PHARMACOKINETIC-PHARMACODYNAMIC STUDIES OF 5-AZACYTIDINE IN COMBINATION WITH GTI-2040
DISSERTATION
Presented in Partial Fulfillment of the Requirements for
the Degree Doctor of Philosophy in the
Graduate School of The Ohio State University
By
Ping Chen, M.S.
* * * * * *
The Ohio State University 2008
Approved by Dissertation Committee:
Dr. Kenneth K. Chan, Adviser
Dr. Guido Marcucci, Co-adviser Adviser Graduate Program in Pharmacy Dr., Duxin Sun Approved by Dr. Robert M. Snapka
Adviser Graduate Program in Pharmacy i ABSTRACT
Leukemia is the most common blood cancer and is characterized by the increased
expansion of abnormal blood cells. Important insights into the pathogenesis of this disease
have led to the development of a number of anti-leukemia drugs including nucleoside
analogues, such as 5-azacytidine (5-AzaC), decitabine and aracytidine, and ribonucleotide
reductase inhibitor such as GTI-2040. 5-Azacytidine and decitabine are hypomethylating
agents that induce DNA demethylation, resulting in reactivation of hypermethylation-
associated silencing of tumor suppressor genes. GTI-2040 is a 20-mer oligonucleotide inhibiting the expression of ribonucleotide reductase subunit 2 mRNA, an enzyme that has been found to be over-expressed in most cancers. Aracytidine is widely used as important cytostatic drug in the treatment for acute myelogenous leukemia. In order to support the mechanistic studies and potential combination treatment of these anti-cancer drugs, a non- radioactive, sensitive and specific LC-MS/MS method has been developed to quantify intracellular NTP and dNTP pools in cell matrices. A significant decrease in dCTP and dATP levels has been observed following GTI-2040 treatment in human leukemia MV411 cells. More importantly, GTI-2040 was found to down-regulate R2 mRNA and protein levels in a dose dependent manner. In order to evaluate the combination treatment effect of
GTI-2040 and aracytidine, a sensitive HPLC method has been developed to determine the intracellular aracytidine triphosphate (Ara-CTP) level. A significant increase in intracellular Ara-CTP level has been observed after pretreatment of GTI-2040 in vitro.
Further pharmacokinetics / pharmacodynamics (PK/PD) modeling and simulation of GTI-
ii 2040 and aracytidine in the cell exhibited the increase of intracellular Ara-CTP level by >2
fold. In order to characterize pharmacokinetic profile of 5-azacytidine in patients with
hematologic malignancies, a simple, non-radioactive, sensitive and specific high- performance HPLC-MS/MS method has also been developed to quantify 5-AzaC in human plasma. A further transporter study revealed that the transport of 5-AzaC into cell may involve the human equilibrative nucleoside transporter 1 (hENT1). The pharmacokinetics
of decitabine was well characterized by a two-compartment model. Body surface area was
identified as a covariate with total systemic clearance in population pharmacokinetic
studies of decitabine in leukemia patients. These results provide valuable insights in
clinical development of GTI-2040, 5-AzaC, aracytidine and decitabine as a single agent or
in combination with other drugs.
iii
Dedicated to my parents.
iv ACKNOWLEDGMENTS
This thesis would not have been possible without the support of many people. First and foremost, I would like to thank my adviser, Dr. Kenneth K. Chan, for his intellectual supervision, continuous support, endless patience, motivation and encouragement throughout my graduate studies. I am very grateful for the time he spent on helping me with every aspect of this research, for his invaluable suggestions and careful guidance. I am fortunate to have Dr. Chan, a knowledgeable and excellent professor as my adviser.
I would like to thank Dr. Duxin Sun and my co-adviser, Dr. Guido Marcucci for their support, sound advice and fruitful comments on my research. Many thanks also go to my committee member, Dr. Robert M. Snapka, for his time and effort in reviewing this work.
Appreciation also goes to my fellow labmates and collaborators. Dr. Shujun Liu and Ms.
Jiuxia Pang in Dr. Marcucci’s laboratory helped me tremendously in biochemical experiments. Without their help and effort, my work would have undoubtedly been more difficult. I would also like to express my thanks to Ms. LeNguyen Huynh for the time she spent on collecting patient samples.
I am very thankful for Dr. Zhongfa Liu’s constructive suggestions and assistance on the bioanalytical method development. I have greatly benefited from his keen scientific
v insight and immense experience in analytical chemistry. My sincere thanks also go to Dr.
Zhiliang Xie and Dr. Ming Heung Chiu for their great help and assistance on sample preparation and analysis. I also thank Dr. Chen Ren and Dr. Yonghua Ling for their support and warm friendship. I would also like to thank Ms. Josephine Aimiuwu for her
valuable scientific discussions on biochemical modulation studies and cell culture experiments.
I am also very grateful to Ms. Joy Scott for her administrative help and support. I would also like to express my thanks to all of my friends and colleagues in the College of
Pharmacy for their encouragement and invaluable scientific discussions.
Finally, my special thanks go to my family. I am deeply and forever indebted to my parents for their everlasting love, support and encouragement, for giving of themselves beyond the call of duty. Especially, I want to thank my father for his unconditional love. I would like to include the following poem to express my sincere and deep remembrance of him.
If Roses grow in Heaven,
Lord please pick a bunch for me,
Place them in my Father's arms
And tell him they're from me.
vi Tell him I love him and miss him so much, and I dream of him every night,
And when he turns to smile,
Place a kiss upon his cheek
And hold him for a while.
Remembering him is easy,
I do it every day,
But there's an ache within my heart
Because I am missing him today.
vii VITA
Nov 15, 1979………………………...... Born in Zhejiang, P.R.China 1999-2003…………………………...... B.S. in Pharmaceutical Science Peking University Health Science Center 2003-present………………………………Graduate Teaching and Research Associate, The Ohio State University
PUBLICATIONS Research Publications:
1. Bulbul Pandit, Yanjun Sun, Ping Chen, Dan L. Sackett, Zhigen Hu, Wendy Rich, Chenglong Li, Andrew Lewis, Kevin Schaefer and Pui-Kai Li, Structure-activity- relationship studies of conformationally restricted analogs of combretastatin A-4 derived from SU5416. Bioorg Med Chem. 2006, 14(19):6492-6501.
2. Ping Chen, Zhongfa Liu, Shujun Liu, Zhiliang Xie, Josephine Aimiuwu, Jiuxia Pang, Rebecca Klisovic, William Blum, Michael R. Grever, Guido Marcucci, Kenneth, K, Chan, A LC-MS/MS method for the analysis of intracellular nucleoside triphosphate levels, Nucleic Acid Research, submitted.
3. Zhongfa Liu, Shujun Liu, Zhiliang Xie, Ryan E. Pavlovicz, Jiejun Wu, Ping Chen, Josephine Aimiuwu, Jiuxia Pang, Deepak Bhasin, Paolo Neviani, James R. Fuchs, Christoph Plass, Pui-Kai Li, Chenglong Li, Tim H-M Huang, Lai-Chu Wus, Laura Rush, Guido Marcucci, Kenneth K. Chan, Modulation of DNA methylation by a sesquiterpene lactone parthenolide, Cancer Research, submitted.
4. Ping Chen, Zhongfa Liu, Shujun Liu, Jiuxia Pang, Rebecca Klisovic, William Blum, Guido Marcucci, Kenneth, K, Chan, Clinical pharmacokinetics and population pharmacokinetics of decitabine at low doses in patients with hematological malignancies, in revision.
Abstracts:
1. Kenneth K. Chan, Ping Chen, Zhiliang Xie. Ching-Shih Chen, Pharmacokinetics of akt inhibitor nsc 728209 in the rat by lc/ms/ms method. AACR Conference, 2006 Nov11.
2. Zhongfa Liu, Shujun Liu, Zhiliang Xie, Chenglong Li, Josephine Aimiuwu, Ping Chen William Blum, Guido Marcucci, Kenneth, K, Chan, NF-kappaB inhibitor Parthenolide mediates DNA demethylation and histone acetylation in leukemia cells . AACR Conference, 2007 Apr.
3. Ping Chen, Zhongfa Liu, Shujun Liu, Zhiliang Xie, Josephine Aimiuwu, Jiuxia Pang,
viii Rebecca Klisovic, William Blum, Guido Marcucci, Kenneth, K, Chan, Analysis of intracellular nucleoside triphosphate levels in leukemia cell line K562 by HPLC coupled with electrospray ion-trap mass. AACR Conference, 2007 Apr.
4. Ping Chen, Zhongfa Liu, Shujun Liu, Zhiliang Xie, Josephine Aimiuwu, Jiuxia Pang, Rebecca Klisovic, William Blum, Guido Marcucci, Kenneth, K, Chan, Biochemical Modulation of Intracellular Nucleoside Triphosphate Levels by GTI-2040, An Inhibitor of Ribonucleotide Reductase in K562 Human Leukemia Cells. AAPS Conference, 2007 Nov.
5. Chen Ren, Zhongfa Liu, Will Jones, Ping Chen, Kenneth K. Chan. An LC-MS/MS method for the quantitation of metastin 45-54 (NSC 741805) and its preclinical pharmacokinetics in rats. AAPS Conference, 2007 Nov.
6. Josephine Aimiuwu, Ping Chen, Ming Chiu, Zhiliang Xie, Zhongfa Liu, Shujun Liu, Guido Marcucci, Kenneth K. Chan. 5-Azacytidine, a Possible New Inhibitor of Ribonucleotide Reductase (R2), and its Combined Biological Effect with GTI 2040 in Chronic and Acute Myeloid Leukemia Cells. AACR Conference, 2008 Apr.
FIELDS OF STUDY
Major Field: Pharmacy
-with studies on preclinical, clinical pharmacokinetics/pharmacodynamics, and bioanalytical method development.
ix TABLE OF CONTENT
page
ABSTRACT...... ii ACKNOWLEDGMENTS ...... v VITA...... viii LIST OF TABLES...... xv LIST OF FIGURES ...... xvi CHAPTER 1 ...... 1 BACKGROUND AND INTRODUCTION ...... 1 1.1 Background...... 1 1.2 Hypothesis...... 1 1.3 Introduction...... 5 1.3.1 Molecular targets for treatment of myeloid leukemia...... 5 1.3.2 Epigenetic and cancers...... 6 1.3.3 DNA and RNA perturbation in cancers...... 9 1.3.4 GTI-2040, an inhibitor of human ribonucleotide reductase (RNR)...... 12 1.3.5 5-Azacytidine and decitabine, hypomethylating agents ...... 14 1.3.5.1 5-Azacytidine...... 15 1.3.5.2 Decitabine ...... 17 1.3.6 Aracytidine...... 18 1.4 Specific aims...... 19 1.5 Rationale of the project...... 21 1.5.1 Combination of Aracytidine with GTI-2040 ...... 21 1.5.2 Combination of 5-Azacytidine with GTI-2040...... 22 1.5.3 Combination of Aracytidine with 5-Azacytidine...... 23 1.6 Significance...... 23
CHAPTER 2 ...... 35 A LC-MS/MS METHOD FOR THE ANALYSIS OF INTRACELLULAR NUCLEOSIDE TRIPHOSPPHATE LEVELS...... 35 2.1 Abstract...... 35 2.2 Introduction...... 36 2.3 Method ...... 37 2.3.1 Chemicals and reagents...... 38 2.3.2 Instrumentation ...... 38 2.3.3 HPLC chromatographic and mass spectrometric conditions...... 39 2.3.4 Cell lines and cell culture condition...... 40 2.3.5 dNTPs/NTPs extraction ...... 41 2.3.6 Cell matrices preparation and matrix effect study ...... 41
x 2.3.7 Calibration standards and method validation...... 42 2.3.8 Determination of intracellular dNTP and NTP pool after GTI-2040 treatment in human MV411 leukemia cells ...... 43 2.3.9 Determination of intracellular dNTP and NTP pools in a bone marrow sample of a leukemia patient...... 43 2.4 Results...... 44 2.4.1 HPLC-MS/MS assay of dNTPs and NTPs ...... 44 2.4.2 Assay validations and matrix effect studies...... 45 2.4.3 Analysis of dNTP and NTP in different cell lines ...... 47 2.4.4 Alterations in dNTPs and NTPs levels in leukemia MV411 treated with GTI- 2040 48 2.4.5 Determination of dNTPs and NTPs levels in bone marrow samples from a leukemia patient...... 49 2.5 Discussion...... 49 2.6 Conclusion ...... 54
CHAPTER 3 ...... 63 A HIGHLY SENSITIVE AND SPECIFIC LC-MS/MS ASSAY FOR THE QUANTITATION OF 5-AZACYTIDINE IN HUMAN PLASMA ...... 63 3.1 Abstract...... 63 3.2 Introduction...... 64 3.3 Experimental Method...... 66 3.3.1 Materials ...... 66 3.3.2 Quantitative conversion of decitabine into dihydro-decitabine as the internal standard (IS)...... 67 3.3.3 Sample preparation ...... 68 3.3.4 Instrumentation ...... 69 3.3.5 HPLC and MS conditions ...... 69 3.3.6 Method validation ...... 71 3.4 Result ...... 72 3.4.1 Verification of the structure of the internal standard...... 72 3.4.2 Separation and identification of 5-AzaC and the IS in human plasma extracts. 73 3.4.3 Method validation ...... 74 3.5 Discussion...... 75 3.6 Conclusions...... 78
CHAPTER 4 ...... 91 A SENSITIVE AND SPECIFIC HPLC/UV ASSAY FOR THE QUANTIFICATION OF INTRACELLULAR ARACYTIDINE TRIPHOSPHATE (ARA-CTP)...... 91 4.1 Abstract...... 91
xi 4.2 Introduction...... 92 4.3 Experimental Method...... 95 4.3.1 Chemicals and reagents...... 95 4.3.2 Cell culture...... 96 4.3.3 Nucleotide extraction...... 96 4.3.4 Instrumentation ...... 97 4.3.5 HPLC chromatography ...... 97 4.3.6 Calibration standards preparation ...... 98 4.3.7 Method validation ...... 98 4.3.8 Determination of intracellular Ara-CTP level after Ara-C treatment in human K562 leukemia cells...... 99 4.3.9 Calculation and statistical analysis ...... 100 4.3.10 Chromatographic characteristics...... 100 4.4 Results...... 102 4.4.1 HPLC chromatography ...... 102 4.4.2 Specificity ...... 102 4.4.3 Chromatographic characteristics...... 103 4.4.4 Linearity...... 103 4.4.5 Method validation ...... 104 4.4.6 Intracellular Ara-CTP accumulation...... 104 4.5 Discussion...... 104 4.6 Conclusion ...... 106
CHAPTER 5 ...... 117 A HIGHLY SENSITIVE AND SPECIFIC LC-MS/MS ASSAY FOR THE QUANTITATION OF DECITABINE-TRIPHOSPHATE IN CELL EXTRACT...... 117 5.1 Abstract...... 117 5.2 Introduction...... 118 5.3 Method ...... 119 5.3.1 Chemicals and reagents...... 119 5.3.2 Instrumentation ...... 120 5.3.3 HPLC chromatographic and mass spectrometric conditions...... 120 5.3.4 Cell lines and cell culture condition...... 121 5.3.5 DAC-TP/dNTPs extraction...... 122 5.3.6 Preparation of cell matrices ...... 123 5.3.7 Calibration standards and method validation...... 123 5.3.8 Intracellular accumulation of DAC-TP in K562 cells following treatment with DAC 124 5.3.9 Intracellular accumulation of DAC-TP in patient bone marrow samples..... 124 following DAC treatment ...... 124 5.4 Results...... 125
xii 5.4.1 HPLC-MS/MS assay of DAC-TP and dNTP...... 125 5.4.2 Assay validations ...... 126 5.4.3 Intracellular accumulation of DAC-TP in K562 cells following treatment with DAC 127 5.4.4 Intracellular accumulation of DAC-TP in patient bone marrow samples..... 128 following DAC treatment ...... 128 5.5 Discussion...... 128 5.6 Conclusion ...... 130
CHAPTER 6 ...... 140 BIOCHEMICAL MODULATION OF INTRACELLULAR NUCLEOSIDE TRIPHOSPHATE LEVELS BY ANTI-LEUKEMIA DRUGS IN K562 HUMAN LEUKEMIA CELLS ...... 140 6.1 Abstract...... 140 6.2 Introduction...... 141 6.3 Method ...... 145 6.3.1 Chemicals and reagents...... 145 6.3.2 HPLC chromatographic and mass spectrometric conditions...... 146 6.3.3 Cell culture conditions ...... 147 6.3.4 NTP/dNTP or Ara-CTP extraction ...... 148 6.3.5 Determination of intracellular dNTP/NTP levels after GTI-2040 treatment in human K562 leukemia cells...... 149 6.3.6 Determination of intracellular Ara-CTP levels after Ara-C treatment in combination with GTI-2040 in human K562 leukemia cells...... 149 6.3.7 Determination of intracellular GTI-2040 concentrations by a hybridization- based ELISA Assay ...... 150 6.3.8 Quantification of R2 mRNA by real-time RT-PCR following GTI-2040 treatment ...... 151 6.3.9 Measurement of R2 protein levels by western blot following GTI-2040 treatment ...... 152 6.3.10 MTS assay...... 153 6.3.11 PK/PD model development of GTI-2040 and aracytidine in the cell...... 154 6.3.12 Software ...... 157 6.4 Result ...... 157 6.4.1 Determination of GTI-2040 concentrations in human leukemia K562 cells 158 6.4.2 Determination of R2 mRNA following GTI-2040 treatment ...... 158 6.4.3 Determination of R2 protein following GTI-2040 treatment ...... 159 6.4.4 Correlation study of intracellular GTI-2040, R2 mRNA expression and R2 protein expression following GTI-2040 treatment ...... 159 6.4.5 Quantification of intracellular dNTP/NTP levels following GTI-2040 treatment in human leukemia K562 cells...... 160
xiii 6.4.6 Quantification of intracellular Ara-CTP levels following Ara-C treatment in combination with GTI-2040 in K562 cells ...... 161 6.4.7 MTS assay...... 161 6.4.8 PK/PD model simulation of the combination effect of GTI-2040 and aracytidine...... 162 6.5 Discussion...... 164 6.6 Conclusion ...... 170
CHAPTER 7 ...... 191 CLINICAL POPULATION PHARMACOKINETICS OF DECITABINE (5-AZA-2’- DEOXYCYTIDINE) AT LOW DOSES IN PATIENTS WITH HEMATOLOGICAL MALIGNANCIES ...... 191 7.1 Abstract...... 191 7.2 Introduction...... 192 7.3 Methods...... 194 7.3.1 Drug Administration ...... 195 7.3.2 Clinical Trial Design...... 195 7.3.3 Pharmacokinetic Sampling and Assay...... 196 7.3.4 Pharmacokinetic Analysis and Statistics ...... 197 7.4 Results...... 198 7.4.1 Clinical Pharmacokinetic Analysis and Statistics...... 198 7.4.2 Population Pharmacokinetic Analysis and Statistics ...... 200 7.5 Discussion...... 203 7.6 Conclusion ...... 206
CHAPTER 8 ...... 223 CONCLUSIONS AND PERSPECTIVES...... 223 BIBLIOGRAPHY...... 230
xiv LIST OF TABLES Table Page
Table 2.1 Assay validation characteristics of dNTPs and NTPs in cell matrices by negative ion ESI LC-MS/MS...... 55 Table 2.2 Basal levels of dNTPs and NTPs in five cell lines...... 56 Table 2.3 Mean matrix effect of dNTP and NTP assay in acidic phosphatase-treated K562 cell extracts using the LC-MS/MS system...... 57 Table 2.4 dNTPs and NTPs levels in bone marrow samples from a leukemia patient. 58 Table 3.1 The intra- and inter-day validation of the quantification method of 5-AzaC in human plasma (n=6)...... 90 Table 4.1 Relevant chromatographic parameters...... 108 Table 4.2 Within-day and between-day validation data in 107 K562 cell lysate (n=6). 109 Table 5.1 The intra- and inter-day validation of the quantification method of DAC-TP and dNTPs in K562 cell lysate...... 139 Table 7.1 Population PK base model and final model...... 207 Table 7.2 Summary of relevant pharmacokinetic parameters of decitabine in patients with hematologic malignancies based on noncompartment analysis. Vd, apparent volume of distribution; Cmax, maximum plasma concentration; Tmax, time to maximum concentration; T1/2, terminal half-life; AUC, area under the concentration; CL, clearance. Data represented the median ± SD…………………………………………………….. 208 Table 7.3 T-test P-values for Non compartmental PK parameters at various doses with decitabine alone. There is no significant difference among various doses………. 209 Table 7.4 T-test P-values for Non compartmental PK parameters at 20 mg/m² dose with decitabine alone (step A) or in combination with valproic acid (step B)………… 210 Table 7.5 Summary of relevant pharmacokinetic parameters of decitabine in patients with hematologic malignancies based on a two compartment analysis: V1, volume of distribution of central compartment; V2, volume of distribution of peripheral compartment; CL, clearance; Q, inter-compartmental clearance. Data represent the median ± SD……………………………………………………………………… 211 Table 7.6 Summary of demographic and clinical characteristics of cancer patients…. 212 Table 7.7 Population pharmacokinetic parameter estimates for decitabine obtained from final model (A) and 859 bootstrap runs of the final model (B)………………….. 213 Table 7.8 Comparison of different dosing strategy at C30 (Peak concentration) and C60 (end of infusion)………………………………………………………………….. 214
xv LIST OF FIGURES
Figure Page
Figure 1.1 Molecular targets for treatment of myeloid leukemia. RTK: receptor tyrosine kinases, NRTK: non-receptor tyrosine kinases (14)...... 25 Figure 1.2 Epigenetic alterations in cancer (100). CpG-island hypermethylation in promoter region of tumor suppressor gene is a common dysfunction in tumorigenesis...... 26 Figure 1.3 Epigenetic alterations on histone (14). Deacetylation of lysine residues by HDACs leads to a compact or closed chromatin, which inactivates gene expression...... 27 Figure 1.4 Structures of nucleoside analogues and sequences of GTI 2040, a ribonucleotide reductase inhibitor...... 28 Figure 1.5 A diagram of the sandwich ELISA assay used in quantification of GTI-2040 (59)...... 29 Figure 1.6 Intracellular phosphorylation of 5-azacytidine (101)...... 30 Figure 1.7 Hypomethylating effects of 5-azacytidine and decitabine at low doses (63). 31 Figure 1.8 Mechanism of action of decitabine at low or high doses (101)...... 32 Figure 1.9 Structures of Ara-C, Ara-U, Ara-CTP, dCTP and CTP...... 33 Figure 1.10 Mechanism of action of Ara-C (102)……………………………………… 34 Figure 2.1 A) Total ion chromatogram of a standard mixture of ATP, GTP, CTP, UTP, dATP, dGTP, dCTP, dTTP and ClATP. B) Full scan of a standard mixture 1 μM of ATP, GTP, CTP, UTP, dATP, dGTP, dCTP and dTTP with a direct infusion at 10μL/min...... 59 Figure 2.2 Product ion mass spectra of the deprotonated molecular ions of dNTPs and NTPs...... 60 Figure 2.3 A) The multiple reaction monitoring (MRM) mass spectra of dNTPs and NTPs, 50 nM each, spiked into acid phosphatase-treated blank K562 cell extracts. B) The multiple reaction monitoring (MRM) mass spectra of dNTPs and NTPs in blank acid phosphatase-treated K562 cell extracts. No significant interference peaks were observed...... 61 Figure 2.4 Alteration of dNTP and NTP levels in MV411 cells following GTI-2040 treatment at various concentrations for 24 hours (n=3). Asterisks indicate significant difference from untreated control at p<0.05...... 62 Figure 3.1 Chemical structures of 5-Azacytidine and its internal standard dihydro- decitabine...... 79 Figure 3.2 Method description of sample preparation………………………………….. 80 Figure 3.3 (A) Full mass scan (1 min) of 200 ng/mL decitabine in 1%, 10 mM ammonium formate in methanol with direct infusion at 10 μL/min under positive
xvi ESI; (B) Full mass scan (1 min) of 200 ng/mL dihydro-decitabine (after reduction) in 1%, 10 mM ammonium formate in methanol with direct infusion at 10 μL/min under positive ESI...... 81 Figure 3.4 (A) MS/MS scan (1 min) of decitabine (200 ng/mL) in the mobile phase (1%, 10 mM ammonium formate in methanol) with direct infusion at 10 μL/min under positive ESI; (B) MS/MS scan (1 min) of decitabine after reduction by NaBH4 in 1%, 10 mM ammonium formate in methanol with direct infusion at 10 μl/min under positive ESI...... 82 Figure 3.5 MS/MS scan (1 min) of dihydro-decitabine in the reduction medium with direct infusion at 10 μL/min under positive ESI...... 83 Figure 3.6 A) Selective reaction monitoring (SRM) chromatogram of the NaBH4 reduced solution of decitabine at m/z 229.06>113.14. B) Selective reaction monitoring (SRM) of the NaBH4 reduced solution at m/z 231.04>115.13...... 84 Figure 3.7 A) Total ion chromatograph (TIC) of bank plasma spiked with 1 μg/mL 5- AzaC and 50 ng/mL internal standard; B) Selective reaction monitoring (SRM) of 1 μg/mL 5-AzaC at m/z 245.09>113.11; C) Selective reaction monitoring (SRM) of 50 ng/ml internal standard at m/z 231.09>115.13...... 85 Figure 3.8 (A) An average mass spectrum (1 min) of 10 μg/mL 5-AzaCin 1% 10 mM ammonium formate in methanol with direct infusion at 10 μL/min under positive ESI (B) An average mass spectrum (1 min) of 200 ng/mL dihydro-decitabine in 1% 10 mM ammonium formate in methanol with direct infusion at 10 μL/min under positive ESI...... 86 Figure 3.9 5-AzaC MS/MS Spectum at m/z 245.09...... 87 Figure 3.10 A) Total ion chromatograam (TIC) of bank plasma spiked with 50 ng/mL internal standard. B) Selective reaction monitoring (SRM) in blank plasma at m/z 245.09>113.11. C) Selective reaction monitoring (SRM) of 50 ng/mL internal standard at m/z 231.09>115.13 ...... 88 Figure 3.11 Representative standard curves of 5-AzaC in human plasma...... 89 Figure 4.1 Structures of Ara-C (R1=OH, R2=H, R3=NH2), Ara-U (R1=OH, R2=H, R3=O), deoxycytidine (R1=H, R2=H, R3=NH2) and cytidine (R1=H, R2=OH, R3=NH2)...... 110 Figure 4.2 Structures of Ara-CTP and its internal standard 7-deaza-dGTP...... 111 Figure 4.3 (A) Representative HPLC chromatogram of lysate of 107 K562 cell; (B) Representative HPLC chromatogram of lysate of 107 K562 cell spiked with 10 μg/ml Ara-CTP and 10 μg/ml 7-deaza-dGTP...... 112 Figure 4.4 A) Representative HPLC chromatogram of 10 μg/ml Ara-CTP and 10 μg/ml mixture of dNTP and NTPs in mobile phase (20 μl injection); B) Representative chromatogram of 25 μM 7-deaza-dGTP and mixture of dNTP and NTPs in mobile phase (20 μL injection)...... 113
xvii Figure 4.5 (A) Representative HPLC chromatogram of 10 μg/mL Ara-CTP and 10 μg/mL dCTP in mobile phase (20 μL injection); (B) Representative HPLC chromatogram of 10 μg/mL Ara-CTP and 10 μg/mL CTP in mobile phase (20 μL injection)...... 114 Figure 4.6 (A) A representative calibration curve of Ara-CTP calculated using peak area; (B) a representative calibration curve of Ara-CTP calculated using peak height... 115 Figure 4.7 Time course of cellular accumulation of Ara-CTP after 10 μM of Ara-C was incubated with K562 cells for 1, 2, 3, 4, 6, 8, 12, 24 hours...... 116 Figure 5.1 Structures of decitabine and decitabine triphosphate (DAC-TP)...... 131 Figure 5.2 Total ion chromatograph (TIC) of bank cell extract spiked with 5 μM dCTP, DAC-TP, dTTP, dATP and 1.25 μM Cl-ATP (the internal standard)...... 132 Figure 5.3 Full scan of a standard mixture 1 μM of dCTP, DAC-TP, dTTP and dATP with a direct infusion at 10μL/min...... 133 Figure 5.4 Product ion mass spectra of the deprotonated molecular ions of DAC-TP and dNTPs...... 134 Figure 5.5 A) The multiple reaction monitoring (MRM) mass spectra of DAC-TP and dNTPs, 50 nM each, spiked into acid phosphatase-treated blank K562 cell extracts. B) The multiple reaction monitoring (MRM) mass spectra of DAC-TP and dNTPs in blank acid phosphatase-treated K562 cell extracts...... 135 Figure 5.6 A) Standard curves of DAC-TP and dNTPs. Linearity was found between 50 nM, the lower limit of quantification (LLOQ), and 1 μM in K562 cell lysate; B) standard curves of DAC-TP and dNTPs. Linearity was found between 1 μM and 10 μM in K562 cell lysate...... 136 Figure 5.7 The quantification of DAC-TP and dNTPs in K562 cell lysate after treatment of DAC for 0, 1, 4 and 24 hrs (n=3). *Represents significant differences from control (time=0) at P<0.05...... 137 Figure 5.8 Intracellular DAC-TP and dNTP levels in patient bone marrow samples following decitabine treatment...... 138 Figure 6.1 Structures of Aracytidine, 5-Azacytidine and GTI 2040...... 172 Figure 6.2 Mechanism of action of down regulation of R2 mRNA by GTI-2040...... 173 Figure 6.3 Illustration of electroporation...... 174 Figure 6.4 Illustration of a two-step ELISA assay in determination of GTI-2040 in leukemia K562 cells (59)...... 175 Figure 6.5 Simplified PK/PD model of GTI-2040, R2 mRNA and Ara-CTP in the cell...... 176 Figure 6.6 Intracellular GTI-2040 concentrations using electroporation...... 177 Figure 6.7 GTI-2040 down-regulates R2 mRNA. K562 cells were transfected with different dosages of GTI2040 for 24hr and real time PCR was performed to quantify R2 mRNA expression. * represent significant difference from control (P<0.05). . 178 Figure 6.8 GTI-2040 down-regulates R2 protein. K562 cells were transfected with different dosages of GTI2040 for 24hr and western blot was performed using R2 antibody...... 179
xviii Figure 6.9 Correlation of GTI-2040 doses with intracellular GTI-2040 levels...... 180 Figure 6.10 Correlation of percentage of R2 mRNA change with intracellular GTI-2040 levels...... 181 Figure 6.11 Correlation of percentage of R2 protein change with intracellular GTI-2040 levels...... 182 Figure 6.12 Alteration of dNTP and NTP levels by GTI-2040 treatment in K562 cells at varied concentrations for 24 hours in K562 cells (n=3). * significantly different from untreated control using t-test (p<0.05)...... 183 Figure 6.13 Ara-CTP accumulations with and without GTI-2040 pre-incubation. Cells were pretreated with various concentrations of GTI-2040 for 24 hr. Then cells were washed and incubated with 10 μM Ara-C for 4 hr. Data are means ± standard deviation of three repicates. * represent significant difference from control (P<0.05)...... 184 Figure 6.14 Human equilibrative nucleoside transporter 1 (hENT1) inhibitor (nitrobenzylthioinosine, NBMPR) protected human leukemia K562 cells against 5- AzaC cytotoxicity. K562 cells were cultured in medium containing graded concentrations of 5-AzaC in the absence ( ) or presence ( ) of 1 μM NBMPR for 72 hrs. Cell viability was measured by MTS assay. Bars means standard deviation from three replicates...... 185 Figure 6.15 Proposed mechanisms of combination treatment of GTI-2040 and aracytidine...... 186 Figure 6.16 (A) Effect of dose on GTI-2040 plasma concentrations; (B) Effect of dose on R2 mRNA expression; (C) Effect of dose on Ara-CTP accumulation...... 187 Figure 6.17 (A) Effect of K30 on GTI-2040 plasma concentrations; (B) Effect of K30 on R2 mRNA expression; (C) Effect of K30 on Ara-CTP accumulation...... 188 Figure 6.18 (A) Effect of EC50 on GTI-2040 plasma concentrations; (B) Effect of EC50on R2 mRNA expression; (C) Effect of EC50 on Ara-CTP accumulation. .. 189 Figure 6.19 (A) Effect of IC50 on GTI-2040 plasma concentrations; (B) Effect of IC50on R2 mRNA expression; (C) Effect of IC50 on Ara-CTP accumulation...... 190 Figure 7.1 Chemical structure of decitabine...... 215 Figure 7.2 Decitabine plasma concentration versus time profiles. Shaded, dashed lines and solid lines represent the hematologic malignancies patients treated at 10, 15 and 20 mg/m2, respectively...... 216 Figure 7.3 A. Decitabine AUC as a function of dose for CLL and AML patients with decitabine alone (step A) based on noncompartment ananlysis. B. Cmax values of decitabine as a function of dose in CLL and AML patients with decitabine alone (step A) based on noncompartment ananlysis. C. Decitabine AUC values as a function of dose in AML patients with decitabine alone (step A) and in combination with valporic acid (step B) based on noncompartment ananlysis. D. Cmax values as a function of dose in AML patients with decitabine alone (step A) and in combination with valporic acid (step B), based on noncompartment ananlysis. The
xix solid line represents the median concentration. The triangles represent mean concentrations...... 217 Figure 7.4 A two compartment model for pharmacokinetic analysis of decitabine in leukemia patients...... 218 Figure 7.5 A) A scatter plot of inter-individual variability of clearance (ETA_CL) versus body surface area (BSA) in base model; B) A scatter plot of inter-individual variability of clearance (ETA_CL) versus body surface area (BSA) in final model...... 219 Figure 7.6 A) A scatter plot of weighted residuals vs individual posterior predicted (IPRED, nM); B) A scatter plot of weighted residuals vs model predicted (PRED, nM) in the whole data set (N = 22)...... 220 Figure 7.7 A) Scatter plots of observed concentration (DV, nM) versus model predicted (PRED, nM, upper); B) Scatter plots of observed concentration (DV, nM) versus individual posterior predicted (IPRED, nM, lower) in the whole data set (N = 22)...... 221 Figure 7.8 Predictive check of the final two-compartment pharmacokinetic model between 0 and 150 min. A number of 1000 data sets were simulated from the final pharmacokinetic parameter estimates using NONMEM. Depicted are the observed decitabine plasma concentrations (dots), upper (95%, upper dashed line) and lower (5%, lower dashed line) quantile of the simulated concentrations and median concentration (dashed line) vs. time...... 222
xx CHAPTER 1
BACKGROUND AND INTRODUCTION
1.1 Background
Leukemia is the most common type of blood cancer. It has been reported by the
National Cancer Institute (NCI) that the age-adjusted death rate of leukemia was 7.5 per
100,000 individuals per year and the overall 5-year survival in the U.S. was 49.6% between 1996-2003 (http://seer.cancer.gov/statfacts/html/leuks.html). Leukemia encompasses a broad spectrum of diseases including acute myeloid leukemia (AML), chronic myeloid leukemia (CML), acute lymphocytic leukemia (ALL) and chronic lymphocytic leukemia (CLL), among which AML is the most common type of leukemia in adults and ALL is the most common among young children. Leukemia is characterized by an abnormal proliferation of blood cells, usually resulting from multiple mutations that lead to abnormalities in the expression or function of gene products that affect the delicate balance between proliferation and differentiation. Currently, chemotherapy is still the major option for the treatment of leukemia. A number of small molecules and oligonucleotides have been developed to target different stages of the disease.
