DOCSLIB.ORG

Redox Regulation of PTEN by Peroxiredoxins

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Redox Regulation of PTEN by Peroxiredoxins antioxidants Review Redox Regulation of PTEN by Peroxiredoxins Thang Nguyen Huu 1,2 , Jiyoung Park 3 , Ying Zhang 4 , Iha Park 1,2, Hyun Joong Yoon 1, Hyun Ae Woo 3,* and Seung-Rock Lee 1,2,* 1 Department of Biochemistry, Research Center for Aging and Geriatrics, Research Institute of Medical Sciences, Chonnam National University Medical School, Gwangju 501-190, Korea; [email protected] (T.N.H.); [email protected] (I.P.); [email protected] (H.J.Y.) 2 Department of Biomedical Sciences, Research Center for Aging and Geriatrics, Research Institute of Medical Sciences, Chonnam National University Medical School, Gwangju 501-190, Korea 3 College of Pharmacy, Graduate School of Pharmaceutical Sciences, Ewha Womans University, Seoul 120-750, Korea; [email protected] 4 Department of Cell Biology, School of Medicine, Jiangsu University, Zhenjiang 212013, China; [email protected] * Correspondence: [email protected] (H.A.W.); [email protected] (S.-R.L.); Tel.: +82-2-3277-4654 (H.A.W.); +82-61-379-2775 (S.-R.L.); Fax: +82-2-3277-3760 (H.A.W.); +82-61-379-2782 (S.-R.L.) Abstract: Phosphatase and tensin homolog deleted on chromosome 10 (PTEN) is known as a tumor suppressor gene that is frequently mutated in numerous human cancers and inherited syndromes. PTEN functions as a negative regulator of PI3K/Akt signaling pathway by dephosphorylating phosphatidylinositol (3, 4, 5)-trisphosphate (PIP3) to phosphatidylinositol (4, 5)-bisphosphate (PIP2), which leads to the inhibition of cell growth, proliferation, cell survival, and protein synthesis. PTEN contains a cysteine residue in the active site that can be oxidized by peroxides, forming an intramolecular disulfide bond between Cys124 and Cys71. Redox regulation of PTEN by reactive oxygen species (ROS) plays a crucial role in cellular signaling. Peroxiredoxins (Prxs) are a superfamily of peroxidase that catalyzes reduction of peroxides and maintains redox homeostasis. Mammalian Citation: Nguyen Huu, T.; Park, J.; Prxs have 6 isoforms (I-VI) and can scavenge cellular peroxides. It has been demonstrated that Zhang, Y.; Park, I.; Yoon, H.J.; Woo, H.A.; Lee, S.-R. Redox Regulation of Prx I can preserve and promote the tumor-suppressive function of PTEN by preventing oxidation PTEN by Peroxiredoxins. Antioxidants of PTEN under benign oxidative stress via direct interaction. Also, Prx II-deficient cells increased 2021, 10, 302. https://doi.org/ PTEN oxidation and insulin sensitivity. Furthermore, Prx III has been shown to protect PTEN from 10.3390/antiox10020302 oxidation induced by 15s-HpETE and 12s-HpETE, these are potent inflammatory and pro-oxidant mediators. Understanding the tight connection between PTEN and Prxs is important for providing Academic Editor: Ho Hee Jang novel therapies. Herein, we summarized recent studies focusing on the relationship of Prxs and the redox regulation of PTEN. Received: 31 December 2020 Accepted: 10 February 2021 Keywords: PTEN; redox regulation; peroxiredoxins Published: 16 February 2021 Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in 1. Introduction published maps and institutional affil- iations. The phosphoinositide-3-kinase/protein kinase B (PI3K/Akt) pathway is the critical in- tracellular signaling in controlling a variety of cellular processes [1]. PI3Ks are intracellular lipid kinases that are conserved from yeast to mammals. It catalyzes the phosphorylation reaction of phosphatidylinositol (PI) at hydroxyl groups to form phosphoinositides [2]. There are three classes of PI3Ks: class I, II, and III, depending on the structure and substrate Copyright: © 2021 by the authors. specificity. Among three classes, class I PI3K has the primary function of inducing the Licensee MDPI, Basel, Switzerland. accumulation of PIP3 by PIP2 