Hyperglycemia Abrogates Ischemic Postconditioning Cardioprotection by Impairing Adipor1/Caveolin-3/STAT3 Signaling in Diabetic Rats

942 Diabetes Volume 65, April 2016

Haobo Li,1,2 Weifeng Yao,2 Zipeng Liu,2,3 Aimin Xu,1,4 Yu Huang,1,5 Xin-liang Ma,6 Michael G. Irwin,2 and Zhengyuan Xia1,2

Hyperglycemia Abrogates Ischemic Postconditioning Cardioprotection by Impairing AdipoR1/Caveolin-3/STAT3 Signaling in Diabetic Rats

Diabetes 2016;65:942–955 | DOI: 10.2337/db15-0782

Signal transducer and activator of transcription 3 Myocardial infarction is a major perioperative complica- (STAT3) activation is key for ischemic postconditioning tion in patients with diabetes (1). Reperfusion therapies (IPo) to attenuate myocardial ischemia-reperfusion restore coronary ﬂow but may cause lethal tissue injury, injury (MIRI), but IPo loses cardioprotection in diabe- called “reperfusion injury.” Ischemic postconditioning tes in which cardiac STAT3 activation is impaired and (IPo), the phenomenon that brief repetitive episodes of adiponectin (APN) reduced. We found that IPo increased ischemia and reperfusion (IR) at the immediate onset of postischemic cardiomyocyte-derived APN, activated reperfusion, can protect the hearts against myocardial mitochondrial STAT3 (mitoSTAT3), improved mitochon- IR injury (MIRI) (2), which needs to activate signal drial function, and attenuated MIRI in wild-type but not 2/2 transducer and activator of transcription 3 (STAT3) (3). in APN knockout (Adipo ) mice subjected to 30 min However, how IPo activates STAT3 remains unclear. In coronary occlusion, followed by 2 or 24 h of reperfusion. addition,heartsfromsubjectswithdiabetesarelessor Hypoxic postconditioning–induced protection against not sensitive to IPo, and the mechanism is unknown (4). hypoxia/reoxygenation injury was lost in Adipo2/2 car- The reduction of myocardial STAT3 activation in diabetes diomyocytes but restored by recombinant APN, but

SIGNAL TRANSDUCTION and the subsequent reduction of myocardial nitric oxide this APN beneficial effect was abolished by specific (NO) bioavailability (5) may be primarily responsible for STAT3 or APN receptor 1 (AdipoR1) gene knockdown, or caveolin-3 (Cav3) disruption. APN activated cardiac the loss of myocardial sensitivity to IPo (4). STAT3 and restored IPo cardioprotection in 4-week di- Adiponectin (APN), an adipocyte-derived plasma pro- abetic rats where AdipoR1 and Cav3 were functionally tein with antidiabetic properties, protects against MIRI interactive but not in 8-week diabetic rats whose car- by reducing myocardial oxidative/nitrative stress and diac Cav3 was severely reduced and AdipoR1/Cav3 activating endothelial nitric oxide synthase (eNOS) and signaling impaired. We concluded that IPo activates increasing NO bioavailability (6), which requires the in- mitoSTAT3 through APN/AdipoR1/Cav3 pathway to teraction of caveolin-3 (Cav3), the structural protein for confer cardioprotection, whereas in diabetes, IPo loses caveolae, which are flask-shaped plasma membrane invag- cardioprotection due to impaired APN/AdipoR1/Cav3 inations, and APN receptor 1 (AdipoR1), the predominant signaling. Therefore, effective means that may concom- APN receptor expressed in cardiomyocytes (7). In cultured itantly activate APN and repair APN signaling (i.e., adult mouse cardiac fibroblasts, APN activates STAT3 (8). AdipoR1/Cav3) in diabetes may represent promising However, whether APN can activate or facilitate the acti- avenues in the treatment of MIRI in diabetes. vation of STAT3 in cardiomyocytes in the context of MIRI