1.2 Hypothesis
1 Human myeloid leukemia, characterized by an abnormal proliferation of blood
cells, results from multiple mutations that lead to abnormalities in the expression or
function of gene products that affect the delicate balance between proliferation. In order
to treat malignancy, extensive studies on anti-leukemia drug development have been
conducted.
GTI-2040, a 20-mer phosphorothioate oligonucleotide (PS ODN) is an inhibitor of
human ribonucleotide reductase (RNR) that catalyzes the conversion of ribonucleotide
diphosphate to deoxyribonucleotide diphosphate. Therefore, the inhibition of RNR may
result in the decrease of deoxynucleotides (dNTPs) and increase of nucleotides (NTPs).
5-Azacytidine is a hypomethylating agent which induces DNA demethylation, gene re-expression, and hematopoietic differentiation at low doses. Due to its hydrophilic properties, 5-azacytidine is difficult to diffuse across cell membranes freely. Two equilibrative nucleoside transporters and at least three sodium-dependent concentrative nucleoside transporters have been identified to be involved in nucleoside uptake (1). 5-
Azacytidine can interfere with nucleic acid metabolism by incorporation into RNA directly or DNA indirectly through intracellular conversion to decitabine by RNR.
Therefore, 5-azacytidine can inhibit DNA, RNA and protein synthesis. Since 5- azacytidine may compete with endogenous CTP or dCTP to incorporate into RNA or
DNA, respectively, and decitabine may compete with dCTP for DNA incorporation,
2 perturbation of endogenous CTP or dCTP levels will affect the treatment effect of these nucleosides. Information on intracellular dNTP and NTP levels will provide important information on monitoring the progress of the drug treatment effect and/or disease. In order to monitor the intracellular dNTP/NTPs, especially CTP/dCTP, we sought to establish a sensitive HPLC-MS/MS method. With this method, it is also possible to screen other drugs, such as GTI-2040, that can cause a decrease of intracellular
CTP/dCTP levels and can be used as potential combination treatment to enhance the therapeutic effect of these nucleosides.
Aracytidine (Ara-C) is a cytotoxic agent that at high doses can compete with endogenous deoxycytidine triphosphate (dCTP) for DNA incorporation, inhibit DNA replication and eventually resulting in apoptosis of malignant tumor cells. Therefore, a decrease in intracellular dNTP pools, induced by certain drugs such as GTI-2040 and 5- azacytidine may result in accumulation of aracytidine triphosphate (Ara-CTP).
Decitabine is a hypomethylating agent, which is phosphorylated to decitabine triphosphate in cells before incorporation into DNA. At higher doses (i.e., 50-100 mg/m2/day), decitabine acts primarily as a cytotoxic agent and its incorporation into
DNA leads to inhibition of DNA synthesis and cell death (2,3). At lower doses (i.e., 5-20 mg/m2/day), it induces DNA demethylation, resulting in reactivation of hypermethylation-associated silencing of tumor suppressor genes (4,5). Currently, low-
3 dose treatment of decitabine has shown higher activity for the treatment of haematological malignancies (6,7) and less toxicity (8-12).
Based on our preliminary results of down regulation of dCTP by GTI-2040, pharmacokinetic (PK) analysis of decitabine and previously published transport studies of azanucleosides (13), we hypothesize that:
1. Decrease in intracellular deoxynucleotides induced by GTI-2040 may result in an
increase in intracellular Ara-CTP levels, when these two drugs are used in
combination.
2. Inhibition of RNR may play a major role in combination therapy with nucleoside
and azanucleoside analogs.
3. While uptake of high dose of azanucleoside drugs may be through passive
diffusion, the use of low dose may involve transporters.
In this chapter, molecular targets for treatment of myeloid leukemia will be discussed. The relationship between epigenetics and cancers will be reviewed. DNA and
RNA perturbation in cancers will also be discussed. The mechanisms of action of anti- leukemia drugs, such as GTI-2040, 5-azacytidine, decitabine and aracytidine will be reviewed. In addition, specific aims of the projects will be proposed. The rationale for these projects will be provided. Finally, the significance of this dissertation project will be discussed.
4
1.3 Introduction
1.3.1 Molecular targets for treatment of myeloid leukemia
Myeloid leukemia is characterized by an increased expansion of abnormal cells which accumulate in bone marrow and fail to differentiate. Important insights into the pathogenesis of this disease have led to the development of a number of small molecules including; tyrosine kinase/nontyrosine kinase inhibitors, nucleoside analogues and oligonucleotides, as shown in Figure 1.1. These molecules target different stages of disease, including epigenetic gene silencing, proliferation, apoptosis and
DNA/Chromosomal translocation (14). Epigenetic alterations of the genome without changes in the DNA sequence have been regarded as important mechanisms in cancer development. DNA methylation and histone methylation and acetylation are two epigenetic changes that play a major role in transcriptional regulation and gene silencing and thus are good targets for anti-cancer drug design (15). In myeloid leukemia, delicate balance between proliferation and apoptosis is disrupted which results in increasing the anti-apoptotic gene expression and uncontrolled cell proliferation. Therefore, BCL-2, a family of anti-apoptotic genes, which is over-expressed in AML and in late myelodysplastic syndrome (MDS), could be a potential target for therapy (16). Cyclin dependent kinases (cdks) are a group of serine/threonine kinases that are critical in
5 regulating the cell cycle and transitions between each phase in eukaryotic cells. In cancer cells, activation of cdks results in hyper-phosphorylation of certain proteins such as the retinoblastoma protein (Rb), a tumor suppressor (17). Thus, modulation of cdks activities could be good strategies in leukemia treatment. Chromosomal translocation and rearrangements have been found in AML and MDS, which result in abnormal proliferation and disruption of apoptosis. These chromosomal translocations lead to the fusion of genes that produce abnormal gene products. For example, the retinoic acid receptor-α chain was fused into the promyelocytic leukemia zinc finger protein
(PLZF/RAR α), which resulted in the transcriptional repression in acute promyelocytic leukemia (APL) (18). Thereby, translocations including Hox family members, ETS family members, core binding factors, and other transcriptional regulatory proteins could also be potential targets in myeloid leukemia treatment (19).
1.3.2 Epigenetic and cancers
Epigenetic refers to the heritable alterations in gene expression with a reversible and dynamic manner that does not directly change the DNA sequence (20). Epigenetic changes were involved in almost all stages of cancer development and progression (21).
Important epigenetic mechanisms include chromatin remodeling, RNA associated gene silencing and chromosome inactivation, and genomic imprinting (20). Alterations of gene expression have been reported in a number of cancer types such as colorectal cancer,
6 prostate cancer, esophageal cancer and leukemia (22). It becomes increasingly apparent that epigenetic dysregulation is highly correlated with cancer initiation, development and progression. DNA methylation and post-translational histone modification are the two best-studied epigenetic cancer therapy targets (23-25). DNA methylation is catalyzed by
DNA methyltransferases (DNMTs) at the 5’ position of the cytosine residues through an enzymatic reaction which uses S-adenosyl-methionine as a methyl group donor (26). In mammals, DNA methylation occurs almost exclusively within CpG dinucleotide sites.
These CpG dinucleotide sites are distributed asymmetrically probably due to the high mutagenic potential of deamination of 5-methylcytosine to thymidine, which result in a progressive depletion of CpG dinucleotides over time (23). However, 0.5-5kb DNA fragments with rich CpG dinucleotides known as CpG islands are mainly located within the first exon and promoter of numerous genes (27). These CpG islands usually remain low in methylation levels and are transcriptionally active in normal cells as shown in
Figure 1.2. In the presence of necessary transcriptional factors, these CpG islands containing genes could be transcribed and the corresponding gene products, including tumor suppressors, could further protect cells. Aberrant hypermethylation of CpG islands in the promoter region, which results in the silencing of a number of gene expressions including tumor suppressor genes (28) occurs in many cancers. In tumors, extensive genomic regions have been found to be demethylated using genomic microarray techniques (29). DNMT1 and DNMT3b have been found to associate with gene silencing in human cancer cells (30). The mechanisms of epigenetic alterations in cancer cells are
7 still not clear. The proposed reasons include dysfunctional effects of genetic variations on
epigenetic genes (31). In hematopoietic malignancies, some genes, such as p15, p16 and
E-cadherin, are commonly hypermethylated (32). However, promoter hypermethylation is potentially reversible by hypomethylating agents such as 5-azacytidine and decitabine
(33). Thus, re-activation of tumor suppressor gene expression through epigenetic regulation thus provides a novel approach in cancer prevention and treatment.
Histone post-translational modifications include acetylation/deacetylation by histone acetyltransferases (HATs)/histone deacetyltransferases (HDATs) and histone methylation by histone lysine methyltransferases (HMTs) (34). These modifications play a key role in gene expression through regulation of chromatin package (35). In general, histone acetylation of lysine residues by HATs on H3 and H4 results in an active or open chromatin. In this way, various transcription factors can have access to the promoters of target genes and subject them to transcription. On the contrary, deacetylation of lysine residues by HDACs leads to a compact or closed chromatin, which inactivates gene expression, as shown in Figure 1.3 (36). Unlike histone acetylation, histone methylation is considered to confer long-standing epigenetic memory (37). Histone lysine methylation can result in either activation or repression of gene expression and is of critical importance in transcriptional regulation, X chromosome inactivation and DNA methylation (38,39). Methylation of certain critical amino acid residues on histones, such
as H3-K9, has been regarded as an important factor contributing to silencing of tumor
8 suppressor genes. It is now believed that DNA methylation and histone modification are
cooperative with each other in regulation gene expression (31).
1.3.3 DNA and RNA perturbation in cancers
In cancer cells, the overall genome is characterized by global DNA hypomethylation, local hypermethylation of CpG islands and specific histone
hypoacetylation, i.e. hypermethylation of promoter CpG islands of RASSF1, RARbeta,
DAPK, p16, p15, MGMT and GSTP1 genes in lung cancer and loss of monoacetylation at
lysine 16 of histone H4 (40,41). These epigenetic abnormalities result in aberrant
transcriptional silencing of tumor suppressor genes and activation of oncogenes.
Aberrations in these epigenetic events are thought to contribute to carcinogenesis,
impaired gene expression and impact other physiologically critical processes, such as
chromosome condensation and apoptosis. Clearly, there is a close connection between
epigenetic alterations and cancer through detrimental expression of inserted viral
sequences, silencing of tumor suppressor genes, loss of imprinting and genomic
instability (42,43). Additionally, RNA perturbation is frequently observed in
malignancies. Bcl-2 represents a family of antiapoptotic genes that are over-expressed in
many cancers. AU-rich elements (ARE) play an important role in Bcl-2 transcription and
is rapidly degraded during apoptosis after binding to the AUF1 protein (44). However,
aberrant expression of ARE-binding proteins and AUF1 has been found in the cytoplasm
9 of aggressive lung cancers, resulting in the sustained Bcl-2 transcription and tumor cell
proliferation (45).
It has been reported that Bcl-2 mRNA and protein levels were over-expressed in B
cell chronic lymphocytic leukemia (46). Deregulation of RNA processing, RNA turnover and translation lead to alterations in steady-state levels of transcripts and their products.
RNA interference (RNAi) pathway is a gene-silencing pathway that is triggered by endogenous non-coding small RNAs, such as microRNAs (miRNAs) (47,48). miRNAs are endogenous ~22 nucleotides-long noncoding RNA molecules, which have a profound effect in regulating gene expression. miRNAs are transcribed by RNA polymerase II (Pol
II) (49). miRNA regulates gene expression by mRNA degradation and translational suppression. miRNAs can bind to their target mRNAs with complete complementarity, leading to down-regulate target mRNAs stabilities and/or translation. On the other hand, miRNAs can also bind to their targets with incomplete complementarity, resulting in translational suppression (50). In addition, miRNA plays a key role in cancer progression through regulation of cancer-related processes, such as cell differentiation and
proliferation. For example, miR-15 and miR-16 induce apoptosis in B-cells through post-
transcriptional down-regulation of anti-apoptotic B cell lymphoma 2 (Bcl2) expression
(51). Notably, some microRNAs may function as oncogenes or tumor suppressors. For
example, mir-17–92 is over-expressed in B-cell lymphomas and can stimulate tumor
progression in transgenic mice, thus functioning as an oncogene (52). In contrast, miRNA
10 let-7 targets RAS and its expression is decreased in human lung cancer, thus functioning as a tumor suppressor (53,54). Therefore, the importance of epigenetic alterations and
RNA interference involved miRNAs in the initiation and progression of human cancer creates novel therapeutic targets for cancer treatment.
In order to treat cancer, a number of drug candidates that target DNA/RNA perturbation in cancer have been developed. These drug candidates, including nucleoside analogs and ribonucleotide reductase inhibitors, target the potential reversibility of
epigenetic changes or induction of DNA/RNA perturbation. The potential mechanisms of
action of these drugs include inhibition of biosynthesis of nucleotides, competition with
endogenous nucleotides for incorporation into DNA or RNA strands, or depletion of substrates critical for DNA synthesis, which may result in the perturbation or imbalance of endogenous nucleotide pools. Deoxyribonucleotides (dNTPs) and ribonucleotides
(NTPs) are the components of DNA or RNA strands, playing an important role in
DNA/RNA synthesis. Ribonucleotide reductase (RNR) is a key enzyme in catalyzing the reduction reaction of ribonucleotides (ADP, GDP, UDP, and CDP) to their corresponding
deoxyribonucleotides (dADP, dGDP, dUDP, and dCDP), which is the rate limiting step
required for DNA replication (55). Ribonucleotide reductase (RNR) plays a critical role,
as it is the only highly regulated enzyme involved in the de novo synthesis of 2’-
deoxyribonucletides. Human RNR consists of the R1 subunit, which contains the
substrate binding site, allosteric sites and redox active disulfides, and the R2 subunit,
11 which contains an oxygen-linked non-heme iron center and a tyrosine residue that are
essential for catalytic activity (56). The R2 protein is only expressed during late G1/early
S phase, which is of fundamental importance to DNA synthesis and repair, while R1
protein levels remain relatively stable throughout the cell cycle (57). Over expression of
R2 is found to be associated with malignant status of solid tumor cells and
leukemogenesis, which makes R2 a good target of anticancer/antileukemic drug
development. RNR subunit 2 (R2) is found to be over-expressed in most cancers, which
makes R2 a good target for anticancer/antileukemia drug development. The inhibition of
R2 may also result in the perturbation or imbalance of endogenous dNTP/NTP pools.
Therefore, the determination of dNTPs and NTPs levels provides important information in the elucidation of the mechanisms of action of drug treatment as well as disease progression.
1.3.4 GTI-2040, an inhibitor of human ribonucleotide reductase (RNR)
The recently developed GTI-2040 (Figure 1.4), a 20-mer oligonucleotide complementary to the coding region of R2 mRNA with the sequence of 5’-
GGCTAAATCGCTCCACCAAG-3’, has shown sequence- and target- specific down- regulation of ribonucleotide reductase subunit R2 mRNA and protein levels in human
H460 lung carcinoma cells, human leukemia cells, human T24 bladder cancer cells and murine L cells (58,59). Due to the negative charges, GTI-2040 was delivered into cells in
12 the form of complexes with cationic lipids in the in-vitro studies (60). However, no complex formulation has been approved for clinical use, and clinically, GTI-2040 was given as long-term continuous infusion. Phase I studies of GTI-2040 alone for the
treatment of advanced solid tumors or lymphoma indicated that the maximum tolerated
dose of GTI-2040 was 222.0 mg/m2/day as a 21-day continuous infusion (61). The mean
elimination half-life of GTI-2040 was <3 hrs at a dose of 185.0 mg/m2/day, and dose independent pharmacokinetic behavior was observed, using capillary electrophoresis
(CE) with ultraviolet absorbance detection (61). Recently, the therapeutic potential on
refractory or relapsed AML combined with aracytidine has been evaluated in a phase I
clinical trial, using a specific hybridization-based enzyme-linked immunosorbent
(ELISA) assay with picomolar sensitivity (59). The rationale of this combination
treatment is that the decrease in the dNTP pool induced by GTI-2040 could increase the
intracellular Ara-CTP level by enhancing deoxycytidine kinase activities, the key enzyme
in catalyzing phosphorylation of Ara-C to Ara-CTP, thus resulting in enhanced cytotoxic
effects. In order to characterize pharmacokinetic profile of GTI-2040 in leukemia
patients, a specific hybridization-based enzyme-linked immunosorbent (ELISA) assay has been developed (59). As shown in Figure 1.5, this assay utilizes the hybridization of
GTI-2040 to the biotin-labeled capture oligonucleotides followed by ligation with
digoxigenin-labeled detection oligonucleotides. The hybridized duplex was then detected
by antidigoxigenin-alkaline phosphatase using Attophos as substrate. This sensitive assay
makes it possible to quantify the intracellular and plasma GTI-2040 level, which provides
13 a powerful tool in pharmacokinetic and pharmacodynamic studies. With this sensitive method, plasma GTI-2040 levels were found to reach its steady-state concentrations (Css) within 4 hrs in leukemia patients following i.v infusion at 5 mg/kg/day. The Css, was achieved rapidly within 6 hrs in PBMC and red blood cells; the mean t½ α was 0.812 hr;
and mean CL was 10.09 L/hr. The mean t ½ β of 27.4 hr (62) was also much longer than previously reported (<3 hr) (61). The reason is probably due to the extremely sensitive
ELISA assay developed in our lab which enables us to fully characterize the elimination phase. In order to develop a novel combination treatment of GTI-2040 with other drugs
to improve therapeutic response, the mechanism of action of GTI-2040 needs to be
further confirmed and investigated.
1.3.5 5-Azacytidine and decitabine, hypomethylating agents
As potent hypomethylating agents, 5-azacytidine and decitabine (Figure 1.4) have
recently been approved by the FDA for the treatment of myelodysplastic syndrome
(MDS). Both of these two drugs are hypomethylating agents that need to be converted to
the corresponding triphosphates to be effective (63). 5-Azacytidine and decitabine differ
structurally by only one hydroxyl group at the 2’ position of the ribose ring which makes
it possible to convert 5-azacytidine diphosphate to decitabine diphosphate by the action
of ribonuleotide reductase.
14 1.3.5.1 5-Azacytidine
5-Azacytidine, a pyrimidine nucleoside analog of cytidine, was originally
developed as a cytotoxic agent by interfering with nucleic acid metabolism in abnormally
proliferating hematopoietic cell lines. As shown in Figure 1.6, inside cells 5-azacytidine
undergoes phosphorylation to its corresponding mono-, di-, and tri-phosphate to
eventually be incorporated into RNA. At the same time, 5-azacytidine di-phosphate is
converted to decitabine diphosphate by ribonucleotide reductase and incorporated into
DNA. Therefore, 5-azacytidine can inhibit DNA, RNA and protein synthesis (4). The
cytotoxic activity primarily occurs in the DNA synthesis phase of the cell cycle (S
phase). Clinically, severe hematologic toxicity was observed in doses higher than 100
mg/m2/day (64). Therefore, 5-azacytidine exerts its hypomethylation effect at low doses
(3~5 μM in vitro or 10-75 mg/m2/day, clinically) by inhibiting DNA methyltransferases
(DNMTs), the enzyme involved in DNA methylation (65-67). Hypermethylation near the
promoter region of critical tumor suppressor genes, which cause gene suppression, has
frequently been observed in tumor cells (68,69). As shown in Figure 1.7, after
intracellular conversion to 5’-aza-2-deoxycytidine (decitabine), 5’-aza-2-deoxycytidine
triphosphate is incorporated into DNA, where it covalently binds to DNMT, causing
degradation of DNMT. Consequently, 5-azacytidine acts as DNA hypomethylating agent
at low doses (10-75 mg/m2/day, clinically) and can reactivate previously silenced genes,
including tumor suppressor genes, restore apoptosis and inhibit proliferation of cancer
cells (4). As a hypomethylating agent, 5-azacytidine has to pass through the cell
15 membrane and be converted to 5-azacytidine triphosphate or decitabine triphosphate, that
can target mRNA or DNA in cytosol or nucleus. Uptake of high doses of 5-azacytidine
may be through passive diffusion due to the higher extracellular concentration (70), but
for low doses it may involve cellular transports (71). When evaluating the importance of hypomethylation effects of 5-azacytidine at low doses, it is critical to examine the nucleoside-specific membrane transport system that may facilitate transporting 5- azacytidine into cells. Previous transporter studies of [14C]5-azacytidine (71) on P388
mouse leukemia cells indicated that 5-azacytidine transport was inhibited by uridine in a
simple competitive manner. Therefore, 5-azacytidine is transported by the same system
as uridine which involves equilibrative nucleoside transporters. Pharmacokinetics of 5-
azacytidine administered with phenylbutyrate in patients with various tumors has been
evaluated in phase I clinical trials. It is reported that 5-azacytidine is rapidly absorbed and eliminated following subcutaneous injection and the peak plasma concentrations were achieved within 60 minutes following administration (67). However, in order to characterize pharmacokinetic (PK) behavior of 5-azacytidine at low doses, a specific and sensitive method needs to be developed. Although a HPLC-MS/MS has been developed, the sensitivity of the published assay was low (5 ng/ml) (72). Furthermore, the run time is relatively long (30 min), which limited its application in large clinical sample measurements. Therefore, we decided to develop a more sensitive method with less running time which can be used in pharmacokinetic analysis of 5-azacytidine at low doses.
16 1.3.5.2 Decitabine
Decitabine (5-aza-2’-deoxycytidine, Dacogen), is a nucleoside analog with in vitro
and in vivo anticancer activity against a variety of solid tumors and hematologic
malignancies (73-75). Decitabine appears to have two different pharmacologic actions
(Figure 1.8). At higher doses (50-100 mg/m2/day), it acts primarily as a cytotoxic agent
which induces cytotoxicity and cell death through DNMT trapping, DNA damage and
DNA synthesis arrest (2,76). At lower doses (5-20 mg/m2/day), it induces DNA demethylation, resulting in reactivation of hypermethylation-associated silencing of tumor suppressor genes (4,5). In addition, lower doses treatment of decitabine led to hematopoietic differentiation (77,78). More importantly, at these lower doses (i.e., 5-20 mg/m2/day), clinical response with toxicity lower than that observed at higher doses has
been reported (8,10,11). Sequential exposure of leukemia cell lines HL-60 and MOLT4
to histone deacetylase inhibitors (e.g. valproic acid at 1 mM), following decitabine at
various concentrations (1~10 μM) showed synergistic reactivation of p57KIP2 and
p21CIP1 (79). A phase 1/2 clinical trial of the combination of decitabine with VPA in
patients with leukemia indicated that this combination therapy in leukemia was safe and
effective (8). Clinical pharmacokinetic analysis of decitabine at 15 and 20 mg/m2/day indicated a large variation of clearance between patients with coefficient of variation
(CV%) greater than 80% (80). A population pharmacokinetic study of decitabine is necessary to identify the covariates that can explain the inter- and intra-patients variability. Since decitabine undergoes a three-step phosphorylation to its active
17 anabolite, decitabine triphosphate (DAC-TP) in the cell and competes with dCTP for
DNA incorporation, the determination of intracellular DAC-TP is therefore of paramount importance for monitoring the effect of drug treatment.
1.3.6 Aracytidine
Aracytidine (cytosine arabinoside, Ara-C) as shown in Figure 1.9, is widely used as an important cytostatic drug for the treatment of acute myelogenous leukemia (AML)
(81). Due to its hydrophilic properties, Ara-C diffuses poorly across the cell membranes.
Nucleoside transport studies in leukemia cells indicated that human equilibrative nucleoside transporter 1 (hENT1) mediates the transport of Ara-C into the cell (82). A high correlation between hENT1 mRNA expression and Ara-C sensitivity has been found in leukemia blasts from AML patients, which provides strong support for the notion that the deficiency of hENT1 expression on cell membranes may result in the resistance to
Ara-C (83). As shown in Figure 1.10, Ara-C can be phosphorlated into aracytidine triphosphate (Ara-CTP), which is the only active metabolite in the cell (84). As an isomer of cytosine triphosphate (CTP), Ara-CTP competes with the natural dCTP for DNA incorporation, resulting in single strand breaks and the termination of DNA chain elongation (85,86). Ara-C can rapidly be converted to the inactive metabolite uracil arabinoside (Ara-U) by cytidine deaminase (87). To overcome the drug resistance and increased catabolism of Ara-C via deamination (88,89), a high dose of aracytidine
18 (>2g/m2) was used. Pharmacokinetic (PK) studies of Ara-C in plasma indicated that there is no significant correlation between PK parameters and response, because Ara-C is the prodrug and needs to be activated to Ara-CTP in the cell to exert its effect (90,91).
However, studies on the intracellular accumulation and retention of the major metabolite,
Ara-CTP, indicated that the intracellular level and duration of retention of Ara-CTP are
important determinants of the therapeutic effects of Ara-C (92,93). A strong correlation
was observed between intracellular Ara-CTP levels and clinical response (94). Therefore,
determination of intracellular Ara-CTP levels is of critical importance in optimal
therapeutic regimen design as well as combination treatment studies. Although several
HPLC methods have been reported to quantify intracellular Ara-CTP levels (95-97), none used an internal standard. Therefore, these methods result in significant variation for sample analysis. In order to accurately measure intracellular Ara-CTP levels, we have extensively modified the HPLC method by the use of a proper internal standard and the
improvement of elution program to minimize base line drift during sample running. With
this method, it becomes possible to study the combination effect of Ara-C with GTI-2040
or 5-azacytidine and gain insight to direct perturbation as described below.