phosphorylation [2–4]. Class I PI3K is also classified into This article is an open access article 2 subgroups, called class IA and class IB, depending on the signaling receptors that activate distributed under the terms and conditions of the Creative Commons them. While the activation of class IA is induced by growth factor receptor tyrosine kinases Attribution (CC BY) license (https:// (RTKs), the activation of class IB is induced by G protein-coupled receptors (GPCRs) [2–4]. creativecommons.org/licenses/by/ All the members of class I have the heterodimeric structure that contains a regulatory 4.0/). subunit and a catalytic subunit: class IA with a p85 regulatory subunit and a p110 catalytic Antioxidants 2021, 10, 302. https://doi.org/10.3390/antiox10020302 https://www.mdpi.com/journal/antioxidants Antioxidants 2021, 10, 302 2 of 13 subunit, class IB with two regulatory subunits (p101, p84/p87PIKAP) and a p110γ catalytic subunit [2–4]. Triggering of the serine/threonine-specific protein kinase Akt after PIP3 generation leads to the activation of an abundance of the downstream targets [5], which is depicted in Figure1. Akt PH domain binds to PIP3 after recruitment to the membrane [ 6] and Akt activation is fully completed when it is phosphorylated by both phosphoinositide- Antioxidants 2021, 10, x FOR PEER REVIEW 2 of 14 dependent kinase 1 (PDK1) at Threonine 308 in the activation loop [7,8] and the rapamycin complex-2 (mTORC2) at Serine 473 [9]. Other kinases, such as mitogen-activated protein kinase-activated kinase 2 (MAPKAPK-2), integrin-linked kinase, and PKB itself, are also p110 catalytic subunit, class IB with two regulatory subunits (p101, p84/p87PIKAP) and a known top110 induceγ catalytic Akt subunit activation [2–4]. Triggering [10]. On of th thee serine/threonine-spe contrary, Aktcific activity protein can kinase be inhibited by dephosphorylationAkt after PIP3 viageneration protein leads phosphatase to the activation 2A of (PP2A)an abundance and of PH the domaindownstream leucine-rich tar- repeat protein phosphatasesgets [5], which is depicted (PHLPP) in Figure [11,12 1.]. Akt PH domain binds to PIP3 after recruitment to the membrane [6] and Akt activation is fully completed when it is phosphorylated by both ROSphosphoinositide-dependent are predominantly generated kinase 1 (PDK1) asby-products at Threonine 308during in the activation various loop physiological [7,8] pro- cesses andand have the rapamycin both advantageous complex-2 (mTORC2) and at disadvantageous Serine 473 [9]. Other kinases, effects such in as mammals mitogen- [13]. At low concentrations,activated protein ROS havekinase-activated positive kinase effects 2 (MAPKAPK-2), by means of integrin-linked increasing kinase, cellular and antioxidative PKB itself, are also known to induce Akt activation [10]. On the contrary, Akt activity can defense systemsbe inhibited which by dephosphorylation enables cells via to prot surviveein phosphatase against 2A higher (PP2A) and levels PH domain of oxidative stress. ROS areleucine-rich also required repeat forprotein the phosphatases regulation (PHLPP) of intracellular [11,12]. signaling, which affects various cellular processes,ROS are includingpredominantly proliferation, generated as by-pro cell survival,ducts during and various other physiological important pro- events [14–16]. The signalingcesses and messenger have both advantageous function is and exerted disadvantageous by triggering effects in themammals reversible [13]. At low oxidation of the concentrations, ROS have positive effects by means of increasing cellular antioxidative regulatorydefense proteins’ systems cysteines.which enables Ascells the to survive cells lackagainst enzymes higher levels to of remove oxidative hydroxylstress. radicals, further reactionsROS are also can required happen for the that regulation leads toof irreversibeintracellular signaling, oxidation which and affects