1State Key Laboratory of Pharmaceutical Biotechnology, The University of Hong Received 9 June 2015 and accepted 12 December 2015. Kong, Hong Kong, China This article contains Supplementary Data online at http://diabetes 2 Department of Anesthesiology, The University of Hong Kong, Hong Kong, China .diabetesjournals.org/lookup/suppl/doi:10.2337/db15-0782/-/DC1. 3Centre for Genomic Sciences, The University of Hong Kong, Hong Kong, China © 2016 by the American Diabetes Association. Readers may use this article as 4Department of Medicine, The University of Hong Kong, Hong Kong, China long as the work is properly cited, the use is educational and not for profit, and 5Institute of Vascular Medicine and Li Ka Shing Institute of Health Sciences, The the work is not altered. Chinese University of Hong Kong, Hong Kong, China 6Department of Emergency Medicine, Thomas Jefferson University, Philadelphia, PA See accompanying article, p. 826. Corresponding author: Zhengyuan Xia, [email protected]. diabetes.diabetesjournals.org Li and Associates 943 in nondiabetic and especially in diabetic conditions, a Evans blue/2,3,5-triphenyl-2H-tetrazolium chloride (TTC) pathological condition that is accompanied with increased staining, as previously described (9), and the operators oxidative stress, is unknown. Nevertheless, the properties were blinded to the information of study design and in- of APN (i.e., activating STAT3 and enhancing NO bioavail- tervention. Global cardiac functions were monitored by ability) suggest that APN may play significant roles in the using a pressure-volume conductance catheter and ana- cardioprotective actions of IPo. Furthermore, the finding lyzed using LabChart 8 software (ADInstruments, Colorado that antioxidant treatment enhanced STAT3 activation in Springs, CO), as we described previously (19). the heart of diabetic rats through APN signaling (9) sug- gests that malfunction of APN might be a key mechanism Detection of Myocardial Apoptosis that rendered the diabetic heart less or not responsive to Myocardial apoptosis was determined by TUNEL staining IPo cardioprotection. In addition, cardioprotective effects using an In Situ Cell Death Detection Kit (Roche Diagnostics of APN were diminished in high-fat diet–induced diabetes GmbH, Mannheim, Germany), as previously described (10,11), in which Cav3 is downregulated (12). This, to- (20). The sections were observed in the light microscope fi by an investigator who was initially blinded to treatment gether with our recent nding that Cav3 is disrupted (13) fi and STAT3 inactivated (9), which deranged eNOS signal- groups. Five randomly selected elds of each slide were ing in diabetic myocardium with concomitantly reduced analyzed, and the apoptotic index was calculated as a APN (9), indicates that APN signaling (e.g., AdipoR1/Cav3) percentage of apoptotic nuclei to total nuclei. is impaired in diabetes. Although AdipoR1 (14,15) and Electron Microscopic Analysis STAT3 (16) have both been shown to be important procell Heart tissues were fixed with 2.5% glutaraldehyde in 0.1 survival factors in multiple cells, their potential interplay mol/L phosphate buffer (pH 7.4), followed by 1% OsO4. in affecting postischemic cell survival in general and spe- After dehydration, thin sections were stained with uranyl fi ci cally in affecting the myocardial responsiveness to IPo acetate and lead citrate for observation under a JEM cardioprotection in diabetes is unknown. We hypothe- 1011CX electron microscope. Images were acquired digitally. sized that the impairment of cardiac APN signaling is responsible for the inactivation of STAT3 in diabetes that Induction of Diabetes and APN Adenovirus Infection disables the ability of the diabetic heart to respond to IPo Type 1 diabetes was induced via signal tail-vein injection and that an intact or adequate AdipoR1/Cav3 interaction of streptozocin (STZ) (65 mg/kg; Sigma-Aldrich, St. Louis, is critical for IPo to activate STAT3 via APN. MO), as previously described (21). One week after STZ injection, rats exhibiting hyperglycemia (blood glucose $ RESEARCH DESIGN AND METHODS 16.7 mmol/L) were considered diabetic and subjected to outlined experiments. Recombinant APN adenovirus Experimental Animals (1*109 plaque-forming units) was used to overexpress APN Male Sprague-Dawley rats (250 6 8g,6–8 weeks) were in vivo, and luciferase was used as the control, which were obtained from the Laboratory Animal Unit (The Univer- 2 2 injected by tail vein into rats 1 week before inducing IR, sity of Hong Kong). Male APN knockout (Adipo / ) mice as previously described (19). (6–8 weeks) with a C57BL/6J background and age- matched wild-type (WT) control mice with the same ge- Measurement of Mitochondrial Respiratory Chain netic background were generated as previously described Complex Activities (17). All of the experiments were conducted in adherence At the end of experiments, heart tissues were immediately with the National Institutes of Health Guide for the Care collected for cardiac mitochondria isolation according and Use of Laboratory Animals and were approved by the to the manufacturer’s protocol per the mitochondria ex- Institutional Animal Care and Use Committee. traction kit (Thermo Fisher Scientific, Chicago, IL). The resulting mitochondrial pellets were resuspended in Tris- MIRI and IPo In Vivo hydroxymethyl aminomethane solution (pH 8.0) and kept After anesthesia, animals were randomized to receive at 280°C for subsequent measurements of mitochondrial sham operation, myocardial IR, or IPo. Myocardial IR was respiratory chain complex activities (complex I-V), as induced by temporarily exteriorizing the heart via a left previously described (22). thoracic incision, and the left anterior descending coronary artery was occluded for 30 min, followed by Determination of 15-F2t-Isoprostane, NO, reperfusion for 2 h (to assess postischemic mRNA and Nitrotyrosine, ATP Content, and Reactive Oxygen protein expressions of cardiac APN and other signaling Species molecules) or 24 h (to assess postischemic cardiac func- Cardiac tissue (area at risk) was rinsed and homogenized. tion, myocardial injury, and infarct size) (6). IPo was pro- Plasma and heart tissue free 15-F2t-isoprostane (15-F2t- duced by three cycles of 10 s of reocclusion and 10 s of IsoP) was measured using immunoassay kits (Cayman reperfusion immediately after ischemia (18). Chemical, Ann Arbor, MI), as previously described (23). 2 2 All assays were performed using tissue from IR area or Concentrations of nitrites (NO2 )andnitrates(NO3 ) an area at risk identified with Evans blue negative were determined by the Griess reaction, as previously staining. Myocardial infarct size was determined by the described (13). Myocardial nitrotyrosine levels were 944 Adiponectin in Ischemic Postconditioning Diabetes Volume 65, April 2016 determined using the Nitrotyrosine Assay Kit (Millipore) 0.1%. Reoxygenation was achieved by exposing cells to according to the manufacturer’s protocol. Myocardial ATP room air (9). content was measured using an ATP ELISA kit (Cloud- At the end of treatments, cells were fixed for immu- Clone, Houston, TX). Superoxide generation in cultured nofluorescence staining, as described below, or collected cardiomyocytes was estimated by dihydroethidium (DHE) andsnapfrozeninliquidN2 for future analysis. Lactate staining, as previously described (24). dehydrogenase (LDH) release in culture medium was de- tected via a commercial LDH kit (Roche, Mannheim, Quantitative Real-Time PCR for Mitochondrial DNA Tfam, Nrf1, and Ppargc1a Germany) (13). After the experiments were completed, Cardiac DNA was extracted from frozen heart tissues with cultured cardiomyocytes were homogenized in lysis TaKaRa Genomic DNA Extraction Kit (TaKaRa Bio, Inc., buffer. The protein concentration was determined via a Shiga, Japan). Quantitative real-time PCR was performed Lowry assay kit (Bio-Rad, Hercules, CA). Concentrations using SYBR Green QPCR system (TaKaRa Bio, Inc.) with of APN were determined by a commercially available specific primers, mouse nuclear DNA (nDNA) contam- APN EIA kit (Antibody and Immunoassay Services, Hong ination nDNA forward: ATGGAAAGCCTGCCATCATG, re- Kong)(22).APNlevelswereexpressed as nanogram per verse: TCCTTGTTGTTCAGCATCAC; mitochondrial DNA microgram of protein. (mtDNA) forward: CCTATCACCCTTGCCATCAT, reverse: Immunoprecipitation GAGGCTGTTGCTTGTGTGAC. The PCR reactions were Isolated cardiomyocytes or heart tissue were homoge- performed using an Applied Biosystems Prism 7000 nized in lysis buffer. A total of 500 mg extracts were Sequence Detection System. Relative quantification of the subjected to immunoprecipitation with 2 mg Cav3 copy number of mtDNA was analyzed using nDNA as the primary antibody in the presence of 20 mL protein A/G standard. Total RNA was extracted using TRIzol (Invi- PLUS-agarose. After extensive PBS washes, the immuno- trogen Life Technologies, Carlsbad, CA), and quantitative precipitates were denatured with SDS loading buffer and real-time PCR was performed with a SYBR Green PCT analyzed for AdipoR1 or APN receptor 2 (AdipoR2) Master Mix (TaKaRa Bio, Inc.) on a Applied Biosystems expression by Western blot, as described below. Prism 7000 Sequence Detection System. Gene-specific fl primers were as follows: Immuno uorescence Isolated cardiomyocytes were incubated in Medium 199 mouse Tfam forward: 59-TCAGGAGCAGCAGGCACTACA-39, and subjected to various treatments. Thereafter, cells were reverse: 59-CTGAGCTCC GAGTCCTTGAACAC-39; fixed and blocked with 10% goat serum and further mouse Nrf1 forward: 59-GATGCTTCAGAACTGCCAACCA-39, incubated with a mixture of mouse against rat Cav3 reverse: 59GGTCATTTCACCGCCCTGTAAC-39; antibody and rabbit against rat AdipoR1 antibody (Santa mouse Ppargc1a forward: 59-CACTGACAGATGGAGCCG Cruz Biotechnology, Santa Cruz, CA). Then, the cells were TGA-39,reverse:59-TGTTGGCTGGTGCCAGTAAGAG-39; incubated with a mixture of Alexa Fluor 488 goat anti- mouse b-actin forward: 59-CATCCGTAAAGACCTCTATGC mouse IgG and Alexa Fluor 594 goat anti-rabbit IgG CAAC-39, reverse: 59-ATGGAGCCACCGATCCACA-39. (Invitrogen, Carlsbad, CA) and were imaged with a confocal laser scanning microscopic, with mounting medium containing DAPI (Vector Laboratories, Burlingame, CA) (13). Adult Mouse and Rat Cardiomyocyte Isolation and Gene Knockdown With Small Interfering RNA in H9C2 Hypoxia/Reoxygenation Cells Calcium-tolerant cardiomyocytes were prepared from Embryonic rat cardiac H9C2 cells were maintained in rat/mouse ventricles via a modified method, as previously DMEM containing 10% FBS in a humidified atmosphere described (13). Mice cardiomyocytes were treated with (5% CO ) at 37°C. Commercial small interfering RNAs stattic (a specific STAT3 inhibitor; 100 mmol/L, 1 h before 2 (siRNAs) (Santa Cruz Biotechnology) were used to respec- hypoxia/reoxygenation [HR]), methyl-b-cyclodextrin (CD, a tively knockdown the gene expression of APN, AdipoR1, disrupter of cholesterol-rich caveolae; 10 mmol/L, 30 min AdipoR2, T-cadherin, and STAT3, according to the man- before HR), or recombinant globular APN (gAd) (2 mg/mL, ufacturer’s protocol. After transfection with control or for 24 h), before being subjected to HR and hypoxic post- specific siRNA, cells were incubated in DMEM for 36 h. conditioning (HPo). Rat cardiomyocytes were incubated in Some of the subgroups were treated with gAd (2 mg/mL) normal glucose (5.5 mmol/L) or high glucose (HG) (25 mmol/L) for 24 h and snap frozen in liquid N . for 18 h or 38 h. Some of the subgroups were subjected to 2 HR and HPo. HR was achieved by hypoxia for 45 min, Isolation of Caveolae-Rich Fractions followed by 2 h of reoxygenation (25). HPo was achieved Caveolae were isolated by discontinuous sucrose gradient by three cycles of 5 min of hypoxia and 5 min of reox- centrifugation, as previously described (13). Each heart ygenation. Hypoxia conditions were obtained by equili- sample gradient was separated into 12 fractions. Frac- brating a humidified Plexiglas chamber containing tions 4–6 were considered the lipid raft fractions (buoy- myocytes with 95% N2 and 5% CO2 and confirmed by ant membrane), and fractions 8–12 were considered the measuring the chamber O2 concentration falling to heavier fractions (nonbuoyant membrane). diabetes.diabetesjournals.org Li and Associates 945