1.4 Specific aims
A.1. Establishment of sensitive and specific assays for the quantification of nucleoside
analogs and nucleotides:
19 1) To develop and validate a sensitive and specific HPLC-MS/MS assay for quantitation of 5-azacytidine in human plasma which will aim at characteration of its clinical pharmacokinetic behavior and future pharmacokinetic and pharmacodynamic (PK/PD) studies.
2) To develop and validate a sensitive and specific HPLC-MS/MS assay for quantitation of nucleoside triphosphates in cell matrices. This will provide a powerful tool to monitor the alteration of intracellular nucleotides induced by anti-cancer drugs and facilitate the design of a novel combination treatment.
3) To develop and validate a sensitive and specific HPLC-MS/MS assay for the quantitation of decitabine triphosphate in cell matrices. This will facilitate metabolism studies of decitabine and biochemical modulation studies of decitabine in combination with other anti-cancer drugs.
4) To develop and validate a sensitive and specific HPLC assay for the quantitation of
Ara-CTP in cell matrices. This will provide a useful tool in elucidation of mechanism of action of combination treatment with Ara-C.
A.2. Evaluation of biochemical modulation effects by anti-leukemia drugs and their transporter system:
1) To evaluate the biochemical modulation effect of intracellular dNTPs and NTPs by
GTI-2040 and 5-azacytidine separately in vitro. This will aid in the elucidation of the
20 mechanism of action of these drugs and provide an important theoretical basis for further
combination studies.
2) To evaluate the biochemical modulation effect of high dose aracytidine in combination
and separately with GTI-2040 in vitro. This will help identify the optimal dosing
regimen in their combination treatment.
3) To evaluate the cellular uptake and transport of 5-azacytidine. This will help to
improve treatment effect and overcome drug resistance.
A.3. Characterization of clinical pharmacokinetics of decitabine and identification of
covariates that can explain inter- or intra-individual variability, which will provide
important information in future individualized dosing schedule designs in clinical trials of
decitabine and 5-azacytidine.
1.5 Rationale of the project
1.5.1 Combination of Aracytidine with GTI-2040
Ribonucleotide reductase (RNR) is an important enzyme that catalyzes the rate limiting step of reduction of ribonucleotides (ADP, GDP, UDP, and CDP) to their corresponding deoxyribonucleotides (dADP, dGDP, dUDP, and dCDP). As a potent RNR
inhibitor, GTI-2040 will cause a decrease in the dNTP pool. The decrease in the dNTP pool, specifically dCTP can increase deoxycytidine kinase activities, the key enzyme in
21 catalyzing phosphorylation of Ara-C to Ara-CTP. Therefore, the combination of Ara-C
with GTI-2040 will increase the intracellular Ara-CTP level and enhance the DNA
incorporation of Ara-CTP, thus resulting in enhanced cytotoxic effects.
1.5.2 Combination of 5-Azacytidine with GTI-2040
Preliminary studies in our laboratory have shown synergistic cytotoxicity of 5-
azacytidine in combination of GTI-2040 in vitro. Pretreatment with 5 μM 5-azacytidine
followed by the treatment with GTI-2040 in K562 cells resulted in a significant decrease
in EC50 to about 2 fold when compared to the single drug treatment. Further studies
indicated that 5-azacytidine can inhibit ribonucleotide reductase (RNR) subunit 2 (R2)
mRNA. Thus, 5-azacytidine and GTI-2040 may target the same enzyme, RNR, causing
its significant down-regulation. RNR is also overexpressed in malignant solid tumor cells
and leukemogenesis. 5-Azacytidine can induce G2/M-phase arrest and GTI-2040 inhibits
R2 protein during G1/early S phase (98). Therefore, the combination treatment of GTI-
2040 and 5-azacytidine may invoke markedly increased rates of apoptosis. 5-Azacytidine
or its intracellular metabolite, decitabine, can compete with CTP or dCTP to incorporate
into RNA or DNA, respectively, and inhibit RNA, DNA and protein synthesis. Thus, the inhibition of R2 which catalyzes the conversion of 5-azacytidine to decitabine by GTI-
2040 will result in incorporation of more 5-azacytidine into RNA which may possibly
inhibit certain important microRNA expression to induce apoptosis. Furthermore, the
22 alterations of global DNA methylation (GDM) induced by 5-azacytidine will result in the
reactivation of tumor suppressor genes which will facilitate GTI-2040 killing tumor cells.
1.5.3 Combination of Aracytidine with 5-Azacytidine
Ara-C is a potent cytostatic drug for the treatment of AML, whereas 5-azacytidine
is an active hypomethylating agent. The combination of these two drugs provides an
obviously attractive clinical proposition. More importantly, we observed the decrease of
dCTP after 5-azacytidine treatment in human leukemia K562 cell line. Similar to the rational of combination of Ara-C with GTI-2040, the decrease of dCTP by 5-azacytidine
will increase the accumulation of Ara-CTP and improve the cytotoxic effects. In addition,
re-activation of silenced genes, such as proapoptotic genes, by the epigenetic effects of 5- azacytidine may result in the chemosensitization of tumor cells that in turn improves Ara-
C cytotoxic activities. More importantly, studies have shown that the activity of
deoxycytidine kinase was increased in human lymphoid cells by 5-azacytidine (99) which
will enhance the intracellular Ara-CTP accumulation and help to overcome Ara-C
resistance.
1.6 Significance
The significance of this study is listed as follows.
1) A sensitive and specific HPLC-MS/MS method for dNTPs and NTPs will be used
23 to characterize DNA/RNA perturbation following anticancer drugs treatment which
will provide a theoretical basis for combination studies and important information
of disease/response progress.
2) A sensitive and specific HPLC-MS/MS method for 5-azacytidine in human plasma
and cell matrices will be used to in clinical PK studies and cellular uptake studies of
5-azacytidine which will characterize PK behavior of 5-azacytidine and facilitate
intracellular PK studies.
3) A sensitive and specific HPLC-UV method for Ara-CTP in cell matrices will be
used for metabolite studies in leukemia cells and combination treatment evaluation
of Ara-C with other drugs, which will help identify the optimal dosing schedule.
More importantly, this method can be used to determine the intracellular Ara-CTP
level in patient samples in ongoing clinical trials which will provide critical
information in correlation of active drug metabolite and clinical response.
4) Cellular uptake and transport studies of 5-azacytidine will identify intracellular drug
concentrations and help design combination treatments to overcome drug
resistance. In addition, it will also help to understand future patient’s variability in
response.
5) Clinical PK and population PK will characterize the PK behavior of decitabine or 5-
azaC in the future and identify the important covariates that explain patient’s
variability that aids future dose regimen design.
24
Figure 1.1 Molecular targets for treatment of myeloid leukemia. RTK: receptor tyrosine kinases, NRTK: non-receptor tyrosine kinases (14).
25
Figure 1.2 Epigenetic alterations in cancer (100). CpG-island hypermethylation in promoter region of tumor suppressor gene is a common dysfunction in tumorigenesis.
26
Figure 1.3 Epigenetic alterations on histone (14). Deacetylation of lysine residues by HDACs leads to a compact or closed chromatin, which inactivates gene expression.
27
NH2 NH2 NH2
N N HC N N N HC N O N O N O
HO HO HO O O O H H H H H H H H H H H H OH OH OH OH OH cytidine 5-aza-cytidine decitabine NH 2
N Hum (R2) mRNA
194 1364 2475 N O CODING
5’UTR 3’UTR Poly A HO
O
H OH 626 645
H H 3’ GAACCACCTCGCTAAATCGG 5’ GTI -2040 OH cytarabine Figure 1.4 Structures of nucleoside analogues and sequences of GTI 2040, a ribonucleotide reductase inhibitor.
28
5’ 3’ Analyte antisense 3’ GTG ATC AAT 5’ B 5’ 3’ Capture probe with 5’ overhang 3’ chain-shorten metabolites
1) hybridization 2) Apply to avidin-coated plate
3’ GTG ATC AAT 5’ D B P 5’CAC TAG TTA3’ 3’ GTG ATC AAT 5’ B 3)T4 ligase, ATP GTG ATC AAT 5’ B 3’ Ap D E-Ab 3’ Ap P CAC TAG TTA D 4)S1 nuclease B GTG ATC AAT 5’ D 5) wash B 3’ GTG ATC AAT 5’ P 5’CAC TAG TTA3’ B Figure 1.5 A diagram of the sandwich ELISA assay used in quantification of GTI-2040 (59).
29
Figure 1.6 Intracellular phosphorylation of 5-azacytidine (101).
30
Figure 1.7 Hypomethylating effects of 5-azacytidine and decitabine at low doses (63).
31
Figure 1.8 Mechanism of action of decitabine at low or high doses (101).
32
NH2 O NH2
N H N N
O N O N O N O O O
H O O H O O HO P O P O P O O
OH OH OH OH OH OH
OH OH OH
Aracytidine (Ara-C ) Arauridine (Ara-U ) Aracytidine 5'-triphosphate (Ara-CTP)
NH2 NH2
N N
O N O N O O O O O O
HO P O P O P O O HO P O P O P O O
OH OH OH OH OH OH
OH OH OH
Deoxycytidine 5'-triphosphate (dCTP) Cytidine 5'-triphosphate (CTP) Figure 1.9 Structures of Ara-C, Ara-U, Ara-CTP, dCTP and CTP.
33
Figure 1.10 Mechanism of action of Ara-C (102).
34 CHAPTER 2
A LC-MS/MS METHOD FOR THE ANALYSIS OF INTRACELLULAR NUCLEOSIDE TRIPHOSPPHATE LEVELS
2.1 Abstract
A non-radioactive, sensitive and specific LC-MS/MS method, with 2-
Chloroadenosine-5’-triphosphate (ClATP) as the internal standard, has been developed to simultaneously quantify intracellular NTP and dNTP pools to assess their alteration by antitumor agents. dGTP and ATP could not be resolved and were analyzed as a composite. The assay was linear between 50 nM, the lower limit of quantification
(LLOQ), and 10 μM in K562 cell lysate. The within-day coefficients of variation (CVs, n=5) were found to be 12.0-18.0% at the LLOQ and 3.0-9.0% between 500-5000 nM for dNTPs and 8.0-15.0% and 2.0-6.0% for NTPs, respectively. The corresponding between- day CVs (n=5) were 9.0-13.0% and 3.0-11.0% for dNTPs and 9.0-13.0% and 3.0-6.0% for NTPs. The within-day accuracy values were 93.0-119.0% for both NTPs and dNTPs.
This method was applied to measure basal intracellular dNTPs/NTPs in five cell lines,
K562, NB4, ML-1, MV411, and THP-1, with two drug-treated. Following treatment with ribonucleotide reductase antisense GTI-2040 in MV411, dCTP and dATP levels were found to decrease significantly. Additionally, perturbation of dNTP/NTP levels in bone marrow sample of a patient treated with GTI-2040 was detected. This method provides a
35 practical tool to measure intracellular dNTP/NTP levels and clinical samples following
anticancer drug therapy.
2.2 Introduction
Many ribonucleotide reductase inhibitors, such as hydroxyurea and antisense GTI-
2040, and nucleoside analogs, such as cytarabine, interfere with DNA and RNA
synthesis. The potential mechanism of action of these anti-cancer drugs include the
inhibition of biosynthesis of deoxynucleoside triphosphates (dNTPs) and nucleoside
triphosphates (NTPs), competition with endogenous dNTPs/NTPs for incorporation into
DNA or RNA strands, or depletion of substrates critical for DNA/RNA syntheses. All these may result in perturbation of endogenous dNTP or NTP pools. Therefore, the determination of cellular dNTP and NTP levels is of fundamental importance in understanding the mechanisms of these agents, monitoring the treatment outcome, and
development of chemo-resistance.
A number of analytical methods have been reported to quantify endogenous dNTPs
(1-17) each with its advantages and disadvantages. Although enzymatic DNA polymerase assays are sensitive (103-106), they are hampered by interference with dideoxynucleoside triphosphates (ddNTPs). Radioimmunoassays (RIA) (107,108), although sensitive, cannot simultaneously measure multiple dNTPs and NTPs due to their cross-reactivity and interference with structurally similar molecules, such as 2’-deoxythymidine 5’-
36 diphosphate (dTDP) (107). HPLC-UV has become an attractive method for the
measurement of dNTPs and NTPs (109-116). However, interference with baseline noise
(110,112) and low sensitivity require the use of a large sample size. Additionally, the
time-consuming sample extraction (111,115,116) and a long run time (>2 hr) (109) have
limited their application to a small number of samples. Furthermore, it is necessary to
remove NTPs from cell extracts prior to dNTPs analysis in order to yield accurate results,
since the contents of endogenous NTPs in mammalian cells are several orders of
magnitude higher than the corresponding dNTPs (113,114,116). Although HPLC-MS/MS
methods have been used for the specific measurement of intracellular dNTPs (117,118) with high sensitivity, no direct, simultaneous determination of endogenous dNTPs and
NTPs in cell extract matrices has been published (117-119). The present study reports the
development of a HPLC-MS/MS method, with a simple dilution method of cell extracts, for the direct separation and simultaneous quantification of intracellular dNTPs and
NTPs. The method has been validated and applied to the determination of endogenous
dNTP and NTP levels in five human leukemia cell lines before and two after drug
treatment and in bone marrow samples from a patient treated with antisense GTI-2040 in
combination with cytosine arabinoside.
2.3 Method
37 2.3.1 Chemicals and reagents
All dNTP standards, 2’-deoxyadenosine 5’-triphosphate (dATP), 2’- deoxythymidine 5’-triphosphate (dTTP), 2’-deoxyguanosine 5’-triphosphate (dGTP), 2’- deoxycytidine 5’-triphosphate (dCTP) and NTP standards, adenosine 5’-triphosphate
(ATP), uridine 5’-triphosphate (UTP), guanosine 5’-triphosphate (GTP), cytidine 5’- triphosphate (CTP), 2-chloroadenosine-5’-triphosphate (ClATP), N,N- dimethylhexylamine (DMHA), formic acid (FA, 90%), sodium azide, sodium periodate, deoxyguanosine, methylamine, rhamnose, sodium acetate and acid phosphatase were purchased from Sigma (St. Louis, MO, USA). HPLC grade methanol and acetonitrile
(ACN) were purchased from Fisher Scientific (Pittsburgh, PA, USA). Deionized water for HPLC analysis was obtained from a Milli-Q system (Millipore, Bedford, MA, USA).
An ATP determination kit was obtained from Invitrogen (Rockville, MD). GTI-2040 (5'-
GGC TAA ATC GCT CCA CCA AG-3') was provided by the National Cancer Institute
(Bethesda, MD).
2.3.2 Instrumentation
The HPLC-UV-MS/MS system used consisted of a Shimadzu HPLC system
(Shimadzu, Columbia, MD) and SPD-M10A PDA detector (Shimadzu, Columbia, MD) coupled to a Finnigan (ThermoFinnigan, San Jose, CA) LCQ ion trap mass spectrometer.
The HPLC system used consisted of two LC-10AT vp pumps, a SIL-10AD autosampler
38 (Shimadzu, Columbia, MD). Semi-automatic tuning was used to optimize all relevant
parameters with an infusion of a mixture of dNTP/NTP solution. The MS2 mass spectra
of each dNTP and NTP were acquired with appropriate optimal collision energies.
Instrument control and data processing were performed using XcaliburTM software
(version B, ThermoFinnigan).
2.3.3 HPLC chromatographic and mass spectrometric conditions
Previously reported HPLC conditions (118) were adapted and coupled to the LCQ
ion trap mass spectrometer for the analysis of dATP, dTTP, dGTP, dCTP, ATP, UTP,
GTP and CTP. Briefly, the analysis was performed on a Supelcogel ODP-50, 150×2.1
mm, 5 μm particle size column (Supelco, Sigma-Aldrich, St. Louis, MO) coupled to a 3.5
μm Waters Xterra MS C18 10×2.1 mm guard column (Waters Corp., Milford, MA). The
eluents used consisted of Mobile Phase A (MPA) containing 5 mM DMHA in ultra-pure
water buffered to pH 7 by 90% FA and mobile Phase B (MPB) consisting of 5 mM
DMHA in ACN (50:50, v/v). Gradient program was used for the separation and identification of dNTPs and NTPs at a flow rate of 0.2 mL/min. The program was initiated with 0-10% MPB from 0 to 3 min, 10-45% MPB from 3-28 min, 45-0% MPB from 28 to 28.5 min, and 0% MPB from 28.5 to 40 min. The injection volume was 50 μL.
The autosampler temperature was set at 4 °C throughout the analysis.
39 The LCQ ion trap mass spectrometer with an ESI source was operated in the
negative ion mode. The LC effluent was introduced into the ESI source without split. The electrospray voltage was set at 3.2 kV and the temperature of the heated capillary was set at 250 °C. The LCQ ion trap mass spectrometer was operated with a background helium pressure of 1.75 × 10−3 Torr, a sheath gas flow of 96 (arbitrary unit), an auxiliary nitrogen
gas flow of 45 (arbitrary unit) and a capillary voltage of -30 V. The ion transitions at m/z
490.1→392.1, 481.0→383.0, 506.1→408.1, 466.0→368.1, 483.0→385.0, 522.3→424.0,
482.1→384.1, 540.0→441.9 for dATP, dTTP, dGTP/ATP, dCTP, UTP, GTP, CTP, and
ClATP, respectively, were used in multiple reaction monitor (MRM) mode. Collision
energy values were optimized to 22-28% for these transitions. All performance was
controlled by Finnigan Xcalibur (Version 1.2) software in a Windows NT 4.0 system.
2.3.4 Cell lines and cell culture condition
Human leukemia cell lines K562, NB4, ML-1, MV411 and THP-1 were used. All
cell lines were cultured in RPMI 1640 media supplemented with L-glutamine (Supplied
by Tissue Culture Shared Resource, Comprehensive Cancer Center, The Ohio State
University, Columbus, Ohio), 1% Penicillin-Streptomycin (Gibco, Rockville, MD) and
10% fetal bovine serum (FBS) (Invitrogen, Rockville, MD). The cell lines were
maintained at 37 °C in a humidified, 5% CO2 environment. Trypan blue dye method and
a hemocytometer were used to determine cell counts.
40
2.3.5 dNTPs/NTPs extraction
Intracellular dNTPs and NTPs were extracted as previously described with
modification that involved sonication to enhance deproteinization (105,118,120). Briefly, cells were counted and monitored for viability using trypan blue exclusion test before
extraction. Cell pellets were washed with phosphate buffered saline (PBS) (Supplied by
Tissue Culture Shared Resource, Comprehensive Cancer Center, The Ohio State
University, Columbus, Ohio) and deproteinized with an addition of 1 mL 60% methanol.
The resulting solution was vortex-mixed for 20 s, left at -20 °C for 30 min, then sonicated
for 15 min in an ice bath. Cell extracts were centrifuged at 1000 g for 5 min at 4 °C.
Supernatants were separated and dried under a stream of nitrogen. The residues were reconstituted with 200 μL of Mobile Phase A and vortex-mixed for 20 s. Cell extracts
were centrifuged at 1000 g for 5 min at 4 °C. A 50 μL aliquot of the resulting
supernatants was then injected into the LC-MS/MS system for dNTP measurement and
for NTP measurement a separate 50 μL aliquot of the 20 × dilution supernatants was
used.
2.3.6 Cell matrices preparation and matrix effect study
A previously reported dephosphorylation method (121) was used in the preparation
of cell matrices. Briefly, K562, MV411, HL-1, THP and NB4 cells (2×108) were
41 harvested and washed two times with ice-cold PBS. dNTPs and NTPs were extracted as described above. The residue was reconstituted in 8 mL 4 °C MPA. Dephosphorylation of intracellular dNTPs and NTPs was achieved by addition of 16 units of acid phosphatase (type XA, Sigma) (St. Louis, MO, USA) and 50 μL of 1 M sodium acetate, pH 4.0, followed by a 1-h incubation at 37 °C. The resulting solution was incubated in a
100 °C water bath for 20 min. After the temperature returned to room temperature, the solution was centrifuged at 1000 g for 5 min. The supernatant was stored at -80 °C for further use for calibration standard preparation. The matrix effect was evaluated in triplicate at three concentrations (50, 500 and 5000 nM) by comparing the ratios of response of dNTPs and NTPs spiked in the treated cell matrix to the same in MPA (122).
2.3.7 Calibration standards and method validation
All the calibration standards preparation and method validation were performed in cellular matrices prepared as described above. The stock solutions of dNTPs and NTPs were prepared by mixing the commercially available NTP and dNTP standards with ultra-pure water to a final concentration of 1 mM and stored at -80 °C. The calibration standards were prepared by spiking various amounts of dNTP and NTP and a constant amount of the internal standard ClATP in 0.20 mL cell matrices. The linearity was assessed in the concentration range of 50 -1000 nM of dNTP and NTP mixtures. Within- day accuracy and precision were determined at 50 nM (low quality control, LQC), 500
42 nM (medium quality control, MQC), and 5 μM (high quality control, HQC) in 5
replicates each. The between-day precision was determined across three QCs at 5
different days. The accuracy was assessed by comparing the nominal concentrations with
the corresponding calculated values based on the calibration curve. The specificity of
assay was evaluated by monitoring the MRM of each dNTPs and NTPs in blank cell
matrices coupled to the HPLC retention times.
2.3.8 Determination of intracellular dNTP and NTP pool after GTI-2040 treatment
in human MV411 leukemia cells
8×106 MV4-11 cells and 5×106 K562 cells were treated with different concentrations of GTI-2040 at 0, 1.0, 5.0, 10.0 and 20.0 μM for 24 hours. After counting trypan blue dyed treated cells with the hemocytometer, cell pellets were prepared and washed with ice-cold PBS. dNTPs and NTPs were extracted and determined as described above.
2.3.9 Determination of intracellular dNTP and NTP pools in a bone marrow sample of a leukemia patient
Bone marrow samples were obtained with informed consent from a patient, who was treated with GTI-2040 infusion for 144 hrs in combination with high dose cytosine arabinoside, at the Arthur G. James Cancer Hospital, the Ohio State University. Bone
43 marrow samples were collected and cell density was determined from GTI-2040 treated patients before treatment on Day 1 and Day 5 during treatment. The frozen bone marrow
samples were thawed in a water bath at 37 °C for 5 min and centrifuged for 5 min at 1000
g. The resulting cell pellets were harvested and washed twice with 1 ml PBS. dNTPs and
NTPs were extracted and determined as described above for leukemia cells.
2.4 Results
2.4.1 HPLC-MS/MS assay of dNTPs and NTPs
The total ion chromatogram of dNTPs and NTPs is shown in Figure 2.1A. As
shown, CTP was eluted first followed by dCTP, UTP, GTP, dTTP, dGTP/ATP, dATP
and the internal standard ClATP. The retention times of CTP, dCTP, UTP, GTP, dTTP,
dGTP/ATP, dATP and ClATP were 18.89, 19.00, 19.76, 20.08, 20.68, 21.02, 21.70 and
24.66 min, respectively. Although none of these NTPs and dNTPs were baseline-
resolved, it was expected that from the molecular weight and fragmentation patterns they
would be mass-resolved using MRM with LC-MS/MS, except for dGTP and ATP, which
are isobaric in mass. Using a direct infusion of a mixture of 1 μM each of dNTPs and
NTPs at 10 μL/min for 1 min, the average electrospray ionization mass spectra of dATP, dTTP, dGTP, dCTP, ATP, UTP, GTP, CTP, and ClATP exhibited several abundant ions at m/z 490.1, 481.0, 506.1, 466.0, 506.10, 483.0, 522.3, 482.1, and 540.0, probably corresponding to their respective deprotonated molecular ions ([MH]-), under negative
ionization conditions (Fig 2.1B). The deprotonated molecular ions were thus selected as
44 the precursor ions and their collision-assisted dissociation (CAD) spectra (Figure 2.2)
were obtained subsequently with a predominant daughter ion for each ion under the
optimized collision energy on the LCQ instrument. As shown, the MH- ions of dATP, dTTP, dGTP, dCTP, ATP, UTP, GTP, CTP, and ClATP exhibited fragment ions at m/z
392.1, 383.0, 408.1, 368.1, 385.0, 424.0, 384.1, and 441.9, respectively, corresponding to the removal of a phosphate group (98 Th) from their precursor ions. Therefore, the ion
transitions at m/z 490.1→392.1, 481.0→383.0, 506.1→408.1, 466.0→368.1,
483.0→385.0, 522.3→424.0, 482.1→384.1, and 540.0→441.9 were selected for
monitoring dATP, dTTP, dGTP/ATP, dCTP, UTP, GTP, CTP, and ClATP, respectively.
These MRMs differ somewhat from the previously reported fragmentation patterns of
dNTPs on an API 3000 (118), probably because of different type of instrument. Despite
various attempts, dGTP/ATP were neither chromatographically nor mass-resolved and
were analyzed as a composite.
2.4.2 Assay validations and matrix effect studies
In order to accurately quantify intracellular dNTP and NTP levels, the assay was
validated in K562 cellular matrices. Prior to the construction of the calibration curve,
endogenous dNTPs and NTPs present in the cellular matrices must first be removed.
Thus, the K562 cell lysate was pretreated with acid phosphatase to cleave the
triphosphates under the condition as described in the Method Section. The extracted ion
45 chromatograms of NTPs and dNTPs of blank acid phosphatase-treated K562 cell extracts
and the extracts spiked with 50 nM dNTPs and NTPs mixture are shown in Figure 2.3. As
shown, no peaks corresponding to dNTPs and NTPs were observed in the blank cell
extracts, suggesting that all dNTPs and NTPs in the cell extracts had completely been
removed. Following spiking with a dNTP and NTP mixture in the treated blank extract
(Figure 2.3B), several peaks were observed from 18 to 25 min, corresponding to the
retention times of these nucleotides and deoxynucleotides. Good linearity was found for
all these dNTPs and NTPs at the range of concentration from 50 to 1000 nM and from
1000 to 10000 nM with regression coefficients r2>0.99. The intra- and inter-day precision
values, expressed as %CV are summarized in Table 2.1. The within-day coefficients of
variation (CVs, n=5) were 15.5%, 15.1%, 11.7%, 18.0%, 14.4%, 7.92% and 14.9% for
dATP, dTTP, dGTP/ATP, dCTP, UTP, GTP, and CTP, respectively, at the lower limit of
quantitation (LLOQ) and 3.0-9.0% between 500-5000 nM for dNTPs and 8.0-15.0% and
2.0-6.0% for NTPs. The between-day CVs (n=5) were 16.1%, 9.5%, 12.8%, 8.6%, 9.0%,
13.3% and 12.9% for dATP, dTTP, dGTP/ATP, dCTP, UTP, GTP, and CTP,
respectively, at LLOQ and 3.0-11.0% between 500-5000 nM for dNTPs and 9.0-13.0% and 3.0-6.0% for NTPs. The within-day accuracy values were 93.0-119.0% for both
NTPs and dNTPs.
46 2.4.3 Analysis of dNTP and NTP in different cell lines
The intracellular basal levels of dNTPs and NTPs in human leukemia cells K562,
NB4, ML-1, MV411 and THP-1, 10×106 cells each, were measured using the above LC-
MS/MS method. The concentration of dNTP and NTP in these cells were calculated from
standard curves constructed from individual acid phosphatase-treated cell extracts. The
amounts of intracellular dNTP and NTP as expressed in pmol/106 cell are shown in Table
2.2. The intracellular dNTP and NTP levels varied in different cell lines from 1-10, 1-5,
4-18, 550-1045, 85-330, 134-1185 and 2393-3532 pmol/106 for dATP, dCTP, dTTP,
GTP, CTP, UTP and dGTP/ATP, respectively. These values, not previously reported for
these cell lines, are in the similar concentration ranges of 1.5-31, 0.7-27, 3-77, 316-800,
77-571, 87-1726 and 915-2627 pmol/106 for dATP, dCTP, dTTP, GTP, CTP, UTP and
dGTP/ATP, respectively, as reported in previous studies for human lymphocytes, CEM-
SS cell line, human A2780 ovarian, HT29 colon, K562 myelogenous leukemia, H322
non-small cell lung cancer cell lines and the murine lung cancer cell line Lewis Lung
(104,112,123). It is worth noting that dNTP and NTP levels measured by HPLC/UV are
generally higher than those measured by enzymatic or our HPLC-MS/MS method and the
reason may be attributed to low specificity and potential interference caused by other
intracellular nucleotides with the HPLC-UV method.
47 2.4.4 Alterations in dNTPs and NTPs levels in leukemia MV411 treated with GTI-
2040
Over-expression of ribonucleotide reductase, the highly regulated enzyme involved in the de novo synthesis of nucleoside triphosphates, has been found in almost every type of cancer studied. Down-regulation of ribonucleotide reductase activity has been considered an important strategy for anticancer therapy (61,124). GTI-2040 is a potent antisense inhibitor of the R2 subunit of the ribonucleotide reductase (55,60). Therefore, monitoring of the perturbation of dNTP and NTP levels following GTI-2040 treatment is of critical importance for validation of its target, monitoring the treatment outcome, and the design of future combination therapies. Following GTI-2040 treatment in MV4-11 cells (Figure 2.4), there were no significant changes among dGTP/ATP, GTP, CTP, UTP and dTTP levels. However, dATP levels decreased by about 50% following exposure to 1 and 5 μM of GTI-2040 and became undetectable at 10 and 20 μM of drug treatment. dCTP level decreased drastically to an undetectable level following all four GTI-2040 treatment levels. Thus, in this cell line, the modulation of dNTP and NTP levels did not appear to show a concentration dependent pattern, probably due to certain salvage or feedback regulations involved.
48 2.4.5 Determination of dNTPs and NTPs levels in bone marrow samples from a
leukemia patient
Intracellular dNTP and NTP levels in bone marrow samples obtained from a
leukemia patient as expressed in pmol/106 cell are shown in Table 2.4. Following GTI-
2040 treatment, dTTP and dCTP levels in bone marrow cells decreased from 5.32 and
1.69 pmol/106 cells to 1.86 and 1.37 pmol/106 cells on day 1 post treatment, respectively,
but rebound at day 2. The dATP level became undetectable on day 1 post treatment from
the pretreatment level of 7.42 pmol/106 cell, but rebound slightly on day 2. The
pretreatment levels of dGTP/ATP, GTP, CTP and UTP were 851.71, 218.30, 105.74 and
296.04 pmol/106 cells, respectively. At day 1 post treatment, these NTP levels increased slightly to moderately, but decreased slightly or no change on day 2. These data are
limited and only preliminary in nature.