degradation various of protein functionscellular [17,18 processes,], which including contributes proliferation, to variouscell survival, diseases, and other suchimportant as diabetes,events [14– obesity, and 16]. The signaling messenger function is exerted by triggering the reversible oxidation of cancer [19the,20 regulatory]. proteins’ cysteines. As the cells lack enzymes to remove hydroxyl radicals, PTENfurther has reactions an antagonizing can happen that functionleads to irreversibe in the oxidation PI3K/Akt and degradation pathway of by pro- inhibiting the downstreamtein functions signaling [17,18], molecules which contributes via dephosphorylation to various diseases, such as of diabetes, PIP3 to obesity, PIP2. and Because PTEN cancer [19,20]. possesses aPTEN cysteine has an in antagonizing the phosphatase function in the domain, PI3K/Akt itpathway becomes by inhibiting a target the ofdown- ROS, especially hydrogenstream peroxide signaling (H molecules2O2), which via dephosphorylation can oxidize and of PIP3 inactivate to PIP2. Because PTEN PTEN phosphatase pos- activity, as mentionedsesses a cysteine by numerous in the phosphatase studies domain, [21,22 it]. becomes In addition a target of toROS, thioredoxin especially hydro- (Trx), a system gen peroxide (H2O2), which can oxidize and inactivate PTEN phosphatase activity, as that can usementioned its active by numerous cysteine studies residues [21,22]. forIn addi reducingtion to thioredoxin oxidized (Trx), proteins a system (contains that disulfide bonds), Prxscan use are its members active cysteine of the residues thiol-dependent for reducing oxidized antioxidant proteins family (contains that disulfide acts as a scavenger of cytosolicbonds), or mitochondrialPrxs are members of peroxides the thiol-dependent such as antioxidant H2O2. Prxs family undergo that acts as modifications
Load more

Recommended publications
  • Oncogenic Inhibition by a Deleted in Liver Cancer Gene Requires Cooperation Between Tensin Binding and Rho-Specific Gtpase-Activating Protein Activities
    Oncogenic inhibition by a deleted in liver cancer gene requires cooperation between tensin binding and Rho-specific GTPase-activating protein activities Xiaolan Qian*, Guorong Li*, Holly K. Asmussen*, Laura Asnaghi*, William C. Vass*, Richard Braverman*, Kenneth M. Yamada†, Nicholas C. Popescu‡, Alex G. Papageorge*, and Douglas R. Lowy*§ *Laboratory of Cellular Oncology and ‡Laboratory of Experimental Carcinogenesis, Center for Cancer Research, National Cancer Institute, National Institutes of Health, Bethesda, MD 20892; and †Laboratory of Cell and Developmental Biology, National Institute of Dental and Craniofacial Research, National Institutes of Health, Bethesda, MD 20892 Communicated by Ira Pastan, National Institutes of Health, Bethesda, MD, April 2, 2007 (received for review March 1, 2007) The three deleted in liver cancer genes (DLC1–3) encode Rho- The prototypic member, designated DLC1, is localized to GTPase-activating proteins (RhoGAPs) whose expression is fre- chromosome 8p21–22 in a region that is commonly deleted in quently down-regulated or silenced in a variety of human malig- hepatocellular carcinoma (5). Its expression is frequently down- nancies. The RhoGAP activity is required for full DLC-dependent regulated or silenced in various solid tumors and hematologic tumor suppressor activity. Here we report that DLC1 and DLC3 bind malignancies, predominantly by promoter methylation (6–13). to human tensin1 and its chicken homolog. The binding has been Ectopic reexpression in DLC1-deficient cancer cell lines can mapped to the tensin Src homology 2 (SH2) and phosphotyrosine suppress cell proliferation, induce apoptosis, and reduce tumor- binding (PTB) domains at the C terminus of tensin proteins. Distinct igenicity. The RhoGAP activity appears to be required for these DLC1 sequences are required for SH2 and PTB binding.