2 2 Western Blotting and Adipo / mice were subjected to myocardial IR 2 2 Equal protein amounts from isolated cardiomyocytes, with or without IPo. After 24 h of reperfusion, Adipo / H9C2 cells, rat heart, and isolated mitochondria or caveolae mice exhibited more severe MIRI, manifested as larger fractions were resolved by 7.5–12.5% SDS-PAGE and trans- myocardial infarct size (Fig. 1A-C), higher plasma creatine ferred to polyvinylidene fluoride membrane for immuno- kinase (CK)-MB (Fig. 1D), and increased cardiomyocyte blot analysis, as previously described (13). apoptosis (Fig. 1E and F), concomitant with reductions in the maximal slope of systolic pressure (dP/dt ), cardiac Statistics Max diastolic decrement (dP/dt )(Fig.1H and I), stroke work, Densitometry was obtained by image analysis software Min cardiac output, ejection fraction, and elevations in cardiac (Bio-Rad). All values are presented as means 6 SEM. end-diastolic pressure (Fig. 1G) and Tau (Supplementary Comparisons between multiple groups were made by Table 1). IPo significantly attenuated all these changes in one-way ANOVA, followed by the Tukey test for multi- 2 2 WT but not in Adipo / mice. ple comparisons. Statistical analysis was performed by GraphPad Prism software (GraphPad Software, Inc., La IPo Increased Myocardial APN Production and Jolla, CA). P values of ,0.05 were considered statistically Mitochondrial STAT3 Activation and Enhanced significant. Postischemic Mitochondrial Function in WT but Not in Adipo2/2 Mice RESULTS Studies showed that APN accumulated in the injured Myocardial IPo Cardioprotection Is Abolished in area of the heart after IR (26) and that mitochondrial Adipo2/2 Mice (mito)STAT3 activation is critical for IPo to confer cardio- APN deficiency exacerbated MIRI (6,26). To determine protection (27). To determine the role of APN in IPo- the role of APN in IPo-mediated cardioprotection, WT mediated cardioprotection and mitoSTAT3 activation, we

Figure 1—Myocardial IPo cardioprotection was abolished in Adipo2/2 mice. A: Representative images of myocardial necrosis (infarct size) determined by TTC and Evans blue staining. B and C: Myocardial infarct size expressed as a percentage of the area-at-risk (AAR) served by the occluded artery. D: Plasma level of CK-MB. E and F: Myocardial cell apoptosis assessed by TUNEL. TUNEL-positive cells were stained brown (arrows). A pressure-volume conductance system was used to determine cardiac end-diastolic pressure (G), cardiac maximal slope of systolic pressure increment (dP/dtMax)(H), and cardiac diastolic decrement (dP/dtMin)(I). Data are mean 6 SEM (n = 8 per group). *P < 0.05; **P < 0.01. NS, not significant. 946 Adiponectin in Ischemic Postconditioning Diabetes Volume 65, April 2016 determined the levels of plasma and cardiac APN as well as mitochondrial function, evidenced as lower complex I/II 2 2 mitoSTAT3 in WT and Adipo / mice subjected to IR and and III/IV/V activities (Fig. 2D) and reduced cardiac ATP IPo. Postischemic plasma and cardiac APN were signifi- production (Fig. 2E), as well as more severe mitochondrial cantly reduced and IPo prevented IR-induced reduction damage manifested as significant morphological defects of cardiac APN protein expression at the early stage of (mitochondrial swelling and dissolving) and a reduction reperfusion (i.e., 1 and 2 h of reperfusion) (Supplementary of the mtDNA-to-nDNA ratio (Fig. 2F and G) concomitant Fig. 1A) and increased the cardiac mitoSTAT3 phosphory- with decreases of mRNA expression of Tfam, Nrf1, and 2 2 lation at site Ser727 in WT but not in Adipo / mice (Fig. Ppargc1a (Supplementary Fig. 1B–D). IPo significantly in- 2A–C), suggesting that IPo required cardiac APN to induce/ creased mitochondrial complex I/IV/V (but not complex II activate STAT3, whereas IPo had no effect on plasma APN and III) activities, increased myocardial ATP production, (Fig. 2A). attenuated mitochondrial morphological changes, in- Further, we determined the effect of IPo on mitochon- creased the mtDNA-to- nDNA ratio (Fig. 2D–G), and upreg- 2 2 drial function. Compared with WT mice, Adipo / mice ulated mRNA expression of Tfam, Nrf1, and Ppargc1a in 2 2 exhibited more severely impaired postischemic myocardial WT but not in Adipo / mice (Supplementary Fig. 1B–D).

Figure 2—IPo increased myocardial APN production and mitoSTAT3 activation that was associated with enhanced mitochondrial function in WT but not in Adipo2/2 mice. A: Plasma level of APN measured by ELISA. B: Protein expression of cardiac APN. C: Protein expression of phosphorylated mitoSTAT3. D: Activities of mitochondrial respiratory chain complex I/II+III/IV/V. E: ATP content measured by ELISA. F: Representative electron photomicrographs of mitochondria (original magniﬁcation 350,000), injured mitochondria manifested as morphological defects of mitochondrial swelling and dissolving are indicated by the arrows. G: Ratio of mtDNA to nDNA determined by quantitative real-time PCR. Data are mean 6 SEM (n = 8 per group). *P < 0.05; **P < 0.01. NS, not signiﬁcant. diabetes.diabetesjournals.org Li and Associates 947

