented by the antibody light chain." Blood 115(2): 282-288. Croset, A., L. Delafosse, J.-P. Gaudry, C. Arod, L. Glez, C. Losberger, D. Begue, A. Krstanovic, F. Robert, F. Vilbois, L. Chevalet and B. Antonsson (2012). "Differences in the glycosylation of recombinant proteins expressed in HEK and CHO cells." Journal of biotechnology 161(3). Crusselle-Davis, V. J., Z. Zhou, A. Anantharaman, B. Moghimi, T. Dodev, S. Huang and J. Bungert (2007). "Recruitment of coregulator complexes to the beta-globin gene locus by TFII-I and upstream stimulatory factor." Febs Journal 274: 6065-6073.

273

Cvitkovic, I. and M. S. Jurica (2013). "Spliceosome Database: a tool for tracking components of the spliceosome." Nucleic Acids Research 41(D1): D132-D141. Daramola, O., J. Stevenson, G. Dean, D. Hatton, G. Pettman, W. Holmes and R. Field (2014). "A High-Yielding CHO Transient System: Coexpression of Genes Encoding EBNA-1 and GS Enhances Transient Protein Expression." Biotechnology Progress 30(1): 132-141. Davies, J. and M. Reff (2001). "Chromosome localization and gene-copy-number quantification of three random integrations in Chinese-hamster ovary cells and their amplified cell lines using fluorescence in situ hybridization." Biotechnology and Applied Biochemistry 33: 99-105. Davis, R., K. Schooley, B. Rasmussen, J. Thomas and P. Reddy (2000). "Effect of PDI overexpression on recombinant protein secretion in CHO cells." Biotechnology Progress 16(5): 736-743. Dean, A. (2006). "On a chromosome far, far away: LCRs and gene expression." Trends in Genetics 22(1): 38-45. Derouazi, M., D. Martinet, N. B. Schmutz, R. Flaction, M. Wicht, M. Bertschinger, D. L. Hacker, J. S. Beckmann and F. M. Wurm (2006). "Genetic characterization of CHO production host DG44 and derivative recombinant cell lines." Biochemical and Biophysical Research Communications 340(4): 1069-1077. Diepenbruck, C., M. Klinger, T. Urbig, P. Baeuerle and R. Neef (2013). "Productivity and Quality of Recombinant Proteins Produced by Stable CHO Cell Clones can be predicted by Transient Expression in HEK Cells." Molecular Biotechnology 54(2): 497-503. Dillman, R. O. (2009). Principles of Cancer Biotherapy, Springer. Dingermann, T. (2008). "Recombinant therapeutic proteins: Production platforms and challenges." Biotechnology Journal 3(1): 90-97. Dorai, H., Y. S. Kyung, D. Ellis, C. Kinney, C. Lin, D. Jan, G. Moore and M. J. Betenbaugh (2009). "Expression of Anti-Apoptosis Genes Alters Lactate Metabolism of Chinese Hamster Ovary Cells in Culture." Biotechnology and Bioengineering 103(3). Dresios, J., A. Aschrafi, G. C. Owens, P. W. Vanderklish, G. M. Edelman and V. P. Mauro (2005). "Cold stress-induced protein Rbm3 binds 60S ribosomal subunits, alters rnicroRNA levels, and enhances global protein synthesis." Proceedings of the National Academy of Sciences of the United States of America 102(6): 1865-1870. Du, Z., D. Treiber, R. E. McCoy, A. K. Miller, M. Han, F. He, S. Domnitz, C. Heath and P. Reddy (2013). "Non-invasive UPR monitoring system and its applications in CHO production cultures." Biotechnology and Bioengineering 110(8): 2184-2194. Dul, J. L. and Y. Argon (1990). "A single amino-acid substitution in the variable region of the light chain specifically blocks immunoglobulin secretion." Proceedings of the National Academy of Sciences of the United States of America 87(20). Dul, J. L., S. Aviel, J. Melnick and Y. Argon (1996). "Ig light chains are secreted predominantly as monomers." Journal of Immunology 157(7): 2969-2975. Edholm, E.-S., E. Bengten and M. Wilson (2011). "Insights into the function of IgD." Developmental and Comparative Immunology 35(12): 1309-1316. Elkabetz, Y., Y. Argon and S. Bar-Nun (2005). "Cysteines in CH1 underlie retention of unassembled ig heavy chains." Journal of Biological Chemistry 280(15). Eskelinen, E.-L. And P. Saftig (2009). "Autophagy: A lysosomal degradation pathway with a central role in health and disease." Biochimica ET Biophysica Acta-Molecular Cell Research 1793(4): 664-673. Evsyukova, I., J. A. Somarelli, S. G. Gregory and M. A. Garcia-Blanco (2010). "Alternative splicing in multiple sclerosis and other autoimmune diseases." RNA Biology 7(4): 462-473.

274

Feng, Y. Q., J. Seibler, R. Alami, A. Eisen, K. A. Westerman, P. Leboulch, S. Fiering and E. E. Bouhassira (1999). "Site-specific chromosomal integration in mammalian cells: Highly efficient CRE recombinase-mediated cassette exchange." Journal of Molecular Biology 292(4): 779-785. Fenteany, G. and S. L. Schreiber (1998). "Lactacystin, proteasome function, and cell fate." Journal of Biological Chemistry 273(15): 8545-8548. Ferrer-Miralles, N., J. Domingo-Espin, J. L. Corchero, E. Vazquez and A. Villaverde (2009). "Microbial factories for recombinant pharmaceuticals." Microbial Cell Factories 8. Finlay, W. J. J. and J. C. Almagro (2012). "Natural and man-made V-gene repertoires for antibody discovery." Frontiers in immunology 3: 342-342. Fiore, M., R. Zanier and F. Degrassi (2002). "Reversible G (1) arrest by dimethyl sulfoxide as a new method to synchronize Chinese hamster cells." Mutagenesis 17(5): 419-424. Florin, L., C. Lipske, E. Becker and H. Kaufmann (2011). "Supplementation of serum free media with HT is not sufficient to restore growth properties of DHFR-/- cells in fed-batch process - Implications of novel CHO-based expression platforms." Journal of Biotechnology 152: 189- 193. Florin, L., A. Pegel, E. Becker, A. Hausser, M. A. Olayioye and H. Kaufmann (2009). "Heterologous expression of the lipid transfer protein CERT increases therapeutic protein productivity of mammalian cells." Journal of Biotechnology 141(1-2): 84-90. Folco, E. G. and R. Reed (2014). In vitro Systems for Coupling RNAP II Transcription to Splicing and Polyadenylation. Spliceosomal Pre-mRNA Splicing: Methods and Protocols. K. J. Hertel.1126: 169-177. Fox, S. R., H. K. Tan, M. C. Tan, S. Wong, M. G. S. Yap and D. I. C. Wang (2005). "A detailed understanding of the enhanced hypothermic productivity of interferon-gamma by Chinese- hamster ovary cells." Biotechnology and Applied Biochemistry 41: 255-264. Fujita, E., Y. Kouroku, A. Isoai, H. Kumagai, A. Misutani, C. Matsuda, Y. K. Hayashi and T. Momoi (2007). "Two endoplasmic reticulum-associated degradation (ERAD) systems for the novel variant of the mutant dysferlin: ubiquitin/proteasome ERAD(I) and autophagy/lysosome ERAD(II)." Human Molecular Genetics 16(6): 618-629. Fujita, J. (1999). "Cold shock response in mammalian cells." Journal of Molecular Microbiology and Biotechnology 1(2): 243-255. Geyer, C. R., J. McCafferty, S. Dubel, A. R. M. Bradbury and S. S. Sidhu (2012). "Recombinant antibodies and in vitro selection technologies." Methods in molecular biology (Clifton, N.J.) 901: 11-32. Geyer, P. K. (1997). "The role of insulator elements in defining domains of gene expression." Current Opinion in Genetics & Development 7(2): 242-248. Goldberg, A. L. (2013). "Development of proteasome inhibitors as research tools and cancer drugs." Journal of Cell Biology: 91-96. Gomez, N., J. Subramanian, J. Ouyang, M. D. H. Nguyen, M. Hutchinson, V. K. Sharma, A. A. Lin and I. H. Yuk (2012). "Culture temperature modulates aggregation of recombinant antibody in CHO cells." Biotechnology and Bioengineering 109(1). Graham, F. L., J. Smiley, W. C. Russell and R. Nairn (1977). "Characteristics of a human cell line transformed by DNA from human adenovirus type-5." Journal of General Virology 36(JUL): 59- 72. Grudzien, E., J. Stepinski, M. Jankowska-Anyszka, R. Stolarski, E. Darzynkiewicz and R. E. Rhoads (2004). "Novel cap analogs for in vitro synthesis of mRNAs with high translational efficiency." RNA-a Publication of the RNA Society 10(9): 1479-1487. Guo, N. and Z. Peng (2013). "MG132, a proteasome inhibitor, induces apoptosis in tumor cells." Asia-Pacific Journal of Clinical Oncology 9(1): 6-11. Gustafsson, C., S. Govindarajan and J. Minshull (2004). "Codon bias and heterologous protein expression." Trends in Biotechnology 22(7): 346-353.