    [Show full text]
  • Transcriptomic and Proteomic Profiling Provides Insight Into
    BASIC RESEARCH www.jasn.org Transcriptomic and Proteomic Profiling Provides Insight into Mesangial Cell Function in IgA Nephropathy † † ‡ Peidi Liu,* Emelie Lassén,* Viji Nair, Celine C. Berthier, Miyuki Suguro, Carina Sihlbom,§ † | † Matthias Kretzler, Christer Betsholtz, ¶ Börje Haraldsson,* Wenjun Ju, Kerstin Ebefors,* and Jenny Nyström* *Department of Physiology, Institute of Neuroscience and Physiology, §Proteomics Core Facility at University of Gothenburg, University of Gothenburg, Gothenburg, Sweden; †Division of Nephrology, Department of Internal Medicine and Department of Computational Medicine and Bioinformatics, University of Michigan, Ann Arbor, Michigan; ‡Division of Molecular Medicine, Aichi Cancer Center Research Institute, Nagoya, Japan; |Department of Immunology, Genetics and Pathology, Uppsala University, Uppsala, Sweden; and ¶Integrated Cardio Metabolic Centre, Karolinska Institutet Novum, Huddinge, Sweden ABSTRACT IgA nephropathy (IgAN), the most common GN worldwide, is characterized by circulating galactose-deficient IgA (gd-IgA) that forms immune complexes. The immune complexes are deposited in the glomerular mesangium, leading to inflammation and loss of renal function, but the complete pathophysiology of the disease is not understood. Using an integrated global transcriptomic and proteomic profiling approach, we investigated the role of the mesangium in the onset and progression of IgAN. Global gene expression was investigated by microarray analysis of the glomerular compartment of renal biopsy specimens from patients with IgAN (n=19) and controls (n=22). Using curated glomerular cell type–specific genes from the published literature, we found differential expression of a much higher percentage of mesangial cell–positive standard genes than podocyte-positive standard genes in IgAN. Principal coordinate analysis of expression data revealed clear separation of patient and control samples on the basis of mesangial but not podocyte cell–positive standard genes.
    [Show full text]
  • Genetic Alterations of Protein Tyrosine Phosphatases in Human Cancers
    Oncogene (2015) 34, 3885–3894 © 2015 Macmillan Publishers Limited All rights reserved 0950-9232/15 www.nature.com/onc REVIEW Genetic alterations of protein tyrosine phosphatases in human cancers S Zhao1,2,3, D Sedwick3,4 and Z Wang2,3 Protein tyrosine phosphatases (PTPs) are enzymes that remove phosphate from tyrosine residues in proteins. Recent whole-exome sequencing of human cancer genomes reveals that many PTPs are frequently mutated in a variety of cancers. Among these mutated PTPs, PTP receptor T (PTPRT) appears to be the most frequently mutated PTP in human cancers. Beside PTPN11, which functions as an oncogene in leukemia, genetic and functional studies indicate that most of mutant PTPs are tumor suppressor genes. Identification of the substrates and corresponding kinases of the mutant PTPs may provide novel therapeutic targets for cancers harboring these mutant PTPs. Oncogene (2015) 34, 3885–3894; doi:10.1038/onc.2014.326; published online 29 September 2014 INTRODUCTION tyrosine/threonine-specific phosphatases. (4) Class IV PTPs include Protein tyrosine phosphorylation has a critical role in virtually all four Drosophila Eya homologs (Eya1, Eya2, Eya3 and Eya4), which human cellular processes that are involved in oncogenesis.1 can dephosphorylate both tyrosine and serine residues. Protein tyrosine phosphorylation is coordinately regulated by protein tyrosine kinases (PTKs) and protein tyrosine phosphatases 1 THE THREE-DIMENSIONAL STRUCTURE AND CATALYTIC (PTPs). Although PTKs add phosphate to tyrosine residues in MECHANISM OF PTPS proteins, PTPs remove it. Many PTKs are well-documented oncogenes.1 Recent cancer genomic studies provided compelling The three-dimensional structures of the catalytic domains of evidence that many PTPs function as tumor suppressor genes, classical PTPs (RPTPs and non-RPTPs) are extremely well because a majority of PTP mutations that have been identified in conserved.5 Even the catalytic domain structures of the dual- human cancers are loss-of-function mutations.