Lack of APN Compromised IPo-Induced Increases in STAT3 activation in the context of IPo, cultured H9C2 NO Production and eNOS Expression and Reduction in cells were treated with specific AdipoR1, AdipoR2, and Myocardial Oxidative Stress T-cadherin siRNA, respectively, and then subjected to HR fi Postischemic cardiac NO was signi cantly reduced, which and HPo. AdipoR1 siRNA, but not AdipoR2 or T-cadherin was associated with decreased eNOS phosphorylation at siRNA, abolished HPo cellular protection manifested as site Ser1177 and increased nitrotyrosine formation in WT increased LDH release, elevated cleaved caspase 3 expres- 2/2 and Adipo mice, and IPo attenuated all of these sion, and decreased Bcl2-to-Bax ratio (Fig. 4A–C). How- 2/2 changes in WT but not in Adipo mice (Supplementary ever, supplementation of APN (by gAd) cannot restore A–C Fig. 2 ). Similarly, IR-induced myocardial oxidative HPo cellular protective effects in H9C2 cells treated 2/2 stress was more pronounced in Adipo mice, evidenced with AdipoR1 gene knockdown (Supplementary Fig. P , as elevated cardiac and plasma levels of 15-F2t-IsoP ( 4E), suggesting that APN-mediated HPo cellular protec- 2/2 0.05, WT-IR vs. WT-Sham; Adipo -IR vs. WT-IR), tion is dependent on AdipoR1. AdipoR1 siRNA, but not fi a speci c index of oxidative stress induced by reactive AdipoR2 or T-cadherin siRNA, diminished HPo-induced fi oxygen species (ROS), and IPo signi cantly attenuated upregulation of eNOS and phosphorylated STAT3 protein 2/2 all these changes in WT but not in Adipo mice (Sup- expression (Fig. 4D–F). plementary Fig. 2D and E). IPo Enhanced AdipoR1 and Cav3 Binding to Facilitate APN Supplementation Enabled IPo to Induce STAT3 APN-Mediated STAT3 Activation in WT but Not in Activation and Confer Cellular Protection in Adipo2/2 Mice 2/2 Cardiomyocytes Isolated From Adipo Mice To determine whether Cav3 contributes to APN-mediated fi To con rm the role of APN in IPo cardioprotection and to IPo cardioprotection, the expression and distribution of see whether this exactly happens in the cardiomyocytes, Cav3 and AdipoR1 were examined. Postischemic myocar- 2/2 cardiomyocytes from WT and Adipo mice were iso- dial Cav3 and AdipoR1 were significantly decreased (Fig. lated and subjected to HR and HPo in the presence or 5A and B) concomitant with reduced Cav3 and AdipoR1 fi absence of gAd and/or the STAT3-speci c inhibitor stattic. accumulation in the buoyant fraction (Fig. 5C). Although In cardiomyocytes isolated from WT mice, posthypoxic cel- cardiac Cav3 protein expression was significantly lower fi 2 2 lular injury was signi cantly increased, manifested as in- in Adipo / mice than that in WT mice, IPo significantly creased LDH and cleaved caspase 3 expression, which was increased Cav3 protein expression both in WT and 2 2 concomitant with reduced APN content, and all of these Adipo / mice. However, IPo significantly increased fi A–C changes were signi cantly attenuated by HPo (Fig. 3 AdipoR1 protein expression, Cav3, and AdipoR1 buoy- A and Supplementary Fig. 3 ). In cardiomyocytes isolated ant fraction accumulation (Fig. 5A-C), with concomitantly 2/2 fi from Adipo mice, HR signi cantly increased cell death increased colocalization of Cav3 and AdipoR1 in WT but D 2 2 (elevated release of LDH, Fig. 3 ), increased apoptosis (en- not in Adipo / mice (Fig. 5D). Furthermore, cardiomyo- E 2 2 hanced cleaved caspase 3 expression, Fig. 3 ), impaired cytes were isolated from WT and Adipo / and subjected mitochondrial function (increased release of cytochrome to HR and HPo, and HPo significantly upregulated Cav3 F C, Fig. 3 ), and elevated ROS production (increased the and AdipoR1 colocalization (Fig. 5E) and attenuated HR- G number of DHE-positive cells, Fig. 3 ) that was associated induced cellular injury and reduction of mitoSTAT3 phos- H 2 2 with reduced mitoSTAT3 activation (Fig. 3 ). Similar to our phorylation in cardiomyocytes from WT but not Adipo / in vivo data, cellular protection of HPo was diminished in mice. All of these cellular protective effects of HPo in 2/2 cardiomyocytes isolated from Adipo mice but was re- WT cardiomyocytes were abolished by CD (a disrupter of stored by APN administration in a dose-dependent manner cholesterol-rich caveolae) (Fig. 5F and G). Whereas in 2 2 manifested as progressively reduced posthypoxic LDH re- cardiomyocytes isolated from Adipo / mice, APN (gAd) C lease and cytochrome C expression (Supplementary Fig. 3 supplementation restored HPo cellular protection and D – and ). However, stattic abolished APN administration HPo-induced mitoSTAT3 activation, but these beneficial mediated restoration of HPo cellular protection. These re- effects were also abolished by CD (Fig. 5H and I). sults from isolated cardiomyocytes were confirmed in H9C2 cells with APN or STAT3 gene knockdown by using respec- APN Restored Heart Sensitivity to IPo tive siRNAs, which showed that APN supplementation Cardioprotection by Activating MitoSTAT3 in 4-Week restored HPo cellular protection in H9C2 with APN but Not in 8-Week Diabetic Rats fi gene knockdown. However, this beneficial effect of APN Postischemic myocardial injury was signi cantly in- supplementation was abolished by STAT3 gene knockdown creased, evidenced as increased infarct size and plasma (Supplementary Fig. 3E and F). CK-MB release in both 4- and 8-week diabetic rats (Supplementary Fig. 5A–C), and these were associated APN-Mediated STAT3 Activation in IPo with increased cardiac 15-F2t-IsoP, reduced cardiac NO Cardioprotection Through AdipoR1 production, and elevated cardiac nitrotyrosine formation APN confers cardioprotective effect mainly through its (Supplementary Fig. 5D–F). IPo significantly attenuated/ three receptors: AdipoR1, AdipoR2, and T-cadherin (28). To prevented all of these changes in nondiabetic but not in determine which receptor is involved in the APN-mediated 4- or 8-week diabetic rats. 948 Adiponectin in Ischemic Postconditioning Diabetes Volume 65, April 2016

Figure 3—Diminished effects of IPo in activating STAT3 to confer cellular protection in Adipo2/2 cardiomyocytes was rescued by APN administration. A: Posthypoxia LDH release in cardiomyocytes isolated from WT mice. Protein expression of cleaved and total caspase 3 (B) and of APN (C) in cardiomyocytes isolated from WT mice. D: Posthypoxia LDH release in cardiomyocytes isolated from Adipo2/2 mice. Protein expression of cleaved and total caspase 3 (E) and of cytochrome C (F) in Adipo2/2 mice. G: ROS production determined by DHE staining. H: Protein expression of phosphorylated (p) mitoSTAT3 in cardiomyocytes isolated from Adipo2/2 mice. Data are mean 6 SEM of two independent experiments each performed in triplicate. *P < 0.05; **P < 0.01.

In nondiabetic control rats, IPo significantly reduced the dose used, did not reduce postischemic infarct size postischemic myocardial injury manifested as a reduction in 4- or 8-week diabetic rats (Fig. 6A and B), but reduced of infarct size (Fig. 6A and B). APN supplementation fur- postischemic CK-MB release in 4-week but not in 8-week ther enhanced IPo cardioprotective effects, whereas these diabetic rats (Fig. 6C). By contrast, APN supplementation protective effects of APN were abolished by STAT3 inhi- in combination with IPo significantly reduced postische- bition (by AG490, a Jak inhibitor that inhibits STAT3) mic infarct size and plasma CK-MB release and improved (Fig. 6A and B). cardiac functional recovery in 4-week but not in 8-week In diabetic rats, blood glucose was increased (28.9 6 diabetic rats (Fig. 6A–D and Supplementary Tables 2 and 0.4 mmol/L in 4-week diabetic rats vs. 6.2 6 0.1 in age- 3). Plasma APN was significantly elevated after APN in- matched control rats; 29.1 6 0.5 mmol/L in 8-week diabetic jection, but no significant changes in cardiac APN protein rats vs. 5.9 6 0.2 in age-matched control rats), which was expression were observed in 4- or 8-week diabetic rats associated with reduced plasma and cardiac APN (Supple- before or after IR and IPo (Supplementary Fig. 6C and mentary Fig. 6A and B). APN supplementation alone, at D). IPo had no significant effect on postischemic cardiac diabetes.diabetesjournals.org Li and Associates 949

Figure 4—APN-mediated STAT3 activation in HPo cardioprotection through AdipoR1. A: Posthypoxic LDH release. B: Cleaved and total caspase 3. C: Bcl2-to-Bax ratio. D: Protein expression of eNOS. E: Protein expression of STAT3. F: Representative images of protein expression determined by Western blotting in H9C2 cells treated with AdipoR1, AdipoR2, and T-cadherin (cadherin) siRNA. C, control; pSTAT3, phosphorylated STAT3; R1, AdipoR1; R2, AdipoR2. Data are mean 6 SEM of two independent experiments each performed in triplicate. *P < 0.05; **P < 0.01.