275

Hahn, S. (1998). "Activation and the role of reinitiation in the control of transcription by RNA polymerase II." Cold Spring Harbor Symposia on Quantitative Biology 63: 181-188. Hammond, C., I. Braakman and A. Helenius (1994). "Role of N-linked oligosaccharide recognition, glucose trimming, and calnexin in glycoprotein folding and quality-control." Proceedings of the National Academy of Sciences of the United States of America 91(3): 913-917. Hammond, S., M. Kaplarevic, N. Borth, M. J. Betenbaugh and K. H. Lee (2012). "Chinese hamster genome database: An online resource for the CHO community at www.CHOgenome.org." Biotechnology and Bioengineering 109(6): 1353-1356. Hammond, S., J. C. Swanberg, M. Kaplarevic and K. H. Lee (2011). "Genomic sequencing and analysis of a Chinese hamster ovary cell line using Illumina sequencing technology." Bmc Genomics 12. Haredy, A. M., A. Nishizawa, K. Honda, T. Ohya, H. Ohtake and T. Omasa (2013). "Improved antibody production in Chinese hamster ovary cells by ATF4 overexpression." Cytotechnology 65(6): 993-1002. Harvey, D. J. (2005). "Proteomic analysis of glycosylation: structural determination of N- and O- linked glycans by mass spectrometry." Expert Review of Proteomics 2(1): 87-101. He, M. Y. and F. Khan (2005). "Ribosome display: next-generation display technologies for production of antibodies in vitro." Expert Review of Proteomics 2(3): 421-430. Heinis, C., A. Huber, S. Demartis, J. Bertschinger, S. Melkko, L. Lozzi, P. Neri and D. Neri (2001). "Selection of catalytically active biotin ligase and trypsin mutants by phage display." Protein Engineering 14(12): 1043-1052. Heinrichs, M. (2008). "Where Generics and Biologics Meet." Generic Drug Trends 1(5). Hellwig, S., J. Drossard, R. M. Twyman and R. Fischer (2004). "Plant cell cultures for the production of recombinant proteins." Nature Biotechnology 22(11): 1415-1422. Hino, M., M. Kataoka, K. Kajimoto, T. Yamamoto, J.-I. Kido, Y. Shinohara and Y. Baba (2008). "Efficiency of cell-free protein synthesis based on a crude cell extract from Escherichia coli, wheat germ, and rabbit reticulocytes." Journal of Biotechnology 133(2): 183-189. Ho, S. C. L., M. Bardor, H. Feng, Mariati, Y. W. Tong, Z. Song, M. G. S. Yap and Y. Yang (2012). "IRES-mediated Tricistronic vectors for enhancing generation of high monoclonal antibody expressing CHO cell lines." Journal of Biotechnology 157(1): 130-139. Ho, S. C. L., E. Y. C. Koh, M. van Beers, M. Mueller, C. Wan, G. Teo, Z. Song, Y. W. Tong, M. Bardor and Y. Yang (2013). "Control of IgG LC: HC ratio in stably transfected CHO cells and study of the impact on expression, aggregation, glycosylation and conformational stability." Journal of Biotechnology 165(3-4): 157-166. Hoffman, L. and M. Rechsteiner (1996). "Nucleotidase activities of the 26 S proteasome and its regulatory complex." Journal of Biological Chemistry 271(51): 32538-32545. Hofmann, K. and L. Falquet (2001). "A ubiquitin-interacting motif conserved in components of the proteasomal and lysosomal protein degradation systems." Trends in Biochemical Sciences 26(6): 347-350. Hofmann, S., V. Cherkasova, P. Bankhead, B. Bukau and G. Stoecklin (2012). "Translation suppression promotes stress granule formation and cell survival in response to cold shock." Molecular Biology of the Cell 23(19): 3786-3800. Hogan, C. and P. Varga-Weisz (2007). "The regulation of ATP-dependent nucleosome remodelling factors." Mutation Research-Fundamental and Molecular Mechanisms of Mutagenesis 618(1-2): 41-51. Holliger, P. and H. Bohlen (1999). "Engineering antibodies for the clinic." Cancer and Metastasis Reviews 18(4): 411-419. Holliger, P. and P. J. Hudson (2005). "Engineered antibody fragments and the rise of single domains." Nature Biotechnology 23(9): 1126-1136.

276

Hong, J. K., S. M. Lee, K.-Y. Kim and G. M. Lee (2014). "Effect of sodium butyrate on the assembly, charge variants, and galactosylation of antibody produced in recombinant Chinese hamster ovary cells." Applied microbiology and biotechnology 98(12): 5417-5425. Hosse, R. J., A. Rothe and B. E. Power (2006). "A new generation of protein display scaffolds for molecular recognition." Protein Science 15(1): 14-27. Hung, F., L. Deng, P. Ravnikar, R. Condon, B. Li, L. Do, D. Saha, Y.-S. Tsao, A. Merchant, Z. Liu and S. Shi (2010). "mRNA stability and antibody production in CHO cells: Improvement through gene optimization." Biotechnology Journal 5(4): 393-401. Hussack, G., A. Keklikian, J. Alsughayyir, P. Hanifi-Moghaddam, M. Arbabi-Ghahroudi, H. van Faassen, S. T. Hou, S. Sad, R. MacKenzie and J. Tanha (2012). "A V-L single-domain antibody library shows a high-propensity to yield non-aggregating binders (dagger)." Protein Engineering Design & Selection 25(6): 313-318. Hussain, S. G. and K. V. A. Ramaiah (2007). "Endoplasmic reticulum: Stress, signalling and apoptosis." Current Science 93(12): 1684-1696. Hwang, S.-J., C.-J. Jeon, S. M. Cho, G. M. Lee and S. K. Yoon (2011). "Effect of Chemical Chaperone Addition on Production and Aggregation of Recombinant Flag-Tagged COMP- Angiopoietin 1 in Chinese Hamster Ovary Cells." Biotechnology Progress 27(2): 587-591. Ignatovich, O., L. Jespers, I. M. Tomlinson and R. M. T. de Wildt (2012). "Creation of the large and highly functional synthetic repertoire of human VH and Vkappa domain antibodies." Methods in molecular biology (Clifton, N.J.) 911: 39-63. Ishiguro, K. and A. C. Sartorelli (2004). "Activation of transiently transfected reporter genes in 3T3 Swiss cells by the inducers of differentiation/apoptosis - dimethylsulfoxide, hexamethylene bisacetamide and trichostatin A." European Journal of Biochemistry 271(12): 2379-2390. Jackson, D. A., P. Berg and R. H. Symons (1972). "Biochemical method for inserting new genetic information into DNA of simian virus 40 - circular SV40 DNA molecules containing lambda phage genes and galactose operon of escherichia-coli." Proceedings of the National Academy of Sciences of the United States of America 69(10): 2904-&. Jadhav, V., M. Hackl, A. Druz, S. Shridhar, C.-Y. Chung, K. M. Heffner, D. P. Kreil, M. Betenbaugh, J. Shiloach, N. Barron, J. Grillari and N. Borth (2013). "CHO microRNA engineering is growing up: Recent successes and future challenges." Biotechnology Advances 31(8): 1501- 1513. Jaeger, V., K. Buessow, A. Wagner, S. Weber, M. Hust, A. Frenzel and T. Schirrmann (2013). "High level transient production of recombinant antibodies and antibody fusion proteins in HEK293 cells." Bmc Biotechnology 13. Jayapal, K. R., K. F. Wlaschin, W. S. Hu and M. G. S. Yap (2007). "Recombinant protein therapeutics from CHO cells - 20 years and counting." Chemical Engineering Progress 103(10): 40-47. Jefferis, R. (2007). "Antibody therapeutics: isotype and glycoform selection." Expert Opinion on Biological Therapy 7(9). Jespers, L., O. Schon, K. Famm and G. Winter (2004). "Aggregation-resistant domain antibodies selected on phage by heat denaturation." Nature Biotechnology 22(9): 1161-1165. Jespers, L., O. Schon, L. C. James, D. Veprintsev and G. Winter (2004). "Crystal structure of HEL4, a soluble, refoldable Human V-H single domain with a germ-line scaffold." Journal of Molecular Biology 337(4): 893-903. Jiang, Z., Y. Huang and S. T. Sharfstein (2006). "Regulation of recombinant monoclonal antibody production in Chinese hamster ovary cells: A comparative study of gene copy number, mRNA level, and protein expression." Biotechnology Progress 22(1): 313-318.

277

Jiang, Z. and S. T. Sharfstein (2008). "Sodium butyrate stimulates monoclonal antibody overexpression in CHO cells by improving gene accessibility." Biotechnology and Bioengineering 100(1): 189-194. Johnson, G. and T. T. Wu (2000). "Kabat Database and its applications: 30 years after the first variability plot." Nucleic Acids Research 28(1): 214-218. Julius, D., R. Schekman and J. Thorner (1984). "Glycosylation and processing of prepro- alpha- factor through the yeast secretory pathway." Cell 36(2): 309-318. Kalwy, S., J. Rance and R. Young (2006). "Toward more efficient protein expression." Molecular Biotechnology 34(2): 151-156. Kao, F. T., L. Chasin and T. T. Puck (1969). "Genetics of somatic mammalian cells .10. Complementation analysis of glycine-requiring mutants." Proceedings of the National Academy of Sciences of the United States of America 64(4): 1284-&. Kao, F. T. and T. T. Puck (1967). "Genetics of somatic mammalian cells. IV. Properties of Chinese hamster cell mutants with respect to the requirement for proline." Genetics 55(3): 513-524. Kartberg, F., L. Asp, S. Y. Dejgaard, M. Smedh, J. Fernandez-Rodriguez, T. Nilsson and J. F. Presley (2010). "ARFGAP2 and ARFGAP3 Are Essential for COPI Coat Assembly on the Golgi Membrane of Living Cells." Journal of Biological Chemistry 285(47): 36709-36720. Kaufmann, H., X. Mazur, M. Fussenegger and J. E. Bailey (1999). "Influence of low temperature on productivity, proteome and protein phosphorylation of CHO cells." Biotechnology and Bioengineering 63(5): 573-582. Kawai, A., H. Uchiyama, S. Takano, N. Nakamura and S. Ohkuma (2007). "Autophagosome- lysosome fusion depends on th pH in acidic compartments in CHO cells." Autophagy 3(2): 154- 157. Kay, B. K., S. Thai and V. V. Volgina (2009). "High-Throughput Biotinylation of Proteins." Methods in Molecular Biology 498: 185-198. Keenan, R. J., D. M. Freymann, R. M. Stroud and P. Walter (2001). "The signal recognition particle." Annual Review of Biochemistry 70: 755-775. Khan, S. U. and M. Schroder (2008). "Engineering of chaperone systems and of the unfolded protein response." Cytotechnology 57(3): 207-231. Kim, J. M., J. S. Kim, D. H. Park, H. S. Kang, J. Yoon, K. Baek and Y. Yoon (2004). "Improved recombinant gene expression in CHO cells using matrix attachment regions." Journal of Biotechnology 107(2): 95-105. Kim, N. S., K. H. Chang, B. S. Chung, S. H. Kim, J. H. Kim and G. M. Lee (2003). "Characterization of humanized antibody produced by apoptosis-resistant CHO cells under sodium butyrate- induced condition." Journal of Microbiology and Biotechnology 13(6): 926-936. Kim, N. S. and G. M. Lee (2001). "Overexpression of bcl-2 inhibits sodium butyrate-induced apoptosis in Chinese hamster ovary cells resulting in enhanced humanized antibody production." Biotechnology and Bioengineering 71(3): 184-193. Kim, N. S. and G. M. Lee (2002). "Inhibition of sodium butyrate-induced apoptosis in recombinant Chinese hamster ovary cells by constitutively expressing antisense RNA of caspase-3." Biotechnology and Bioengineering 78(2): 217-228. Kim, S. Y., J. H. Lee, H. S. Shin, H. J. Kang and Y. S. Kim (2002). "The human elongation factor 1 alpha (EF-1 alpha) first intron highly enhances expression of foreign genes from the murine cytomegalovirus promoter." Journal of Biotechnology 93(2): 183-187. Kim, Y.-G., J. Y. Kim, B. Park, J. O. Ahn, J.-K. Jung, H. W. Lee, G. M. Lee and E. G. Lee (2011). "Effect of Bcl-xL overexpression on erythropoietin production in recombinant Chinese hamster ovary cells treated with dimethyl sulfoxide." Process Biochemistry 46(11): 2201-2204. Kisselev, A. F. and A. L. Goldberg (2001). "Proteasome inhibitors: from research tools to drug candidates." Chemistry & Biology 8(8): 739-758.