    [Show full text]
  • In This Table Protein Name, Uniprot Code, Gene Name P-Value
    Supplementary Table S1: In this table protein name, uniprot code, gene name p-value and Fold change (FC) for each comparison are shown, for 299 of the 301 significantly regulated proteins found in both comparisons (p-value<0.01, fold change (FC) >+/-0.37) ALS versus control and FTLD-U versus control. Two uncharacterized proteins have been excluded from this list Protein name Uniprot Gene name p value FC FTLD-U p value FC ALS FTLD-U ALS Cytochrome b-c1 complex P14927 UQCRB 1.534E-03 -1.591E+00 6.005E-04 -1.639E+00 subunit 7 NADH dehydrogenase O95182 NDUFA7 4.127E-04 -9.471E-01 3.467E-05 -1.643E+00 [ubiquinone] 1 alpha subcomplex subunit 7 NADH dehydrogenase O43678 NDUFA2 3.230E-04 -9.145E-01 2.113E-04 -1.450E+00 [ubiquinone] 1 alpha subcomplex subunit 2 NADH dehydrogenase O43920 NDUFS5 1.769E-04 -8.829E-01 3.235E-05 -1.007E+00 [ubiquinone] iron-sulfur protein 5 ARF GTPase-activating A0A0C4DGN6 GIT1 1.306E-03 -8.810E-01 1.115E-03 -7.228E-01 protein GIT1 Methylglutaconyl-CoA Q13825 AUH 6.097E-04 -7.666E-01 5.619E-06 -1.178E+00 hydratase, mitochondrial ADP/ATP translocase 1 P12235 SLC25A4 6.068E-03 -6.095E-01 3.595E-04 -1.011E+00 MIC J3QTA6 CHCHD6 1.090E-04 -5.913E-01 2.124E-03 -5.948E-01 MIC J3QTA6 CHCHD6 1.090E-04 -5.913E-01 2.124E-03 -5.948E-01 Protein kinase C and casein Q9BY11 PACSIN1 3.837E-03 -5.863E-01 3.680E-06 -1.824E+00 kinase substrate in neurons protein 1 Tubulin polymerization- O94811 TPPP 6.466E-03 -5.755E-01 6.943E-06 -1.169E+00 promoting protein MIC C9JRZ6 CHCHD3 2.912E-02 -6.187E-01 2.195E-03 -9.781E-01 Mitochondrial 2-
    [Show full text]
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name tensin 1 Gene Symbol TNS1 Organism Human Gene Summary The protein encoded by this gene localizes to focal adhesions regions of the plasma membrane where the cell attaches to the extracellular matrix. This protein crosslinks actin filaments and contains a Src homology 2 (SH2) domain which is often found in molecules involved in signal transduction. This protein is a substrate of calpain II. A second transcript from this gene has been described but its full length nature has not been determined. Gene Aliases DKFZp586K0617, MGC88584, MST091, MST122, MST127, MSTP122, MSTP127, MXRA6, TNS RefSeq Accession No. NC_000002.11, NT_005403.17 UniGene ID Hs.471381 Ensembl Gene ID ENSG00000079308 Entrez Gene ID 7145 Assay Information Unique Assay ID qHsaCED0056481 Assay Type SYBR® Green Detected Coding Transcript(s) ENST00000171887, ENST00000446688 Amplicon Context Sequence GGCAGAGCAGCAAGACTCAATCCCCAGCCCCCAAAAAGGCATCATGCAGGTAA GCAGGTCTGAGATAAGGCTGGTCCAGGGGCATGAAACCCAATAACAAGGCTGA G Amplicon Length (bp) 77 Chromosome Location 2:218668016-218668122 Assay Design Exonic Purification Desalted Validation Results Efficiency (%) 109 R2 0.9936 cDNA Cq 23.48 cDNA Tm (Celsius) 83 Page 1/5 PrimePCR™Assay Validation Report gDNA Cq 25.01 Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 2/5 PrimePCR™Assay Validation Report TNS1, Human Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis
    [Show full text]
  • Nº Ref Uniprot Proteína Péptidos Identificados Por MS/MS 1 P01024
    Document downloaded from http://www.elsevier.es, day 26/09/2021. This copy is for personal use. Any transmission of this document by any media or format is strictly prohibited. Nº Ref Uniprot Proteína Péptidos identificados 1 P01024 CO3_HUMAN Complement C3 OS=Homo sapiens GN=C3 PE=1 SV=2 por 162MS/MS 2 P02751 FINC_HUMAN Fibronectin OS=Homo sapiens GN=FN1 PE=1 SV=4 131 3 P01023 A2MG_HUMAN Alpha-2-macroglobulin OS=Homo sapiens GN=A2M PE=1 SV=3 128 4 P0C0L4 CO4A_HUMAN Complement C4-A OS=Homo sapiens GN=C4A PE=1 SV=1 95 5 P04275 VWF_HUMAN von Willebrand factor OS=Homo sapiens GN=VWF PE=1 SV=4 81 6 P02675 FIBB_HUMAN Fibrinogen beta chain OS=Homo sapiens GN=FGB PE=1 SV=2 78 7 P01031 CO5_HUMAN Complement C5 OS=Homo sapiens GN=C5 PE=1 SV=4 66 8 P02768 ALBU_HUMAN Serum albumin OS=Homo sapiens GN=ALB PE=1 SV=2 66 9 P00450 CERU_HUMAN Ceruloplasmin OS=Homo sapiens GN=CP PE=1 