APN protein expression in diabetic rats irrespective of significantly reduced after 38 h of HG treatment (Fig. 7E APN supplementation (Supplementary Fig. 6D), which and F). Similarly, AdipoR1 and Cav3 colocalization was was in keeping with the result gained in primarily cul- significantly reduced in both 4- and 8-week diabetic rats tured cardiomyocytes in which IPo did not affect HR- but was reversed by IPo in 4-week but not in 8-week di- induced reduction of APN in cardiomyocytes incubated abetic rats (Fig. 7G). with HG (Supplementary Fig. 3B). Further, AG490 significantly reduced mitoSTAT3 phosphorylation and can- DISCUSSION celed the cardioprotection conferred by the combined In the current study, we demonstrated that APN is E use of APN and IPo in 4-week diabetic rats (Fig. 6 ). required for IPo to activate mitoSTAT3 to confer cardio- Also, mitochondrial complex I/II and III/IV/V activities protection and that APN mediates mitoSTAT3 activation fi were signi cantly increased after APN supplementation after IPo via AdipoR1/Cav3 signaling. Reduction in APN fi and were further enhanced by IPo, but these bene cial and impairment of AdipoR1/Cav3 signaling are responsible F effects of IPo were abolished by AG490 (Fig. 6 ). APN for the loss of IPo cardioprotection in diabetes. In the early fi supplementation alone or combined with IPo signi cantly stage of diabetes, loss of IPo cardioprotection is mainly due attenuated postischemic mitochondrial damage (reduc- to the reduced APN, whereas with the progression of tion of cytochrome C release) and reduced cardiac free diabetes, it is mainly due to the impairment of AdipoR1/ fi 15-F2t-IsoP formation, whereas these bene cial effects Cav3 signaling. Supplementation of APN by preserving G H of APN were abolished by AG490 (Fig. 6 and ). mitoSTAT3 activation can restore heart sensitivity to IPo IPo Lost Cardioprotection in Diabetic Rats Due to the in the early stage of diabetes, where AdipoR1 and Cav3 are Inability to Activate MitoSTAT3 Subsequent to the still functionally interactive, but not in the late stage Impairment of AdipoR1/Cav3 of diabetes when AdipoR1/Cav3 signaling is severely As shown in Fig. 7A and B, AdipoR1, but not AdipoR2, impaired. protein was progressively reduced from 1 week to 8 weeks APN is an abundant circulating adipocytokine secreted of diabetic induction (Fig. 7A and B). The colocalization of from adipose tissue (29) and cardiomyocytes (30). Our AdipoR1 and Cav3 was significantly and progressively re- results suggest that IPo confers cardioprotection through duced after diabetic induction (Fig. 7C). In cardiomyo- increasing endogenous APN, which is generated by and cytes isolated from nondiabetic rats exposed to normal may be subsequently secreted from cardiomyocytes. Con- glucose or HG for different durations, the colocalization versely, Shibata et al. (26) reported that 24 h after myo- of AdipoR1 and Cav3 was increased after 18 h of HG cardial IR, APN was upregulated and accumulated in the exposure but was significantly decreased after 38 h of damaged myocardium, which was concomitant with the HG exposure (Fig. 7D). These results were further con- dramatic decrease of postischemic circulating APN. The firmed by coimmunoprecipitation showing that the inconsistencies of these results may be due to the differ- colocalization of AdipoR1 but not AdipoR2 with Cav3 was ent time points of sample collection but provide further 950 Adiponectin in Ischemic Postconditioning Diabetes Volume 65, April 2016

Figure 5—IPo enhanced AdipoR1 and Cav3 binding to facilitate APN-mediated STAT3 activation. A: Cardiac protein expression of Cav3 in WT and Adipo2/2 mice subjected to myocardial IR in the presence or absence of IPo. B: Protein expression of AdipoR1. C: Representative images of Cav3 and AdipoR1 in buoyant membrane and nonbuoyant membrane fractions. D: Colocalization of Cav3 and AdipoR1 in WT and Adipo2/2 mice. IP, immunoprecipitation; WB, Western blotting. E: Confocal laser microscopic image of isolated cardiomyocytes subjected to HR and HPo. F: LDH release in cardiomyocytes isolated from WT mice. G: Protein expression of phosphorylated mitoSTAT3 in cardiomyocytes isolated from WT mice. H: LDH release in cardiomyocytes isolated from Adipo2/2 mice. I: Protein expression of phosphorylated mitoSTAT3 in cardiomyocytes isolated from Adipo2/2 mice. A–D: Data are mean 6 SEM (n =8pergroup).E–I:Dataare mean 6 SEM of two independent experiments each performed in triplicate. *P < 0.05; **P < 0.01.Ab,antibody;C,control;NS,notsigniﬁcant.

information that there is a delay for APN to be shuttled pathway (31), the reperfusion injury salvage kinase path- from other compartments to the injured heart and that way (i.e., PI3K/Akt) (32), and the survival activating fac- cardioprotection of IPo seen in our present study may be tor enhancement pathway (Jak/STAT3, which is essential mainly through acutely/rapidly upregulating cardiomyocyte- for IPo cardioprotection [33]). These pathways converge driven APN. This was conﬁrmed in the in vitro study in at the mitochondria as an integration point that is de- isolated cardiomyocytes (Fig. 3), which showed that IPo cisive for survival of cardiomyocytes (34). However, how increased APN protein expression and reduced cellular IPo improves postischemic mitochondrial function subse- injury in cardiomyocytes isolated from WT but not from quent to acute STAT3 activation is unknown. By using 2 2 2 2 2 2 Adipo / mice. The loss of IPo protection in Adipo / loss-of-function approach in Adipo / mice and gain-of- cardiomyocytes was reversed by APN supplementation, function approach in isolated cardiomyocytes, we demon- which further indicates the essential role of cardiac APN strated that IPo, by increasing cardiac APN, activated in IPo cardioprotection. STAT3, which subsequently shuttled into mitochondria, IPo exerts its cardioprotection via three major in- reversed the activities of mitochondrial complex I/IV/V, tracellular pathways, the NO synthase/protein kinase G leading to increased ATP content and an increased diabetes.diabetesjournals.org Li and Associates 951

Figure 6—APN restored heart responsiveness to IPo cardioprotection by activating mitoSTAT3 in diabetic rats at the early stage but not at the late stage of diabetes. A: Representative images of myocardial necrosis (infarct size) determined by TTC and Evans blue staining. B: Myocardial infarct size expressed as a percentage of the area-at-risk (AAR) in nondiabetic (Non-DM), 4-week (4w), and 8-week (8w) STZ-induced diabetic (DM) rats subjected to IR and IPo, with or without AG490 (Jak inhibitor that inhibits STAT3). C: Plasma level of CK-MB. D: Left ventricular (LV) ejection fraction. E: Protein expression of phosphorylated mitoSTAT3. F: Activities of mitochondrial respiratory chain complex I/II+III/IV/V. G: Protein expression of cytochrome C. H: Cardiac level of 15-F2t-IsoP. Data are mean 6 SEM (n =8 per group). *P < 0.05, **P < 0.01. IS, infarct size; pSTAT3, phosphorylated STAT3.