278

Kober, L., C. Zehe and J. Bode (2013). "Optimized signal peptides for the development of high expressing CHO cell lines." Biotechnology and Bioengineering 110(4): 1164-1173. Kohler, G. and C. Milstein (1975). "Continuous cultures of fused cells secreting antibody of predefined specificity." Nature 256(5517): 495-497. Komar, A. A. and M. Hatzoglou (2011). "Cellular IRES-mediated translation the war of ITAFs in pathophysiological states." Cell Cycle 10(2): 229-240. Kotsopoulou, E., H. Bosteels, Y. T. Chim, P. Pegman, G. Stephen, S. I. Thornhill, J. D. Faulkner and M. Uden (2010). "Optimised mammalian expression through the coupling of codon adaptation with gene amplification: Maximum yields with minimum effort." Journal of Biotechnology 146(4): 186-193. Kouzarides, T. (2007). "Chromatin modifications and their function." Cell 128(4): 693-705. Kriegler, M. (1990). "Assembly of enhancers, promoters, and splice signals to control expression of transferred genes." Methods in Enzymology 185: 512-527. Krol, J., I. Loedige and W. Filipowicz (2010). "The widespread regulation of microRNA biogenesis, function and decay." Nature Reviews Genetics 11(9). Kumar, N., P. Gammell, P. Meleady, M. Henry and M. Clynes (2008). "Differential protein expression following low temperature culture of suspension CHO-K1 cells." Bmc Biotechnology 8. Lattenmayer, C., E. Trummer, K. Schriebl, K. Vorauer-Uhl, D. Mueller, H. Katinger and R. Kunert (2007). "Characterisation of recombinant CHO cell lines by investigation of protein productivities and genetic parameters." Journal of Biotechnology 128(4): 716-725. Le Fourn, V., P.-A. Girod, M. Buceta, A. Regamey and N. Mermod (2014). "CHO cell engineering to prevent polypeptide aggregation and improve therapeutic protein secretion." Metabolic Engineering 21: 91-102. Lederkremer, G. Z. (2009). "Glycoprotein folding, quality control and ER-associated degradation." Current Opinion in Structural Biology 19(5): 515-523. Lee, D. H. and A. L. Goldberg (1998). "Proteasome inhibitors: valuable new tools for cell biologists." Trends in Cell Biology 8(10): 397-403. Lee, J. S. and G. M. Lee (2012). "Effect of sodium butyrate on autophagy and apoptosis in Chinese hamster ovary cells." Biotechnology Progress 28(2): 349-357. Lee, S. M., Y.-G. Kim, E. G. Lee and G. M. Lee (2014). "Digital mRNA profiling of N-glycosylation gene expression in recombinant Chinese hamster ovary cells treated with sodium butyrate." Journal of Biotechnology 171: 56-60. Leitzgen, K., M. R. Knittler and I. G. Haas (1997). "Assembly of immunoglobulin light chains as a prerequisite for secretion - A model for oligomerization-dependent subunit folding." Journal of Biological Chemistry 272(5). Lewis, N. E., X. Liu, Y. Li, H. Nagarajan, G. Yerganian, E. O'Brien, A. Bordbar, A. M. Roth, J. Rosenbloom, C. Bian, M. Xie, W. Chen, N. Li, D. Baycin-Hizal, H. Latif, J. Forster, M. J. Betenbaugh, I. Famili, X. Xu, J. Wang and B. O. Palsson (2013). "Genomic landscapes of Chinese hamster ovary cell lines as revealed by the Cricetulus griseus draft genome." Nature Biotechnology 31(8): 759. Li, J. H., Z. Huang, X. M. Sun, P. Y. Yang and Y. X. Zhang (2006). "Understanding the enhanced effect of dimethyl sulfoxide on hepatitis B surface antigen expression in the culture of Chinese hamster ovary cells on the basis of proteome analysis." Enzyme and Microbial Technology 38(3-4): 372-380. Lin, Z., P. Cao and H. Lei (2008). "Identification of a neutralizing scFv binding to human vascular endothelial growth factor 165 (VEGF165) using a phage display antibody library." Applied Biochemistry and Biotechnology 144(1): 15-26.

279

Lindenbaum, M., E. Perkins, E. Csonka, E. Fleming, L. Garcia, A. Greene, L. Gung, G. Hadlaczky, E. Lee, J. Leung, N. MacDonald, A. Maxwell, K. Mills, D. Monteith, C. F. Perez, J. Shellard, S. Stewart, T. Stodola, D. Vandenborre, S. Vanderbyl and H. C. Ledebur (2004). "A mammalian artificial chromosome engineering system (ACE System) applicable to biopharmaceutical protein production, transgenesis and gene-based cell therapy." Nucleic Acids Research 32(21). Ling, W. L. W., L. Deng, J. Lepore, C. Cutler, S. Connon-Carlson, Y. Wang and M. Voloch (2003). "Improvement of monoclonal antibody production in hybridoma cells by dimethyl sulfoxide." Biotechnology Progress 19(1): 158-162. Liu, C., B. Dalby, W. Chen, J. M. Kilzer and H. C. Chiou (2008). "Transient transfection factors for high-level recombinant protein production in suspension cultured mammalian cells." Molecular Biotechnology 39(2): 141-153. Liu, C. H., I. M. Chu and S. M. Hwang (2001). "Enhanced expression of various exogenous genes in recombinant Chinese hamster ovary cells in presence of dimethyl sulfoxide." Biotechnology Letters 23(20): 1641-1645. Liu, C. H., I. M. Chu and S. M. Hwang (2001). "Pentanoic acid, a novel protein synthesis stimulant for Chinese hamster ovary (CHO) cells." Journal of Bioscience and Bioengineering 91(1): 71-75. Liu, H., X. Zheng, F. Zhang, L. Yu, X. Zhang, H. Dai, Q. Hua, X. Shi, W. Lan, P. Jia and L. Yuan (2013). "Selection and characterization of single-chain recombinant antibodies against spring viraemia of carp virus from mouse phage display library." Journal of Virological Methods 194(1-2): 178-184. Livesey, K. M., D. Tang, H. J. Zeh and M. T. Lotze (2009). "Autophagy inhibition in combination cancer treatment." Current Opinion in Investigational Drugs 10(12): 1269-1279. Lodish, H., D. Baltimore, A. Berk, S. L. Zipursky, P. Matsudaira, J. Darnell, H. Lodish, D. Baltimore, A. Berk, S. L. Zipursky, P. Matsudaira and J. Darnell (1995). "Molecular cell biology; Third edition." Molecular cell biology, Third edition: l+1344p. Lonberg, N. (2005). "Human antibodies from transgenic animals." Nature Biotechnology 23(9): 1117-1125. Ma, Z., X. Yi and Y. Zhang (2008). "Enhanced intracellular accumulation of recombinant HBsAg in CHO cells by dimethyl sulfoxide." Process Biochemistry 43(6): 690-695. Malhotra, J. D. and R. J. Kaufman (2007). "The endoplasmic reticulum and the unfolded protein response." Seminars in Cell & Developmental Biology 18(6): 716-731. Malys, N. and J. E. G. McCarthy (2011). "Translation initiation: variations in the mechanism can be anticipated." Cellular and Molecular Life Sciences 68(6): 991-1003. Mariati, S. C. L. Ho, M. G. S. Yap and Y. Yang (2012). "Post-transcriptional Regulatory Elements for Enhancing Transient Gene Expression Levels in Mammalian Cells." Protein Expression in Mammalian Cells: Methods and Protocols 801: 125-135. Mariati, Y. K. Ng, S.-H. Chao, M. G. S. Yap and Y. Yang (2010). "Evaluating regulatory elements of human cytomegalovirus major immediate early gene for enhancing transgene expression levels in CHO K1 and HEK293 cells." Journal of Biotechnology 147(3-4): 160-163. Martin, T. M., G. D. Wiens and M. B. Rittenberg (1998). "Inefficient assembly and intracellular accumulation of antibodies with mutations in V-H CDR2." Journal of Immunology 160(12). Martinet, D., M. Derouazi, N. Besuchet, M. Wicht, J. Beckmann and F. M. Wurm (2007). "Karyotype of CHO DG44 cells." Cell Technology for Cell Products: 363-366. Marvin, J. S. and Z. P. Zhu (2005). "Recombinant approaches to IgG-like bispecific antibodies." Acta Pharmacologica Sinica 26(6): 649-658. Mason, M., B. Sweeney, K. Cain, P. Stephens and S. T. Sharfstein (2012). "Identifying bottlenecks in transient and stable production of recombinant monoclonal-antibody sequence variants in chinese hamster ovary cells." Biotechnology Progress 28(3).