SV=1 64 10 P02671 FIBA_HUMAN Fibrinogen alpha chain OS=Homo sapiens GN=FGA PE=1 SV=2 58 11 P08603 CFAH_HUMAN Complement factor H OS=Homo sapiens GN=CFH PE=1 SV=4 56 12 P02787 TRFE_HUMAN Serotransferrin OS=Homo sapiens GN=TF PE=1 SV=3 54 13 P00747 PLMN_HUMAN Plasminogen OS=Homo sapiens GN=PLG PE=1 SV=2 48 14 P02679 FIBG_HUMAN Fibrinogen gamma chain OS=Homo sapiens GN=FGG PE=1 SV=3 47 15 P01871 IGHM_HUMAN Ig mu chain C region OS=Homo sapiens GN=IGHM PE=1 SV=3 41 16 P04003 C4BPA_HUMAN C4b-binding protein alpha chain OS=Homo sapiens GN=C4BPA PE=1 SV=2 37 17 Q9Y6R7 FCGBP_HUMAN IgGFc-binding protein OS=Homo sapiens GN=FCGBP PE=1 SV=3 30 18 O43866 CD5L_HUMAN CD5 antigen-like OS=Homo
    [Show full text]
  • Discovery and Systematic Characterization of Risk Variants and Genes For
    medRxiv preprint doi: https://doi.org/10.1101/2021.05.24.21257377; this version posted June 2, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. It is made available under a CC-BY 4.0 International license . 1 Discovery and systematic characterization of risk variants and genes for 2 coronary artery disease in over a million participants 3 4 Krishna G Aragam1,2,3,4*, Tao Jiang5*, Anuj Goel6,7*, Stavroula Kanoni8*, Brooke N Wolford9*, 5 Elle M Weeks4, Minxian Wang3,4, George Hindy10, Wei Zhou4,11,12,9, Christopher Grace6,7, 6 Carolina Roselli3, Nicholas A Marston13, Frederick K Kamanu13, Ida Surakka14, Loreto Muñoz 7 Venegas15,16, Paul Sherliker17, Satoshi Koyama18, Kazuyoshi Ishigaki19, Bjørn O Åsvold20,21,22, 8 Michael R Brown23, Ben Brumpton20,21, Paul S de Vries23, Olga Giannakopoulou8, Panagiota 9 Giardoglou24, Daniel F Gudbjartsson25,26, Ulrich Güldener27, Syed M. Ijlal Haider15, Anna 10 Helgadottir25, Maysson Ibrahim28, Adnan Kastrati27,29, Thorsten Kessler27,29, Ling Li27, Lijiang 11 Ma30,31, Thomas Meitinger32,33,29, Sören Mucha15, Matthias Munz15, Federico Murgia28, Jonas B 12 Nielsen34,20, Markus M Nöthen35, Shichao Pang27, Tobias Reinberger15, Gudmar Thorleifsson25, 13 Moritz von Scheidt27,29, Jacob K Ulirsch4,11,36, EPIC-CVD Consortium, Biobank Japan, David O 14 Arnar25,37,38, Deepak S Atri39,3, Noël P Burtt4, Maria C Costanzo4, Jason Flannick40, Rajat M 15 Gupta39,3,4, Kaoru Ito18, Dong-Keun Jang4,
    [Show full text]
  • Circrna Circ 102049 Implicates in Pancreatic Ductal Adenocarcinoma Progression Through Activating CD80 by Targeting Mir-455-3P
    Hindawi Mediators of Inflammation Volume 2021, Article ID 8819990, 30 pages https://doi.org/10.1155/2021/8819990 Research Article circRNA circ_102049 Implicates in Pancreatic Ductal Adenocarcinoma Progression through Activating CD80 by Targeting miR-455-3p Jie Zhu,1 Yong Zhou,1 Shanshan Zhu,1 Fei Li,1 Jiajia Xu,1 Liming Zhang,1 and Hairong Shu 2 1Medical Laboratory, Taizhou Central Hospital (Taizhou University Hospital), Taizhou, Zhejiang, China 2Department of Medical Service, Taizhou Central Hospital (Taizhou University Hospital), Taizhou, Zhejiang, China Correspondence should be addressed to Hairong Shu; [email protected] Received 30 September 2020; Revised 27 November 2020; Accepted 13 December 2020; Published 7 January 2021 Academic Editor: Xiaolu Jin Copyright © 2021 Jie Zhu et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Emerging evidence has shown that circular RNAs (circRNAs) and DNA methylation play important roles in the causation and progression of cancers. However, the roles of circRNAs and abnormal methylation genes in the tumorigenesis of pancreatic ductal adenocarcinoma (PDAC) are still largely unknown. Expression profiles of circRNA, gene methylation, and mRNA were downloaded from the GEO database, and differentially expressed genes were obtained via GEO2R, and a ceRNA network was constructed based on circRNA-miRNA pairs and miRNA-mRNA pairs. Inflammation-associated genes were collected from the GeneCards database. Then, functional enrichment analysis and protein-protein interaction (PPI) networks of inflammation- associated methylated expressed genes were investigated using Metascape and STRING databases, respectively, and visualized in Cytoscape.