mtDNA-to-nDNA ratio (Fig. 2), and reduced myocardial to postulate that inhibition of NO may abrogate APN- oxidative stress and attenuated postischemic myocardial mediated IPo cardioprotection. This hypothesis deserves injury. We previously showed that APN attenuated post- to be further investigated. Further, in the current study, ischemic myocardial dysfunction and apoptosis by de- wefoundthattheabove-mentionedAPN-mediatedcar- creasing NADPH oxidase expression and blocking dioprotective effects in IPo were abolished by STAT3 peroxynitrite formation (6,35). In addition, we recently inhibition, which was associated with increased ROS showed that administration of APN increased heme formation (Fig. 3). This indicates that APN-mediated oxygenase-1 induction by concomitantly increasing Brg1 mitoSTAT3 activation plays essential roles in IPo cardi- and Nrf2, which reduced myocardial oxidative stress and oprotection, especially in IPo-induced reduction of post- cardiac dysfunction in STZ-induced diabetes (19). Simi- ischemic myocardial oxidative stress. larly, in the current study, we found that IPo attenuated We previously showed that APN-mediated protection postischemic myocardial oxidative stress in WT but not in against MIRI depends on the activation of AdipoR1, the 2 2 Adipo / mice (Supplementary Fig. 2), suggesting that predominate form of AdipoRs in the heart (37). Similarly, APN is required for IPo to confer cardioprotection in the current study, AdipoR1 siRNA, but not AdipoR2 or through decreasing myocardial oxidative stress. T-cadherin siRNA, abolished HPo-induced STAT3 activa- NO represents one of the most important defense tion, eNOS expression, and cellular protection, indicating mechanisms against MIRI and is also one of the major that cardiac APN-induced STAT3 activation during IPo is mediators of IPo cardioprotection (36). In the current AdipoR1 dependent. We further found that IPo signifi- study, IPo conferred cardioprotective effects through cantly increased myocardial Cav3 protein expression and APN that was associated with reduced postischemic nitro- increased the colocalization of AdipoR1 and Cav3. The tyrosine formation and increased cardiac NO production critical role of effective AdipoR1/Cav3 interaction in 2 2 in WT but not in Adipo / mice. All of these suggest that IPo-mediated cardioprotection was confirmed by our find- IPo confers cardioprotection by reducing myocardial oxi- ings that the application of a Cav3 disrupter, CD, not only dative stress and increasing NO bioavailability through canceled HPo-induced cellular protection but also reduced APN (Supplementary Fig. 2A and B). Thus, it is reasonable HPo-induced STAT3 activation in cardiomyocytes isolated 952 Adiponectin in Ischemic Postconditioning Diabetes Volume 65, April 2016

Figure 7—Reduced IPo cardioprotection in STZ-induced type 1 diabetic rats due to the inability of IPo to activate mitoSTAT3 as a consequence of impairment of AdipoR1/Cav3 signaling. Protein expression of AdipoR1 (A) and AdipoR2 (B). C: Changes of AdipoR1 and Cav3 colocalization in control and in 1, 2, 4, and 8 weeks in STZ-induced diabetic rats. D: Confocal laser microscopic image of isolated cardiomyocytes exposed to normal glucose (NG) or HG for 18 h and 38 h. E and F: Colocalization of AdipoR1 or AdipoR2 with Cav3 in isolated cardiomyocytes exposed to HG for 38 h. G: Colocalization of AdipoR1 and Cav3 in 4-week and 8-week diabetic (DM) rats subjected to IR and IPo. A–C and G: Data are mean 6 SEM (n = 8 per group). D–F: Data are mean 6 SEM of two independent experiments each performed in triplicate. *P < 0.05 vs. control, #P < 0.01 vs. control in A–C;*P < 0.05 in E and G. Ab, antibody; IP, immunoprecipitation; NS, not signiﬁcant; WB, Western blotting.

from WT mice despite not affecting the cardiomyocyte Increased oxidative stress in the heart of diabetic content of APN and AdipoR1 (data not shown). These animals is a major mechanism that renders the diabetic provide additional evidence that Cav3 plays an essential heart less or not responsive to cardioprotective interven- role in APN transmembrane signaling and in APN anti-IR tions that are otherwise effective in nondiabetic hearts actions, as we reported (37). Our finding that APN (4,38), but the underlying mechanism is unclear. Plasma supplementation mediated restoration of HPo-induced and cardiac APN levels are reduced in patients with di- 2 2 STAT3 activation and HPo cardioprotection in Adipo / abetes (39) and in STZ-induced diabetic rats (9,40). More- cardiomyocytes was canceled by Cav3 disruptor indicates over, oxidative stress can downregulate APN level (9,41). that APN-induced STAT3 activation in IPo cardioprotec- Thus, reduced APN, in part as a consequence of increased tion is mediated by or needs the participation Cav3. oxidative stress in diabetes, should be responsible for the diabetes.diabetesjournals.org Li and Associates 953 loss of IPo cardioprotection in diabetes. To this end, we was mainly due to the reduced APN, whereas at the late used an adenovirus to overexpress APN in diabetic rats stage of the disease, it was mainly due to the impaired and subjected them to IR and IPo. Interestingly, supple- APN signaling (AdipoR1/Cav3), which consequently di- mentation of APN restored IPo cardioprotection by im- minished IPo-induced STAT3 activation. proving mitochondrial function and ameliorating oxidative Our results may provide an explanation for the stress subsequent to mitoSTAT3 activation (Fig. 8), but discrepancy showing that although clinical and animal these effects of APN were only seen in 4-week but not in studies all indicated that APN is cardioprotective, those 8-week diabetes. This promoted us postulate that the with type 1 diabetes are more susceptible to myocardial IR different responses to APN at 4- and 8-week diabetes and not sensitive to IPo irrespective of increased or may be due to the impaired APN signaling in diabetes. decreased APN seen in patients and animals with type 1 After diabetes induction, AdipoR1 expression decreased diabetes (42,43). Our results showed that loss of the APN progressively with the significant reduction at 4 and 8 cardioprotective effect seen in the late stage of diabetes is weeks, whereas AdipoR2 expression did not change. largely due to the malfunction of APN, especially the im- More importantly, the colocalization of cardiac AdipoR1 paired AdipoR1/Cav3 signaling, but not merely the reduc- and Cav3 reduced progressively in diabetes, with the tion of APN content. That the protective effects of most significant reduction seen at 8-week diabetes. Fur- IPo may be abolished by diabetes mainly through APN- ther, our in vitro study results showed that AdipoR1 and independent mechanisms is unlikely, because we have Cav3 colocalization increased after HG exposure for 18 h clearly demonstrated that APN is required for IPo cardi- 2 2 but significantly decreased when cardiomyocytes were oprotection by using Adipo / mice. It should be noted, exposed to HG for a longer period (38 h), whereas the however, that reduction of APN is not the main reason in vivo study showed that IPo significantly increased why diabetic hearts lose responsiveness to IPo. This ex- AdipoR1 and Cav3 colocalization in 4-week but not in plains why APN supplementation combined with IPo can- 8-week diabetes (Fig. 7). These findings collectively in- not restore diabetic heart responsiveness to IPo at the late dicate that in the early stage of diabetes, the loss of IPo state of the disease when cardiac Cav3/AdipoR1 signaling