280

Masterton, R. J., A. Roobol, M. B. Al-Fageeh, M. J. Carden and C. M. Smales (2010). "Post- Translational Events of a Model Reporter Protein Proceed With Higher Fidelity and Accuracy Upon Mild Hypothermic Culturing of Chinese Hamster Ovary Cells." Biotechnology and Bioengineering 105(1): 215-220. Matasci, M., L. Baldi, D. L. Hacker and F. M. Wurm (2011). "The PiggyBac Transposon Enhances the Frequency of CHO Stable Cell Line Generation and Yields Recombinant Lines With Superior Productivity and Stability." Biotechnology and Bioengineering 108(9): 2141-2150. Matz, J. and P. Chames (2012). "Phage display and selections on purified antigens." Methods in molecular biology (Clifton, N.J.) 907: 213-224. McCafferty, J., A. D. Griffiths, G. Winter and D. J. Chiswell (1990). "Phage antibodies - filamentous phage displaying antibody variable domains." Nature 348(6301): 552-554. McLean, G. R., M. Torres, B. Trotter, M. Noseda, S. Bryson, E. F. Pai, J. W. Schrader and A. Casadevall (2005). "A point mutation in the CH3 domain of human IgG3 inhibits antibody secretion without affecting antigen specificity." Molecular Immunology 42(9). McLeod, J., P. M. O'Callaghan, L. P. Pybus, S. J. Wilkinson, T. Root, A. J. Racher and D. C. James (2011). "An Empirical Modeling Platform to Evaluate the Relative Control Discrete CHO Cell Synthetic Processes Exert Over Recombinant Monoclonal Antibody Production Process Titer." Biotechnology and Bioengineering 108(9). Mead, E. J., L. M. Chiverton, S. K. Spurgeon, E. B. Martin, G. A. Montague, C. M. Smales and T. von der Haar (2012). "Experimental and In Silico Modelling Analyses of the Gene Expression Pathway for Recombinant Antibody and By-Product Production in NS0 Cell Lines." Plos One 7(10). Merk, H., C. Gless, B. Maertens, M. Gerrits and W. Stiege (2012). "Cell-free synthesis of functional and endotoxin-free antibody Fab fragments by translocation into microsomes." Biotechniques 53(3): 153. Merrick, W. C. (2004). "Cap-dependent and cap-independent translation in eukaryotic systems." Gene 332: 1-11. Mikami, S., T. Kobayashi, M. Masutani, S. Yokoyama and H. Imataka (2008). "A human cell- derived in vitro coupled transcription/translation system optimized for production of recombinant proteins." Protein Expression and Purification 62(2): 190-198. Mimura, Y., J. Lund, S. Church, S. C. Dong, J. Li, M. Goodall and R. Jefferis (2001). "Butyrate increases production of human chimeric IgG in CHO-K1 cells whilst maintaining function and glycoform profile." Journal of Immunological Methods 247(1-2): 205-216. Moore, A., J. Mercer, G. Dutina, C. J. Donahue, K. D. Bauer, J. P. Mather, T. Etcheverry and T. Ryll (1997). "Effects of temperature shift on cell cycle, apoptosis and nucleotide pools in CHO cell batch cultures." Cytotechnology 23(1-3): 47-54. Moore, G. L., H. Chen, S. Karki and G. A. Lazar (2010). "Engineered Fc variant antibodies with enhanced ability to recruit complement and mediate effector functions." Mabs 2(2): 181-189. Morrison, S. L., M. J. Johnson, L. A. Herzenberg and V. T. Oi (1984). "Chimeric human-antibody molecules - mouse antigen-binding domains with human constant region domains." Proceedings of the National Academy of Sciences of the United States of America- Biological Sciences 81(21): 6851-6855. Mosser, M., I. Chevalot, E. Olmos, F. Blanchard, R. Kapel, E. Oriol, I. Marc and A. Marc (2013). "Combination of yeast hydrolysates to improve CHO cell growth and IgG production." Cytotechnology 65(4): 629-641. Nelson, A. L. (2010). "Antibody fragments Hope and hype." Mabs 2(1): 77-83. Nelson, A. L. and J. M. Reichert (2009). "Developement trends for therapeutic antibody fragments." Nature Biotechnology 27(4): 331-337.

281

Nettleship, J. E., J. Ren, N. Rahman, N. S. Berrowa, D. Hatherley, A. N. Barclay and R. J. Owens (2008). "A pipeline for the production of antibody fragments for structural studies using transient expression in HEK 293T cells." Protein Expression and Purification 62(1): 83-89. Netzer, W. J. and F. U. Hartl (1997). "Recombination of protein domains facilitated by co- translational folding in eukaryotes." Nature 388(6640): 343-349. Nilsson, I. and G. Vonheijne (1993). "Determination of the distance between the oligosaccharyltransferase active-site and the endoplasmic-reticulum membrane." Journal of Biological Chemistry 268(8): 5798-5801. Nirenberg, M. and J. H. Matthaei (1961). "Dependence of cell-free protein synthesis in e coli upon naturally occurring or synthetic polyribonucleotides." Proceedings of the National Academy of Sciences of the United States of America 47(10): 1588-&. O'Callaghan, P. M., J. McLeod, L. P. Pybus, C. S. Lovelady, S. J. Wilkinson, A. J. Racher, A. Porter and D. C. James (2010). "Cell Line-Specific Control of Recombinant Monoclonal Antibody Production by CHO Cells." Biotechnology and Bioengineering 106(6): 938-951. Oerlemans, R., N. E. Franke, Y. G. Assaraf, J. Cloos, I. van Zantwijk, C. R. Berkers, G. L. Scheffer, K. Debipersad, K. Vojtekova, C. Lemos, J. W. van der Heijden, B. Ylstra, G. J. Peters, G. L. Kaspers, B. A. C. Dijkmans, R. J. Scheper and G. Jansen (2008). "Molecular basis of bortezomib resistance: proteasome subunit beta 5 (PSMB5) gene mutation and overexpression of PSMB5 protein." Blood 112(6): 2489-2499. Osterborg, A., H. Mellstedt and M. Keating (2002). "Clinical effects of Alemtuzumab (Campath- 1H) in B-cell Chronic Lymphocytic Leukemia." Medical Oncology 19(Supplement): S21-26. Pande, J., M. M. Szewczyk and A. K. Grover (2010). "Phage display: Concept, innovations, applications and future." Biotechnology Advances 28(6): 849-858. Peng, R.-W., C. Guetg, M. Tigges and M. Fussenegger (2010). "The vesicle-trafficking protein munc18b increases the secretory capacity of mammalian cells." Metabolic Engineering 12(1): 18-25. Peng, R. W. and M. Fussenegger (2009). "Molecular Engineering of Exocytic Vesicle Traffic Enhances the Productivity of Chinese Hamster Ovary Cells." Biotechnology and Bioengineering 102(4): 1170-1181. Pikaart, M. I., F. Recillas-Targa and G. Felsenfeld (1998). "Loss of transcriptional activity of a transgene is accompanied by DNA methylation and histone deacetylation and is prevented by insulators." Genes & Development 12(18): 2852-2862. Pizzinga, M. and M. P. Ashe (2014). "Yeast mRNA localization: protein asymmetry, organelle localization and response to stress." Biochemical Society transactions 42(4): 1256-1260. Plantier, J.-L., B. Guillet, N. Jolimay, M.-H. Rodriguez, N. Enjolras and C. Negrier (2002). "A B Domain-Deleted Factor VIII Is Aggregated and Degraded by Proteasomal and Lysosomal Degradation Pathways in CHO Cells." Blood 100(11): 3839-Abstract No. 3839. Proudfoot, N. J., A. Furger and M. J. Dye (2002). "Integrating rnRNA processing with transcription." Cell 108(4): 501-512. Puck, T. T., P. Sanders and D. Petersen (1964). "Life cycle analysis of mammalian cells .2. Cells from chinese hamster ovary grown in suspension culture." Biophysical Journal 4(6): 441. Pybus, L. P., D. C. James, G. Dean, T. Slidel, C. Hardman, A. Smith, O. Daramola and R. Field (2014). "Predicting the Expression of Recombinant Monoclonal Antibodies in Chinese Hamster Ovary Cells Based on Sequence Features of the CDR3 Domain." Biotechnology Progress 30(1): 188-197. Radhakrishnan, P., H. Basma, D. Klinkebiel, J. Christman and P.-W. Cheng (2008). "Cell type- specific activation of the cytomegalovirus promoter by dimethylsulfoxide and 5-Aza-2'- deoxycytidine." International Journal of Biochemistry & Cell Biology 40(9): 1944-1955.

282

Reichert, J. M. (2012). "Marketed therapeutic antibodies compendium." Mabs 4(3): 413-415. Reisinger, H., W. Steinfellner, B. Stern, H. Katinger and R. Kunert (2008). "The absence of effect of gene copy number and mRNA level on the amount of mAb secretion from mammalian cells." Applied Microbiology and Biotechnology 81(4): 701-710. Riechmann, L., M. Clark, H. Waldmann and G. Winter (1988). "Reshaping human-antibodies for therapy." Nature 332(6162): 323-327. Robinson, C. P. (1986). "Muromonab-CD3 orthoclone OKT3 a review." Drugs of Today 22(12): 603-610. Robinson, D. G., G. Hinz and S. E. H. Holstein (1998). "The molecular characterization of transport vesicles." Plant Molecular Biology 38: 49-76. Rodriguez, J., M. Spearman, N. Huzel and M. Butler (2005). "Enhanced production of monomeric interferon-ss by CHO cells through the control of culture conditions." Biotechnology Progress 21(1): 22-30. Rodriguez, M. S., C. Dargemont and F. Stutz (2004). "Nuclear export of RNA." Biology of the Cell 96(8): 639-655. Roskos, L. K., C. G. Davis and G. M. Schwab (2004). "The clinical pharmacology of therapeutic monoclonal antibodies." Drug Development Research 61(3): 108-120. Saviranta, P., T. Haavisto, P. Rappu, M. Karp and T. Lovgren (1998). "In vitro enzymatic biotinylation of recombinant fab fragments through a peptide acceptor tail." Bioconjugate Chemistry 9(6): 725-735. Schaefer, J. V. and A. Plueckthun (2012). "Transfer of engineered biophysical properties between different antibody formats and expression systems." Protein Engineering Design & Selection 25(10): 485-505. Schatz, S. M., R. J. Kerschbaumer, G. Gerstenbauer, M. Kral, F. Dorner and F. Scheiflinger (2003). "Higher expression of Fab antibody fragments in a CHU cell line at reduced temperature." Biotechnology and Bioengineering 84(4): 433-438. Schlabach, M. R., J. K. Hu, M. Li and S. J. Elledge (2010). "Synthetic design of strong promoters." Proceedings of the National Academy of Sciences of the United States of America 107(6): 2538-2543. Schlatter, S., S. H. Stansfield, D. M. Dinnis, A. J. Racher, J. R. Birch and D. C. James (2005). "On the optimal ratio of heavy to light chain genes for efficient recombinant antibody production by CHO cells." Biotechnology Progress 21(1): 122-133. Schroeder, H. W., Jr. and L. Cavacini (2010). "Structure and function of immunoglobulins." Journal of Allergy and Clinical Immunology 125(2): S41-S52. Schroeder, S. C., B. Schwer, S. Shuman and D. Bentley (2000). "Dynamic association of capping enzymes with transcribing RNA polymerase II." Genes & Development 14(19): 2435-2440. Schubert, I., C. Kellner, C. Stein, M. Kuegler, M. Schwenkert, D. Saul, K. Mentz, H. Singer, B. Stockmeyer, W. Hillen, A. Mackensen and G. H. Fey (2011). "A single-chain triplebody with specificity for CD19 and CD33 mediates effective lysis of mixed lineage leukemia cells by dual targeting." Mabs 3(1): 21-30. Shcherbakova, N. S., A. N. Chikaev, L. I. Karpenko and A. A. Il'ichev (2012). "The Influence of biotinylation of 2F5 antibody on peptide selection from the combinatorial phage library." Molecular Genetics Microbiology and Virology 27(1): 22-27. Sheikholeslami, Z., M. Jolicoeur and O. Henry (2013). "The impact of the timing of induction on the metabolism and productivity of CHO cells in culture." Biochemical Engineering Journal 79: 162-171. Shimizu, Y., T. Kanamori and T. Ueda (2005). "Protein synthesis by pure translation systems." Methods 36(3): 299-304.