    [Show full text]
  • Views for Entrez
    BASIC RESEARCH www.jasn.org Phosphoproteomic Analysis Reveals Regulatory Mechanisms at the Kidney Filtration Barrier †‡ †| Markus M. Rinschen,* Xiongwu Wu,§ Tim König, Trairak Pisitkun,¶ Henning Hagmann,* † † † Caroline Pahmeyer,* Tobias Lamkemeyer, Priyanka Kohli,* Nicole Schnell, †‡ †† ‡‡ Bernhard Schermer,* Stuart Dryer,** Bernard R. Brooks,§ Pedro Beltrao, †‡ Marcus Krueger,§§ Paul T. Brinkkoetter,* and Thomas Benzing* *Department of Internal Medicine II, Center for Molecular Medicine, †Cologne Excellence Cluster on Cellular Stress | Responses in Aging-Associated Diseases, ‡Systems Biology of Ageing Cologne, Institute for Genetics, University of Cologne, Cologne, Germany; §Laboratory of Computational Biology, National Heart, Lung, and Blood Institute, National Institutes of Health, Bethesda, Maryland; ¶Faculty of Medicine, Chulalongkorn University, Bangkok, Thailand; **Department of Biology and Biochemistry, University of Houston, Houston, Texas; ††Division of Nephrology, Baylor College of Medicine, Houston, Texas; ‡‡European Molecular Biology Laboratory–European Bioinformatics Institute, Hinxton, Cambridge, United Kingdom; and §§Max Planck Institute for Heart and Lung Research, Bad Nauheim, Germany ABSTRACT Diseases of the kidney filtration barrier are a leading cause of ESRD. Most disorders affect the podocytes, polarized cells with a limited capacity for self-renewal that require tightly controlled signaling to maintain their integrity, viability, and function. Here, we provide an atlas of in vivo phosphorylated, glomerulus- expressed
    [Show full text]
  • 4059.Full.Pdf
    Published OnlineFirst June 11, 2014; DOI: 10.1158/1078-0432.CCR-13-1559 Clinical Cancer Cancer Therapy: Preclinical Research Tyrosine Phosphoproteomics Identifies Both Codrivers and Cotargeting Strategies for T790M-Related EGFR-TKI Resistance in Non–Small Cell Lung Cancer Takeshi Yoshida1,5, Guolin Zhang1, Matthew A. Smith1, Alex S. Lopez2, Yun Bai1, Jiannong Li1, Bin Fang3, John Koomen3, Bhupendra Rawal4, Kate J. Fisher4, Ann Y. Chen4, Michiko Kitano5, Yume Morita5, Haruka Yamaguchi5, Kiyoko Shibata5, Takafumi Okabe5, Isamu Okamoto5, Kazuhiko Nakagawa5, and Eric B. Haura1 Abstract Purpose: Irreversible EGFR-tyrosine kinase inhibitors (TKI) are thought to be one strategy to overcome EGFR-TKI resistance induced by T790M gatekeeper mutations in non–small cell lung cancer (NSCLC), yet they display limited clinical efficacy. We hypothesized that additional resistance mechanisms that cooperate with T790M could be identified by profiling tyrosine phosphorylation in NSCLC cells with acquired resistance to reversible EGFR-TKI and harboring T790M. Experimental Design: We profiled PC9 cells with TKI-sensitive EGFR mutation and paired EGFR-TKI– resistant PC9GR (gefitinib-resistant) cells with T790M using immunoaffinity purification of tyrosine- phosphorylated peptides and mass spectrometry–based identification/quantification. Profiles of erlotinib perturbations were examined. Results: We observed a large fraction of the tyrosine phosphoproteome was more abundant in PC9- and PC9GR-erlotinib–treated cells, including phosphopeptides corresponding to MET, IGF, and AXL signaling. Activation of these receptor tyrosine kinases by growth factors could protect PC9GR cells against the irreversible EGFR-TKI afatinib. We identified a Src family kinase (SFK) network as EGFR-independent and confirmed that neither erlotinib nor afatinib affected Src phosphorylation at the activation site.