2.5 Discussion
Due to the presence of multiple phosphate groups, nucleotides are only weakly
retained on reversed-phase HPLC columns under normal conditions. Therefore, ion-
pairing agents are necessary to neutralize the negative charges of the nucleotides, which
facilitate their retention on the reversed-phase columns. First, we tested a previously reported HPLC condition (118) using a gradient composing of 50% 6 mM DMHA
dissolved in 20 mM ammonia formate and 50% ultrapure water as MPA and 50% solution A and 50% ACN as MPB. However, no separation of NTPs and dNTPs was
49 achieved. We then lowered the DMHA concentration in the mobile phase to 5 mM,
which resulted in a better resolution. Measurement of the pH of 5 mM DMHA aqueous
solution showed a pH value of 10.3. When we evaluated their separation at the pH values
of MPA between 5 to 10, the separation of eight dNTPs and NTPs was achieved at pH
7.0, using the gradient as described in the Method Section. Thus, we selected 5 mM
DMHA as an ion-pairing agent. DMHA appears to increase the nucleotides binding to the column and prolongs their retention, resulting in better resolution of NTPs and dNTPs, higher signal intensity, lower interference, and is compatible with the use in ESI-MS
(118,119,125,126). The pH value of MPA (5 mM DMHA, pH 10.3) was adjusted to 7.0,
which is critical for nucleotide separation and quantification (119,126,127). At pH values
above 7.5, nucleotide peak shape distortion was observed and signal intensity was
significantly decreased, and at low pH, decreased signal intensity of some dNTPs and
NTPs was also found.
dGTP and ATP are isobaric (identical mass) and give similar fragmentation patterns
and retention times. This makes it impossible to differentiate these two compounds under
the current LC-MS/MS condition, and the similar problem existed in a previous method
(118). To overcome this limitation, attempts were made to eliminate the ATP levels. Two
sample preparation methods were evaluated, boronate affinity chromatography (116,128)
and degradation of the cis-diol NTPs by periodate and methylamine (129-131). However,
the high salt concentration in the mobile phase for boronate affinity chromatography
50 caused severe ion suppression and limits its application to LC-MS/MS. Additionally, we
found that boronate affinity chromatography cannot completely deplete ATP. The
average intracellular ATP level is about 2000 pmol/106 cells (112,132) and the average
intracellular dGTP level is only about 10 pmol/106 cells (109,112,132). Even 99%
depletion (1% ATP remaining) would pose significant interference with the dGTP signal.
A periodate oxidation method was evaluated and we found that ATP could not be
completely depleted either. In addition, this procedure was reported to cause partial loss
of dGTP because of the formation of some dicarbonyl compounds (128). Although
Hennere et al. (118) reported an improved periodate oxidation method by an addition of
deoxyguanosine, which is supposed to circumvent the loss of dGTP; we were unable to
reproduce their method. Additionally, the high salt concentration present in the final
solution made it difficult to run a large number of samples on our LC-MS/MS system.
Hence, we sought an enzymatic method using luciferin and luciferase; however, this
method also caused partial dGTP loss and was not cost-effective due to the large amount
of costly luciferin and luciferase required to eliminate ATP. Another possible method
was to use a sodium azide oxidation method to deplete ATP (133). Unfortunately, this
method also could not totally deplete ATP. Although dGTP is of critical importance in
intracellular signaling pathways, the separate determination of dGTP was not central in
the present investigation of perturbation of dNTP and NTP pools by antitumor agents, as most antileukemia nucleoside analogs cause perturbation of mainly intracellular dCTP,
51 dATP and CTP levels, less significant on dGTP. Our method successfully quantified all
other dNTP and NTP levels.
To improve the sensitivity and specificity, MRM was used to monitor each selected
molecule. It is noteworthy that the molecular weights of parent ions and corresponding
daughter ions for dTTP (m/z 383.0), CTP (m/z 384.1) and UTP (m/z 385.0) differ by
only one Th. The presence of isotopic peaks could potentially cause interference.
However, all these peaks (dTTP, CTP, UTP) were chromatographically resolved,
allowing an accurate quantification of these molecules. In addition, the mass isolation widths were all set to 1.0 for both the parent ion and daughter ion of dTTP, CTP and
UTP, which further reduces the interference due to isotopic peaks.
The matrix effect often poses a challenge in the development of LC-MS/MS assays.
The mean matrix effect was evaluated by comparing the ratio of analyte response in acid phosphatase treated cell extracts with that in Mobile Phase A as described (122). There
were variable matrix effects among dNTPS and NTPs with a mean matrix effect of about
64% (Table 2.3), suggesting a possible ion suppression of dNTPs and NTPs in acid
phosphatase-treated K562 cell extracts. Therefore, in order to accurately quantify the
intracellular dNTP and NTP levels, it is important to prepare a standard curve for each analyte in the treated cell extracts. We used an internal standard as it compensates for the
52 lower than quantitative recovery. None of the previously reported methods have addressed this issue (117,118) and this shortcoming has compromised their validity.
Ribonucleotide reductase is an important enzyme which catalyzes the conversion of ribonucleotides (ADP, GDP, UDP, and CDP) to their corresponding deoxyribonucleotides (dADP, dGDP, dUDP, and dCDP). Since GTI-2040 is a potent ribonucleotide reductase inhibitor, the inhibition of ribonucleotide reductase may result in decrease of dATP and dCTP levels and increase of ATP, GTP, UTP and CTP levels.
After GTI-2040 treatment in MV411, a significant decrease in dCTP and dATP has been observed and this confirms the inhibition effect of GTI-2040 on ribonucleotide reductase.
However, the dTTP level remains unchanged, possibly due to its biosynthesis pathway independent of ribonucleotide reductase. No significant changes were observed among
NTP levels. This effect may be due to presence of the salvage pathway of intracellular
NTP biosynthesis, which compensates for the increase in NTPs. The significant decrease in dNTP and increase in NTP levels based on CV of our method at day 1 post treatment of GTI-2040 in one leukemia patient also supports the potential mechanism of action of
GTI-2040. However, more patient data are necessary to confirm the pharmacological action of GTI-2040. Since GTI-2040 significantly decreases dCTP and dATP levels, the combination treatment with GTI-2040 and cytarabine may be a good strategy for future anticancer therapies, since the active metabolite of cytarabine, araCTP, competes with
53 dCTP for DNA incorporation. This combination therapy is currently being evaluated at our institution (134).
2.6 Conclusion
In conclusion, we developed a non-radioactive LC-MS/MS method for quantifying intracellular NTP and dNTP pools and successfully applied it to measure their levels in different cell lines and in bone marrow samples from a patient. Our present study provides a useful tool for the further measurement of biochemical modulations of nucleotide pools by various anti-cancer nucleoside analogs and nucleotide reductase inhibitors. Direct measurement of nucleotide pools provides important information for future combination therapies.
54
Reproducibility (CV %, n=5) Accuracy (%, n=5) Nominal 50 500 5000 50 500 5000 Concentration (nM) → Analyte ↓ Within- dTTP 15.1 4.17 3.87 107 101 101 day dATP 15.5 8.74 3.06 107 105 103 dCTP 18.0 3.43 3.44 112 103 104 GTP 7.92 1.97 3.88 111 92.8 102 CTP 14.9 3.96 4.72 115 102 107 UTP 14.4 5.52 6.08 105 95.7 109 dGTP/ATP 11.7 3.15 3.60 119 98.7 103
Between- dTTP 9.5 8.2 7.4 day dATP 16.1 7.7 4.6 dCTP 8.6 10.7 2.6 GTP 13.3 6.2 3.7 CTP 12.9 5.1 4.1 UTP 9.0 4.9 3.9 dGTP/ATP 12.8 6.3 3.7
Table 2.1 Assay validation characteristics of dNTPs and NTPs in cell matrices by negative ion ESI LC-MS/MS.
55
Analyte Concentration, pmol/106 cell (SD) → dGTP/ATP dATP dCTP dTTP GTP CTP UTP Cell line↓ MV411 2642.9 1.53 1.93 7.56 607.8 165.0 315.6 (219.3) (0.34) (0.58) (0.63) (20.4) (11.8) (17.3) K562 3532.1 2.7 4.8 17.6 1045.0 329.6 1184.7 (123.6) (0.96) (0.77) (7.23) (58.4) (46.2) (67.6) HL-1 2837.4 10.1 1.44 7.14 550.6 116.8 290.6 (255.9) (1.12) (0.17) (0.38) (24.1) (7.03) (25.7) THP 2393.7 1.87 1.01 4.39 532.9 85.2 133.8 (180.3) (0.37) (0.41) (0.17) (39.2) (16.9) (7.8) NB4 2767.4 6.98 2.21 5.04 582.7 137.2 302.1 (271.0) (0.62) (0.39) (0.98) (67.8) (19.3) (26.4)
Table 2.2 Basal levels of dNTPs and NTPs in five cell lines.
56
Analyte Concentration Mean matrix effecta (nM) dTTP 50 61.60 ± 7.91 500 68.65 ± 3.27 5000 65.05 ± 1.13 dATP 50 57.06 ± 6.97 500 68.65 ± 4.97 5000 64.91 ± 5.62 dCTP 50 65.95 ± 5.03 500 66.25 ± 4.90 5000 68.45 ± 2.37 GTP 50 57.39 ± 8.15 500 63.74 ± 5.68 5000 68.92 ± 3.86 CTP 50 63.36 ± 4.35 500 60.96 ± 4.61 5000 71.67 ± 2.25 UTP 50 54.93 ± 9.18 500 61.31 ± 1.69 5000 67.97 ± 0.56 dGTP/ATP 50 53.40 ± 9.20 500 66.77± 1.62 5000 68.31 ± 2.36 aMean matrix effect was evaluated as mean area ratio of analyte in cell extract/analyte in mobile phase ± S.D. (n=3)
Table 2.3 Mean matrix effect of dNTP and NTP assay in acidic phosphatase-treated K562 cell extracts using the LC-MS/MS system.
57
Analyte Concentration, pmol/106 cell (SD) → dGTP/ATP dATP dCTP dTTP GTP CTP UTP Sampling Time ↓ Pre- 851.71 7.42 1.69 5.32 218.30 105.74 296.04 treatment Day 1 1284.30 -a 1.37 1.86 406.71 164.60 401.59 Day 2 361.97 1.70 1.81 7.61 184.28 102.52 176.84 aUndetectable
Table 2.4 dNTPs and NTPs levels in bone marrow samples from a leukemia patient.
58 A. dTTP GTP
UTP dGTP/ATP
CTP
dCTP
dATP ClATP
0 5 10 15 20 25 30 Time (min) B. dTTP
UTP 481.1 dGTP /ATP 483.1
506.1
dATP
CTP 482.1
490.1 GTP
dCTP
522.1 466.1
450 460 470 480 490 500 510 520 530 540 m/z Figure 2.1 A) Total ion chromatogram of a standard mixture of ATP, GTP, CTP, UTP, dATP, dGTP, dCTP, dTTP and ClATP. B) Full mass scan of a standard mixture 1 μM of ATP, GTP, CTP, UTP, dATP, dGTP, dCTP and dTTP with a direct infusion at 10μL/min.
59 392.1 368.1 100 100
80 80
60 60
40 40
Relative Abundance Relative 471.9 Relative Abundance 20 20 447.8 466.0 378.7 410.4 490.1 354.3 386.3 0 0 200 250 300 350 400 450 500 550 200 250 300 350 400 450 500 550 m/z m/z dATP (490.1 392.1) ddCTPCTP (466.0 368.1)
383.1 408.1 100 100
80 80
60 60
488.1 40 40 Relative Abundance Relative 20 Relative Abundance 20 462.8 239.2 506.2 354.9 421.2 481.0 426.0 0 0 200 250 300 350 400 450 500 550 200 250 300 350 400 450 500 550 m/z m/z dTTP (481.0 383.1) dGTP (506.2 408.1)
408.1 384.1 100 100
80 80
60 60
40 488.0 40 Relative Abundance Relative Relative Abundance 20 20 506.1 257.3 379.5 272.8 354.8 482.1 0 0 200 250 300 350 400 450 500 550 200 250 300 350 400 450 500 550 m/z m/z ATP (506.1 408.1) CTCTPP (482.1 384.1)
385.0 100 424.0 100
80 80
60 60
40 40 Relative Abundance Relative
20 Abundance Relative 20 483.0 441.0 522.3 0 0 200 250 300 350 400 450 500 550 200 250 300 350 400 450 500 550 m/z m/z UTUTPP (483.0 385.0) GTP (522.3 424.0)
Figure 2.2 Product ion mass spectra of the deprotonated molecular ions of dNTPs and NTPs.
60 A. B.
GTP GTP RT: 20.08 NL: 3.43E3 RT: 22.22 NL: 4.70E2 100 GTP 100 RT: 17.92 RT: 28.39 RT: 28.82 0 0 0 5 10 15 20 25 30 35 40 0 5 10 15 20 25 30 35 40 Time (min) Time (min)
CTP CTP RT: 18.89 NL: 3.71E3 RT: 18.00 100 CTP 100 RT: 28.75 NL: 4.26E2 RT: 14.41 0 0 5 10 15 20 25 30 35 40 5 10 15 20 25 30 35 40 Time (min) Time (min) UTP UTP RT: 19.76 NL: 2.36E3 RT: 15.97 100 UTP 100 NL: 4.01E2 RT: 22.35 RT: 21.56RT: 28.30 0 0 5 10 15 20 25 30 35 40 5 10 15 20 25 30 35 40 Time (min) Time (min) dGTP/ATP dGTP/ATP dGTP/ATP RT: 21.02 NL: 2.74E3 RT: 27.91 NL: 5.05E2 100 100 RT: 22.17 RT: 26.33 0 0 0 5 10 15 20 25 30 35 40 0 5 10 15 20 25 30 35 40 Time (min) Time (min)
dTTP dTTP dTTP RT: 20.68 NL: 1.36E3 RT: 23.05 100 100 NL: 4.47E2 RT: 23.55 0 0 0 5 10 15 20 25 30 35 40 0 5 10 15 20 25 30 35 40 Time (min) Time (min)
dATP dATP dATP RT: 21.70 RT: 20.98 RT: 27.29 100 NL: 3.46E3 100 NL: 5.45E2
0 0 0 5 10 15 20 25 30 35 40 0 5 10 15 20 25 30 35 40 Time (min) Time (min)
dCTP dCTP RT: 19.00 RT: 18.99 100 dCTP NL: 3.70E3 100 RT: 11.82 RT: 28.17 NL: 4.57E2 RT: 25.45 0 0 0 5 10 15 20 25 30 35 40 0 5 10 15 20 25 30 35 40 Time (min) Time (min)
Figure 2.3 A) The multiple reaction monitoring (MRM) mass spectra of dNTPs and NTPs, 50 nM each, spiked into acid phosphatase-treated blank K562 cell extracts. B) The multiple reaction monitoring (MRM) mass spectra of dNTPs and NTPs in blank acid phosphatase-treated K562 cell extracts. No significant interference peaks were observed.
61
dTTP dGTP/ATP 140 160 120 140 100 120 80 100 80 60 60 dTTP level
(% of control) of (% 40 40 (% of control) (% 20 level dGTP/ATP 20 0 0
Control GTI-2040 GTI-2040 GTI-2040 GTI-2040 Control GTI-2040 GTI-2040 GTI-2040 GTI-2040 no drug 1 μM 5 μM 10 μM 20 μM no drug 1 μM 5 μM 10 μM 20 μM dCTP dATP 140 140 120 120 100 100 80 80 60 60 * * dCTP level (% of control) (% of 40 dATP level 40 (% of control) 20 20 *** * 0 **
Control GTI-2040 GTI-2040 GTI-2040 GTI-2040 Control GTI-2040 GTI-2040 GTI-2040 GTI-2040 0 no drug 1 μM 5 μM 10 μM 20 μM no drug 1 μM 5 μM 10 μM 20 μM
CTP GTP 140 160 120 140 120 100 100 80 80 60 GTP level CTP level 60
(% of of control) (% 40 (% of control) of (% 40 20 20 0 0 Control GTI-2040 GTI-2040 GTI-2040 GTI-2040 Control GTI-2040 GTI-2040 GTI-2040 GTI-2040 no drug 1 μM 5 μM 10 μM 20 μM no drug 1 μM 5 μM 10 μM 20 μM
UTP 160 140 120 100 80 60 UTP level
(% of control) 40 20 0 Control GTI-2040 GTI-2040 GTI-2040 GTI-2040 no drug 1 μM 5 μM 10 μM 20 μM
Figure 2.4 Alteration of dNTP and NTP levels in MV411 cells following GTI-2040 treatment at various concentrations for 24 hours (n=3). Asterisks indicate significant difference from untreated control at p<0.05.
62 CHAPTER 3
A HIGHLY SENSITIVE AND SPECIFIC LC-MS/MS ASSAY FOR THE QUANTITATION OF 5-AZACYTIDINE IN HUMAN PLASMA
3.1 Abstract
5-Azacytidine (5-AzaC), an azanucleoside, possesses anti-leukemia activities and is
used for the treatment of myelodysplastic syndrome (MDS), myeloid leukemia, and other
forms of neoplasia. As a DNA methyltransferase inhibitor, 5-AzaC can be incorporated
into DNA or RNA, resulting in degradation of DNA methyltransferase and reactivation
of tumor suppressor gene expression. Currently, 5-AzaC is being clinically evaluated for the treatment of patients with hematologic malignancies and solid tumors. However, 5-
AzaC is rather unstable under neutral and basic conditions, which greatly limits the characterization of its pharmacokinetics and pharmcodynamics. The purpose of this study was to develop a simple, non-radioactive, sensitive and specific high-performance liquid chromatography mass spectrometry (HPLC-MS/MS) method to quantify 5-AzaC in human plasma. Separation of 5-AzaC and its internal standard dihydro-decitabine (IS) from the endogenous interfering substance in human plasma extract was achieved by
HPLC on a C18 Aquasil column and identification was accomplished based on a specific fragmentation pathway of the molecular ion of 5-AzaC (m/z 245→113) and IS
(231→115) under collision-induced dissociation. An isocratic elution with a mobile
63 phase consisting of 1% methanol and 10 mM ammonium formate at a flow rate of 0.2
mL/min was performed. A triple quadruple mass spectrometer (Finnigan TSQ Quantum)
was used to measure 5-AzaC under a positive ion electrospray mode. The calibration
standards were prepared by spiking various amounts of 5-AzaC and a constant amount of
IS in 0.20 mL human plasma. Linearity was found between 1 ng/mL, the lower limit of quantification (LLOQ), and 500 ng/mL in human plasma. For best results, the calibration
curve was separated into two sections: 1-20 ng/mL and 20-500 ng/ml. The within-day coefficients of variation (CVs, n=6) at 1, 5, 50, 500 ng/mL were 13.18, 16.76, 15.94 and
9.90%, respectively. The between-day CVs (n=6) at 1, 5, 50, 500 ng/mL were 17.99,
14.38, 7.75 and 2.36%, respectively. The within-day accuracy values at 1, 5, 50, 500 ng/mL for 5-AzaC were 118.83, 110.74, 105.66 and 108.28%, respectively. This method provides a useful and practical tool to further evaluate clinical pharmacokinetics of 5-
AzaC at low doses (<25 mg/kg).
3.2 Introduction
5-Azacytidine (5-AzaC), an azanucleoside (Figure 3.1), possesses anti-leukemia
activities and is used for the treatment of myelodysplastic syndrome (MDS), myeloid
leukemia, and other forms of neoplasia. 5-AzaC is activated into 5-Azacytidine
triphosphate in the cell which can be incorporated into RNA (4). At high doses (100
mg/m2/day), 5-AzaC inhibits cell proliferation primarily due to its potent cytotoxicity
(63,135). At low doses (25 mg/m2/day), 5-AzaC acts as an effective hypomethylating
64 agent that traps DNA methyltransferases, causing their degradation, which results in
reduction of functional enzyme level (136). Hypermethylation near the promoter region
of tumor suppressor genes such as P15 is frequently observed in cancer (69). Therefore,
the treatment of 5-AzaC at low doses induces hypomethylation of DNA and can
reactivate those quiescent genes, resulting in restoration of these gene functions. 5-AzaC
was found to produce remissions or clinical improvements for the treatment of MDS
(137,138) and recently was approved by the FDA for the treatment of MDS (139).
The pharmacokinetic analysis of 5-[4-14C]-AzaC in humans given intraveneous
bolus administration at high doses (50-100 mg/d) revealed that the elimination half life
(βt1/2) was 3.4-6.2 hr. In addition, less than 2% of 5-AzaC was present in plasma 30 min
after dose (140). However, the pharmacokinetic analysis of 5-AzaC given subcutaneous
injection at lower doses (10-75 mg/m2/d) showed that the mean elimination half life
(βt1/2) was 1.5 hr and the mean Tmax was 0.47 hr (67). Pharmacokinetics of 5-AzaC at
low doses (<25 mg/kg) has not been well-characterized, however, probably due to a lack
of a sensitive assay method. In order to characterize pharmacokinetic behavior of 5-AzaC
at low doses, especially to obtain an accurate βt1/2 value, a more sensitive and specific
method for quantification of 5-AzaC is necessary in clinical studies.
A number of methods have been developed to quantify 5-AzaC in plasma. Since 5-
AzaC can inhibit cell growth and proliferation, 5-AzaC was originally quantified using a
65 microbiologic assay (141). However, this method was not specific because the
degradation products of 5-AzaC also possesses inhibitory effects on cell growth. A HPLC method was developed, which became widely used to determine 5-AzaC concentration in plasma (142-144); however, this method is not sensitive with the lower limit of
quantitation of only 250 ng/mL. Recently, Zhao et. al (72) reported a sensitive and
specific HPLC-MS/MS method using a gradient HPLC program. However, this gradient
HPLC program requires a long run time of 30 min including re-equilibration. In addition,
the lower limit of quantitation (LLOQ) is 5 ng/ml, which may not be adequate for
accurate determination of the elimination phase of 5-AzaC. In order to more accurately
characterize the clinical pharmacokinetics of 5-AzaC and to more efficiently analyze a
large number of patient samples, an improved HPLC-MS/MS method has been developed
using an isocratic elution program. The method discussed in this chapter provides the
lower limit of quantitation as low as 1 ng/mL with a run time of only 15 min.
3.3 Experimental Method
3.3.1 Materials
5-AzaC and decitabine standards (as powder) were obtained from The National
Cancer Institute. Sodium borohydride (NaBH4), hydrochloric acid (HCl) solution (3.0
M), ammonia formate and ammonia hydroxide solution (29.1%, v/v) were purchased
from Sigma (St. Louis, MO, USA). HPLC grade methanol and acetonitrile (ACN) were
66 purchased from Fisher Scientific (Pittsburgh, PA, USA). Deionized water for HPLC analysis was obtained from a Milli-Q system (Millipore, Bedford, MA, USA). Oasis
MCX SPE cartridges (1 mL, 30 mg) were purchased from Waters Corp. (Milford, MA,
USA). Drug-free (blank) human plasma was obtained from Pittsburgh Blood Plasma Inc.
(Pittsburgh, PA, USA).
3.3.2 Quantitative conversion of decitabine into dihydro-decitabine as the internal standard (IS)
To 100 μL of freshly prepared aqueous solution of NaBH4 (10 mg/mL) was added
1000 μL of decitabine methanolic solution (1 mg/mL) and the resulting solution was allowed to stand at room temperature for 30 min. The methanol was evaporated and the residue was dissolved in 800 μL distilled water. The resulting solution was neutralized with 3 N HCl to pH 7.0 and the total volume was adjusted to 1 mL. HPLC-MS/MS analysis was performed to verify the purity of IS and the mass spectrometer was tuned to its optimum sensitivity by direct infusion of the resulting solution. Full mass scan was performed to test the identity of the newly synthesized dihydro-decitabine. The most intense peak from the full mass scan of the IS was then selected for further zoom scan and data dependent MS/MS scan to identify the dominent daughter ion of the IS. The full mass scan and MS/MS scan were also used to examine the presence of decitabine in the final reaction solution. Decitabine and the IS were analyzed by the selective reaction
67 monitor (SRM) mode using ion transitions at m/z 229.10>113.16 with relative collision
energy of 17% and m/z 231.09>115.13 with relative collision energy of 12%,
respectively. Due to the absence of ion peaks of appreciable intensity corresponding to
full mass or MS/MS scan of decitabine and the presence of intensive ion peaks
corresponding to full mass or MS/MS scan of dihydro-decitabine, the conversion to IS
from decitabine was considered quantitative with minimal degradation. The quantity of
the product (dihydro-decitabine) was estimated as 1mg/mL in the final solution, similar
to that of the initial input decitabine. The final solution was further diluted to 1 μg/mL
with water and stored at -80°C as the stock solution of the IS.
3.3.3 Sample preparation
All sample preparations were performed on ice. The stock solution of 5-AzaC was
prepared by dissolving the accurately weighed drug in 10 mL of 50% methanol to a final
concentration of 1 mg/mL and stored in a glass vial at -80°C. Working solutions were
prepared fresh daily by diluting the stock solution with methanol. Calibration standards
were prepared in human plasma by serial dilutions of the stock solution to obtain the
following concentrations: 1, 2, 5, 10, 20, 50, 100, 200, and 500 ng/mL. The quality
controls (QCs) were at 1, 5, 50 and 500 ng/mL. Sample extraction and clean-up were
carried out on Oasis MCX SPE cartridge (Waters corp, Massachusetts) as shown in
Figure 3.2. Briefly, a plasma sample containing 50 ng/mL IS was loaded onto an Oasis
68 MCX SPE cartridge, which had been pre-activated and equilibrated with 1.0 mL of
methanol and 1.0 mL of H2O, respectively. The column was then eluted in sequence with
1.0 mL 0.1N HCl, 1.0 mL 50% methanol, 1.0 mL methanol, and 1.0 mL 5.0% NH4OH in
95% methanol. The NH4OH/methanol fraction was collected and the solvent evaporated under a stream of nitrogen. The residue was reconstituted in 100 μL of 4°C water by votex mixing for 30 s. The sample was then centrifuged at 5000 g at 4°C for 1 min and the supernatant was transferred to a 250 μL polypropylene autosampler vial. A 20 μL aliquot was directly injected into the LC-MS/MS instrument using a temperature controlled autosampler operating at 4 °C during sample analysis.
3.3.4 Instrumentation
The LC/MS system used consisted of a Finnigan TSQ Quantum EMR Triple
Quadruple mass spectrometer (ThermoFinnigan, San Jose, CA) coupled to Shimadzu
HPLC system (Shimadzu, Columbia, MD). The Shimadzu system is equipped with a
CBM-20A system controller, an LC-20 AD pump, a SIL-20AC autosampler, CTO-20A column oven, DGU-20A5 degasser and FCV-11AL valve unit.
3.3.5 HPLC and MS conditions
5-AzaC and the IS were separated from endogenous interfering substances in human plasma extract on a 250×2.1 mm Hypersil Aquasil C18 5 mm stainless steel
69 column (Thermo Hypersil-Keystone, Bellefonte, PA, USA), which was coupled to a 20
mm×2.1 mm, Aquasil precolumn (Thermo Hypersil-Keystone) at room temperature.
Isocratic program was used to quantify 5-AzaC. The mobile phase used consisted of 10
mM ammonium formate containing 1% methanol and the flow rate was set at 0.2
mL/min.
The mass spectrometer was operated in the positive electrospray (ESI) mode with a helium pressure of 20 psi, a typical electrospray needle voltage of 4988 V, a sheath nitrogen gas flow of 27 (arbitrary unit) and a heated capillary temperature of 300 °C. An auxiliary nitrogen gas flow and ion sweep gas pressure were set at 0.6 and 2 (arbitary unit), respectively. The scan width and scan time were set at 1.00 and 0.3, respectively.
Both Q1 and Q3 peak width (FWHM) were set at 0.7. 5-AzaC and the IS were analyzed by multiple reaction monitor (MRM) mode using ion transitions at m/z 245.10>113.16 with relative collision energy of 15% and m/z 231.09>115.13 with relative collision energy of 11%, respectively. The mass spectrometer was tuned to its optimum sensitivity by direct infusion of 5-AzaC. All operations were controlled by Finnigan Xcalibur software on a Windows NT 4.0 system.
70 3.3.6 Method validation
Calibration samples were prepared as described in Figure 3.2 over the range from 1 to 500 ng/mL. Calibration curves were constructed using the peak area ratios of 5-AzaC over that of of IS. Linear regression was performed to obtain the calibration curve. Three criteria were selected to determine the lower limit of quantitation (LLOQ): the signal to noise ratio (S/N) of peak area of LLOQ was greater than 20, the within-day and between- day precision of LLOQ is less than 20% and the accuracy of LLOQ is between 80-120%.
Based on these criteria, the LLOQ of the assay for 5-AzaC was determined to be 1 ng/mL. The accuracy of the assay was determined by comparing the mean calculated concentrations with the corresponding mean nominal concentrations as shown in the following equation.
⎧ (5 − AzaC) ⎫ Accuracy of 5-AzaC (%) 100 ×= ⎨ mean ⎬ ⎩()5 − AzaC min alno ⎭
The between-day precision was expressed as coefficients of variation (% CV) and was determined for four QCs on six different days. The between-day % CV was calculated by the following equation.
SD _ Between-day CV (%) = 100× Between−day MeanCon _5− AzaC
The within-day precision, expressed as % CV, was determined at four QCs with six replicates each. The within-day % CV was calculated by the following equation.
71 SD _ Within-day CV (%) = 100× −dayWithin MeanCon _5− AzaC
The linearity was evaluated based on correlation of coefficient obtained from linear
regression. The specificity of the method was assessed by using selective reaction
monitor (SRM) mode and comparing the retention time of interference peaks on blank
human plasma extracts with that of human plasma extracts spiked with 1 μg/mL 5-AzaC.
3.4 Result
3.4.1 Verification of the structure of the internal standard
As shown in Figure 3.3A, the full average mass spectrum scan (1 min) of 200
ng/mL decitabine in mobile phase (99% methanol and 1% 10 mM ammonium formate)
with direct infusion at 10 μL/min under positive ESI gave a major ion at m/z 229.06,
+ representing the MH of decitabine. However, after reduction with NaBH4, an intense ion
at m/z 231.04 was observed, consistent with the expected MH+ ion of dihydro-decitabine,
while the ion at m/z 229.06, representing decitabine, diminished (Figure 3.3 B). The
MS/MS scan of decitabine in mobile phase with relative collision energy of 17% gave a
major daughter ion at m/z 113.14 (Figure 3.4 A), however, the daughter ion of decitabine
in final reduction medium was not observed (Fig 3.4 B). Instead, the MS/MS scan of dihydro-decitabine in the final reduction reaction solution gave a major daughter ion at
m/z 115.1 (Figure 3.5). In extracted ion chromatograms of the reduction medium as shown in Figure 3.6A, no peak corresponding to decitabine with appreciable intensity
72 was observed. However, in Figure 3.6B, a strong ion peak corresponding to dihydro-
decitabine was observed. Therefore, based on the above results, after reduction reaction,
decitabine has been completely converted to dihydro-decitabine (IS).