283

Sibler, A. P., E. Kempf, A. Glacet, G. Orfanoudakis, D. Bourel and E. Weiss (1999). "In vivo biotinylated recombinant antibodies: high efficiency of labelling and application to the cloning of active anti-human IgG1 Fab fragments." Journal of Immunological Methods 224(1-2). Sidhu, S. S. (2000). "Phage display in pharmaceutical biotechnology." Current Opinion in Biotechnology 11(6): 610-616. Skerra, A. (2007). "Alternative non-antibody scaffolds for molecular recognition." Current Opinion in Biotechnology 18(4): 295-304. Smith, G. P. (1985). "Filamentous fusion phage - novel expression vectors that display cloned antigens on the virion surface." Science 228(4705): 1315-1317. Soltes, G., M. Hust, K. K. Y. Ng, A. Bansal, J. Field, D. I. H. Stewart, S. Dubel, S. Cha and E. J. Wiersma (2007). "On the influence of vector design on antibody phage display." Journal of Biotechnology 127(4): 626-637. Sonenberg, N. and A. G. Hinnebusch (2009). "Regulation of Translation Initiation in Eukaryotes: Mechanisms and Biological Targets." Cell 136(4): 731-745. Sonna, L. A., J. Fujita, S. L. Gaffin and C. M. Lilly (2002). "Invited Review: Effects of heat and cold stress on mammalian gene expression." Journal of Applied Physiology 92(4): 1725- 1742. Sonoda, H., Y. Kumada, T. Katsuda and H. Yamaji (2012). "Production of single- chain Fv-Fc fusion protein in stably transformed insect cells." Biochemical Engineering Journal 67: 77-82. Stech, M., H. Merk, J. A. Schenk, W. F. M. Stoecklein, D. A. Wuestenhagen, B. Micheel, C. Duschl, F. F. Bier and S. Kubick (2012). "Production of functional antibody fragments in a vesicle- based eukaryotic cell-free translation system." Journal of Biotechnology 164(2): 220- 231. Stocker, G., D. Dumoulin, C. Vandevyver, F. Hilbrig and R. Freitag (2008). "Screening of a Human Antibody Phage Display Library Against a Peptide Antigen Using Stimuli- Responsive Bioconjugates." Biotechnology Progress 24(6): 1314-1324. Stoops, J., S. Byrd and H. Hasegawa (2012). "Russell body inducing threshold depends on the variable domain sequences of individual human IgG clones and the cellular protein homeostasis." Biochimica et Biophysica Acta (BBA) - Molecular Cell Research 1823(10): 1643-1657. Subramani, S., R. Mulligan and P. Berg (1981). "Expression of the mouse dihydrofolate- reductase complementary deoxyribonucleic-acid in simian-virus 40 vectors." Molecular and Cellular Biology 1(9): 854-864. Suen, K. F., M. S. Turner, F. Gao, B. Liu, A. Althage, A. Slavin, W. Ou, E. Zuo, M. Eckart, T. Ogawa, M. Yamada, T. Tuntland, J. L. Harris and J. W. Trauger (2010). "Transient expression of an IL- 23R extracellular domain Fc fusion protein in CHO vs. HEK cells results in improved plasma exposure." Protein Expression and Purification 71(1): 96-102. Sung, Y. H., Y. J. Song, S. W. Lim, J. Y. Chung and G. M. Lee (2004). "Effect of sodium butyrate on the production, heterogeneity and biological activity of human thrombopoietin by recombinant Chinese hamster ovary cells." Journal of Biotechnology 112(3): 323-335. Sunley, K. and M. Butler (2010). "Strategies for the enhancement of recombinant protein production from mammalian cells by growth arrest." Biotechnology Advances 28(3): 385-394. Swanton, E. and N. J. Bullied (2003). “Protein folding and translocation across the endoplasmic reticulum membrane (Review).” Molecular Membrane Biology 20 (2): 99-104. Tan, H. K., M. M. Lee, M. G. S. Yap and D. I. C. Wang (2008). "Overexpression of cold- inducible RNA-binding protein increases interferon-gamma production in Chinese- hamster ovary cells." Biotechnology and Applied Biochemistry 49: 247-257. Teplova, M., L. Wohlbold, N. W. Khin, E. Izaurralde and D. J. Patel (2011). "Structure-function studies of nucleocytoplasmic transport of retroviral genomic RNA by mRNA export factor TAP." Nature Structural & Molecular Biology 18(9): 990-U946.

284

Terpe, K. (2006). "Overview of bacterial expression systems for heterologous protein production: from molecular and biochemical fundamentals to commercial systems." Applied Microbiology and Biotechnology 72(2): 211-222. Tiller, T., I. Schuster, D. Deppe, K. Siegers, R. Strohner, T. Herrmann, M. Berenguer, D. Poujol, J. Stehle, Y. Stark, M. Hessling, D. Daubert, K. Felderer, S. Kaden, J. Koelln, M. Enzelberger and S. Urlinger (2013). "A fully synthetic human Fab antibody library based on fixed VH/VL framework pairings with favorable biophysical properties." Mabs 5(3): 445-470. Tjio, J. H. and T. T. Puck (1958). "Genetics of somatic mammalian cells .2. Chromosomal constitution of cells in tissue culture." Journal of Experimental Medicine 108(2): 259-&. Todorovska, A., R. C. Roovers, O. Dolezal, A. A. Kortt, H. R. Hoogenboom and P. J. Hudson (2001). "Design and application of diabodies, triabodies and tetrabodies for cancer targeting." Journal of Immunological Methods 248(1-2): 47-66. Tornoe, J., P. Kusk, T. E. Johansen and P. R. Jensen (2002). "Generation of a synthetic mammalian promoter library by modification of sequences spacing transcription factor binding sites." Gene 297(1-2): 21-32. Trummer, E., K. Fauland, S. Seidinger, K. Schriebl, C. Lattenmayer, R. Kunert, K. Vorauer-Uhl, R. Weik, N. Borth, H. Katinger and D. Mueller (2006). "Process parameter shifting: Part I. Effect of DOT, pH, and temperature on the performance of Epo-Fc expressing CHO cells cultivated in controlled batch bioreactors." Biotechnology and Bioengineering 94(6): 1033-1044. Tumminello, F. M., R. J. Bernacki, N. Gebbia and G. Leto (1993). "Pepstatins - aspartic proteinase-inhibitors having potential therapeutic applications." Medicinal Research Reviews 13(2): 199-208. Underhill, M. F., C. Coley, J. R. Birch, A. Findlay, R. Kallmeier, C. G. Proud and D. C. James (2003). "Engineering mRNA translation initiation to enhance transient gene expression in Chinese hamster ovary cells." Biotechnology Progress 19(1): 121-129. Underhill, M. F., R. J. Marchant, M. J. Carden, D. C. James and C. M. Smales (2006). "On the effect of transient expression of mutated eIF2 alpha and eIF4E eukaryotic translation initiation factors on reporter gene expression in mammalian cells upon cold-shock." Molecular Biotechnology 34(2): 141-149. Urlaub, G. and L. A. Chasin (1980). "Isolation of chinese-hamster cell mutants deficient in dihydrofolate-reductase activity." Proceedings of the National Academy of Sciences of the United States of America-Biological Sciences 77(7): 4216-4220. Urlaub, G., E. Kas, A. M. Carothers and L. A. Chasin (1983). "Deletion of the diploid dihydrofolate- reductase locus from cultured mammalian-cells." Cell 33(2): 405-412. Valle, C. W. and N. Vij (2012). "Can Correcting the Delta F508-CFTR Proteostasis-Defect Rescue CF Lung Disease?" Current Molecular Medicine 12(7): 860-871. Valliere-Douglass, J. F., C. M. Eakin, A. Wallace, R. R. Ketchem, W. Wang, M. J. Treuheit and A. Balland (2010). "Glutamine-linked and Non-consensus Asparagine-linked Oligosaccharides Present in Human Recombinant Antibodies Define Novel Protein Glycosylation Motifs." Journal of Biological Chemistry 285(21): 16012-16022. Vergara, M., S. Becerra, J. Reyes and C. Altamirano (2010). "Incidence of Mild Hypothermia on Metabolic Behavior and Synthesis of tPA in CHO Cells Inhibited ERAD Degradation Pathways." Journal of Biotechnology 150: S415-S415. Verma, R., E. Boleti and A. J. T. George (1998). "Antibody engineering: Comparison of bacterial, yeast, insect and mammalian expression systems." Journal of Immunological Methods 216(1- 2): 165-181. Verma, R., R. S. Oania, N. J. Kolawa and R. J. Deshaies (2013). "Cdc48/p97 promotes degradation of aberrant nascent polypeptides bound to the ribosome." eLife 2: e00308- e00308.

285

Verma, R., R. S. Oania, N. J. Kolawa and R. J. Deshaies (2013). "Cdc48/p97 promotes degradation of aberrant nascent polypeptides bound to the ribosome." Elife 2. Vink, T., M. Oudshoorn-Dickmann, M. Roza, J.-J. Reitsma and R. N. de Jong (2014). "A simple, robust and highly efficient transient expression system for producing antibodies." Methods 65(1): 5-10. Walsh, G. (1998). Biopharmaceuticals: Biochemistry and Biotechnology, John Wiley & Sons. Walsh, G. (2010). "Biopharmaceutical benchmarks 2010." Nature Biotechnology 28(9): 917-924. Walsh, G. and R. Jefferis (2006). "Post-translational modifications in the context of therapeutic proteins." Nature Biotechnology 24(10): 1241-1252. Wang, W., X. Yi and Y. Zhang (2007). "Gene transcription acceleration: Main cause of hepatitis B surface antigen production improvement by dimethyl sulfoxide in the culture of Chinese hamster ovary cells." Biotechnology and Bioengineering 97(3): 526-535. Watanabe, H., K. Tsumoto, R. Asano, Y. Nishimiya and I. Kumagai (2002). "Selection of human antibody fragments on the basis of stabilization of the variable domain in the presence of target antigens." Biochemical and Biophysical Research Communications 295(1): 31-36. Waters, M. G., E. A. Evans and G. Blobel (1988). "Prepro-alpha-factor has a cleavable signal sequence." Journal of Biological Chemistry 263(13): 6209-6214. Watkins, N. A. and W. H. Ouwehand (2000). "Introduction to antibody engineering and phage display." Vox Sanguinis 78(2): 72-79. Webb, C.-H. T. and K. J. Hertel (2014). "Preparation of Splicing Competent Nuclear Extracts." Spliceosomal Pre-Mrna Splicing: Methods and Protocols 1126: 117-121. Welch, M., A. Villalobos, C. Gustafsson and J. Minshull (2009). "You're one in a googol: optimizing genes for protein expression." Journal of the Royal Society Interface 6. Wendland, B. (2002). "Epsins: adaptors in endocytosis?" Nature Reviews Molecular Cell Biology 3(12): 971-977. Wesolowski, J., V. Alzogaray, J. Reyelt, M. Unger, K. Juarez, M. Urrutia, A. Cauerhff, W. Danquah, B. Rissiek, F. Scheuplein, N. Schwarz, S. Adriouch, O. Boyer, M. Seman, A. Licea, D. V. Serreze, F. A. Goldbaum, F. Haag and F. Koch-Nolte (2009). "Single domain antibodies: promising experimental and therapeutic tools in infection and immunity." Medical Microbiology and Immunology 198(3): 157-174. Whittaker, J. W. (2013). "Cell-free protein synthesis: the state of the art." Biotechnology Letters 35(2): 143-152. Wiens, G. D., K. A. Heldwein, M. P. StenzelPoore and M. B. Rittenberg (1997). "Somatic mutation in V-H complementarity-determining region 2 and framework region 2 - Differential effects on antigen binding and Ig secretion." Journal of Immunology 159(3): 1293-1302. Wiens, G. D., A. Lekkerkerker, M. Veltman and M. B. Rittenberg (2001). "Mutation of a single conserved residue in V-H complementarity-determining region 2 results in a severe Ig secretion defect." Journal of Immunology 167(4): 2179-2186. Wijesuriya, S. D., R. L. Cotter and A. H. Horwitz (2013). "Functional premature polyadenylation signals and aberrant splicing within a recombinant protein coding sequence limit expression." Protein Expression and Purification 92(1): 14-20. Will, C. L. and R. Luhrmann (2011). "Spliceosome structure and function." Cold Spring Harbor perspectives in biology 3(7). Wood, P. (2001). Understanding Immunology, Prentice Hall. Woof, J. M. and D. R. Burton (2004). "Human antibody - Fc receptor interactions illuminated by crystal structures." Nature Reviews Immunology 4(2): 89-99. Wu, S.-C. (2009). "RNA interference technology to improve recombinant protein production in Chinese hamster ovary cells." Biotechnology Advances 27(4): 417-422.