    [Show full text]
  • Endocrine System Local Gene Expression
    Copyright 2008 By Nathan G. Salomonis ii Acknowledgments Publication Reprints The text in chapter 2 of this dissertation contains a reprint of materials as it appears in: Salomonis N, Hanspers K, Zambon AC, Vranizan K, Lawlor SC, Dahlquist KD, Doniger SW, Stuart J, Conklin BR, Pico AR. GenMAPP 2: new features and resources for pathway analysis. BMC Bioinformatics. 2007 Jun 24;8:218. The co-authors listed in this publication co-wrote the manuscript (AP and KH) and provided critical feedback (see detailed contributions at the end of chapter 2). The text in chapter 3 of this dissertation contains a reprint of materials as it appears in: Salomonis N, Cotte N, Zambon AC, Pollard KS, Vranizan K, Doniger SW, Dolganov G, Conklin BR. Identifying genetic networks underlying myometrial transition to labor. Genome Biol. 2005;6(2):R12. Epub 2005 Jan 28. The co-authors listed in this publication developed the hierarchical clustering method (KP), co-designed the study (NC, AZ, BC), provided statistical guidance (KV), co- contributed to GenMAPP 2.0 (SD) and performed quantitative mRNA analyses (GD). The text of this dissertation contains a reproduction of a figure from: Yeo G, Holste D, Kreiman G, Burge CB. Variation in alternative splicing across human tissues. Genome Biol. 2004;5(10):R74. Epub 2004 Sep 13. The reproduction was taken without permission (chapter 1), figure 1.3. iii Personal Acknowledgments The achievements of this doctoral degree are to a large degree possible due to the contribution, feedback and support of many individuals. To all of you that helped, I am extremely grateful for your support.
    [Show full text]
  • Multifaceted Role of Tensins in Cancer
    1 Multifaceted role of Tensins in cancer 2 3 Abdulaziz Alfahed*1,2,3, Teresa Pereira Raposo*1,2,4 , Mohammad Ilyas1,2 4 5 1 Division of Cancer and Stem Cells, School of Medicine, University of Nottingham, 6 Nottingham, United Kingdom 7 2 Nottingham Molecular Pathology Node, University of Nottingham, Nottingham, United 8 Kingdom 9 3 Department of Medical Laboratory, College of Applied Medical Sciences, Prince Sattam Bin 10 Abdulaziz University, Al-Kharj, Saudi Arabia 11 *Equal contribution to this work 12 13 Corresponding Author: 14 Teresa Raposo4 15 Cancer Biology Unit, Division of Cancer and Stem Cells,West block, D floor, Queen’s Medical 16 Centre, NG7 2UH Derby Road, Nottingham, United Kingdom 17 Email address: [email protected] 18 19 Abstract 20 Tensins are structural adaptor proteins localized at focal adhesions. Tensins can act as 21 mechanosensors and participate in the transduction of biochemical signals from the extracellular 22 matrix to the cytoskeleton, acting as an interface able to alter cell behavior in responses to 23 changes in their surrounding environment. 24 This review aims to provide a concise summary of the main functions of the four known tensins 25 in cell and cancer biology, their homology and recently unveiled signaling mechanisms. We 26 focus specifically on how tensin 4 (TNS4/Cten) may contribute to cancer both as an oncogene 27 supporting metastasis and as tumour suppressor in different types of tissue. A better 28 understanding of the cancer mechanistics involving tensins may provide the rationale for 29 development of specific therapeutic strategies. 30 31 Introduction 32 Tensins were first identified in the 1980s as F-actin (filamentous actin) capping proteins 33 localised to focal adhesions.
    [Show full text]