3.4.2 Separation and identification of 5-AzaC and the IS in human plasma
extracts.
An isocratic HPLC program was developed to measure 5-AzaC in human plasma
based on the previously reported method for the quantification of decitabine in human
plasma (145). The mobile phase used consisted of 10 mM ammonium formate containing
1% methanol with a flow rate of 0.2 ml/min. The retention times for 5-AzaC and the
internal standard were 9.4 and 10.9 min, respectively (Figure 3.7). The overall run time
was 15 min.
5-AzaC and the IS could not be resolved chromatographically; however, they can
be mass-resolved. Under positive ESI analysis of 5-AzaC gave a major ion at m/z 245.09
in the mass spectrum, which corresponds to the protonated molecular ion ([MH+]) of 5-
AzaC (Figure 3.8 A). The mass spectrum of the internal standard (dihydro-decitabine) showed a protonated molecular ion ([MH+]) at m/z 231.09 (Figure 3.8 B). The parent 5-
AzaC ion was selected for the MS/MS analysis and was fragmented to produce one major
daughter ion at m/z 113.11 (Figure 3.9), corresponding to the protonated 4-amino-1H-
73 [1,3,5]triazin-2-one, the formation of which resulted from the elimination of 2,3- dedihydroribose. The peak area of the ion transition 245.10>113.16 of 5-AzaC was found to be linearly correlated with concentrations of 5-AzaC, using the selective reaction monitor (SRM) mode. Therefore, SRM mode with the ion transition at m/z
245.10>113.16 was used to monitor 5-AzaC. Upon the use of collision energy at 11%, the parent dihydro-decitabine (IS) ion was fragmented to produce a major daughter ion at m/z 115.13, probably due to the elimination of 2-deoxy-2,3-dedihydroribose. Therefore, the SRM mode using an ion transition at m/z 231.09>115.13 was used to monitor the internal standard. The specificity of the method was assessed using the SRM mode and comparing the retention time of interference peaks on blank human plasma extracts with that of human plasma extracts spiked with 1 μg/mL 5-AzaC. Comparing Figure 3.7 with
Figure 3.10, there was no interference peak observed for 5-AzaC. Thus, this method is specific for the quantification of 5-AzaC.
3.4.3 Method validation
The LC-MS/MS method was validated in human plasma. The intra- and inter-day precision, expressed as %CV are summarized in Table 3.1. The within-day coefficients of variation (CVs, n=6) were 13.18%, 16.76%, 15.94%, 9.9%, for 5-AzaC at 1, 5, 50, 500 ng/mL, respectively. The between-day CVs (n=6) were 17.99%, 14.38%, 7.75%, 2.36%,
5-AzaC at 1, 5, 50, 500 ng/mL, respectively. The within-day accuracy values were
74 118.83%, 110.74%, 105.66% and 108.28% for 5-AzaC at 1, 5, 50, 500 ng/mL,
respectively. As shown in Figure 3.11, a good linear regression curve was found at the
concentration range from 1 to 20 ng/mL and from 20 to 500 ng/mL with a regression
coefficient (r2) > 0.99.
3.5 Discussion
In order to successfully quantify the 5-AzaC in human plasma, sample isolation and
clean-up during sample preparation is necessary. In previous studies with decitabine
(145), the Oasis MCX SPE cartridge was used to extract decitabine from plasma due to
its selectivity and good recovery. We employed this extraction column and obtained
acceptable precision and accuracy for 5-AzaC quantification. This cation-exchange
cartridge retained 5-AzaC and water soluble impurities and proteins in human plasma
were first removed by elution with 0.1 N hydrochloric acid. Sequential elution with 50%
and 100% methanol removed lipid soluble molecules. Finally, 5-AzaC was eluted from
the sorbent with 5% ammonium hydroxide.
5-AzaC, due to its hydrophilic property, cannot be retained efficiently on a typical
reversed-phase HPLC column, such as a Vydac C18 peptidemass. However, the recently
developed Hypersil Aquasil C18 column (Thermo Hypersil-Keystone), due to its unique
hydrophilic end-capping, has been found to provide better retention for polar compounds
like decitabine (145). We have successfully used this column and obtained good
75 resolution. During the assay development, a modifier in the mobile phase buffer needed to be used to facilitate 5-AzaC retention on reversed-phase columns, most importantly,
with sufficient volatility compatible with mass spectroscopy. We adapted the HPLC conditions of Liu, Z et al. (145) and chose the 10 mM ammonium formate as a volatile
modifier in the mobile phase buffer. Initially, we tested 10 mM ammonium formate
containing 5% methanol as an isocratic mobile phase. However, some interference peaks
in blank human plasma extracts existed and overlapped with the 5-AzaC peak using an
ion transition at 245.10>113.16. The retention time for these peaks (one or many) was
observed at 7.5 min. These interference peaks were identified as cytidine and uridine
based on the molecular weight of these endogenous nucleosides. Although these
nucleosides remain low in the human plasma extracts, they may affect the quantification
of 5-AzaC at low concentrations. It was difficult to remove these interfering species
during sample preparation due to their similar chemical and physical properties to 5-
AzaC. The molecular weights of isotopic cytidine and uridine peaks are the same as that of 5-AzaC. In addition, the collision-induced dissociation (CID) mass spectrum of the ions of the interference substances produce the same fragment ion as 5-AzaC. Thus, it is not feasible to achieve a good resolution by mass spectrometry. However, the nucleobase structures of cytidine, uridine and 5-AzaC are different and these differences may provide possible separation on HPLC column chromatography under appropriate conditions.
Based on our previous experience, lowering organic solvent content in the mobile phase may improve chromatographic resolution. Therefore, in order to improve the separation
76 and resolution of 5-AzaC, different compositions of ammonium formate and methanol
were tested. Ten mM ammonium formate containing 1% methanol was found as the
optimal mobile phase composition and this mobile phase produced good resolution of 5-
AzaC from other components. The retention time for 5-AzaC was slightly lengthened to
9.4 min. Compared to the previously reported HPLC-MS/MS method (72), our isocratic
HPLC program produced a better resolution of 5-AzaC from its interference peaks in plasma, higher signal intensity, and shorter run time.
This method did not utilize decitabine as the IS because of its instability in water and human plasma. It is reported that decitabine decomposed rapidly in human plasma at
24°C and 37°C (145). After 6 h, about 10%, 40% and 70% of decitabine decomposed at
4°C, 24°C and 37°C in human plasma, respectively. The decomposition studies of decitabine indicated that the N5, C6-double bond on the base of decitabine may become
hydrated in water and human plasma and exists as open-ring N-formyl or closed-ring
form (145). Therefore, decitabine is not an ideal internal standard for 5-AzaC
quantification. However, its reduced analog, dihydro-decitabine was rather stable.
Saturation of the N5, C6-double bond on the base stablizes decitabine toward
decomposition in human plasma. Thus, the use of dihydro-decitabine as the internal
standard provided a highly reproducible assay, and was successfully validated in human
plasma.
77 3.6 Conclusions
In conclusion, we developed a highly sensitive and specific HPLC-MS/MS analytic
method for quantification of 5-AzaC in human plasma. This method can be applied to
pharmacokinetic studies of 5-AzaC in patients at low doses and the quantification of 5-
AzaC concentration as low as 1 ng/mL, which is 5 times more sensitive than previously
reported methods. Our method provides a simple and rapid quantification of 5-AzaC and may be practical for the analysis of a large number patient samples in clinical trials. Our present study provides a useful tool for future pharmacokinetic/pharmacodynamic
(PK/PD) studies.
78 NH NH 2 2
HN N N N
O O CH OH N CH OH N 2 2 O O
OH OH OH
5-Azacytidine Dihydro-decitabine
Figure 3.1 Chemical structures of 5-azacytidine and its internal standard dihydro- decitabine.
79
Calibration standards were prepared in human plasma by serial dilutions of stocking solution
Load samples on pre conditioned OasisMCXSPE cartridge
Washed with 1.0mL 0.1N HCl, 1.0mL 50% methanol, 1.0mL
methanol, and eluted with 1.0mL 5.0% NH4OH in 95% methanol
Evaporate and reconstitute 100 μL 4°C distilled water and analyzed immediately by LC/MS
Figure 3.2 Method description of sample preparation.
80
A) Full mass scan of decitabine 229.06 + 100 [M+H] 95 90 85 80 75 70 65 60 55 50 45 40
Relative Abundance Relative 35 30 25 242.24 20 15 219.08 230.06 10 225.07 243.24 5 212.11 215.10 220.09 223.09 227.12 231.08 235.06 239.08 246.08 248.08 0 210 215 220 225 230 235 240 245 250 m/z B) Full mass scan of dihydro-decitabine (after reduction)
231.04 + 100 [M+H] 95 90 85 80 75 70 65 60 55 50 45 40
Relative Abundance Relative 35 30 25 245.06 20 211.08 229.11 15 221.09 227.08 232.05 239.06 10 217.04 225.04 215.07 235.05 241.07 246.09 249.08 5 0 210 215 220 225 230 235 240 245 250 m/z Figure 3.3 (A) Full mass spectrum scan (1 min) of 200 ng/mL decitabine in 1%, 10 mM ammonium formate in methanol with direct infusion at 10 μL/min under positive ESI; (B) Full mass spectrum scan (1 min) of 200 ng/mL dihydro-decitabine (after reduction) in 1%, 10 mM ammonium formate in methanol with direct infusion at 10 μL/min under positive ESI.
81
113.14 (A) 100 95 90 NL: 2.21e6 85 80 75 70 65 60 55 50 45 40 35 Relative Abundance 30 25 20 15 10 229.12 5 117.20 126.08 144.36 166.03 187.01 196.95 211.35 247.85 262.45 275.04 294.69 0 100 120 140 160 180 200 220 240 260 280 300 m/z (B) 137.11 100 151.09 95 197.10 90 85 NL: 1.23e3 80 75 169.03 70 161.12 65 176.11 60 123.13 55 179.04 50 45 109.22 40 35 Relative Abundance Relative 30 211.97 183.02 25 20 15 193.80 10 5 214.95 0 223.88 254.81 263.26 284.06 294.41 100 120 140 160 180 200 220 240 260 280 300 m/z Figure 3.4 (A) MS/MS scan (1 min) of decitabine (200 ng/mL) in the mobile phase (1%, 10 mM ammonium formate in methanol) with direct infusion at 10 μL/min under positive ESI; (B) MS/MS scan (1 min) of decitabine after reduction by NaBH4 in 1%, 10 mM ammonium formate in methanol with direct infusion at 10 μl/min under positive ESI.
82
Dihydro-Decitabine (IS) MS/MS Spectra at m/z 231.09+
115.13
+ NH H m/z 231.09 2
HN N
O CH OH N 2 m/z 115.13 O
NL:1.23e6
OH
231.09
100 120 140 160 180 200 220 240 260 m/z Figure 3.5 MS/MS scan (1 min) of dihydro-decitabine in the reduction medium with direct infusion at 10 μL/min under positive ESI.
83
7.20
A) SRM of reduction solution at 12.38 m/z 229.06 → 113.14 7.59 11.91
12.85 NL: 2.47e2
8.04 11.38
13.68
9.99 11.05
8.72
1.36 1.76 2.54 3.09 4.25 5.41 5.99 14.46
0 2 4 6 8 10 12 14 Time (min)
B) SRM of reduction solution at 7.33 m/z 231.04 → 115.13
NL: 1.24e6
0.95 2.46 3.10 4.09 5.28 6.83 10.35 11.42 0 2 4 6 8 10 12 14 Time (min)
Figure 3.6 A) Selective reaction monitoring (SRM) chromatogram of the NaBH4 reduced solution of decitabine at m/z 229.06>113.14. B) Selective reaction monitoring (SRM) of the NaBH4 reduced solution at m/z 231.04>115.13.
84 (A) TIC of blank plasma spiked with 1 9.41 10.89 μg/ml 5-azaC and 50 ng/ml IS NL: 1.07E5 5-azaC Internal Standard (Reduced Decitabine)
0 2 4 6 8 10 12 14 Time (min) 9.41 NL: 2.05E5 (B) SRM of 1 μg/ml 5-azaC at 5-azaC m/z 245.09 →113.11
0 2 4 6 8 10 12 14 Time (min)
10.90 (C) SRM of 50 ng/ml IS at Internal Standard NL: 2.02E5 m/z 231.09 → 115.13 (Reduced Decitabine)
0 2 4 6 8 10 12 14 Time (min) Figure 3.7 A) Total ion chromatograph (TIC) of bank plasma spiked with 1 μg/mL 5- AzaC and 50 ng/mL internal standard; B) Selective reaction monitoring (SRM) of 1 μg/mL 5-AzaC at m/z 245.09>113.11; C) Selective reaction monitoring (SRM) of 50 ng/mL internal standard at m/z 231.09>115.13.
85 [M+H]+
(A) MS of 5-azacytidine 245.02 NL:1.32e7
225 230 235 240 245 250 255 260 m/z
(B) MS of Dihydro-Decitabine [M+H]+ 231.08
NL:2.50e6
225 230 235 240 245 250 255 260 m/z Figure 3.8 (A) An average mass spectrum (1 min) of 10 μg/mL 5-AzaCin 1% 10 mM ammonium formate in methanol with direct infusion at 10 μL/min under positive ESI (B) An average mass spectrum (1 min) of 200 ng/mL dihydro-decitabine in 1% 10 mM ammonium formate in methanol with direct infusion at 10 μL/min under positive ESI.
86
113.11
+ NH H m/z 245.09 2
N N
O CH OH N 2 m/z 113.11 O
OH OH
245.09
100 120 140 160 180 200 220 240 260 m/z Figure 3.9 5-AzaC MS/MS Spectum at m/z 245.09.
87 10.87 (A) TIC of blank plasma spiked with 50 ng/ml IS Internal Standard NL: 8.01E4 (Reduced Decitabine)
12.36 0 2 4 6 8 10 12 14 Time (min) 8.16 NL: 7.55E2 (B) SRM of blank plasma at m/z 245.09 → 113.11 9.18
0 2 4 6 8 10 12 14 Time (min) 10.88 (C) SRM of 50 ng/ml IS at NL: 1.57E5 m/z 231.09 → 115.13
12.37
0 2 4 6 8 10 12 14 Time (min) Figure 3.10 A) Total ion chromatogram (TIC) of bank plasma spiked with 50 ng/mL internal standard. B) Selective reaction monitoring (SRM) in blank plasma at m/z 245.09>113.11. C) Selective reaction monitoring (SRM) of 50 ng/mL internal standard at m/z 231.09>115.13
88
7 y = 0.0124x + 0.0703 2 6 R = 0.9995
5
4 ratio 3
2
1
0 0 100 200 300 400 500 600 concentration (ng/ml)
0.3 y = 0.0140x - 0.0099 R2 = 0.9970 0.25
0.2
ratio 0.15
0.1
0.05
0 0 5 10 15 20 25 concentration (ng/ml) Figure 3.11 Representative standard curves of 5-AzaC in human plasma.
89
Within-day 5-AzaC concentrations (ng/mL): 500 50 5 1 Accuracy (%) 108.28 105.66 110.74 118.83 CVa (%) 9.90 15.94 16.76 13.18 Between-day 5-AzaC concentrations (ng/mL): 500 50 5 1 CVa (%) 2.36 7.75 14.38 17.99 aCoefficient of variation (%)
Table 3.1 The intra- and inter-day validation of the quantification method of 5-AzaC in human plasma (n=6).
90 CHAPTER 4
A SENSITIVE AND SPECIFIC HPLC/UV ASSAY FOR THE QUANTIFICATION OF INTRACELLULAR ARACYTIDINE TRIPHOSPHATE (ARA-CTP)
4.1 Abstract
Aracytidine (Ara-C), one of the most effective anticancer agents for the treatment of acute myleoid leukemia (AML), inhibits DNA synthesis following its intracellular phosphorylation to its active metabolite aracytidine triphosphate (Ara-CTP). The determination of intracellular Ara-CTP is therefore of primary importance for monitoring the effect following drug treatment. The purpose of this study was to develop and validate a non-radioactive, sensitive and specific HPLC/UV method to quantify the intracellular Ara-CTP level to characterize the accumulation effect of Ara-CTP as a single drug or in combination treatment with other agents. Separation of Ara-CTP from other dNTPs and NTPs was achieved on a 4.6 × 250 mm partisil 10 SAX column using an isocratic elution with 0.35 M KH2PO4 in 0.15 M KCl aqueous solution as the mobile
phase at a flow rate of 1.5 mL/min. 7-deaza-dGTP was used as the internal standard. The
absorbance of the eluted compounds was determined at 280 nm. The calibration
standards were prepared by spiking various amounts of Ara-CTP and a constant amount
of 7-deaza-dGTP in 0.20 mL of K562 cell lysates (~107 cells). This method was applied
91 to measure the intracellular levels of Ara-CTP in K562 cells following treatment with
Ara-C at different times. Ara-CTP was baseline-resolved from all other intracellular
dNTP and NTPs. The retention times for UTP, dTTP, CTP, dCTP, Ara-CTP, ATP,
dATP, GTP, dGTP, 7-deaza-dGTP were 12.3, 13.7, 13.8, 14.4, 16.3, 20.8, 26.7, 32.9,
37.8, 42.2 min, respectively. Linearity was found between 500 ng/mL, the lower limit of
quantification (LLOQ), and 50 μg/mL in K562 cell lysates using a 50 μL sample injection loop. The within-day coefficients of variation (CVs) for Ara-CTP were found to be 19%, 3.5% and 4.2% at 500 ng/mL, 5 and 50 μg/mL, respectively. The between-day
CVs were 6.8% at the LLOQ and 0.6-1.6% between 5-50 μg/mL. The within-day accuracy values for Ara-CTP were 105.5%, 100.1% and 97.2% at 500 ng/mL, 5 and 50
μg/mL, respectively. In K562 cells, after 4 hrs continuous incubation with 10 μM Ara-C, the intracellular Ara-CTP level rose to 76 pmol/106 cells, fluctuated to 60 pmol/106 cells at 6 hrs and maintained at 60 pmol/106 cells at 24 hrs. A non-radioactive and simple
HPLC-UV method has been developed to measure intracellular Ara-CTP level in K562 cells. The intracellular levels in K562 cells were found to sustain following AraC treatment.
4.2 Introduction
Aracytidine (Ara-C) (Figure 4.1) is widely used for the treatment of leukemia, including acute myeloid leukemia (146) and acute lymphocytic leukemia (147). As an isomer of cytosine, Ara-C is transported into cells by the human equilibrative nucleoside
92 transporter (hENT1) (148). Inside the cell, Ara-C undergoes a three-step phosphorylation
(Figure 4.1) to its active anabolite, aracytidine triphosphate (Ara-CTP, Figure 4.2) sequentially by the action of deoxycytidine kinase, UMP-CMP kinase and nucleotide diphosphate kinase (149). In vivo studies indicated that Ara-C can be deaminated by cytidine deaminase, resulting in the production of its major metabolite catabolite, uracil arabinoside (Ara-U, Figure 4.1) (150). As the only active metabolite of Ara-C, Ara-CTP competes with intracellular deoxycytidine triphosphate (dCTP) and can further incorporate into DNA, leading to inhibition of DNA synthesis, induction of DNA single stand breakage, and chromosome damage, and cell death (85,86). A significantly higher dose of Ara-C administered in short infusion compared to the standard dose of Ara-C model was proposed by Momparler in 1974 (151). This strategy has been extensively applied in the clinic and has shown excellent therapeutic effect in patients with acute leukemia (152-155). In vitro studies also supported the notion that high dose Ara-C treatment could overcome drug resistance induced by increased deamination and decreased phosphorylation of Ara-C (156). However, clinical data indicated that peak plasma concentration or plasma levels of Ara-C during treatment did not correlate with toxicity or response (90,91). In addition, cerebrospinal fluid levels of Ara-C were found not to correlate with neurological toxicity or clinical response in leukemia patients (91).
In contrast, intracellular accumulation and retention of its active metabolite, Ara-CTP, were found to closely correlate with the therapeutic effect (94,157,158). Plunkett et al. has reported that a longer duration of remission and higher rate of complete remission
93 correlated with prolonged Ara-CTP retention in the cells (159). Additionally, a reduction
in intracellular Ara-CTP level has been found to be an important factor for chemo-
resistance in patients with acute myeloid leukemia (160). The determination of
intracellular Ara-CTP is, therefore, of paramount importance for monitoring the effect of
drug treatment and designing the optimal dose regimen of Ara-C therapy in the clinic.
More importantly, the quantification of Ara-CTP inside the cell (IC) plays an important role in combination studies of Ara-C with ribonucleotide reductase inhibitors, such as trimidox, since these agents enhance the intracellular Ara-CTP level (161,162).
A number of high-performance liquid chromatographic (HPLC) methods have been
reported to quantify intracellular Ara-CTP levels (96,97,163-167). These assays,
however, suffer from several disadvantages: (1) they require gradient elution for sample
analysis with a long elution and re-equilibration time, causing baseline drifts (96,97,163-
165); (2) they require elevated column temperatures (166,167), which reduce column life;
(3) they utilize radio-labeled Ara-CTP to improve sensitivity, which renders more
complex sample handling; (4) none of these methods employs an internal standard for the
assay and this would impart large variation in Ara-CTP quantifications. In addition, Ara-
CTP is the isomer of CTP which poses a significant challenge in achieving good
resolution between these two compounds. In view of these disadvantages, we developed a non-radioactive, sensitive and specific HPLC/UV method to quantify intracellular Ara-
CTP levels. An isocratic elution system at an ambient column temperature was thus
94 employed with the use of an internal standard. This method has been applied to
characterize the accumulation effect of Ara-CTP in K562 leukemia cells and can be used in single drug therapy or in combination with other agents. The development of this specific, sensitive and reliable method to determine intracellular Ara-CTP level also greatly expands the knowledge of biochemical and clinical pharmacology of Ara-C.
4.3 Experimental Method
4.3.1 Chemicals and reagents
Aracytidine 5’-triphosphate (Ara-CTP) was purchased from Jena Bioscience (Jena,
Germany). 7-Deaza-2’-deoxyguanosine 5’-triphosphate lithium salt (7-deaza-dGTP,
Figure 4.2), aracytidine (Ara-C), ammonium phosphate monobasic (NH4H2PO4), potassium chloride (KCl) and potassium phosphate monobasic (KH2PO4) were obtained
from Sigma-Aldrich (St. Louis, MO, USA). All dNTP standards, 2’-deoxyadenosine 5’-
triphosphate (dATP), 2’-deoxythymidine 5’-triphosphate (dTTP), 2’-deoxyguanosine 5’-
triphosphate (dGTP), 2’-deoxycytidine 5’-triphosphate (dCTP) and NTP standards,
adenosine 5’-triphosphate (ATP), uridine 5’-triphosphate (UTP), guanosine 5’-
triphosphate (GTP) and cytidine 5’-triphosphate (CTP) were purchased from Sigma (St.
Louis, MO, USA). Disodium EDTA was purchased from Invitrogen (Invitrogen Corp.,
Rockville, MD, USA). HPLC grade methanol was purchased from Fisher Scientific
95 (Pittsburgh, PA, USA). Deionized water for HPLC analysis was obtained from a Milli-Q
system (Millipore, Bedford, MA, USA).
4.3.2 Cell culture
Human leukemia K562 cells were used to produce cell matrices for calibration
curve preparation. K562 cells were cultured in RPMI 1640 media supplemented with L-
glutamine (Comprehensive Cancer Center, the Ohio State University, Columbus, Ohio),
1% Penicillin-Streptomycin (Gibco, Rockville, MD) and 10% fetal bovine serum (FBS)
(Invitrogen, Rockville, MD). The cell line was maintained at 37 °C in a humidified
environment with 5% CO2. Trypan blue dye and a hemocytometer were used to determine cell counts.
4.3.3 Nucleotide extraction
Intracellular Ara-CTP was extracted using 60% methanol. All the extraction
processes were performed on ice. Briefly, cells were counted and monitored for viability
with trypan blue dye before extraction. Cell pellets were washed with phosphate buffered
saline (PBS) and deproteinized with 1 mL 60% methanol. The resulting mixture was
vortex-mixed for 20 s, left at -20 °C for 30 min, then sonicated for 15 min in an ice bath.
Cell extracts were centrifuged at 1000 g at 4 °C for 5 min. The supernatants were
separated and dried under a stream of nitrogen. The residues were reconstituted with 100
96 μL deionized water and vortex-mixed for 20 s. After membrane-filtration, a 50 μL aliquot was then injected into the HPLC system for Ara-CTP measurement.
4.3.4 Instrumentation
The HPLC-UV system consisted of a Shimadzu HPLC system with two LC-10AT vp pumps, one SIL-10AD autosampler and one SPD-10A PDA detector (Shimadzu,
Columbia, MD). All instrument control and data process were performed using EZStart software in a Windows NT 4.0 system (7.2.1 version, Shimadzu).
4.3.5 HPLC chromatography
HPLC-UV was use to characterize the retention times of Ara-CTP and its internal standard 7-deaza-dGTP on a Partisil-10 SAX anion-exchange, 4.6 mm×25 cm, 10 μm particle size column (Whatman, Inc., Clitton, NJ) coupled to a 5 μm SAX hypersil 10×4 mm drop-in guard column (Thermo Scientific, San Jose, CA). Mobile phase consisted of
0.35 M KH2PO4 and 0.15M KCl in ultra-pure water. An isocratic program was used for the separation of Ara-CTP and 7-deaza-dGTP at a flow rate of 1.5 mL/min. Elution was carried out at room temperature and mobile phase was degassed prior to use. The injection volume was 50 μL. To assure the stability of cell extracts during sample analysis, autosampler temperature was set at 4 °C throughout the analysis. The ultraviolet
97 absorbance of eluted compounds was monitored at 280 nm by SPD-10A detector. Peak areas or peak heights were quantitated with EZStart software.
4.3.6 Calibration standards preparation
The stock solution of Ara-CTP was prepared by diluting the commercially available
Ara-CTP standards (5 mg/mL) with ultra-pure water to a final concentration of 500
μg/mL. This standard stock solution was further diluted serially to prepare calibration standards containing 50, 20, 10, 5, 2, 1, 0.5, 0.2 μg/mL of Ara-CTP in an 0.20 mL cell matrices (equivalent of 107 cells) and spiked with a constant amount of the internal standard (7-deaza-dGTP, 25 μM). One mL of 60% methanol was added each standard solutions. The resulting solutions were vortex-mixed for 20 s, left at -20 °C for 30 min and sonicated for 15 min in an ice bath. Cell extracts were centrifuged at 1000 g for 5 min at 4 °C. Supernatants were separated and dried under a stream of nitrogen. The residues were reconstituted with 100 μL of ultra-pure water and vortex-mixed for 20 s.
Cell extracts were centrifuged at 1000 g for 5 min at 4 °C. After membrane-filtration, a
50 μL aliquot of the resulting supernatants was then injected into the aforementioned
HPLC/UV system for Ara-CTP measurement.
4.3.7 Method validation
98 The linearity was assessed in the concentration range of 0.2 (2 pmol/106 cell)-50
μg/mL (500 pmol/106 cell) of Ara-CTP in cellular matrices. Within-day and between-day
accuracy and precision were determined at 0.5 (5 pmol/106 cell, low quality control,
LQC), 5 (50 pmol/106 cell, medium quality control, MQC), and 50 μg/mL (500 pmol/106 cell, high quality control, HQC). These QC samples from 0.5-50 μg/mL were chosen because they covered the expected lower and upper limits of Ara-CTP in leukemia cells of patients treated with Ara-C based on previous studies (165,168-171). The within-day precision was determined with 6 replicates of each independently processed QC sample, and the between-day precision was determined across three QCs at 6 different days. The accuracy was assessed by comparing the nominal concentrations with the corresponding calculated concentrations based on the calibration curve. The precision of the assay was calculated by comparing the standard deviation (SD) of the determined concentrations.
The specificity of assay was evaluated by comparing the retention times of blank cell matrices with that spiked with 10 μg/mL Ara-CTP and 25 μM of the internal standard.
4.3.8 Determination of intracellular Ara-CTP level after Ara-C treatment in human
K562 leukemia cells
10×106 K562 cells were treated with 10 μM Ara-C for 0, 1, 2, 3, 4, 6, 8 and 24
hours. After treating with trypan blue dye and counting with a hemocytometer, cells were
99 centrifuged and pellets were washed three times with cold PBS. Ara-CTP was extracted
and determined as described in the Method Section.
4.3.9 Calculation and statistical analysis
The linearity of calibration curves were evaluated by unweighted least-squares
linear regression analysis. Using Microsoft Excel software version 7.0 (Microsoft Inc.,
Redmond, WA), the experimental data points (concentrations versus ratio of peak area or
peak height of the analyte over the internal standard) were fitted to a equation: y = ax + b where a is the slope, b is the intercept, x is concentration and y is the ratio of peak area of the analyte over the internal standard. The unknown concentrations of intracellular Ara-
CTP were calculated by substitution of the ratio of peak area or peak height of the analyte over internal standard into y and solve for x. The standard deviation and coefficient of variation were obtained.
4.3.10 Chromatographic characteristics
In order to evaluate the separation of Ara-CTP from its endogenous intracellular nucleotides. Standard mixture solutions containing CTP and Ara-CTP (Mixture 1) or dCTP and Ara-CTP (Mixture 2) were eluted through the column. Resolution and column efficiency were assessed based on following equations: t0=Vm/F
100 phase stationaryin solute ofAmount ofAmount solute stationaryin phase K’= phase mobilein solute ofAmount ofAmount solute mobilein phase
− tt = R 01 t0
centerpeak ebetween th Distance th ebetween centerpeak Rs= bandwith baseline Average baseline bandwith
− tt =1.198* RR 12 + ww )2(2/1)1(2/1
CB As= AC
2 ⎛ t ⎞ N=5.54*⎜ R1 ⎟ ⎜ ⎟ ⎝ w )1(2/1 ⎠
L H= N
Where t0 is the dead time of guard and analytical column; Vm is the void volume which does not include retained solvent; F is flow rate; K’ is the capacity factor of Ara-CTP; tR1 is the retention time of Ara-CTP; Rs is the resolution between two analytes; As is a measurement of the peak shape; CB is the peak width at 10% peak height to the right with respect to the perpendicular; AC is the peak width at 10% peak height to the left with respect to the perpendicular; tR2 is the retention time of CTP or dCTP; w1/2(1) is the
peak width at half-height of Ara-CTP; w1/2(2) is the peak width at half-height of CTP or
101 dCTP; N is the theoretical plate number; L is the length of column and H is the theoretical plate height.