286

Wulhfard, S., S. Tissot, S. Bouchet, J. Cevey, M. De Jesus, D. L. Hacker and F. M. Wurm (2008). "Mild hypothermia improves transient gene expression yields several fold in Chinese hamster ovary cells." Biotechnology Progress 24(2): 458-465. Wurm, F. M. (2004). "Production of recombinant protein therapeutics in cultivated mammalian cells." Nature Biotechnology 22(11): 1393-1398. Xiong, F., L. Xia, J. Wang, B. Wu, D. Wang, L. Yuan, Y. Cheng, H. Zhu, X. Che, Q. Zhang, G. Zhao and Y. Wang (2014). "A High-Affinity CDR-Grafted Antibody against Influenza A H5N1 Viruses Recognizes a Conserved Epitope of H5 Hemagglutinin." Plos One 9(2). Xiong, K. H., Q. C. Liang, H. Xiong, C. X. Zou, G. D. Gao, Z. W. Zhao and H. Zhang (2005). "Expression of chimeric antibody in mammalian cells using dicistronic expression vector." Biotechnology Letters 27(21): 1713-1717. Xu, X., H. Nagarajan, N. E. Lewis, S. Pan, Z. Cai, X. Liu, W. Chen, M. Xie, W. Wang, S. Hammond, M. R. Andersen, N. Neff, B. Passarelli, W. Koh, H. C. Fan, J. Wang, Y. Gui, K. H. Lee, M. J. Betenbaugh, S. R. Quake, I. Famili, B. O. Palsson and J. Wang (2011). "The genomic sequence of the Chinese hamster ovary (CHO)-K1 cell line." Nature Biotechnology 29(8). Yam, G. H.-F., K. Gaplovska-Kysela, C. Zuber and J. Roth (2007). "Sodium 4-phenylbutyrate acts as a chemical chaperone on misfolded myocilin to rescue cells from endoplasmic reticulum stress and apoptosis." Investigative Ophthalmology & Visual Science 48(4): 1683-1690. Yang, W. C., J. Lu, N. B. Nguyen, A. Zhang, N. V. Healy, R. Kshirsagar, T. Ryll and Y.-M. Huang (2014). "Addition of Valproic Acid to CHO Cell Fed-Batch Cultures Improves Monoclonal Antibody Titers." Molecular Biotechnology 56(5): 421-428. Yang, Y., Mariati, J. Chusainow and M. G. S. Yap (2010). "DNA methylation contributes to loss in productivity of monoclonal antibody-producing CHO cell lines." Journal of Biotechnology 147(3-4). Ye, J., K. Alvin, H. Latif, A. Hsu, V. Parikh, T. Whitmer, M. Tellers, M. C. d. l. C. Edmonds, J. Ly, P. Salmon and J. F. Markusen (2010). "Rapid Protein Production Using CHO Stable Transfection Pools." Biotechnology Progress 26(5). Ye, J., V. Kober, M. Tellers, Z. Naji, P. Salmon and J. F. Markusen (2009). "High-Level Protein Expression in Scalable CHO Transient Transfection." Biotechnology and Bioengineering 103(3): 542-551. Yin, G., E. D. Garces, J. Yang, J. Zhang, T. Cuong, A. R. Steiner, C. Roos, S. Bajad, S. Hudak, K. Penta, J. Zawada, S. Pollitt and C. J. Murray (2012). "Aglycosylated antibodies and antibody fragments produced in a scalable in vitro transcription-translation system." Mabs 4(2): 217- 225. Yoon, S. K., S. H. Kim, J. Y. Song and G. M. Lee (2006). "Biphasic culture strategy for enhancing volumetric erythropoietin productivity of Chinese hamster ovary cells." Enzyme and Microbial Technology 39(3): 362-365. Yoon, S. K., J. Y. Song and G. M. Lee (2003). "Effect of low culture temperature on specific productivity, transcription level, and heterogeneity of erythropoietin in chinese hamster ovary cells." Biotechnology and Bioengineering 82(3): 289-298. Yoshimura, H., A. Inaguma, T. Yamada and T. Ozawa (2012). "Fluorescent Probes for Imaging Endogenous beta-Actin mRNA in Living Cells Using Fluorescent Protein- Tagged Pumilio." Acs Chemical Biology 7(6): 999-1005. Yu, Y. H., Y. Y. Zhang, D. D. Sabatini and G. Kreibich (1989). "Reconstitution of translocation- competent membrane-vesicles from detergent-solubilized dog pancreas rough microsomes." Proceedings of the National Academy of Sciences of the United States of America 86(24): 9931-9935.

287

Zhang, F., A. R. Frost, M. P. Blundell, O. Bales, M. N. Antoniou and A. J. Thrasher (2010). "A Ubiquitous Chromatin Opening Element (UCOE) Confers Resistance to DNA Methylation- mediated Silencing of Lentiviral Vectors." Molecular Therapy 18(9): 1640-1649. Zhang, F., X.-P. Yi, X.-M. Sun and Y.-X. Zhang (2006). "Metabolism of recombinant CHO-GS cell reducing of toxic effect of ammonia." Sheng Wu Gong Cheng Xue Bao 22(1): 94-100. Zhang, J., X. Liu, A. Bell, R. To, T. N. Baral, A. Azizi, J. Li, B. Cass and Y. Durocher (2009). "Transient expression and purification of chimeric heavy chain antibodies." Protein Expression and Purification 65(1): 77-82. Zhang, K. L., J. C. Luo and C. Q. Liu (2005). "Exploring consensus mRNA secondary (folding) structure units by stochastic sampling and folding simulation." Journal of Molecular Structure- Theochem 715(1-3): 15-20. Zhang, L., Q. X. Leng and A. J. Mixson (2005). "Alteration in the IL-2 signal peptide affects secretion of proteins in vitro and in vivo." Journal of Gene Medicine 7(3): 354-365. Zhao, X., Y. Yu, Z. Zhao, J. Guo, L. Fu, T. Yu, L. Hou, S. Yi and W. Chen (2012). "Establishment of Tetracycline-Inducible, Survivin-Expressing CHO Cell Lines by an Optimized Screening Method." Bioscience Biotechnology and Biochemistry 76(10): 1909-1912. Zhou, H., Z.-g. Liu, Z.-w. Sun, Y. Huang and W.-y. Yu (2010). "Generation of stable cell lines by site-specific integration of transgenes into engineered Chinese hamster ovary strains using an FLP-FRT system." Journal of Biotechnology 147(2): 122-129. Zubay, G. (1973). "In-vitro synthesis of protein in microbial systems." Annual Review of Genetics 7: 267-287.

288

APPENDICES Appendix I: Suppliers of reagents, materials and equipment

Bacterial cell lines, phage and phage libraries

Dr A. J. Dickson, University of Manchester, UK E. coli DH5α strain (genotype F-, φ80dlacZΔM15, Δ (lacZYA-argF) U169, deoR,recA1, endA1, hsdR17(rk-, mk+), phoA, supE44, λ-, thi-1, gyrA96, relA1)

LifeTechnologies™ MaxEfficiency® DH5α® competent cells

GlaxoSmithKline, Stevenage, UK TG1 E.coli M13 phage

Domantis, Stevenage, UK

4G phage library (VHS, VHM, VHL, Vκ)

Mammalian cell lines

GlaxoSmithKline, Stevenage, UK HEK293E CHO-DG44 (DHFR negative)

Dr Lisa Swanton, Univeristy of Manchester, UK HEK293T

Plasmids

GlaxoSmithKline, Stevenage, UK pTT5 (MAO111, MAO112, MJM HC mAbdAb, SJC208, SJC209) pDOM5 RSV (MNB001, MNB002) LifeTechnologies™ pcDNA3.1+

289

Media, supplements and transfection reagents

BD biosciences, UK Difco™ TC Yeastolate

LifeTechnologies™, UK Freestyle™ 293E Opti-MEM® 293-Fectin™ CD CHO CD OptiCHO CD DG44 Hypoxanthine (HT) supplement

GlaxoSmithKline, Stevenage, UK GEM103D G68

Sigma-Aldrich, UK DMEM (with glutamine) Fetal bovine serum (FBS) Trypsin EDTA

Chemicals, solvents and kits

Abcam, UK Anti-IgG Affibody® Molecule (Biotin) Mouse anti-Ubiquitin (P4D1) monoclonal

Bioline, UK Hyperladder I™ to 10KB Hyperladder V™ to 500bp Biotaq™ PCR kit Tetro cDNA synthesis kit dNTP set

Eurofins MGW Operon, Germany Oligonucleotide primers

Fluka Analytical, UK Crystalline hen egg white lysozyme (HEWL) powder

GeneArt® gene synthesis service, UK CDR3 swapped dAb sequence synthesis

Gyros®, UK Rexxip F detection reagent diluent Hyclone, UK Molecular Biology Grade Water