Figure 8—Schematic of proposed signaling involved in APN-mediated mitoSTAT3 activation IPo cardioprotection under nondiabetic and diabetic conditions. Under nondiabetic condition, IPo confers cardioprotective effects via concomitantly upregulating cardiomyocytes APN expression and enhancing the interaction of AdipoR1 with Cav3, leading to the activation of STAT3, which subsequently translocates into mitochondria and enhances mitochondrial complex I/II+III/IV/V activities. These, together with IPo-mediated activation of Akt, result in reduced myocardial oxidative stress and attenuated cardiomyocyte apoptosis and eventually attenuates IR injury. However, under diabetic condition, IPo fails to activate STAT3 due to the reduced cardiomyocyte APN production and impaired AdipoR1 and Cav3 interaction. These, together with the inability of IPo to activate Akt, lead to poor postischemic mitochondrial function, resulting in enhanced myocardial oxidative stress and increased cardiomyocyte apoptosis. 954 Adiponectin in Ischemic Postconditioning Diabetes Volume 65, April 2016 is impaired. In addition to type 1 diabetes, IPo cardiopro- subjects, which cannot mimic the clinical situation. tective effects were also reduced in type 2 diabetes (44), Findings from our current study indicate that effective and we have shown that APN cardioprotective effects also means that may concomitantly activate APN and repair reduced in type 2 diabetes associated with reduced APN APN signaling (i.e., AdipoR1/Cav3) in diabetes may re- content (10,11). However, whether IPo can increase the present promising avenues to restore IPo cardioprotec- interaction of AdipoR1 and Cav3 in type 2 diabetes is not tion in the treatment of MIRI in diabetes. Recently, APN known. If so, then the mechanism identified in the type 1 receptor(s) agonist, which can be given orally, has been diabetic model in the current study may also operate in successfully generated (47), therefore providing optimism type 2 diabetes. This needs to be studied further. that the application of an APN receptor agonist in combi- Of note, previous studies showed that APN exerts its nation with IPo could be promising therapies in combating metabolic regulative effects largely through the AMPK- MIRI in diabetes. dependent pathway. However, our recent study (6) shows that APN reduced postischemic myocardial injury via its antioxidative effects rather than through metabolic Acknowledgments. The authors thank Dr. Yan Chen and Dr. Jiao Peng, regulation. In addition, exogenous APN supplementation Department of Surgery, The University of Hong Kong, Hong Kong, China, for could attenuate myocardial apoptosis in cardiomyocytes excellent technical assistance. subjected to HR by decreasing NADPH oxidase expression Funding. Z.X. has received General Research Fund grants 784011, and blocking peroxynitrite formation in an AMPK- 17124614, and 17123915 from the Research Grants Council of Hong Kong and grant 81270899 from the National Natural Science Foundation of China. independent fashion (35). These results strongly suggest Duality of Interest. No potential conflicts of interest relevant to this article that the degree of AMPK involvement in the biological were reported. functions of APN is determined by the intracellular envi- Author Contributions. H.L. and Z.X. designed the study. H.L., W.Y., and ronment, particularly AMP concentration. Under patho- Z.L. performed experiments and analyzed data. H.L., W.Y., Z.L., A.X., Y.H., X.-l.M., logical conditions (such as myocardial IR) in which M.G.I., and Z.X. interpreted results of experiments. H.L. drafted the manuscript. intracellular AMP concentrations are elevated (45,46) M.G.I. and Z.X. edited and revised the manuscript. Z.X. approved the final version and AMPK has already been significantly activated, APN of the manuscript. Z.X. is the guarantor of this work and, as such, had full access may exert its biological actions largely through signaling to all the data in the study and takes responsibility for the integrity of the data and molecules other than AMPK. In the current study, the accuracy of the data analysis. we found APN activates STAT3 that during IPo and sub- Prior Presentation. Parts of these data were presented at the American fi – sequently reduces myocardial oxidative stress mainly Heart Association Scienti c Sessions 2014, Chicago, IL, 15 19 November 2014, and published as an abstract in Circulation 2014;130:A13879. through AdipoR1/Cav3. Because we did not determine the change of AMPK in this process, we cannot exclude References the possibility that AMPK may also play a role in this 1. Roffi M, Eberli FR. Diabetes and acute coronary syndromes. Best Pract Res APN-induced STAT3 activation in IPo, and thus, further Clin Endocrinol Metab 2009;23:305–316 study regarding the role of AMPK in APN-mediated 2. Zhao ZQ, Corvera JS, Halkos ME, et al. Inhibition of myocardial injury by STAT3 activation in IPo is needed, and its resolution ischemic postconditioning during reperfusion: comparison with ischemic pre- will advance the understanding of IPo cardioprotection. conditioning. Am J Physiol Heart Circ Physiol 2003;285:H579–H588 3. Boengler K, Buechert A, Heinen Y, et al. Cardioprotection by ischemic Conclusions postconditioning is lost in aged and STAT3-deficient mice. Circ Res 2008;102: To our knowledge, our study demonstrated for the first 131–135 time that IPo, by activating APN, activates STAT3 and 4. Przyklenk K, Maynard M, Greiner DL, Whittaker P. Cardioprotection with leads to its mitochondrial shuttling and consequently im- postconditioning: loss of efficacy in murine models of type-2 and type-1 diabetes. proves postischemic cardiac mitochondrial function and Antioxid Redox Signal 2011;14:781–790 attenuates myocardial injury and that intact AdipoR1/ 5. Gross ER, Hsu AK, Gross GJ. Diabetes abolishes morphine-induced car- Cav3 signaling is critical for IPo to activate STAT3 dioprotection via multiple pathways upstream of glycogen synthase kinase-3beta. – through APN. Diabetes, by reducing APN and disarrang- Diabetes 2007;56:127 136 6. Tao L, Gao E, Jiao X, et al. Adiponectin cardioprotection after myocardial ing the AdipoR1/Cav3 interaction, diminishes APN- ischemia/reperfusion involves the reduction of oxidative/nitrative stress. Circu- induced STAT3 activation and eventually reduces IPo lation 2007;115:1408–1416 cardioprotection in the hearts from diabetes (Fig. 8). 7. Wang Y, Wang X, Jasmin JF, et al. Essential role of caveolin-3 in adipo- Clinical Perspectives nectin signalsome formation and adiponectin cardioprotection. Arterioscler Although most experimental animal studies have shown Thromb Vasc Biol 2012;32:934–942 consistent results of effective cardioprotection of IPo, 8. Liao W, Yu C, Wen J, et al. Adiponectin induces interleukin-6 production and activates STAT3 in adult mouse cardiac fibroblasts. Biol Cell 2009;101:263–272 attempts to translate IPo into clinical use are not success- 9. Wang T, Mao X, Li H, et al. N-acetylcysteine and allopurinol up-regulated ful. The reason might be that most patients typically have the Jak/STAT3 and PI3K/Akt pathways via adiponectin and attenuated myocardial comorbidities, such as diabetes, aging, dyslipidemia, and postischemic injury in diabetes. Free Radic Biol Med 2013;63:291–303 hypertension, which have been shown to influence the 10. Yi W, Sun Y, Gao E, et al. Reduced cardioprotective action of adiponectin protective effects of IPo. By contrast, most of the animals in high-fat diet-induced type II diabetic mice and its underlying mechanisms. used in experimental studies are healthy, juvenile, adult Antioxid Redox Signal 2011;15:1779–1788 diabetes.diabetesjournals.org Li and Associates 955