4.4 Results
4.4.1 HPLC chromatography
The successful separation of Ara-CTP from naturally occurring nucleosides, nucleotides and other substances in the cell was achieved. Ara-CTP and its internal standard 7-deaza-dGTP were baseline-resolved from all other intracellular dNTP and
NTPs. As shown in Figures 4.3 and 4.4, UTP was eluted about 4 min earlier than Ara-
CTP, while dTTP, CTP and dCTP were eluted about 3 min earlier than Ara-CTP. This was followed by Ara-CTP, ATP, dATP, GTP, dGTP and IS which were eluted sequentially. The retention times for UTP, dTTP, CTP, dCTP, ATP, dATP, GTP and dGTP were 12.3, 13.7, 13.8, 14.4, 20.8, 26.7, 32.9, 37.8 min, respectively. Following
spiking with 10 μg/mL Ara-CTP and 25 μM 7-deaza-dGTP, the retention times for Ara-
CTP and 7-deaza-dGTP were identified at 16.3 and 42.2 min, respectively.
4.4.2 Specificity
Ara-CTP was not co-eluted with other deoxyribonucleotides (dNTPs) and ribonucleotides (NTPs) in mobile phase or in cell extracts (Figures 4.3 and 4.4). As
shown in Figure 4.3A, no peak was observed at 16.3 min in the cell extract. However,
after spiking with 10 μg/mL Ara-CTP (Figure 4.3B), a new peak was detected at that
102 time. This peak was identified as Ara-CTP, after we compared it with the peak of Ara-
CTP in mobile phase as shown in Figure 4.4A. Similarly, the peak of the internal
standard was found (7-deaza-dGTP) not to overlap with other endogenous substance in
the cell matrix as shown in Figure 4.3B, nor did it overlap with other nucleotides as shown in Figure 4.4B (based on its retention time).
4.4.3 Chromatographic characteristics
Resolution and column efficiency were evaluated based on the equations listed in the Method Section. As shown in Table 4.1 and Figure 4.5, the capacity factor of Ara-
CTP is 7.29. Resolutions of CTP versus Ara-CTP and dCTP versus Ara-CTP are 2.01
and 1.06, respectively. The asymmetry factor of Ara-CTP is 1.10. The theoretical plate number and height for the column are 3059 and 81 μm, respectively.
4.4.4 Linearity
Excellent linearity of the Ara-CTP assay was found between 500 ng/mL, the lower limit of quantification (LLOQ) and 50 μg/mL in K562 cell lysate, using the 50 μL sample injection loop and the result is shown in Figure 4.6. As shown, a calibration curve obtained using peak area ratios between Ara-CTP and the internal standard gave a regression coefficient of 0.999. Because of the good peak symmetry, peak height could be used to construct the calibration curve (data not shown).
103 4.4.5 Method validation
The within-day coefficients of variation (CVs) for Ara-CTP were 19%, 3.5% and
4.2% at 500 ng/mL, 5 and 50 μg/mL, respectively. The between-day CVs were 6.8% at
LLOQ and 0.6-1.6% between 5-50 μg/mL for Ara-CTP. The within-day accuracy values
for Ara-CTP were 105.5%, 100.1% and 97.2% at 500 ng/mL, 5 and 50 μg/mL,
respectively, based on six replicates as shown in Table 4.2.
4.4.6 Intracellular Ara-CTP accumulation
When K562 cells were treated with 10 μM of Ara-C for 24 hrs, a maximum
intracellular concentration of Ara-CTP at 6.96 ± 2.22 μg/mLwas achieved after 4 hrs
(Figure 4.7). The Ara-CTP level was sustained for 24 hrs at a steady-state concentration
around 6.5 μg/mL.
4.5 Discussion
The biggest challenge in quantification of Ara-CTP in cell extracts is to separate
Ara-CTP from naturally occurring CTP and dCTP that have their similar structures and
chemical properties. We first adapted the method developed by Plunkett et al. (96) using
our Shimadzu HPLC system. However, no resolution between CTP, dCTP and Ara-CTP
was observed and this problem was probably due to differences in the gradient elution
program with a different HPLC instrument (Waters Associate for the published method).
104 Even though the intracellular dCTP level is relatively low compared to CTP, the overlap
of dCTP and Ara-CTP peaks would compromise an accurate quantification of
intracellular Ara-CTP levels. We therefore evaluated an ion-pair HPLC method
developed by Schilsky, R et al. (97). However, severe base line drift occurred during
sample analysis. After several attempts, we achieved a good separation of Ara-CTP from
dNTPs and NTPs using an isocratic elution system. The mobile phase selected consisted of 0.35 M KH2PO4 and 0.15M KCl.
During the course of the assay development, we noticed that none of the published
methods of quantification of intracellular Ara-CTP utilized an internal standard. It is
essential to employ an internal standard to accurately quantify Ara-CTP in cells because
of sample loss during sample workup. Hence, we sought a suitable internal standard for
Ara-CTP quantification. An ideal internal standard should meet the following criteria: (1) the chemical and physical properties of internal standard should resemble Ara-CTP as closely as possible; (2) the internal standard and Ara-CTP should be baseline resolved
from each other and from other nucleotides and substance in the cell extracts during
chromatography; (3) the internal standard should be eluted at a retention time that is close
to Ara-CTP and other substances in the cell extracts. Considering all these criteria, we
found 7-deaza-2’- deoxyguanosine-5’-triphospate (7-deaza-dGTP) to be a good candidate
as the internal standard in intracellular Ara-CTP quantification. As shown in Figures
4.4B, 7-deaza-dGTP was eluted after dGTP. More importantly, 7-deaza-dGTP was
105 baseline resolved chromatographically from Ara-CTP and all other intracellular nucleotides and substances. Therefore, 7-deaza-dGTP was identified as the internal standard in the Ara-CTP measurement.
As shown in Figure 4.3, both Ara-CTP and 7-deaza-dGTP were baseline separated from other components in the cell extracts. The resolutions of Ara-CTP and CTP or dCTP are all greater than 1.5 which indicated baseline resolution is achieved. The asymmetry factor of Ara-CTP is between 0.9 and 1.2 which suggested good peak symmetry. Therefore, peak height can also be used in calculating the ratio of analyte versus internal standard. The theoretical plate number is 3059 and theoretical plate height is 81 μm which indicated that the column is efficient.
This method was applied to analyze intracellular Ara-CTP accumulation in K562 cells following treatment with 10 μM Ara-C exposure for 24 hr. The results indicated that the Ara-CTP level in cells can be retained for up to 24 hr. The maximum Ara-CTP accumulation was achieved after 4 hr which provided important information for future combination studies of Ara-C with other drugs in vitro.
4.6 Conclusion
A non-radioactive, sensitive and specific HPLC/UV method to quantify intracellular Ara-CTP level has been developed and its application to pharmacological
106 studies in human leukemic K562 cells following Ara-C treatment has been demonstrated.
This assay could also be used in clinical pharmacokinetic studies of intracellular Ara-
CTP in patients. The successful development of this assay provides us a useful tool to further explore the mechanism and clinical pharmacology of Ara-C.
107
Parameters Value
K’ (capacity factor of Ara-CTP) 7.29
Rs (resolution) of CTP/Ara-CTP 2.01
Rs (resolution) of dCTP/Ara-CTP 1.60
As (asymmetry factor) of Ara-CTP 1.10
N (theoretical plate number) 3059
H (theoretical plate height) 81 μm
Table 4.1 Relevant chromatographic parameters
108
Concentration (ug/ml)
Within-day 0.5 5 50 Accuracy 105.5 100.1 97.2 CV%a 19.1 3.5 4.2 Between-day Accuracy 97.5 100.7 100.4 CV%a 6.8 1.6 0.6 aCoefficient of variation
Table 4.2 Within-day and between-day validation data in 107 K562 cell lysate (n=6)
109 R3
N
N O HO O
R1
OH R2
Figure 4.1 Structures of Ara-C (R1=OH, R2=H, R3=NH2), Ara-U (R1=OH, R2=H, R3=O), deoxycytidine (R1=H, R2=H, R3=NH2) and cytidine (R1=H, R2=OH, R3=NH2).
110
(A) NH2
N
O O O O N HO P O P O P O
OH OH OH
H H O O
OH
(B) O
NH
NH2 O O O N N HO P O P O P O OH OH OH
OH
Figure 4.2 Structures of Ara-CTP and its internal standard 7-deaza-dGTP.
111
(A) 10 dTTP CTP UTP 8 ATP
dCTP GTP 6
4 mAU 2
0
-2
-4
0 5 10 15 20 25 30 35 40 45 Minutes
(B) 10 SPD-10Avp Ch1-280nmdTTP CTP UTP 8 dCTP Ara- ATP 7-deaza- 6 CTP GTP dGTP
4 mAU 2
0
-2
-4
0 5 10 15 20 25 30 35 40 45 Minutes
Figure 4.3 (A) Representative HPLC chromatogram of lysate of 107 K562 cell; (B) Representative HPLC chromatogram of lysate of 107 K562 cell spiked with 10 μg/ml Ara-CTP and 10 μg/ml 7-deaza-dGTP.
112
A 10
8 CTP dCTP dTTP 6 Ara-CTP 4 UTP GTP ATP dATP dGTP mAU 2
0
-2
-4
0 5 10 15 20 25 30 35 40 45 Minutes B 10 CTP dCTP 8 dTTP
6 7-deaza-dGTP
4 UTP ATP dATP GTP dGTP mAU 2
0
-2
-4
0 5 10 15 20 25 30 35 40 45 Minutes
Figure 4.4 A) Representative HPLC chromatogram of 10 μg/ml Ara-CTP and 10 μg/ml mixture of dNTP and NTPs in mobile phase (20 μl injection); B) Representative chromatogram of 25 μM 7-deaza-dGTP and mixture of dNTP and NTPs in mobile phase (20 μL injection).
113
(A)
10 SPD-10Avp Ch1-280nm
8
6 dCTP
4 Ara-CTP mAU 2
0
-2
-4
0 5 10 15 20 25 30 35 40 45 Minutes
(B)
10
8
CTP 6
Ara-CTP 4 mAU 2
0
-2
-4
0 5 10 15 20 25 30 35 40 45 Minutes Figure 4.5 (A) Representative HPLC chromatogram of 10 μg/mL Ara-CTP and 10 μg/mL dCTP in mobile phase (20 μL injection); (B) Representative HPLC chromatogram of 10 μg/mL Ara-CTP and 10 μg/mL CTP in mobile phase (20 μL injection).
114
A)
Ara-CTP-Area y = 0.1422x - 0.0456 R2 = 0.9995 8
7
6
5
4 ratio 3
2
1
0 0 102030405060 concentration (ug/ml)
B)
Ara-CTP-Height y = 0.3399x - 0.1051 R2 = 0.9995 18 16
14 12 10
8 ratio 6
4 2 0 0 102030405060 -2 concentration (ug/ml)
Figure 4.6 (A) A representative calibration curve of Ara-CTP calculated using peak area; (B) a representative calibration curve of Ara-CTP calculated using peak height.
115
Ara-CTP Accumulaiton
10 9 8 7 6 5
4 3 concentration (ug/ml) concentration 2 1 0 0 5 10 15 20 25 30 time (hr)
Figure 4.7 Time course of cellular accumulation of Ara-CTP after 10 μM of Ara-C was incubated with K562 cells for 1, 2, 3, 4, 6, 8, 12, 24 hours.
116 CHAPTER 5
A HIGHLY SENSITIVE AND SPECIFIC LC-MS/MS ASSAY FOR THE QUANTITATION OF DECITABINE-TRIPHOSPHATE IN CELL EXTRACT
5.1 Abstract
The hypomethylating agent, decitabine (DAC), possesses a dual mechanism of action following its intracellular phosphorylation to its active metabolite decitabine triphosphate (DAC-TP). At low doses (i.e., 5-20 mg/m2/day), it has been found to reactivate silenced genes, such as tumor suppressive genes p15 and p17; at high doses
(i.e., 50-100 mg/m2/day), it induces cytotoxcity. The determination of intracellular DAC-
TP is important for monitoring the effect of drug treatment. The purpose of this study was to develop a non-radioactive, sensitive and specific HPLC-MS/MS method to simultaneously quantify intracellular DAC-TP and dNTP levels. Separations of DAC-TP, dNTP and its internal standard 2-chloroadenosine-5’-triphosphate (ClATP) (IS) from the endogenous interfering substances in leukemia K562 cell extracts were achieved on a
Supelcogel ODP-50 column, using a gradient elution with pH 7.0, 5 mM N, N-dimethyl- n-hexylamine (DMHA) and 50% acetonitrile at a flow rate of 0.2 mL/min. An ion trap mass spectrometer was used to measure DAC-TP and dNTPs using a negative ion electro-spray mode. The following multiple reaction monitors (MRMs) at m/z
117 467.1→369.0, 490.1→392.1, 466.0→368.1, 481.0→383.1, 540.0→441.9 were used for
DAC-TP, dATP, dCTP, dTTP, and the internal standard 2-chloroadenosine-5’-
triphosphate (ClATP), respectively. Linearity was demonstrated between 50 nM, the
lower limit of quantification (LLOQ), and 10 μM in K562 cell lysates. The within-day
coefficients of variation (CVs, n=6) were found to be between 14.2-19.9% at LLOQ and
4.7-7.0% between 500-5000 nM for DAC-TP and dNTPs. The between-day CVs (n=3) were 7.5-15.6% at LLOQ and 7.5-18.9% between 500-5000 nM for DAC-TP and dNTPs.
The within-day accuracy values were 83.7-115.6% for both DAC-TP and dNTPs. The application of this method for determination of intracellular DAC-TP following
decitabine treatment is ongoing.
5.2 Introduction
Decitabine (DAC) (Fig 6.1), a DNA hypomethylating agent, possesses a wide range
of antitumor activities in treatment of myelodysplastic syndrome (MDS), myeloid
leukemia, and other forms of neoplasia (75,172-174). Pharmacologically, decitabine
possesses a dual mechanism of action. At low doses (i.e., 5-20 mg/m2/day), it has been
found to reactivate silenced genes, such as tumor suppressive genes p15 and p17
(4,5,77,175); at high doses (i.e., 50-100 mg/m2/day), it possesses antileukemia activities
(2,3,101). Human equilibrative nucleoside transporter (hENT1) was found to be involved
in the transport of decitabine across cell membranes (83). Inside the cell, decitabine
undergoes a three-step phosphorylation to its active anabolite, decitabine triphosphate
118 (DAC-TP, Fig. 6.1) by the sequential action of deoxycytidine kinase, deoxycytidine monophosphate kinase and nucleotide diphosphate kinase (101). DAC-TP competes with the intracellular deoxycytidine triphosphate (dCTP) for incorporation into DNA, and once incorporated, DAC-TP traps DNA methyltransferase, leading to hypomethylation and gene reactivation (101). The determination of intracellular DAC-TP is, therefore, of paramount importance for monitoring the effect of DAC treatment. To date, no information of the intracellular level of DAC-TP has been reported due to the lack of an analytical method. The present study develops a technique that accurately quantifies intracellular DAC-TP, which would facilitate the understanding of patient’s response or resistance to decitabine in the clinic.
5.3 Method
5.3.1 Chemicals and reagents
DAC-TP was obtained from Jena Bioscience (Jena, Germany). All dNTP standards,
2’-deoxyadenosine 5’-triphosphate (dATP), 2’-deoxythymidine 5’-triphosphate (dTTP),
2’-deoxycytidine 5’-triphosphate (dCTP), internal standard 2-chloroadenosine-5’- triphosphate (ClATP), N, N-dimethylhexylamine (DMHA) and formic acid (FA, 90%) were purchased from Sigma (St. Louis, MO, USA). HPLC grade methanol and
acetonitrile (ACN) were purchased from Fisher Scientific (Pittsburgh, PA, USA).
Deionized water for HPLC analysis was obtained from a Milli-Q system (Millipore,
119 Bedford, MA, USA). Decitabine was provided by the National Cancer Institute
(Bethesda, MD).
5.3.2 Instrumentation
The HPLC-UV-MS/MS system used consisted of a Shimadzu HPLC system
(Shimadzu, Columbia, MD) and SPD-M10A PDA detector (Shimadzu, Columbia, MD)
coupled to a Finnigan (ThermoFinnigan, San Jose, CA) LCQ ion trap mass spectrometer.
The HPLC system used consisted of two LC-10AT vp pumps, a SIL-10AD autosampler
(Shimadzu, Columbia, MD). Semi-automatic tuning was used to optimize all relevant
parameters with infusion of a mixture of DAC-TP/dNTP solution. The MS2 mass spectra of each DAC-TP and dNTP were acquired at appropriate optimal collision energies.
Instrument control and data processing were performed using XcaliburTM software
(version B, ThermoFinnigan).
5.3.3 HPLC chromatographic and mass spectrometric conditions
The quantification method of dNTP and NTP as discussed in Chapter 2 was adapted
to determine intracellular DAC-TP and dNTP levels. Briefly, the analysis was performed
on a Supelcogel ODP-50, 150×2.1 mm, 5 μm particle size column (Supelco, Sigma-
Aldrich, St. Louis, MO) coupled to a 3.5 μm Waters Xterra MS C18 10×2.1 mm guard
column (Waters Corp., Milford, MA). The eluents consisted of Mobile Phase A (MPA)
consisting of 5 mM DMHA in ultra-pure water buffered to pH 7 by 90% FA and Mobile
Phase B (MPB) consisting of 5 mM DMHA in ACN (50:50, v/v). Gradient program was
120 used for the separation and identification of DAC-TP and dNTPs at a flow rate of 0.2 mL/min. The program was initiated with 0-10% MPB from 0 to 3 min; 10-45% MPB from 3-28 min; 45-0% MPB from 28 to 28.5 min; 0% MPB from 28.5 to 40 min. The injection volume was 50 μL. The autosampler temperature was set at 4 °C throughout the analysis.
The LCQ ion trap mass spectrometer was used to quantify DAC-TP and dNTPs levels with an ESI source operated in the negative ion mode. The electrospray high voltage was set at 3.2 kV and the temperature of the heated capillary was set at 250 °C.
The LCQ ion trap mass spectrometer was performed with a sheath gas flow of 90
(arbitrary unit), an auxiliary nitrogen gas flow of 35 (arbitrary unit) and a capillary
voltage of -30 V. The multiple ion transitions at m/z 467.1→369.0, 490.1→392.1,
466.0→368.1, 481.0→383.1, 540.0→441.9 were used for DAC-TP, dATP, dCTP, dTTP, and the internal standard 2-chloroadenosine-5’-triphosphate (ClATP), respectively, were used in the multiple reaction monitor (MRM) mode. Collision energy values were optimized to 22-25% for these transitions. All mass spectrometry operation was controlled by the Finnigan Xcalibur (Version 1.2) software in a Windows NT 4.0 system.
5.3.4 Cell lines and cell culture condition
121 Human leukemia cell line, K562, was used. The cells were cultured in RPMI 1640
media supplemented with L-glutamine (supplied by Tissue Culture Shared Resource,
Comprehensive Cancer Center, The Ohio State University, Columbus, Ohio), 1%
Penicillin-Streptomycin (Gibco, Rockville, MD) and 10% fetal bovine serum (FBS)
(Invitrogen, Rockville, MD). The cell line was maintained at 37 °C in a humidified
environment with 5% CO2. Trypan blue dye and a hemocytometer were used to determine cell counts.
5.3.5 DAC-TP/dNTPs extraction
Intracellular DAC-TP and dNTP were extracted as described in Chapter 2. Briefly, cells were counted and monitored for viability using trypan blue exclusion test before
extraction. Cell pellets were washed with phosphate buffered saline (PBS) and
deproteinized with an addition of 1 mL 60% methanol. The resulting solution was vortex-
mixed for 20 s, left at -20 °C for 30 min and sonicated for 15 min in ice bath. Cell
extracts were centrifuged at 1000 g for 5 min at 4 °C. Supernatants were separated and
dried under a stream of nitrogen. The residues were reconstituted with 200 μL of Mobile
Phase A and vortex-mixed for 20 s. Cell extracts were centrifuged at 1000 g for 5 min at
4 °C. A 50 μL aliquot of the resulting supernatants was then injected into the
aforementioned LC/MS/MS system for DAC-TP and dNTP measurement.
122 5.3.6 Preparation of cell matrices
Cell matrices were prepared as described in Chapter 2. Briefly, K562 cells (2×108) were harvested and washed two times with ice-cold PBS (supplied by Tissue Culture
Shared Resource, Comprehensive Cancer Center, The Ohio State University, Columbus,
Ohio). Endogenous nucleotides were extracted as described in the Method Section. The residue was reconstituted in 8 mL 4 °C Mobile Phase A. Dephosphorylation of intracellular dNTPs and NTPs was achieved by adding 16 units of acid phosphatase (type
XA, Sigma) as powder and 50 μL of 1 M sodium acetate, pH 4.0, followed by an 1-h incubation at 37 °C. The resulting solution was incubated in a 100 °C water bath for 20 min. The subsequent solution was centrifuged at 1000 g for 5 min after the temperature was returned to room temperature. The supernatant was stored at -80 °C for further calibration standards preparation.
5.3.7 Calibration standards and method validation
All the calibration standards preparation and method validation were performed in cellular matrices prepared as described before. The stock solutions of DAC-TP and dNTP were prepared by mixing the commercially available DAC-TP and dNTP standards with ultra-pure water to a final concentration of 1 mM and stored at -80 °C. The calibration standards were prepared by spiking various amounts of DAC-TP and dNTP mixtures and a constant amount of the internal standard (2-chloroadenosine-5’-triphosphate, ClATP) in
123 0.20 mL of cell matrices. The linearity was assessed in the concentration range of 50 -
10000 nM of mixtures of DAC-TP and dNTP. Within-day accuracy and precision were determined at 50 nM (low quality control, LQC), 500 nM (medium quality control,
MQC), and 5 μM (high quality control, HQC) in 6 replicates each. The between-day precision was determined across three QCs on 3 different days. The accuracy was assessed by comparing the nominal concentrations with the corresponding calculated values based on the calibration curve. The specificity of assay was evaluated by monitoring the MRM of each DAC-TP and dNTP in blank cell matrices coupled to the
HPLC retention times.
5.3.8 Intracellular accumulation of DAC-TP in K562 cells following treatment with DAC
10×106 K562 cells were treated with 2 μM DAC for 0, 1, 4 and 24 hours. After
counting trypan blue dyed treated cells with the hemocytometer, cell pellets were
prepared and washed with ice-cold PBS. DAC-TP and dNTPs were extracted and
determined as described above.
5.3.9 Intracellular accumulation of DAC-TP in patient bone marrow samples
following DAC treatment
124 20×106 patient bone marrow samples were collected at day 1 and day 5 post DAC treatment. Cell pellets were washed with ice-cold PBS. DAC-TP and dNTPs were extracted and determined as described above.
5.4 Results
5.4.1 HPLC-MS/MS assay of DAC-TP and dNTP
The total ion chromatogram (TIC) of blank cell extract spiked with 5 μM dCTP,
DAC-TP, dTTP, dATP and 1.25 μM Cl-ATP (the internal standard) is shown in Figure
5.2. As shown, dCTP was eluted first followed by DAC-TP, dTTP, and dATP. The retention times of DAC-TP, dCTP, dTTP, dATP and IS were 15.21, 15.25, 16.61, 17.70, and 20.33 min, respectively. Although DAC-TP and dCTP was not baseline-resolved, it was expected they would be mass-resolved using MRM, based on their molecular weights and fragmentation patterns. With a direct infusion of a mixture of DAC-TP and dNTP at 10 μL/min for 1 min, the average electro-spray ionization mass spectra of the mixture of 1 μM of DAC-TP, dCTP, dTTP, and dATP exhibited several abundant ions at m/z 467.0, 466.0, 481.0 and 490.0, probably corresponding to their respective deprotonated molecular ions ([MH]-) under negative ionization conditions, as shown in
Figure 5.3. The deprotonated molecular ions were thus selected as the precursor ions and their collision-assisted dissociation (CAD) spectra (Figure 5.4) were subsequently obtained, each showing a predominant daughter ion under the optimized collision energy
125 on the LCQ instrument. The (CAD) spectra (Figure 5.4) of the MH- ions of DAC-TP,
dCTP, dTTP, and dATP exhibited fragment ions at m/z 369.0, 368.1, 383.1 and 392.1,
respectively, corresponding to the removal of a phosphate group (98 Th) from their
precursor ions at the 5’ position. Multiple reaction monitors (MRMs) were used to
perform these transitions and the ion transition at m/z 467.1→369.0, 466.0→368.1,
481.0→383.1, 490.1→392.1, 540.0→441.9 were selected for monitoring of DAC-TP,
dCTP, dTTP, dATP and the ClATP. MRM of blank cell extract at m/z 467.1>369.0
(Figures 5.5 B) did not show significant interference peaks for DAC-TP. However, an
intense peak was observed with MRM of blank cell extract with acid phosphatase
treatment spiked with 5 μM DAC-TP at m/z 467.1>369.0 (Figures 5.5 A), which
indicated good selectivity of this assay.
5.4.2 Assay validations
In order to accurately quantify intracellular DAC-TP and dNTP levels
simultaneously, this assay was validated in K562 cellular matrices. Endogenous dNTPs
present in the cellular matrices were removed by the pretreatment with acid phosphatase
to cleave the triphosphates under the condition as described in the Experimental Section.
As shown in Figure 5.5, no peaks corresponding to dNTPs were observed in the blank
cell extracts, suggesting that all dNTPs in the cell extracts had completely been removed.
As shown in Figure 5.6, good linearity was found for all these DAC-TP and dNTPs in the range of concentration from 50 to 1000 nM and from 1000 to 10000 nM with regression
126 coefficients (r2) > 0.99. The intra- and inter-day precision, expressed as %CV are
summarized in Table 5.1. Three criteria were selected to determine the lower limit of
quantitation (LLOQ): the signal to noise ratio (S/N) of peak area of LLOQ was greater
than 20, the within-day and between-day precision of LLOQ is less than 20% and the
accuracy of LLOQ is between 80-120%. Based on these criteria, the LLOQ of the assay
for DAC-TP was determined to be 50 nM. The within-day coefficients of variation (CVs, n=6) were 19.9%, 19.8%, 19.3% and 14.2% for DAC-TP, dATP, dCTP and dTTP, respectively, at the lower limit of quantitation (LLOQ) 50 nM and 4.7-7.0% between
500-5000 nM for DAD-TP and dNTPs. The between-day CVs (n=3) were 15.2%, 15.2%,
7.5% and 15.6% for DAC-TP, dATP, dCTP and dTTP, respectively, at LLOQ and 7.5-
18.9% between 500-5000 nM for DAC-TP and dNTP. The within-day accuracy values were 83.7-115.6% for both DAC-TP and dNTP.
5.4.3 Intracellular accumulation of DAC-TP in K562 cells following treatment with DAC
As shown in Figure 5.7, in K562 cells, following DAC treatment for 4 hr, the accumulation of DAC-TP reaches its maximum level and is sustained for 24 hr.
Compared to the blank samples, DAC treatment for 4 and 24 hr resulted in a significant increase of intracellular dTTP and dATP levels by more than 2 fold. However, dCTP
127 levels increased by about 60% following DAC-TP treatment for 4 hr and dropped back to
basal level when DAC was treated for 24hr.
5.4.4 Intracellular accumulation of DAC-TP in patient bone marrow samples following DAC treatment
As shown in Figure 5.8, in Patient #1 bone marrow sample, the intracellular
DAC-TP, dTTP and dATP levels were 1.14, 1.48 and 1.39 pmol/106 cells, respectively
following DAC treatment. The intracellular dCTP level in this patient was below the limit
of detection. In Patient #2 bone marrow sample, the intracellular DAC-TP level sustained
until day 5 post DAC treatments. Compared to day 1 post DAC treatment, the
intracellular dTTP and dATP levels in Patient #2 increased by more than 1 fold on day 5.
However, the intracellular dCTP level in Patient #2 decreased by about 20% on day 5
compared to day 1. These data were preliminary in nature and could not be statistically verified.
5.5 Discussion
Decitabine, a deoxycytidine analogue, is a prodrug that requires phosphorylation to its active metabolite, decitabine triphosphate (DAC-TP) after transport into the cell.
DAC-TP competes with dCTP for DNA incorporation. After DNA incorporation, DAC-
TP irreversibly binds to DNA methylation transferase (DNMT), leading to the
128 degradation of DNMT. This decrease of DNMT will further result in reactivation of silenced genes and cell differentiations. Therefore, it is critical to simultaneously quantify
DAC-TP and dNTP so that we can fully understand the pharmacological action of decitabine. The structure and chemical properties of DAC-TP are similar to other endogenous nucleotides, but the molecular weight of parent and daughter ions of DAC-
TP are different. Therefore, a previously developed HPLC-MS/MS method in determination of intracellular dNTP and NTPs was adapted to quantify DAC-TP and dNTP simultaneously in leukemia cells. Although DAC-TP and dNTP were not chromatographically resolved, they were distinguishable using MRM due to their distinct molecular masses and fragmentation patterns.
The matrix effect could pose a considerable challenge in accurate quantification of intracellular DAC-TP level. Although, the total ion chromatograph of cell extracts with or without acid phosphatase treatment did not show an appreciable interference for DAC-
TP, nevertheless, using acid phosphatase-treated K562 cell extracts provides a more robust condition for the assay. The validated assay indicated good selectivity and specificity.
The accumulation studies of DAC-TP in K562 cells indicated that the formation of
DAC-TP may involve a saturation process. In addition, the treatment of DAC will also affect the intracellular dNTP level, which is probably due to the interference of de novo
129 synthesis or salvage pathway of dNTP by DAC-TP formation. The measurement of
intracellular DAC-TP in patient bone marrow samples suggested that the DAC-TP level
in bone marrow cells sustained for at least 5 days. However, more patient samples need
to be tested to study the correlation between intracellular DAC-TP and disease response.
5.6 Conclusion
In conclusion, we have developed a highly sensitive and specific HPLC-MS/MS
analytic method for quantification of DAC-TP and dNTP simultaneously in cell extracts.
This method could be applied for studying treatment outcome and development of
resistance of decitabine in the clinic and also for future planning of biochemical modulation studies of decitabine in combination with other drugs. This method provides
a useful tool for mechanistic studies of drug resistance in clinic. Our present study also provides a simple and quick approach for future pharmacokinetic/pharmacodynamic
(PK/PD) studies.