290

Johnson and Johsons, UK Precept disinfectant tablets

Li-cor, UK Goat anti-human IgG (H+L) IRDye800CW Donkey anti-mouse IRDye800CW

LifeTechnologies, UK Dynabeads® M-280 Streptavadin Phenol:Chloro:Isoamylalcohol (25:24:1) solution Trypan blue

Melford laboratories Ltd., UK Agar Agarose Tryptone Yeast extract

National Diagnostics, USA Protogel solution

New England Biolabs, UK Calf intestine phosphatase (CIP) Instant sticky end ligase Restriction enzymes Prestained protein marker, broad range (7-175 kDa)

PerkinElmer, UK 35S Methionine

Promega, UK Canine Pancreatic Microsomal Membranes Nuclease-treated rabbit reticulate lysate system (kit) rNTP kit RNAsin T7 RNA polymerase T7 RNA polymerase transcription buffer

Santa Cruz Bitochnology Inc., USA Mouse anti-ERK2 (6H3)monoclonal

Qiagen Ltd., UK Gel extraction kit High-speed Plasmid Maxi Kit PCR Purification Kit RNA Extraction Kit Qiagen Plasmid Mini Kit

291

Sigma-Aldrich, UK 3,3',5,5'-Tetramethylbensidine (TMB) tablets Ampicillin Ammonium persulphate Β-mercaptoethanol Boric acid Bovine serum albumin (BSA) Bromophenol blue Calcium chloride Dithiothreitol (DTT) DEPC (diethylpyrocarbonate) DMSO (dimethyl sulphoxide) DNAseI kit Glucose Hydrogen peroxide Magnesium acetate Magnesium chloride Manganese chloride tetrahydrate Magnesium sulphate heptahydrate PBS (phosphate buffer saline) tablets PIPES Polyethylene glycol Ponceau-S Potassium Acetate Potassium chloride Potassium hydroxide Sodium acetate Sodium citrate Sucrose TEMED (N,N,N,N’,N’-Tetramethyl-Ethylenediamine) Trizma™ base Tween-20 T-8642 Type XIII from Bovine Pancreas Tetracycline

Stratech, UK Goat anti-human IgG Fab-HRP antibody Goat anti-human IgG Fc fragment specific antibody

Thermoscientific, UK EDTA EZ-link NHS sulpho biotin kit Glacial acetic acid Glycerol Glycine HEPES Concentrated Hydrocloric acid Methanol

292

Sodium chloride SDS (sodium dodecyl sulphate) Sodium hydroxide pellets Sulphuric acid

Marvel™ skimmed milk powder can be purchased in supermarkets F(ab)2 anti human IgG Kappa light chain Alexa 647 was kindly donated by Jane Clarkson, GlaxoSmithKline, Stevenage Bortezomib (Velcrade®) was kindly donated by Dr Lisa Swanton, University of Manchester, UK

Apparatus and Software

General glassware and disposable plastics were purchased from standard suppliers. Specific materials were purchased from the following suppliers:

Abgene, UK 96-well skirted PCR plates

Beckmann-Coulter, USA ViCell® automated cell counter

BioTEK, UK BioTEK Power 340 plate reader Gen5 Software

Bio-rad Laboratories Ltd., UK Mini-gel II Slab System Extra Thick blot paper Trans-blot semi- dry transfer cell Gene Pulser Xcell™ Electroporation system GenePulser 0.2cm electroporation cuvettes Mini-PROTEAN Tetra system

Carl Zeiss, Germany Axiovert 35 light microscope

Corning Inc. Life Sciences, USA 12-well tissue culture plates 125ml vented shake flasks T75 tissue culture flasks BD low-evaporation non-coated flat bottom plate Falcon tubes

DNAstar Lasergene, UK Seqman Megalign Protean

293

GE Healthcare, UK Biacore 4000 Biacore 4000 evaluation software 1.0 CM5 Biacore chip

Gyros, UK BioAffy HC 20 CD Gyros plate sealers Gyrolab Workstation

IBIS Biosciences, USA Bioedit

LifeTechnologies, UK Countess® automated cell counter Countess® slides

Li-Cor, UK Odessy scanner

LTE Scientific Ltd., UK Autoclave (Series 250)

Millipore, USA 0.22μM filter

Molecular Devices, USA QPix 400 automated colony picker

NIH, USA Image J densiometry analysis software

SnapGene, UK SnapGene Viewer

ThemoScientific, UK Nunc 1.8ml cryotubes Nunc 96 well MaxiSorp plates Mr.Frosty™ freezing container TiteTops adhesive plate sealers

Whatman Biosystems Ltd., UK 3mm filter paper

294

Appendix II: Sequences identified during phage display selection

Table A2.1. CDR sequences of randomly selected VHS dAb library phage clones during passive selection. DNA from a sample of 22 randomly selected clones was prepared for the VHS dAb library after each round of selection as described in Section 2.2.9, subject to

DNA sequence analysis (Section 2.3.14.1) and aligned in DNAstar lasergene 8. Amino acid sequences were predicted using Megalign. No of clones is the number of sequence reads identified with the same nucleotide sequence and % Unique is the percentage of clones with unique sequences identified.

295

Table A2.2. CDR sequences of randomly selected VHM dAb library phage clones during passive selection. DNA from a sample of 22 randomly selected clones was prepared for the VHM dAb library after each round of selection as described in Section 2.2.9, subject to

DNA sequence analysis (Section 2.3.14.1) and aligned in DNAstar lasergene 8. Amino acid sequences were predicted using Megalign. Noof clones is the number of sequence reads identified with the same nucleotide sequence and % Unique is the percentage of clones with unique sequences identified.

296

Table A2.3. CDR sequences of randomly selected VHL dAb library phage clones during passive selection. DNA from a sample of 22 randomly selected clones was prepared for the VHL dAb library after each round of selection as described in Section 2.2.9, subject to DNA sequence analysis (Section 2.3.14.1) and aligned in DNAstar lasergene 8. Amino acid sequences were predicted using Megalign. Noof clones is the number of sequence reads identified with the same nucleotide sequence and % Unique is the percentage of clones with unique sequences identified.

297

Table A2.4. CDR sequences of randomly selected VK dAb library phage clones during passive selection. DNA from a sample of 22 randomly selected clones was prepared for the

VK dAb library after each round of selection as described in Section 2.2.9, subject to DNA sequence analysis (Section 2.3.14.1) and aligned in DNAstar lasergene 8. Amino acid sequences were predicted using Megalign. No of clones is the number of sequence reads identified with the same nucleotide sequence and % Unique is the percentage of clones with unique sequences identified.

298

Table A2.5. CDR sequences of randomly selected VHS dAb library phage clones during soluble selection. DNA from a sample of 22 randomly selected clones was prepared for the

VHS dAb library after each round of selection as described in Section 2.2.9, subject to DNA sequence analysis (Section 2.3.14.1) and aligned in DNAstar lasergene 8. Amino acid sequences were predicted using Megalign. Noof clones is the number of sequence reads identified with the same nucleotide sequence and % Unique is the percentage of clones with unique sequences identified.

299

Table A2.6 CDR sequences of randomly selected VHM dAb library phage clones during soluble selection. DNA from a sample of 22 randomly selected clones was prepared for the

VHM dAb library after each round of selection as described in Section 2.2.9, subject to DNA sequence analysis (Section 2.3.14.1) and aligned in DNAstar lasergene 8. Amino acid sequences were predicted using Megalign. Noof clones is the number of sequence reads identified with the same nucleotide sequence and % Unique is the percentage of clones with unique sequences identified.

300

Table A2.7. CDR sequences of randomly selected VHL dAb library phage clones during soluble selection. DNA from a sample of 22 randomly selected clones was prepared for the

VHL dAb library after each round of selection as described in Section 2.2.9, subject to DNA sequence analysis (Section 2.3.14.1) and aligned in DNAstar lasergene 8. Amino acid sequences were predicted using Megalign. Noof clones is the number of sequence reads identified with the same nucleotide sequence and % Unique is the percentage of clones with unique sequences identified.

301

Table A2.8. CDR sequences of randomly selected VK dAb library phage clones during soluble selection. DNA from a sample of 22 randomly selected clones was prepared for the VK dAb library after each round of selection as described in Section 2.2.9, subject to DNA sequence analysis (Section 2.3.14.1) and aligned in DNAstar lasergene 8. Amino acid sequences were predicted using Megalign. No of clones is the number of sequence reads identified with the same nucleotide sequence and % Unique is the percentage of clones with unique sequences identified.

302

Figure A2.1 Sequence alignments of predicted amino acid sequence of the 50 unique dAbs obtained from passive and soluble selection. HEWL-specific dAbs were selected through passive

(Section 2.2.2) and soluble (Section 2.2.3) phage selection. Amplified phage in TG1 E.coli (Section

2.2.6) from round 3 passive and round 2 soluble were cloned into the CEG1 expression vector

(Section 2.3.11) and subjected to DNA sequencing (Section 2.3.14.1). Nucleotide sequences were aligned in DNAstar lasergene 8. Amino acid sequences were predicted using Megalign and final sequences aligned in BioEdit using Clustal W multiple alignment.