11. Li R, Xu M, Wang X, et al. Reduced vascular responsiveness to adiponectin 29. Berg AH, Combs TP, Scherer PE. ACRP30/adiponectin: an adipokine in hyperlipidemic rats–mechanisms and significance. J Mol Cell Cardiol 2010;49: regulating glucose and lipid metabolism. Trends Endocrinol Metab 2002;13: 508–515 84–89 12. Tan Z, Zhou LJ, Mu PW, et al. Caveolin-3 is involved in the protection of 30. Piñeiro R, Iglesias MJ, Gallego R, et al. Adiponectin is synthesized and resveratrol against high-fat-diet-induced insulin resistance by promoting GLUT4 secreted by human and murine cardiomyocytes. FEBS Lett 2005;579:5163– translocation to the plasma membrane in skeletal muscle of ovariectomized rats. 5169 J Nutr Biochem 2012;23:1716–1724 31. Cohen MV, Downey JM. Cardioprotection: spotlight on PKG. Br J Pharmacol 13. Lei S, Li H, Xu J, et al. Hyperglycemia-induced protein kinase C b2 acti- 2007;152:833–834 vation induces diastolic cardiac dysfunction in diabetic rats by impairing caveolin-3 32. Hausenloy DJ, Tsang A, Yellon DM. The reperfusion injury salvage kinase expression and Akt/eNOS signaling. Diabetes 2013;62:2318–2328 pathway: a common target for both ischemic preconditioning and post- 14. Rice DS, Calandria JM, Gordon WC, et al. Adiponectin receptor 1 conserves conditioning. Trends Cardiovasc Med 2005;15:69–75 docosahexaenoic acid and promotes photoreceptor cell survival. Nat Commun 33. Skyschally A, van Caster P, Boengler K, et al. Ischemic postconditioning in 2015;6:6228 pigs: no causal role for RISK activation. Circ Res 2009;104:15–18 15. Yamauchi T, Kadowaki T. Adiponectin receptor as a key player in healthy 34. Heusch G, Boengler K, Schulz R. Inhibition of mitochondrial permeability longevity and obesity-related diseases. Cell Metab 2013;17:185–196 transition pore opening: the holy grail of cardioprotection. Basic Res Cardiol 16. van Oosten AL, Costa Y, Smith A, Silva JC. JAK/STAT3 signalling is suffi- 2010;105:151–154 cient and dominant over antagonistic cues for the establishment of naive pluri- 35. Wang Y, Tao L, Yuan Y, et al. Cardioprotective effect of adiponectin is potency. Nat Commun 2012;3:817 partially mediated by its AMPK-independent antinitrative action. Am J Physiol 17. Ma K, Cabrero A, Saha PK, et al. Increased beta-oxidation but no insulin Endocrinol Metab 2009;297:E384–E391 resistance or glucose intolerance in mice lacking adiponectin. J Biol Chem 2002; 36. Penna C, Granata R, Tocchetti CG, Gallo MP, Alloatti G, Pagliaro P. 277:34658–34661 Endogenous cardioprotective agents: role in pre and postconditioning. Curr Drug 18. Liao XL, Hu XX, Chang FJ, et al. A simple modification results in greater Targets 2015;16:843–867 success in the model of coronary artery ligation and myocardial ischemia in mice. 37. Wang Y, Lau WB, Gao E, et al. Cardiomyocyte-derived adiponectin is bi- J Cardiovasc Pharmacol 2013;61:430–436 ologically active in protecting against myocardial ischemia-reperfusion injury. Am 19. Li H, Yao W, Irwin MG, et al. Adiponectin ameliorates hyperglycemia- J Physiol Endocrinol Metab 2010;298:E663–E670 induced cardiac hypertrophy and dysfunction by concomitantly activating Nrf2 38. Kersten JR, Toller WG, Gross ER, Pagel PS, Warltier DC. Diabetes abolishes and Brg1. Free Radic Biol Med 2015;84:311–321 ischemic preconditioning: role of glucose, insulin, and osmolality. Am J Physiol 20. Xu J, Li H, Irwin MG, et al. Propofol ameliorates hyperglycemia-induced Heart Circ Physiol 2000;278:H1218–H1224 cardiac hypertrophy and dysfunction via heme oxygenase-1/signal transducer 39. Hotta K, Funahashi T, Arita Y, et al. Plasma concentrations of a novel, and activator of transcription 3 signaling pathway in rats. Crit Care Med 2014;42: adipose-specific protein, adiponectin, in type 2 diabetic patients. Arterioscler e583–e594 Thromb Vasc Biol 2000;20:1595–1599 21. Li H, Liu Z, Wang J, et al. Susceptibility to myocardial ischemia reperfusion 40. Wang T, Qiao S, Lei S, et al. N-acetylcysteine and allopurinol synergistically injury at early stage of type 1 diabetes in rats. Cardiovasc Diabetol 2013;12:133 enhance cardiac adiponectin content and reduce myocardial reperfusion injury in 22. Lin Z, Wu F, Lin S, et al. Adiponectin protects against acetaminophen- diabetic rats. PLoS One 2011;6:e23967 induced mitochondrial dysfunction and acute liver injury by promoting autophagy 41. Kamigaki M, Sakaue S, Tsujino I, et al. Oxidative stress provokes in mice. J Hepatol 2014;61:825–831 atherogenic changes in adipokine gene expression in 3T3-L1 adipocytes. 23. Xia Z, Kuo KH, Nagareddy PR, et al. N-acetylcysteine attenuates PKCbeta2 Biochem Biophys Res Commun 2006;339:624–632 overexpression and myocardial hypertrophy in streptozotocin-induced diabetic 42. Saraheimo M, Forsblom C, Fagerudd J, et al.; FinnDiane Study Group. rats. Cardiovasc Res 2007;73:770–782 Serum adiponectin is increased in type 1 diabetic patients with nephropathy. 24. Liu Y, Lei S, Gao X, et al. PKCb inhibition with ruboxistaurin reduces oxi- Diabetes Care 2005;28:1410–1414 dative stress and attenuates left ventricular hypertrophy and dysfunction in rats 43. Lindström T, Frystyk J, Hedman CA, Flyvbjerg A, Arnqvist HJ. Elevated with streptozotocin-induced diabetes. Clin Sci (Lond) 2012;122:161–173 circulating adiponectin in type 1 diabetes is associated with long diabetes du- 25. Yao LL, Huang XW, Wang YG, Cao YX, Zhang CC, Zhu YC. Hydrogen sulfide ration. Clin Endocrinol (Oxf) 2006;65:776–782 protects cardiomyocytes from hypoxia/reoxygenation-induced apoptosis by pre- 44. Zhu SG, Xi L, Kukreja RC. Type 2 diabetic obese db/db mice are refractory venting GSK-3beta-dependent opening of mPTP. Am J Physiol Heart Circ Physiol to myocardial ischaemic post-conditioning in vivo: potential role for Hsp20, 2010;298:H1310–H1319 F1-ATPase d and Echs1. J Cell Mol Med 2012;16:950–958 26. Shibata R, Sato K, Kumada M, et al. Adiponectin accumulates in myocardial 45. Omar MA, Fraser H, Clanachan AS. Ischemia-induced activation of AMPK tissue that has been damaged by ischemia-reperfusion injury via leakage from does not increase glucose uptake in glycogen-replete isolated working rat hearts. the vascular compartment. Cardiovasc Res 2007;74:471–479 Am J Physiol Heart Circ Physiol 2008;294:H1266–H1273 27. Heusch G, Musiolik J, Gedik N, Skyschally A. Mitochondrial STAT3 activation 46. Folmes CD, Clanachan AS, Lopaschuk GD. Fatty acids attenuate insulin and cardioprotection by ischemic postconditioning in pigs with regional myo- regulation of 59-AMP-activated protein kinase and insulin cardioprotection after cardial ischemia/reperfusion. Circ Res 2011;109:1302–1308 ischemia. Circ Res 2006;99:61–68 28. Denzel MS, Scimia MC, Zumstein PM, Walsh K, Ruiz-Lozano P, Ranscht B. 47. Okada-Iwabu M, Yamauchi T, Iwabu M, et al. A small-molecule AdipoR T-cadherin is critical for adiponectin-mediated cardioprotection in mice. J Clin agonist for type 2 diabetes and short life in obesity. Nature 2013;503:493– Invest 2010;120:4342–4352 499