130
NH2 NH2
N N N N OH OH OH O HO O O N P N CH2OH O P P O O O O O O
OH OH
Decitabine Decitabine triphosphate (DAC-TP)
Figure 5.1 Structures of decitabine and decitabine triphosphate (DAC-TP).
131
DAC-TP dCTP
dTTP
dATP
Cl-ATP (IS)
Figure 5.2 Total ion chromatograph (TIC) of bank cell extract spiked with 5 μM dCTP, DAC-TP, dTTP, dATP and 1.25 μM Cl-ATP (the internal standard).
132
dATP
dCTP
dTTP DAC-TP
Figure 5.3 Full mass scan of a standard mixture 1 μM of dCTP, DAC-TP, dTTP and dATP with a direct infusion at 10μL/min.
133
Dec-TPDAC-TP (467.1(467.1 369.0) dTTP (481.0 383.1)
dCTP (466.0 368.1) dATP (490.1 392.1)
Figure 5.4 Product ion mass spectra of the deprotonated molecular ions of DAC-TP and dNTPs.
134
A) B) DAC-TP NL: 3.21E3 DAC-TP NL: 5.92E2 100 100 0 0 0 10 20 30 40 0 10 20 30 40 Time (min) Time (min) dTTP dTTP NL: 1.74E3 NL: 3.18E2 100 100 0 0 0 10 20 30 40 0 10 20 30 40 Time (min) Time (min) dATP dATP NL: 2.15E3 NL: 4.12E2 100 100 0 0 0 10 20 30 40 0 10 20 30 40 Time (min) Time (min) dCTP dCTP NL: 2.80E3 NL: 4.44E2 100 100 0 0 0 10 20 30 40 0 10 20 30 40 Time (min) Time (min)
Figure 5. 5 A) The multiple reaction monitoring (MRM) mass spectra of DAC-TP and dNTPs, 50 nM each, spiked into acid phosphatase-treated blank K562 cell extracts. B) The multiple reaction monitoring (MRM) mass spectra of DAC-TP and dNTPs in blank acid phosphatase-treated K562 cell extracts.
135 A. 0.4 DAC-TP 0.35 dTTP 0.3 dATP 0.25 dCTP 0.2 ratio 0.15
0.1
0.05
0 0 200 400 600 800 1000
concentration (nM)
B. 4 DAC-TP 3.5 dTTP 3 dATP 2.5 dCTP 2 ratio 1.5
1
0.5
0 0 2000 4000 6000 8000 10000 concentration (nM)
Figure 5.6 A) Standard curves of DAC-TP and dNTPs. Linearity was found between 50 nM, the lower limit of quantification (LLOQ), and 1 μM in K562 cell lysate; B) standard curves of DAC-TP and dNTPs. Linearity was found between 1 μM and 10 μM in K562 cell lysate.
136
DAC-TP level in K562 Cells dTTP level in K562 Cells
3.00 60.00 * 2.50 50.00
2.00 40.00 1.50 Sensitive 30.00 * Sensitive 1.00 20.00
0.50 10.00 Amount (pmol/10^6 cells) Amount (pmol/10^6 cells) 0.00 0.00 1 hr 4 hr 24 hr 0 hr 1 hr 4 hr 24 hr Time (hr) Time (hr)
dATP level in K562 Cells dCTP level in K562 Cells
20.00 3.00 * 18.00 * 16.00 2.50 14.00 2.00 12.00 * 10.00 Sensitive 1.50 Sensitive 8.00 6.00 1.00 4.00 0.50 2.00 Amount (pmol/10^6 cells) Amount (pmol/10^6 cells) 0.00 0.00 0 hr 1 hr 4 hr 24 hr 0 hr 1 hr 4 hr 24 hr Time (hr) Time (hr)
Figure 5.7 The quantification of DAC-TP and dNTPs in K562 cell lysate after treatment of DAC for 0, 1, 4 and 24 hrs (n=3). *Represents significant differences from control (time=0) at p<0.05
137
DAC-TP dTTP
10.00 10.00
Patient #1 Patient #1 Patient #2 Patient #2 Amount (pmol/10^6 cells) Amount (pmol/10^6cells)
1.00 1.00 Day 1 Day 5 Day 1 Day 5 Treatment day Treatment day
dATP dCTP
10.00 10.00
Patient #1 Patient #1 undetectable 1.00 Patient #2 Patient #2 Amount (pmol/10^6cells) Amount (pmol/10^6 cells)
1.00 0.10 Day 1 Day 5 Day 1 Day 5 Treatment day Treatment day
Figure 5.8 Intracellular DAC-TP and dNTP levels in patient bone marrow samples following decitabine treatment.
138
Within-day Validation (n=6): nM Decitabine- 2dATP 2dCTP 2dTTP TP cva acb cv ac cv ac cv ac 5000 4.7 109.4 5.6 115.6 6.6 101.0 5.3 86.7 500 7.0 87.3 5.6 102.3 6.3 101.4 6.8 94.5 50 19.9 105.9 19.8 83.7 19.3 88.8 14.2 104.2 Between-day Validation (n=3): nM Decitabine- 2dATP 2dCTP 2dTTP TP cv cv cv cv 5000 7.5 10.4 12.8 17.7 500 10.2 9.6 8.1 18.9 50 15.2 15.2 7.5 15.6 aCoefficient of variation bAccuracy (%)
Table 5.1 The intra- and inter-day validation of the quantification method of DAC-TP and dNTPs in K562 cell lysate.
139 CHAPTER 6
BIOCHEMICAL MODULATION OF INTRACELLULAR NUCLEOSIDE TRIPHOSPHATE LEVELS BY ANTI-LEUKEMIA DRUGS IN K562 HUMAN LEUKEMIA CELLS
6.1 Abstract
Over-expression of ribonucleotide reductase, the highly regulated enzyme involved
in the de novo synthesis of nucleoside triphosphates, has been found in almost every type
of cancers studied. GTI-2040 is a potent antisense inhibitor of the R2 subunit of the ribonucleotide reductase. The purpose of this study was to apply a newly developed LC-
MS/MS method to monitor the alteration of nucleoside triphosphate levels after GTI-
2040 treatment in K562 human leukemia cells. GTI-2040 was introduced into the cells via electroporation. A two-step hybridization-ligation ELISA assay was used to quantify the intracellular GTI-2040 concentration. Real-time PCR and western blot methods were used to measure ribonucleotide reductase R2 subunit mRNA and protein levels, respectively, after K562 cells were exposed to different levels of GTI-2040 for 24 hours.
Intracellular nucleoside triphosphate levels (dATP, dTTP, dCTP, dGTP/ATP, UTP, CTP and GTP) were quantified in these cells before and after GTI-2040 treatment, using a LC-
MS/MS method. About 60~70% of GTI-2040 was found to be introduced into the cells using electroporation, which is comparable to the use of neophectine. GTI-2040 was
140 found to down-regulate R2 mRNA and protein levels in a dose dependent manner. The inhibition of ribonucleotide reductase by GTI-2040 results in a decrease of dATP and dCTP levels and this was found for the first time. dATP and dCTP levels were found to decrease significantly, ~2-fold (p<0.05), after GTI-2040 treatment (>5 μM); however, no significant change has been found in other nucleoside triphosphate levels. In a combination study of GTI-2040 with aracytidine, a commonly used antileukemia drug, an increase of intracellular aracytidine triphosphate level after pretreatment with GTI-2040 in vitro was found, using a newly developed HPLC-UV method. This important data provides a laboratory and mechanistic justification for the current phase I evaluation of
GTI-2040 in combination with aracytidine in patients with acute myeloid leukemia. 5-
Azacytidine (5-AzaC) is a cytosine analogue and has shown a wide range of antitumor activities for the treatment of leukemia. The in vitro mechanism studies of GTI-2040 with
5-AzaC indicated a potential synergistic effect on their combination treatment. A further transporter study revealed that the transport of 5-AzaC into cells may involve the human equilibrative nucleoside transporter 1 (hENT1). Pharmacokinetics / pharmacodynamics
(PK/PD) modeling and simulation of GTI-2040 and aracytidine in the cell indicated an increase in intracellular Ara-CTP level by >2 fold. This model and the simulation strategy also provide a novel approach for future PK/PD modeling and simulation of GTI-2040 and 5-AzaC.
6.2 Introduction
141 Ribonucleotide reductase (RNR), a highly regulated enzyme involved in the de novo synthesis of 2’-deoxyribonucleotides, plays a critical role in nucleoside metabolism
(56,176). RNR catalyzed the reduction reaction of ribonucleotides (ADP, GDP, UDP, and
CDP) to their corresponding deoxyribonucleotides (dADP, dGDP, dUDP, and dCDP),
which is the rate limiting step required for DNA replication (177). Human RNR consists
of the R1 subunit, which contains a substrate binding site, an allosteric site and redox
active disulfides, and R2 subunit which contains an oxygen-linked non-heme iron center
and a tyrosine residue that are essential for catalysis activity (178,179). R2 protein is only
expressed during late G1/early S phase which is of fundamental importance to DNA
synthesis and repair, while R1 protein level remains relatively stable throughout the cell
cycle (179). Over expression of R2 is found to be associated with malignant status of
tumor cells and cancer metastasis, which makes R2 a good target for anticancer drugs
development (60,180). A number of RNR inhibitors have been developed, such as
hydroxyurea and gemcitabine (180,181). The inhibition of RNR induces imbalance of
ribonucleotides and deoxyribonucleotides, resulting in decrease of dNTPs in the cells
which leads to inhibition of DNA synthesis and repair, and further cell cycle arrest and
apoptosis (182). The recently developed GTI-2040 (Figure 6.1) is a 20-mer
oligonucleotide complementary to the coding region of R2 mRNA with the sequence of
5’-GGCTAAATCGCTCCACCAAG-3’. As shown in Figure 6.2, the mechanism of
action of GTI-2040 is to complementarily bind to R2 mRNA, resulting in the recruitment
of RNase H, leading to cleavage of the drug-mRNA complex. In vitro and in vivo studies
142 have shown that the treatment of GTI-2040 led to sequence- and target- specific down-
regulation of ribonucleotide reductase subunit R2 mRNA and protein levels in a variety
of tumor cells and greatly increased the survival rate of immunodeficient mice bearing
Burkitt's lymphoma (60). Phase I studies of GTI-2040 alone for the treatment of
advanced solid tumors or lymphoma indicated that the maximum tolerated dose of GTI-
2040 was 222.0 mg/m2/day as a 21-day continuous infusion (61). The inhibition of RNR by GTI-2040 may result in the alteration of intracellular dNTP level which could provide
potential combination treatment strategies with GTI-2040 and other anticancer drugs such as aracytidine and 5-azacytidine. Therefore, the confirmation of down-regulation of dNTP level in the cell by GTI-2040 is important for the design of further combination studies.
Aracytidine (Fig 6.1) is widely used for the treatment of acute myeloid leukemia
(183,184). Aracytidine needs to be phosphorylated into aracytidine triphosphate (Ara-
CTP) by deoxycytidine kinase in the cell to compete with dCTP for incorporation into
DNA, leading to inhibition of DNA synthesis and cell death (185). The therapeutic potential on the combination treatment of GTI-2040 with aracytidine is based on the
rationale that the decrease in intracellular dNTP levels, especially dCTP level, by GTI-
2040 could increase deoxycytidine kinase activities, resulting in the increase of
intracellular Ara-CTP level. The successful development of an HPLC-UV assay to
quantify Ara-CTP level in the cell as discussed in Chapter 4 enables us to evaluate the
143 combination effect of GTI-2040 and aracytidine and will provide critical information in
optimizing dosing and schedule in the clinic. Pharmacokinetic/pharmacodynamic
(PK/PD) modeling and simulation have been widely used to predict pharmacological and
therapeutic effects of drugs. In order to investigate the synergistic effect between GTI-
2040 and aracytidine, it is important to develop a PK/PD model based on the mechanistic
studies of these two drugs.
5-Azacytidine (5-AzaC) (Fig 6.1) is a cytosine analogue that has a wide range of
antitumor activities in the treatment of myelodysplastic syndrome (MDS), myeloid
leukemia, and other forms of neoplasia (186). High dose 5-AzaC can inhibit cell
proliferation due to cell cytotoxicity (135,187-189), while low dose 5-AzaC traps DNA
methyltransferases and targets them for degradation which results in reactivation of tumor suppressor genes (186,190-192). The significant hypomethylating effect of 5-AzaC at low doses on the promoter region has made it a good candidate in combination treatment with GTI-2040 that targets R2 mRNA. The rationale is that 5-Azacytidine can induce G2/M-phase arrest and GTI 2040 inhibits R2 protein during G1/early S phase, which invoke marked increases rates of apoptosis. However, 5-AzaC does not appear to freely diffuse across cells, especially at low doses due to its hydrophilic property and may involve active transport. Therefore, it is critical to examine the nucleoside-specific membrane transport system that may facilitate the transport of 5-azacytidine into cells.
144 The purpose of this study was to characterize the alteration of intracellular dNTP and NTP pool size after GTI-2040 treatment, using a sensitive LC/MS/MS method.
Intracellular levels of GTI-2040, R2 mRNA and R2 protein were determined to further explore the mechanism of action of GTI-2040. The intracellular Ara-CTP level was examined in the combination treatment with GTI-2040 to investigate their combination treatment effect. Nucleoside-specific membrane transporter inhibition assay was performed to examine the potential transporters involved in 5-AzaC diffusion into the cells. PK/PD modeling and simulation of GTI-2040 and Ara-CTP was conducted to evaluate the synergistic effect for the combination treatment of these two drugs.
6.3 Method
6.3.1 Chemicals and reagents
All standards dNTPs (dATP, dTTP, dGTP, dCTP) and NTPs (ATP, UTP, GTP,
CTP, 2-Chloroadenosine-5’-triphosphate) were purchased from Sigma (St. Louis, MO,
USA). N, N-Dimethylhexylamine (DMH), nitrobenzylthioinosine (NBMPR), and formic acid (FA, 90%) were obtained from Sigma. Aracytidine 5’-triphosphate (Ara-CTP) was purchased from Jena Bioscience (Jena, Germany). 7-Deaza-2’-deoxyguanosine 5’- triphosphate lithium salt (7-deaza-dGTP), potassium chloride (KCl) and potassium phosphate monobasic (KH2PO4) were obtained from Sigma-Aldrich (St. Louis, MO,
USA). HPLC grade methanol and acetonitrile (ACN) were purchased from Fisher
145 Scientific (Pittsburgh, PA, USA). Sodium acetate was obtained from Sigma. Deionized
water for HPLC anaysis was obtained from a Milli-Q system (Millipore, Bedford, MA,
USA). The 20mer phosphorothioate oligonucleotide, GTI-2040, with sequence of 5'-
GGC TAA ATC GCT CCA CCA AG-3' was provided by the National Cancer Institute
(Bethesda, MD) and used without further purification.
6.3.2 HPLC chromatographic and mass spectrometric conditions
The previously developed LC-MS/MS method as discussed in Chapter 2 was used
for the analysis of dATP, dTTP, dCTP, dGTP/ATP, UTP, GTP and CTP. Briefly, the analysis was performed on a Supelcogel ODP-50, 150×2.1 mm, 5 μm particle size column (Supelco, Sigma-Aldrich, St. Louis, MO) coupled to a 3.5 μm Waters Xterra
MSC18 10×2.1 mm guard column (Waters Corp., Milford, MA). The mobile phase was prepared as Mobile Phase A and Mobile Phase B. Mobile Phase A consisted of 5 mM
DMH in ultrapure water buffered to pH 7 by 90% FA. Mobile Phase B consisted of 5 mM DMH in ACN (50:50, v/v). Gradient elution was used for the separation and identification of all dNTPs and NTPs at a flow rate of 0.2 ml/min. The previously developed HPLC-UV method, as discussed in Chapter 4, was used for the analysis of
Ara-CTP in cells. Briefly, Ara-CTP in the cell matrix was separated on a Partisil-10 SAX anion-exchange, 4.6 mm×25 cm, 10 μm particle size column (Whatman, Inc., Clifton,
NJ) coupled to a 5 μm SAX hypersil 10×4 mm drop-in guard column (Thermo Scientific,
146 San Jose, CA). Mobile phase consisted of 0.35 M KH2PO4 and 0.15M KCl in ultra-pure water containing 5 μl of methylene chloride. An isocratic program was used for the separation and identification of Ara-CTP and 7-deaza-dGTP at a flow rate of 1.5 ml/min.
The LCQ ion trap mass spectrometer was used to quantify dNTPs and NTPs with an ESI source operated in the negative ion mode. The LC effluent was introduced into the
ESI source without split. The multiple reaction monitoring (MRM) mode analysis was used with ion transitions at: m/z 489.9→392.00, 481.00→383.00, 506.00→408.00,
466.00→368.00, 506.00→408.00, 483.00→385.00, 522.00→424.00, 482.00→384.00,
540→441.9 for dATP, dTTP, dGTP, dCTP, ATP, UTP, GTP, CTP and 2-
Chloroadenosine-5’-triphosphate, respectively. Collision energy was optimized to 28%,
22%, 25%, 25%, 22%, 25%, 25%, 25%, 23% for dATP, dTTP, dGTP, dCTP, ATP, UTP,
GTP, CTP, 2-Chloroadenosine-5’-triphosphate, respectively. All performances were controlled by Finnigan Xcalibur (Version 1.2) software in a Windows NT 4.0 system.
6.3.3 Cell culture conditions
The leukemia cell line K562 (ATCC, Manassa) was used as the cell matrices. K562 cells were cultured in RPMI 1640 medium supplemented with L-glutamine (CCC, the
Ohio State University, Columbus, Ohio), 1% Penicillin-Streptomycin (PS) (Gibco,
Rockville, MD) and 10% fetal bovine serum (FBS) (Invitrogen, Rockville, MD). The cell
147 line was maintained at 37 °C in a humidified environment with 5% CO2. The culture
media was changed every 2 or 3 days to maintain a cell density at 0.4 million cells/ml.
Trypan blue dye exclusion and hemocytometer were used to determine cell viability and
cell counts, respectively.
6.3.4 NTP/dNTP or Ara-CTP extraction
Intracellular dNTP/NTPs or Ara-CTP were extracted as described in Chapters 2 and
4. All the extraction processes were performed on ice. Briefly, cells were counted and monitored for viability with trypan blue dye before extraction. Cell pellets were washed with PBS and deproteinized with 1 ml 60% methanol. The resulting solution was vortex- mixed for 5 s, left at -20 °C for 30 min and sonicated for 15 min in ice bath. Cell extracts were centrifuged at 13000 rpm for 2 min at 4 °C. The supernatants were dried under a stream of nitrogen. The residues were reconstituted in mobile phase and vortex-mixed for
20 s. The contents were then centrifuged at 13000 rpm for 2 min at 4 °C. A fifty μL aliquot of the resulting supernatants was injected into LC/MS/MS system for dNTP and
NTP measurement or HPLC-UV system for Ara-CTP measurement.
148 6.3.5 Determination of intracellular dNTP/NTP levels after GTI-2040 treatment in
human K562 leukemia cells
GTI-2040 is an oligonucleotide with multiple negative charges and does not diffuse
into cells. Electroporation was used to deliver GTI-2040 into cells using an
electroporation device BIO-RAD (BIO-RAD Lab, CA, USA). As shown in Figure 6.3,
pores are created on the cell membrane by an applied electric field and large molecules,
such as GTI-2040, could migrate into the cell through these pores. After removal of the
electric field, these pores could be closed. Briefly, 5× 106 cells were spun down and the supernatant was discarded. One hundred μL of electroporation medium was added to the
cell pellet and mixed. After transfection, 500 μL of the cell medium was immediately
added and mixed with the solution. The resulting solution was added into 9.5 ml pre-
warmed media. In order to measure intracellular dNTP and NTP levels, 10×106 K562 cells were treated with GTI-2040 at 0, 1, 5, 10, 20 μM for 24 hours using an electroporation delivery technique. After 24 hr, cells were harvested and intracellular dNTP and NTP levels were measured using LC-MS/MS.
6.3.6 Determination of intracellular Ara-CTP levels after Ara-C treatment in
combination with GTI-2040 in human K562 leukemia cells
In order to study the combination treatment effects, 10×106 K562 cells were pre-
treated with GTI-2040 at 0, 1, 5, 10, 20 μM for 24 hours using electroporation. After 24
149 hr, 10 μM of Ara-C was added into each treatment. Four hours later, cells were harvested
and intracellular Ara-CTP was measured using HPLC-UV.
6.3.7 Determination of intracellular GTI-2040 concentrations by a hybridization-
based ELISA Assay
A previously developed two-step hybridization-ligation ELISA assay was used to
determine intracellular GTI-2040 levels (59). The procedure is shown in Figure 6.4.
Briefly, GTI-2040 was first base paired to the capture probe in a polypropylene 96-well
plate. 10% Triton X-100 was added to the mixture solution and incubated at 42°C for 2.5 h for hybridization. The resulting solution was transferred to a NeutrAvidin-coated 96- well plate and further incubated at 37°C for 30 min to ensure the attachment of biotin
labeled capture probe to NeutrAvidin-coated wells. After washing six times, the ligation
solution containing T4 ligase and detection probe was added to each well followed by the
addition of S1 nuclease solution. The reaction was blocked with Superblock buffer
(Pierce, IL). Anti-Digoxigenin-Alkaline phosphatase (AP) was then added into each well.
Following addition of substrate solution (36 mg Attophos in 60 ml diethanolamine
buffer), fluorescence intensity was measured at Ex 430/Em 560 (filter=550nm) using a
Gemini XS fluorescence microtiter plate reader (Molecular Devices, Sunnyvale, CA).
150 6.3.8 Quantification of R2 mRNA by real-time RT-PCR following GTI-2040
treatment
2 × 106 K562 cells were treated with GTI-2040 at 0, 1, 5, 10, 20 μM using electroporation, followed by continuous incubation in RPMI medium with 10% FBS and
1% PS for 24 hrs. Cells were then harvested and total cellular RNA was isolated and extracted using Trizol reagent (Stratagene, La Jolla, CA) following the manufacturer’s instruction. RNA was precipitated with ethanol and the resulting pellet was dissolved in water. A 1.5 μL aliquot of 20 μM random hexamer primers (Perkin Elmer, Boston, MA) was added into the extracted total RNA (2 μg) of each sample for complementary
(cDNA) synthesis. The denaturation step was performed at 70 ºC for 2 min and then
cooled on ice for 5 min. The reverse transcription reaction was performed in a solution
containing 17 μL of a Master Mixture containing 5 X reaction buffer (Invitrogen,
Carlsbad, CA), 10 mM of each dNTP, M-Murine leukemia virus reverse transcriptase
(Invitrogen, Carlsbad, CA), 100 mM DTT and RNasin (Promega, Madison, WI) at 40 ºC for 60 min and 94 ºC for 5 min in a Thermal Cycler (Applied Biosystem, Foster City,
CA). The mRNA expression levels of R2 and the endogenous housekeeping gene ABL as a reference were quantified using real-time PCR analysis on an ABI Prism 7700
Sequence Detection System (Applied Biosystem, Foster City, CA). Dual-fluorescent nonextendable probe labeled with FAM at the 3’ end and MGB at 5’ end was used to detect amplification of the R2 transcript, while a labeled probe with 3’ FAM and 5’
TAMRA was used for the ABL gene as the internal control. A previously developed
151 comparative cycle time (Ct) method was used to calculate relative mRNA expression
(193). The critical value CT for the R2 transcript was normalized to the ABL PCR Ct
value and the mRNA expression level for R2 was calculated using the following
equation:
-(Ct -Ct ) Relative R2 mRNA expression = 2 R2 ABL ×100%
6.3.9 Measurement of R2 protein levels by western blot following GTI-2040
treatment
3 × 106 K562 cells treated as control or with different concentrations of GTI-2040
were used to measure the R2 protein. Cells thawed on ice and washed with 1 ml ice-cold
PBS were centrifuged at 1000 g for 5 min at 4 ºC. The pellet was obtained and resuspended in 100 μL lysis buffer (50 mM PH 7.6 Tris-HCl, 250 mM NaCl, 5 mM
EDTA, 2 mM Na3VO4, 50 mM NaF and 1% protease inhibitor cocktail) (P8340, Sigma)
for 30 min on ice. The lysate was sonicated for 10 seconds. Total protein concentration
was determined using the BCA protein assay method (Pierce, Rockford, IL). Equal
amounts of protein for each sample were incubated with 6x SDS loading buffer (100
mM, pH 6.8 Tris, 200 mM DTT, 4% SDS, 20% glycerol, and 0.015% bromphenol blue) and boiled for 5 min. The proteins were then separated on 15% SDS-polyacrylamide gels
and transferred to nitrocellulose membranes (Amersham, Piscataway, NJ). The R2
protein was recognized with a rabbit antihuman R2 polyclonal antibody (E-16) (Santa
152 Cruz Biotechnology, Santa Cruz, CA) as the first antibody, followed by a HRP
(horseradish peroxidase) conjugated anti-rabbit IgG secondary antibody. The molecular
weight of R2 protein is 45,000 dalton, which was detected by ECL (Amersham,
Arlington Heights, IL). GAPDH was probed as the internal loading control. R2 protein
expressions were quantified by densitometry and normalized to GAPDH.
6.3.10 MTS assay
K562 cells were grown in log phase and refreshed with RPMI medium containing
10% FBS and 1% PS the day before the experiment. K562 cells were then counted and
suspended at 5 × 104 cells/mL in fresh RPMI medium. One hundred μL of cell
suspensions was placed into each well of a 96-well tissue culture plate to have a total of
2000 K562 cells/well. Graded concentrations of 5-azacytidine alone were added to the
cell culture to determine the drug effect. In order to investigate the nucleoside specific
transporters involved in 5-azacytidine transport to cells, the human equilibrative
nucleoside transporter 1 (hENT1) inhibitor, nitrobenzylthioinosine, (NBMPR) was added to the cell culture and incubated at 37 °C for 15 min. Cells were then cultured in the
presence of 5-azacytidine at a concentration range of 0.1 μM-100 μM. Cells in medium
without 5-azacytidine were used as the control, and cultured medium only was used as
blank. The plates were incubated continuously for a total of 72 hrs at 37 °C in humidified
air containing 5% CO2. MTS (3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-
153 2-(4-sulfopheyl)-2H-tetrazolium) (Sigma-Aldrich, St. Louis, MO, USA) and PMS
(phenazine methosulfate) were used to determine cell viability. Briefly, a mixture of
MTS/PMS (ratio 20:1) was added into cell culture and incubated for an additional 3-4 hrs
at 37 °C. Only viable cells are able to reduce MTS into a brown/blue formazan product that is soluble in the medium. The optical density (OD) was detected at 490 nm on a microplate reader Germini XS (Molecular Devices, Sunnyvale, CA). Triplicates were performed at each drug concentration. After subtraction of the blank values, the IC50 was
calculated using inhibitory effect sigmoidal Emax model in WinNonLin software
(version 4.0, Pharsight, Mountain View, CA).
6.3.11 PK/PD model development of GTI-2040 and aracytidine in the cell
The clinical pharmacokinetic (PK) studies of GTI-2040 in human plasma and the
PK profile of Ara-CTP in bone marrow samples from patients have been previously
reported (165). A two compartment model was used to characterize the PK profile of
GTI-2040 in human plasma. Indirect response models were used to evaluate the PD endpoint of R2 mRNA and Ara-CTP in the cell. Based on previous studies in our
laboratory on GTI 2040 in AML patients, a hypothetical effect compartment was used to link plasma PK profile of GTI-2040 and PD endpoint (Figure 6.5). This hypothetical
effect compartment can be viewed as cell compartment because GTI-2040 needs to
154 diffuse into the cell to exhibit its pharmacological effect. Due to its bulky size, negative
charge, and hydrophilic properties, it is difficult for GTI-2040 to directly permeate
through the cell membrane by passive diffusion. The in vitro experiments indicated that
an active endocytosis mechanism may be involved in the uptake of phosphorothioate
oligonucleotide in cultured cells (194-198). Therefore, we hypothesize that the cellular
uptake of GTI-2040 is done through an active transport system. Michaelis-Menten
enzyme kinetics will be used to describe the distribution of GTI 2040 from the central
compartment to the effect compartment. In addition, the following assumptions will be
made in the model: a) Efflux of GTI 2040 from effect compartment to the central
compartment is negligible; b) Equilibrium between the central and peripheral
compartments is rapidly achieved. The differential equations for the amounts of drugs in different compartments are shown as follows:
155 where A1, A2, A3 represent the amounts of GTI 2040 in the central, peripheral and effect
compartments, respectively. K12 and K21 are the intercompartmental transfer rate constants for the central and peripheral compartments, respectively. K10 and K30 are the elimination rate constants from the central and the effect compartments, respectively. V1 is the volume of central compartment, Vm the maximum uptake rate of GTI-2040 into
cells and Km the substrate concentration that reaches the half maximal uptake rate. All of
these parameters can be obtained from the previous GTI 2040 studies in our laboratory
and will be used as fixed parameters for our PK/PD modeling. In the effect compartment,
the uptakes of GTI 2040 in cells will complementarily pair to ribionucleotide reductase
R2 subunit mRNA, which causes the degradation of R2 mRNA by RNase H, thus
inhibiting the R2 mRNA expression. Since ribonucleotide reductase catalyzes the
conversion of ribonucleotides (ADP, GDP, UDP, and CDP) to their corresponding
deoxyribonucleotides (dADP, dGDP, dUDP, and dCDP), the inhibition of R2 mRNA
expression induces a decrease of intracellular dCTP level, which will in turn negatively
regulate the deoxycytidine kinase, resulting in the stimulation of ARA-CTP formation.
The differential equation is shown as follows:
156 where A4 is the amount of the normalized R2 mRNA level in cells, V3 is the volume of
the effect compartment, Emax is the maximum reduced level of R2 mRNA, EC50 is the concentration of GTI 2040 required to reach half maximal reduction of R2 mRNA,
Ksyn_04 and Ksyn_05 are the synthesis rates of R2 mRNA and Ara-CTP, respectively.
Kdeg_40 and Kdeg_50 are the elimination rate constants of R2 mRNA and Ara-CTP, respectively. A5 is the amount of the intracellular Ara-CTP level. IC50 is the
concentration of R2 mRNA change required to reach half maximal enhancement of Ara-
CTP. In order to perform the simulation, all parameters were obtained from a previously
published report of clinical pharmacokinetic evaluation of GTI-2040 and the
pharmacokinetic profile of Ara-CTP in bone marrow samples from patients. Simulations
were performed to predict the combination effect of GTI-2040 and aracytidine using
currently clinical used doses.