303

. . R ...... S ...... S ...... K ...... V ...... I ...... T ...... | E ...... | V ...... V ...... 120 . L ...... K ...... T ...... T ...... G ...... G ...... Q ...... | G ...... | Q ...... 100 . W ...... G ...... Y ...... F ...... S . . . . D ...... T ...... F ...... N Y Y S K F L I L L Y L | A G Q L I I K - - Q T P - . S I R E H G G S T G N G Q G G P R E - E R . L I Q S | P ...... 110 . - P Q - A M Q - - A A R - - T A S T L R R - V N A N P G - R - S - - G - D P D L . T Y F F H E R Y Y R W F . - Y - - P P S - - - P G - - - P P S T H H - S E P E G F - R - Y - - P - - F G G . S . A H R Y L D Q R M V . - R ------S - - V V Y - - - G T - T N ------N D - N A . - T ------. Y H A A R . K W . S S . | - F ------M ------P . S V W D R R Y F H H D D . - K ------Y - - Y - - - - F - W - W T F - - - - L - - Y N - K K | Q ...... 90 . G V ------S - - R - P - - S - P - P H P - - - - K - - N N - N K . Q ...... Y A - - - - - D M - - - A . - - . R S K K A L - - - A T K - N - D S D . T - L W . C ...... S W . M - - - P G - - - A - E - - Q M Y Y P H - - - . F R - D R V T D P L - . L . Y ...... | - E H P - - K G G P - - D - S - N G S K K G R - - - T T G - G W S G V N S - T S 100 . Y ...... - H G E E E G S I E E R D F E E D L S R R R H P E P Y V F E D N P M M T Y D Y P . K E ...... E ...... E E E ...... E . . . . Q . . E . . | T ...... A ...... A ...... C ...... F ...... | Y ...... D ...... Y ...... E ...... V ...... | P ...... A ...... 80 . Q ...... T ...... | D ...... L ...... 90 . E ...... S ...... A ...... S ...... R ...... | I ...... L ...... T ...... | S ...... L ...... N ...... T ...... M ...... F ...... Q ...... L ...... | D ...... 70 | Y ...... T ...... 80 . L ...... G ...... T ...... A ...... S ...... N ...... G ...... K ...... | S ...... | S ...... G ...... N ...... D ...... S I . . . . . G . . . . . R ...... F ...... S ...... R ...... | I ...... 70 | S ...... 60 . T ...... P ...... F ...... L ...... V ...... R ...... G E ...... G ...... | K ...... S ...... V ...... | Q . . . . . P . . . R . . S ...... L ...... D ...... S Q T E I E Y R H W D N . A ...... S ...... | Y ...... 60 . A V I V G . S G . S S G . Y ...... | A R G G H W N R W N D W . T ...... 50 . S V H Y T N Q R L L H M A V H N A Y P D Y D F T F . L F V T Y . R T V K F R . M . Y ...... G N A V R S . M E R T K F H T L Q K Q N M L . A S H S L S T K N Q Q N A . D H Y . I ...... | G ...... L ...... S D . D A . Y H K Q H . H D H Q T . Q V . G . F G G H W D D G D D T D D D . R T . L ...... G R A A P P S V D A R K P Y K . P M P P P P P A P P A Q I S P P P P H A A M A P | K ...... R . . S K N T . . D D . D . . T T T T . D G N G E G . . . L D G E . T D D T . . N . D . P ...... I ...... A ...... | A S S G T T S E E S T T . S S S T T T . T S S T T S S R S G S T R Q L D H S . H 50 . K ...... S ...... V ...... G ...... W ...... | P ...... 40 . E ...... K ...... | L ...... P ...... Q ...... G ...... Q ...... K ...... Y ...... G ...... | W ...... P ...... | A ...... N H . . . L E M . E Q S 40 . Q ...... L ...... R ...... Y W G A K L A E M N S L . V ...... A . . A . . . . . S T N L D D R R D R R D . W ...... | S R . W K E G G M D R E | S V F E E E Y Q Y E E . Q G A E G A G G E T A V E E A D M Y R N Q E G G E K A E 30 . I ...... M ...... S N F D . N . P T N N N . A D T S T Q S G P S D E S D K T D D S W H E Q D T T S . Y N G V N H E R G D E R . Y ...... Q ...... S L K D R A R R R N R V E Y A A R E D P M Y G D V M Q D D K G R A W Y W . W Y Y . S ...... | S G . Y A G A . . . . P . . T K K N F N G D A E D . T T Q A Y A N G R H H G D P | A ...... 30 . F ...... R ...... T ...... C ...... F ...... T ...... G ...... I ...... | S ...... A ...... T ...... | T ...... 20 . A ...... V ...... C ...... R ...... S ...... D ...... | L ...... 20 . G ...... R ...... | V ...... L ...... S ...... S ...... A ...... G ...... | G ...... S ...... P ...... L ...... Q ...... | S ...... 10 . V ...... S ...... L ...... P ...... | G ...... 10 . S ...... G ...... Q ...... G ...... S ...... | T ...... E ...... V ...... M ...... | L ...... S ...... Q ...... L ...... I ...... Q ...... D ...... V ...... E ...... VH Dummy H014 H020 H025 H018 H017 H032 H006 H007 H008 H009 H010 H012 H068 H114 H042 H015 H019 H029 H050 H031 H049 H035 H047 H048 H078 H093 H100 H080 H081 H092 H085 H101 H098 H105 H095 H109 H086 H082 H091 Vk Dummy K001 K005 K003 K004 K007 K010 K012 K013 K015 K016 K017

304

Appendix III: Vector maps for transient, stable and in vitro expression

Figure A3.1 Vector maps for the generation of transient pTT5 vectors. Vectors were digested using the enzymes indicated on the map (underlined) Section 2.3.7. Digests were migrated on a

1% agarose gel (Section 2.3.8) and the appropriate backbone or insert band gel purified

(Section 2.3.9) prior to ligation (Section 2.3.10). Vector maps were generated using SnapGene.

All vectors were supplied by GSK. A. mAbdAb pTT5 backbone vector with dAb site. B.

Alemtuzumab variable heavy chain insert vector. C. CEG1 mAbdAb heavy chain vector with dAb acceptor site. D. PDOM4 phage vector containing HEWL-specific dAbs. E. Light chain pTT5 backbone vector. F. Alemtuzumab variable light chain insert vector. G. CEG2 Alemtuzumab LC pTT5 vector. H. Heavy chain pTT5 backbone vector without dAb site. I. Alemtuzumab heavy chain vector without liker or dAb.

305

gIII

M13ori

tag

Myc Myc

Not

dAb

TET

in pDOM4 in

~9270bp

Sal

VH and V and VH

GAS

leader

colE1 ori colE1

RBS

geneIII geneIII

promoter

D A

306

E H 307

Figure A3.2 Vectors used in stable cell line generation. Vectors were digested using the enzymes indicated on the map (underlined) Section 2.3.7. Digests were migrated on a 1% [w/v] agarose gel

(Section 2.3.8) and the appropriate backbone or insert band gel purified (Section 2.3.9) prior to ligation (Section 2.3.10). Stable vectors were linearized prior to transfection using the single cutting restriction enzyme Adh I. Vector maps were generated using SnapGene. All vectors were supplied by

GSK. A. Stable mAbdAb heavy chain backbone vector. B. Stable mAbdAb heavy chain vector (CEG1 insert vector). C. Stable Alemtuzumab heavy chain vector (CEG3 insert vector). D. Stable LC vector backbone. E. Stable LC vector (CEG2 insert vector).

308

A D

309

Figure A3.3 Vectors used in cell free translation. Vectors were digested using the enzymes indicated on the map (underlined) Section 2.3.7. Digests were migrated on a 1% agarose gel

(Section 2.3.8) and the appropriate backbone or insert band gel purified (Section 2.3.9) prior to ligation (Section 2.3.10). Vector maps were generated using SnapGene. A. pcDNA3.1 (+) backbone vector. B. pcDNA3.1 (+) mAbdAb heavy chain vector (CEG4 insert vector). C. pcDNA3.1 (+) Alemtuzumab heavy chain vector (CEG6 insert vector).

310

311

Appendix IV: Computational analyses to predict poor expression

Figure A4.1 dAb mRNA secondary structures of a high and low expressing mAbdAb compared to the structure of Alemtuzumab VH. Three mRNA secondary structures were predicted for each construct from nucleotide sequence using the MatthewsLab webserver (Section 2.8.1). A.

Alemtuzumab VH. B. H014 (high expressing) dAb. C. H092.

312

Figure A4.2 Correlation of dAb mRNA free energy and expression titre in HEK transient and CHO stable cells. Three mRNA secondary structures were predicted for each construct from nucleotide sequence using the MatthewsLab webserver (Section 2.8.1). The average free energy required to fold these structures was correlated to HEK transient (Section 2.5.1.1) and CHO stable expression titres.

Linear regression analyses were performed in Microsoft Excel. A. Correlation of VH dAbs (VHS, VHM and

VHL) to HEK transient expression titre. B. Correlation of VK dAbs to HEK transient expression titre. C.

Correlation of VH dAbs (VHS, VHM and VHL) to CHO stable expression titre. D. Correlation of VK dAbs to

CHO stable expression titre. Key to Figure: Passive VH dAbs, transient titres, soluble VH dAbs, transient titres, passive and soluble VH dAbs, stable titres, passive VK dAbs, transient titres,

soluble VK dAbs, transient titres, Alemtuzumab VH, Alemtuzumab VK.

313

Figure A4.3. Correlation of codon adaption index (CAI) with CHO expression titres. Codon adaption index was determined as described in Section 2.8.3 using full mAbdAb nucleotide sequences. Key to Figure: mAbdAb, Alemtuzumab HC, Alemtuzumab LC.

314

Figure A4.4 Physicochemical properties of dAbs correlated to mAbdAb expression in HEK transient cells. Physicochemical property analysis was performed as described in Section 2.8.2 and correlated to HEK expression titres obtained by Gyros quantification (Section 2.5.1.1). Linear regression analysis was performed in Microsoft Excel, prominent R2 values are indicated. The physicochemical properties are A. Isoelectric point. B. Charge at pH7. C. Hydrophobicity. D. %

Charged amino acids. E. % Hydrophobic amino acids. F. % Acidic amino acids. G. % Polar amino acids. H. Correlation of HEWL specificity values obtained by binding ELISA (Section 2.5.2.1) to HEK transient expression titres. Key to Figure: VH (VHS, VHM, VHL) dAbs from passive selection, VK dAbs from passive selection, VH dAbs from soluble selection, VK dAbs from soluble selection.

315

316

Appendix V: Sensorgrams of BIAcore analysis of dAb binding to HEWL

Figure A5.1 Example sensorgram data for BIAcore analysis of mAbdAb binding to HEWL.

HEK293E cells were transiently transfected as described in Section 2.4.2.2 and supernantant samples taken as described in Section 2.4.1.5 on day 3 post-transfection. Supernatant samples were then used for BIAcore analysis as described in Section 2.5.2.2 using HEWL (the ligand for the dAb domain). Sensorgrams were chosen to represent the different binding kinetic profiles observed during binding of dAbs to the HEWL ligand. A. H014 B. K008 C. H025 D. H020

317

Appendix VI: Optimisation of RT-PCR analysis of HC, LC and B2M gene expression

Figure A6.1 Optimisation of RT-PCR of cDNA dilutions. CHO DG44 suspension cells were

transfected with the H014 mAbdAb construct as described in Section 2.4.3.3 and batch

cultures performed as described in Section 2.4.3.4. RNA samples were taken on day 6 of

batch culture as described in Section 2.6.1, treated with DNAseI as described in Section

2.6.2 and reverse-transcribed to cDNA as described in Section 2.6.4. A total of 1µg of cDNA

was used for the undiluted sample and cDNA was diluted 1:6 in DEPC treated H20 and

serially diluted 1:2 to a dilution of 1:48 in DEPC treated H20. RT-PCR analysis was performed

as described in Section 2.6.5 and products were migrated on a 2% [w/v] agarose gel as

described in Section 2.3.8. Band density was then measured by densitometric analysis as

described in Section 2.6.6. A. Representative 2% [w/v] agarose gel electrophoresis of

variable heavy chain, variable light chain and B2M RT-PCR products after 30 amplification

cycles. B. Correlation of cDNA dilution with band intensity. Key to Figure: Variable heavy

chain (VH) mRNA, variable light chain (VL) mRNA, B2M mRNA. A dilution of 1:12 (cDNA:

H20) was used for all subsequent RT-PCR reactions.

318