6.3.12 Software
WinNonLin 4.0 (Pharsight Corporation, North Carolina) was used in the
pharmacokinetic analysis. ADAPT II (Version 4) (David Z.D’Argenio and Alan
Schumitzky, University of Southern California) was used in the PK/PD model simulation. Excel (Microsoft Office Word 2007, Washington) was used in the data plot.
6.4 Result
157 6.4.1 Determination of GTI-2040 concentrations in human leukemia K562 cells
In order to confirm the internalization of macromolecule GTI-2040 into cells, intracellular GTI-2040 levels were determined. As shown in Figure 6.6, K562 cell uptakes of GTI-2040 were determined to be 0.508 ± 0.232 pmol, 2.93 ± 0.84 pmol, 5.49
± 0.74 pmol and 13.95 ± 0.82 pmol, when cells were treated with 1, 5, 10, 20 µM of GTI-
2040, respectively, using eletroporation for transfection. Thus, intracellular GTI-2040 content was found to increase with an increase in exposure concentrations.
6.4.2 Determination of R2 mRNA following GTI-2040 treatment
Following different doses of GTI-2040 treatment in K562 cells, R2 mRNA levels were determined and the results are shown in Figure 6.7. As shown, the expression of R2 mRNA did not change significantly compared to the control after treatment with 1 and 5
µM of drug, respectively. However, after treatment with 10 and 20 µM of GTI-2040 in
K562 cells, R2 mRNA expression decreased significantly. Therefore, down-regulation of
R2 mRNA in K562 cells by GTI-2040 occurred in a concentration dependent manner.
158 6.4.3 Determination of R2 protein following GTI-2040 treatment
Parallel experiments to examine R2 protein expression were also carried out in
K562 cells and the results are shown in Figure 6.8. As shown, after K562 cells were transfected with GTI-2040 at 1 and 5 µM for 24hr, the expression of R2 protein did not change significantly. However, when K562 cells were transfected with GTI-2040 at 10,
20 and 30 µM for 24 hr, the expression of R2 protein decreased significantly (P<0.05) indicating that the down regulation was exposure concentration dependent.
6.4.4 Correlation study of intracellular GTI-2040, R2 mRNA expression and R2 protein expression following GTI-2040 treatment
Correlation studies of intracellular GTI-2040, R2 mRNA expression and R2 protein expression following GTI-2040 treatment were performed. As shown in Figure 6.9, a good correlation of doses with its intracellular GTI-2040 levels was observed. As doses were increased, the accumulation of GTI-2040 in K562 cells also proportionally increased. As shown in Figure 6.10, these increased intracellular GTI-2040 levels correlated well with the percentage of change of R2 mRNA expression in the cells. As described previously, the mechanism of action of down regulation of R2 mRNA by GTI-
2040 is based on the rationale that the hybrid duplex of GTI-2040 and its target R2 mRNA was cleaved by RNase H in the nucleus, resulting in suppression of R2 mRNA expression (Fig 6.2). In addition, RNase H is enriched in nucleus. Therefore, it is possible
159 that GTI-2040 levels in the nucleus may provide a better correlation with the R2 mRNA
change. Currently, we do not have data to substantiate this possibility. The correlation of
GTI-2040 accumulation in the cell with percentage of change of R2 protein as shown in
Figure 6.11 was not as significant as the change in R2 mRNA. This is probably due to the fact that GTI-2040 was directly base-paired with R2 mRNA, leading to the inhibition of
R2 mRNA expression through recruitment of RNase H. On the other hand, translation of
R2 mRNA to R2 protein is rather complex and may involve post-translational processes,
and time dependent turn-over. Thus, this multiple processing may be responsible for the
lack of correlation between intracellular GTI-2040 levels with R2 protein expression.
6.4.5 Quantification of intracellular dNTP/NTP levels following GTI-2040
treatment in human leukemia K562 cells
Following GTI-2040 treatment in K562 cells (Fig. 6.12), there was no significant
change in dGTP/ATP, GTP, CTP, and dTTP levels. UTP level was increased by about
15% at 5, 10 and 20 μM (p>0.05). However, dATP level was decreased by about 50% at
20 μM (p<0.05) and dCTP level was decreased by about 50% given GTI-2040 at 5, 10,
20 μM (p<0.05).
160 6.4.6 Quantification of intracellular Ara-CTP levels following Ara-C treatment in combination with GTI-2040 in K562 cells
Following 10 μM Ara-C treatment in combination with various concentrations of
GTI-2040 in K562 cells, intracellular Ara-CTP levels increased dramatically (Figure
6.13). With GTI-2040 pretreatment at 10 μM and 20 μM, Ara-CTP levels increased by about 50% from the control, although no significant change in Ara-CTP levels was seen at low GTI-2040 exposure.
6.4.7 MTS assay
In order to investigate the possible involvement of transporter in 5-AzaC uptake in leukemia cells, we tested the cytotoxicity of 5-AzaC in combination with the human equilibrative nucleoside transporter 1 (hENT1) inhibitor, nitrobenzylthioinosine,
(NBMPR) by MTS assays. As shown in Figure 6.14, 1 μM NBMPR significantly inhibited anticancer activity of 5-AzaC in K562 cells. More than 30% of the cells were killed when cells were exposed to 0.1-1 μM 5-AzaC tested (low dose); however, in the presence of the hENT1 inhibitor (NBMPR), cell kill was reduced to about 15% (1 μM).
161 6.4.8 PK/PD model simulation of the combination effect of GTI-2040 and aracytidine
The mechanism-based rationale for the combination treatment of GTI-2040 with aracytidine (Fig 6.15) indicated that the decrease of intracellular dNTP levels, especially dCTP level due to down regulation of R2 mRNA expression by GTI-2040, could increase deoxycytidine kinase activities, resulting in an increase in intracellular Ara-CTP level.
Thus, a PK/PD model was developed as shown in Figure 6.5 to characterize this process.
The purpose of this PK/PD simulation study is to investigate the effects of doses on PD response, to identify the critical PK or PD parameters that are important to determine PD response, and to provide guides for future drug development. These doses were selected based on currently used doses in clinical trials. The simulation results of plasma drug concentration, R2 mRNA expression and intracellular Ara-CTP level given different doses are shown in Figure 6.16. The increase of doses from 3.5 mg/kg/day to 15 mg/kg/day leads to significant increase of plasma GTI-2040 concentration (>2 fold) (Fig
6.16 A); however, the escalation of doses did not seem to enhance the down-regulation of
R2 mRNA (Fig 6.16 B) and accumulation of Ara-CTP (Fig 6.16 C). Thus, the escalation in doses only may not be a good strategy to enhance PD response. Actually, previous clinical studies of GTI-2040 (199) indicated that less than 10% of GTI-2040 in the plasma was uptaken into the cell. Therefore, a better delivery system needs to be studied to improve the cellular uptake of GTI-2040. K30 is the degradation rate constant of drug in the cell and plays a key role in determining the duration of drug in the cell. Thus, it is
162 important to evaluate the effect of K30 on PD response. The increase of K30 value
resulted in a significantly less down-regulation of R2 mRNA (Fig 6.17 B) and a decrease
in intracellular Ara-CTP levels (Fig 6.17 C); however, the pharmacokinetic profiles of
GTI-2040 in plasma overlapped given a different K30, which indicated that the change of
K30 did not seem to affect the plasma GTI-2040 concentrations (Fig 6.17 A). Thus, agents that could decrease efflux of GTI-2040 in the cell such as liposome formulation may decrease K30, resulting in better therapeutic effects. EC50 is the concentration of
GTI 2040 required to reach half maximal reduction of R2 mRNA and is assumed to be
affected by the efficiency in recruitment of RNase H as well as the binding affinity
between GTI-2040 and R2 mRNAs. Based on the simulation results, the increase in
EC50 value from 1 to 100 did not appear to alter the plasma GTI-2040 concentrations
(Fig 6.18 A); however, the elevation in EC50 by 10 or 100 fold could lead to less down-
regulation of R2 mRNA by more than 2 or 4 fold, respectively (Fig 6.18 B), and decrease in intracellular Ara-CTP level by more than 30% and 50 %, respectively (Fig 6.18 C).
Thus, a new technology that can lower EC50 value could be applied to enhance antisense effects. Gapmer (chimeric antisense) is such a technology that can improve the binding affinity between antisense and target mRNA (200,201) and thus be able to decrease
EC50, leading to more down-regulation of R2 mRNA and accumulation of Ara-CTP.
IC50 is the concentration of R2 mRNA change required to reach half maximal
enhancement of Ara-CTP and is related to increase in the Ara-CTP formation. As shown
in Figure 6.19, the change of IC50 values did not result in the significant alteration of
163 GTI-2040 plasma concentrations (Fig 6.19 A) and R2 mRNA expression (Fig 6.19 B); however, the increase in the IC50 value from 30 to 90 would significantly increase the accumulation of Ara-CTP by more than 3 fold (Fig 6.19 C). Thus, factors that increase the IC50 value may help to increase the intracellular accumulation of Ara-CTP. Such factors include increased deoxycytidine kinase activity, which stimulates the biosynthesis of Ara-CTP, leading to enhancement of drug treatment effect.
6.5 Discussion
In our initial attempts to quantify intracellular dNTP/NTP levels after GTI-2040 treatment in vitro, the transfection reagent, neophectin, was used to deliver GTI-2040 into
the cell. However, an alteration of intracellular dNTP level was observed in leukemia
K562 cells treated with neophectin alone, which indicated that neophectin itself may affect the dNTP/NTP levels in the cells. In order to eliminate the interference induced by tranfection reagents, the electroporation method was used to deliver GTI-2040 into the cell. With this method, pores were formed on cell membrane when the voltage across a plasma membrane exceeds its dielectric strength, so that large molecules such as GTI-
2040 can diffuse into the cell. In order to evaluate the delivery efficiency using electroporation compared to a conventional transfection reagent, intracellular GTI-2040 concentration was measured. As shown, about 60-70% of GTI-2040 was introduced into the cell with electroporation, which is comparable to that when using a transfection
164 reagent. Therefore, electroporation was used in our lab as an effective way to deliver
GTI-2040 into the cell.
After delivery of GTI-2040 into cells using electroporation, dose-dependent down regulation of R2 mRNA and protein were observed (Figures 6.7 and 6.8, respectively).
These results are consistent with the proposed mechanism of GTI-2040 in leukemia cells and provide an experimental verification of the theoretical basis for its use in the treatment of cancer.
Ribonucleotide reductase is an important enzyme which catalyzes the conversion of ribonucleotides (ADP, GDP, UDP, and CDP) to their corresponding deoxyribonucleotides (dADP, dGDP, dUDP, and dCDP). Since GTI-2040 is a potent ribonucleotide reductase inhibitor, the inhibition of ribonucleotide reductase may result in decrease of dATP and dCTP levels and increase of ATP, GTP, UTP and CTP levels.
Following GTI-2040 treatment in K562 cells, a significant decrease in dCTP and dATP levels was observed, which confirmed the inhibition effect on ribonucleotide reductase by
GTI-2040. However, dTTP remained unchanged probably due to its biosynthesis pathway independent of ribonucleotide reductase. However, no significant changes were observed among NTP levels except a slight increase in UTP level in K562 cells. This effect may be due to the salvage pathways of intracellular NTP biosynthesis which compensates the increase in NTPs. Since GTI-2040 can significantly decrease dCTP and
165 dATP levels, the combination treatment of GTI-2040 and cytarabine may be a good
strategy for anticancer therapy because the active metabolite of cytarabine competes with
dCTP for incorporation into DNA. These data provide in vitro justification of the ongoing
clinical trials.
Aracytidine is one of the most effective anticancer agents for the treatment of acute
myleoid leukemia (AML), and its therapeutic effect at low or high doses has been
extensively studied (88,90,153,155,159,202-204). The metabolism of Ara-C in vitro can be greatly enhanced by ribonucleotide reductase (RNR) inhibitors, such as, hydroxyurea and amidox (161,162,205). Biochemical modulation studies of Ara-C in HL-60 promyelocytic human leukemia cells by trimidox, another RNR inhibitor, have shown an increase in the intracellular Ara-CTP level and Ara-C incorporation into DNA by more than two fold using 100 μM trimidox pre-treatment (161). A combination study of Ara-C and fludarabine, which is also a RNR inhibitor, indicated that pre-treatment with fludarabine led to a significant accumulation of Ara-CTP in lymphocytes obtained from patients with chronic lymphocytic leukemia (206,207). A sustained inhibition of DNA synthesis in circulating leukemia blasts was observed with the combination treatment of
RNR inhibitor chlorodeoxyadenosine and Ara-C in patients with acute myelogenous leukemia (208). The inhibition of RNR resulted in inhibition of de novo dNTP synthesis
which could enhance Ara-C sensitivity and even overcome Ara-C resistance (209,210).
Due to these promising effects of combination treatment of RNR inhibitors with Ara-C,
166 we evaluated the combination effect of GTI-2040, a new RNR inhibitor, and Ara-C in
human leukemia K562 cells. As shown in Figure 6.13, pre-incubation of GTI-2040 at 10
or 20 μM led to significant enhancement of intracellular Ara-CTP level by about 50%.
Compared to other RNR inhibitors, GTI-2040 may provide more advantages in
combination treatment with Ara-C. First, GTI-2040 is less toxic and we were unable to determine its IC50 when human leukemia K562 cells were exposed to GTI-2040 0.01-100
μM. Phase I studies of GTI-2040 alone for the treatment of advanced solid tumors or lymphoma indicated that GTI-2040 is generally well tolerated as a single agent with only
two patients experiencing a dose limiting reversible hepatic toxicity (61). In contrast,
Ara-C exhibited neurotoxicity including central nervous system associated effects and
pulmonary toxicity (211,212). Therefore, there are no overlapping toxicity profiles
between GTI-2040 and Ara-C, and this may allow full-dose administration of each drug,
resulting in a better therapeutic effect. Second, GTI-2040 is stable and efficiently inhibits
RNR expression through direct base-pairing to R2 mRNA that is degraded by RNase H, leading to RNR down regulation. On the contrary, conventional deoxyadenosine analogues such as fludarabine and clofarabine are susceptible to enzymatic phosphorolysis by Escherichia coli purine nucleoside phosphorylase and are acid labile.
Taken together, GTI-2040 appears to be a good candidate in combination treatment with
Ara-C for human leukemia.
167 Due to its hydrophilic properties, 5-AzaC diffuses poorly across cell membranes at low doses. 5-AzaC is a nucleoside analogue, thus certain nucleoside-specific transporters
may facilitate the uptake of 5-AzaC into the cell. A number of equilibrative nucleoside
transporters and concentrative Na+-dependent nucleoside transporters have been reported
(148,213-216). Previous studies with [14C]5-azacytidine in P388 mouse leukemia cells
indicated that 5-azacytidine transport across cell membranes was inhibited by uridine in a
simple, competitive manner (13). Human equilibrative nucleoside transporter 1 (hENT1)
was found to facilitate uridine diffusion into the cells (217,218). Hence, we hypothesized
that hENT1 may be involved in 5-AzaC cellular uptake. hENT1 is sensitive to NBMPR, a
nucleoside derivative that binds reversibly to equilibrative-sensitive (es) polypeptides on cell membranes (219-221). [3H]NBMPR and its conjugated derivative 5-(SAENTA-x8)-
fluorescein have been widely used in measurements of the content of es transporters in
cultured cells and leukemia cells from patients (222-224). Hence, an inhibitory MTS
assay was conducted to confirm our hypothesis. As shown in Figure 6.14, the blockage of
es transporter hENT1 by NBMPR significantly reduced the cytotoxicity of 5-AzaC on
human K562 leukemia cells. Therefore, hENT1 activity is important for 5-AzaC
sensitivity in cells.
PK/PD modeling and simulation are useful tools in predicting pharmacological
effects of drugs. During the course of the model development, mechanisms of action of
GTI-2040 and Aracytidine were examined. GTI-2040 is a large molecule with a
168 molecular weight over 6000. Due to its hydrophilic properties and negative charges, it is difficult for GTI-2040 to diffuse freely across the cell membrane. In-vitro studies usually employ cationic lipids to facilitate cellular uptake of GTI-2040; however, none of the cationic lipids has been approved in the clinic and long term infusion to deliver GTI-2040 has been used in the clinic. PK/PD modeling and simulation results revealed the potential need for better develivery of GTI-2040 into the cell, stabilization of drug in the cell and enhanced drug-mRNA binding efficiency.
The mechanism of GTI-2040 is to bind to R2 mRNA in the cell, resulting in the recruitment of RNase H to cleave the drug-mRNA complex and leading to degradation of target R2 mRNA. Therefore, delivery of GTI-2040 into the cell is critical for its antisense activity. A time lag has been found between the maximum plasma GTI-2040 concentrations and maximum R2 mRNA down-regulation (62). Hence, based on the mechanism of GTI-2040, a hypothetical effect compartment was used to link the plasma concentration and pharmacodynamic response. This effect compartment can be viewed as site of action where GTI-2040 binds to R2 mRNA. The processing between central compartment and hypothetical effect compartment was assumed to be an endocytosis mediated cell uptake process. Thus, the Michaelis-Menten saturable equation was used to describe this transport-mediated process. The recruitment of RNase H to cleave drug- mRNA complex would result in stimulation of degradation of target R2 mRNA.
Therefore, an indirect response model with stimulatory effect on degradation of R2
169 mRNA was used to illustrate the mechanism of GTI-2040 in the cell. Based on the
rationale of combination treatment of GTI-2040 with aracytidine as shown in Figure 6.15,
the decrease in intracellular dNTP levels, especially dCTP level by GTI-2040, could
increase deoxycytidine kinase activities which would increase the production of Ara-CTP
from aracytidine in the cell. Furthermore, the decrease in dCTP in the cell will reduce the
competition of dCTP with Ara-CTP, so that more Ara-CTP can be incorporated into
DNA. Therefore, the effect of GTI-2040 was to enhance the Ara-CTP pool in the cell by
down-regulation of R2 mRNA. An indirect response model with stimulatory effect on
synthesis of Ara-CTP was used to demonstrate the mechanism of combination treatment
of GTI-2040 and aracytidine in the cell. Model simulation results revealed that the
parameters related to the disposition of the drug in the cell, such as K30, or stimulation of
R2 mRNA degradation, such as EC50, are also critical for PD response as well as Ara-
CTP accumulation. The parameter IC50 related to stimulation of Ara-CTP formation
would affect the intracellular Ara-CTP level, but not plasma GTI-2040 or R2 mRNA
levels. In contrast, dose escalation would improve the plasma GTI-2040 concentration,
but it would not affect the R2 mRNA or Ara-CTP level. Therefore, the intracellular GTI-
2040 level maybe a more important determinant for R2 mRNA down-regulation and Ara-
CTP accumulation. This PK-PD model may be applicable to future similar studies of 5-
aza C with GTI 2040 and provide a proof of principle for such a study.
6.6 Conclusion
170 GTI-2040 was found to inhibit ribonuclotide reductase by down-regulation of R2
mRNA and protein levels. The inhibition of ribonuclotide reductase by GTI-2040 results
in a decrease in dATP and dCTP levels and increase in Ara-CTP levels, which was found
for the first time. This provides a laboratory and mechanistic justification for the current
phase I evaluation of GTI-2040 in combination with aracytidine in patients with acute
myeloid leukemia. hENT1 has been found to be involved in 5-AzaC transport into the
cell and this may provide important information for future drug resistance studies. PK/PD
modeling and simulation also provides critical insight in the combination treatment of
GTI-2040 and aracytidine.
171
NH2 NH2
N N N
N O N O
HO HO O O H OH H H H H H H OH OH OH Aracytidine 5-aza-cytidine
Hum (R2) mRNA
194 1364 2475 CODING
5’UTR 3’UTR Poly A
626 645 3 ’ GAACCACCTCGCTAAATCGG 5 ’ GTI - 2040 Figure 6.1 Structures of Aracytidine, 5-Azacytidine and GTI 2040.
172
Figure 6.2 Mechanism of action of down regulation of R2 mRNA by GTI-2040.
173
Figure 6.3 Illustration of electroporation.
174
Figure 6.4 Illustration of a two-step ELISA assay in determination of GTI-2040 in leukemia K562 cells (59).
175
R0 infusion
K12 Central CPT Peripheral CPT C1, V1 C2, V2 K10 K21
Vm, Km
Ksyn_04 Kdeg_40 Effect CPT R2 mRNA C3, V3 Inhibition Emax model: (1+Emax*C3/(EC50+C3))
K30
(1-A4/(IC50+A4))
Ara-CTP Ksyn_05 Kdeg_50
Figure 6.5 Simplified PK/PD model of GTI-2040, R2 mRNA and Ara-CTP in the cell.
176
Intracellular GTI-2040 levels following introduction by electroporation
20
15
10 (pmol) 5
0 Intracellular GTI-2040 control 1 5 10 20
GTI-2040 concentration (μM)
Figure 6.6 Intracellular GTI-2040 concentrations using electroporation.
177
R2-mRNA Expression
1.40
1.20
1.00
0.80 * 0.60 *
0.40
Relative R2 mRNA expression Relative R2 mRNA 0.20
0.00
Control 1μM5μM10μM20μM
GTI-2040 concentration Figure 6.7 GTI-2040 down-regulates R2 mRNA. K562 cells were transfected with different dosages of GTI2040 for 24hr and real time PCR was performed to quantify R2 mRNA expression. *Represents a significant difference from the control (p<0.05).
178 GTI-2040 (μM) 01 510 20 30
R2
GAPDH
R2 protein expression 1.20 on i 1.00
0.80 n express i e t 0.60 pro R2 (% of control) of (% 0.40 ve ve ti a l
e 0.20 R
0.00 control 1 μM 5 μM10 μM20 μM 30 μM
GTI 2040 concentrations Figure 6.8 GTI-2040 down-regulates R2 protein. K562 cells were transfected with different dosages of GTI2040 for 24hr and western blot was performed using R2 antibody.
179
Correlation of doses with intracellular GTI-2040 levels
16 y = 0.6909x - 0.399 2 14 R = 0.988
12
10
8
6
4
2 Intracellular GTI-2040 levels 0 0 5 10 15 20 25 -2 GTI-2040 doses (uM)
Figure 6.9 Correlation of GTI-2040 doses with intracellular GTI-2040 levels.
180
Correlation of R2 mRNA expression with intracellular GTI-2040 levels
20 Intracellular amount of GTI-2040 (pmol) 10 0 -10 0 2 4 6 8 10 12 14 16 -20 -30 y = -5.5368x + 0.9058 R2 = 0.8138 -40 -50 -60 -70 -80 Percentage of change R2 mRNA (%) -90
Figure 6.10 Correlation of percentage of R2 mRNA change with intracellular GTI-2040 levels.
181
Correlation of R2 protein expression with intracellular GTI-2040 levels Intracellular amount of GTI-2040 (pmol) 0 0246810121416 -10
-20 y = -4.2895x - 9.173 R2 = 0.6127 -30
-40 (%)
-50
-60
-70 Percentage of R2 protein change change protein R2 of Percentage
-80
Figure 6.11 Correlation of percentage of R2 protein change with intracellular GTI-2040 levels.
182
dTTP ATP/dGTP 120 120 100 110 100 80 90 80 60 70 60 dTTP level 50
(% of control) of (% 40 40
(% of control) of (% 30 20 ATP/dGTP level 20 10 0 0
Control GTI-2040 GTI-2040 GTI-2040 GTI-2040 Control GTI-2040 GTI-2040 GTI-2040 GTI-2040 no drug 1 μM 5 μM 10 μM 20 μM no drug 1 μM 5 μM 10 μM 20 μM
dATP dCTP 120 120
100 100 80 * 80 60 ** 60 *
dCTP level 40
dATP level 40 (% of control) of(% (% ofcontrol) 20 20
0 0
Control GTI-2040 GTI-2040 GTI-2040 GTI-2040 Control GTI-2040 GTI-2040 GTI-2040 GTI-2040 no drug 1 μM 5 μM 10 μM 20 μM no drug 1 μM 5 μM 10 μM 20 μM 140 GTP 140 CTP 120 120 100 100 80 80 60
60 level GTP (% of control) CTP level CTP level 40 40 (% of control) of (% 20 20 0 0
Control GTI-2040 GTI-2040 GTI-2040 GTI-2040 Control GTI-2040 GTI-2040 GTI-2040 GTI-2040 no drug 1 μM 5 μM 10 μM 20 μM no drug 1 μM 5 μM 10 μM 20 μM UTP 140 * 120 ** 100 80
UTP level UTP level 60
(% of control) (% 40 20 0 Control GTI-2040 GTI-2040 GTI-2040 GTI-2040 no drug 1 μM 5 μM 10 μM 20 μM Figure 6.12 Alteration of dNTP and NTP levels by GTI-2040 treatment in K562 cells at varied concentrations for 24 hours in K562 cells (n=3). *Significantly different from the untreated control using t-test (p<0.05).
183
180 * 160 * 140
120
100
80
60
40
20 Percentage of Ara-CTP accumulation (%) 0 control 1uM 5uM 10uM 20uM GTI-2040 treatment Figure 6.13 Ara-CTP accumulations with and without GTI-2040 pre-incubation. Cells were pretreated with various concentrations of GTI-2040 for 24 hr. Then cells were washed and incubated with 10 μM Ara-C for 4 hr. Data are means ± standard deviation of three repicates. *Represents a significant difference from the control (p<0.05).
184
120
100
80 5-AzaC + NBMPR 60 5-AzaC NBMPR 40 Cell viability (% of control) (% viability Cell 20
0 0.0 0.1 1 10 100 Concentration (μM)
Figure 6.14 Human equilibrative nucleoside transporter 1 (hENT1) inhibitor (nitrobenzylthioinosine, NBMPR) protected human leukemia K562 cells against 5-AzaC cytotoxicity. K562 cells were cultured in medium containing graded concentrations of 5- AzaC in the absence ( ) or presence ( ) of 1 μM NBMPR for 72 hrs. Cell viability was measured by MTS assay. Bars means standard deviation from three replicates.
185
us cle Nu DNA Ara-C
R2 m RNA Ara-CMP down -regu lation C Ara-CDP e ll m e m b Ara-CTP r a n e R2 protein down-regulation Increase Intracellular Inhibition GTI-2040 NDP dNDP dNTP depletion
Plasma GTI-2040
Extracellular Figure 6.15 Proposed mechanisms of combination treatment of GTI-2040 and aracytidine.
186 (A)
10000
1000
100 3.5 mg/kg/day 10 7.0 mg/kg/day 15 mg/kg/day 1
0.1 GTI-2040 plasma conc. (nM)
0.01 0 100 200 300 Time (hr)
(B)
100
80 A 60 3.5 mg/kg/day 7.0 mg/kg/day 40 15 mg/kg/day % of mRN R2
20
0 0 100 200 300 Time (hr)
(C)
500
400
300 3.5 mg/kg/day 7.0 mg/kg/day 200 15 mg/kg/day
100 % of Ara-CTP accumulation
0 0 50 100 150 200 250 300 Time (hr)
Figure 6.16 (A) Effect of dose on GTI-2040 plasma concentrations; (B) Effect of dose on R2 mRNA expression; (C) Effect of dose on Ara-CTP accumulation.
187 (A)
10000
1000
100 K30=0.02 10 K30=0.2 K30=2 1
0.1 GTI-2040 plasma conc. (nM) conc. plasma GTI-2040
0.01 0 100 200 300 Time (hr)
(B)
100
80
60 K30=0.02 K30=0.2 40 K30=2 % of R2 mRNA R2 % of
20
0 0 50 100 150 200 250 300 Time (hr)
(C)
500
400
300 K30=0.02 K30=0.2 200 K30=2
100 % of Ara-CTP accumulation
0 0 50 100 150 200 250 300 Time (hr)
Figure 6.17 (A) Effect of K30 on GTI-2040 plasma concentrations; (B) Effect of K30 on R2 mRNA expression; (C) Effect of K30 on Ara-CTP accumulation.
188 (A)
10000
1000
100 EC50=1 10 EC50=10 EC50=100 1
0.1 GTI-2040 plasma conc. (nM)
0.01 0 50 100 150 200 250 300 Time (hr)
(B)
100
80
60 EC50=1 EC50=10 40 EC50=100 % of R2 mRNA R2 % of
20
0 0 50 100 150 200 250 300 Time (hr)
(C)
500
400
300 EC50=1 EC50=10
200 EC50=100
100 % of Ara-CTP accumulation
0 0 50 100 150 200 250 300 Time (hr)
Figure 6.18 (A) Effect of EC50 on GTI-2040 plasma concentrations; (B) Effect of EC50on R2 mRNA expression; (C) Effect of EC50 on Ara-CTP accumulation.
189 (A)
10000
1000
100 IC50=30 10 IC50=60 IC50=90 1
0.1 GTI-2040plasma conc. (nM)
0.01 0 50 100 150 200 250 300 Time (hr)
(B)
100
80
60 IC50=30 IC50=60 40 IC50=90 % of mRNA R2
20
0 0 50 100 150 200 250 300 Time (hr)
(C)
600
500
400 IC50=30 300 IC50=60 IC50=90 200
% of Ara-CTP accumulation 100
0 0 50 100 150 200 250 300 Time (hr)
Figure 6.19 (A) Effect of IC50 on GTI-2040 plasma concentrations; (B) Effect of IC50on R2 mRNA expression; (C) Effect of IC50 on Ara-CTP accumulation.
190
CHAPTER 7
CLINICAL POPULATION PHARMACOKINETICS OF DECITABINE (5-AZA- 2’-DEOXYCYTIDINE) AT LOW DOSES IN PATIENTS WITH HEMATOLOGICAL MALIGNANCIES
7.1 Abstract
The purpose of this study is to characterize the pharmacokinetics of decitabine (5-
aza-2’-deoxycytidine) in patients with acute myeloid leukemia (AML) and chronic
lympholic leukemia (CLL) using a population pharmacokinetics model. Covariates
influencing variability among patients have been identified to provide the optimal dosing
strategies for patients with AML and CLL. Pharmacokinetic (PK) data were obtained
from 33 patients enrolled in a phase I clinical trial (Protocol OSU #0336) of decitabine
alone or in combination with valproic acid in patients with AML and CLL. Decitabine at
doses ranging from 10 to 20 mg/m2/d was administered once daily as a 1 hr i.v. infusion for 10 days alone or in combination with valproic acid, which was administered as an oral dose from 15 to 25 mg/d. Plasma decitabine levels were quantified using a validated liquid chromatography/tandem mass spectrometric (LC-MS/MS) method. Compartment and non-compartment pharmacokinetic analyses were assessed using WinNonLin computer software. Population pharmacokinetic analysis was performed using
191 NONMEM. Maximum plasma concentrations (Cmaxs) of decitabine were found to be attained at 0.5 hr for most patients (57%). Median Cmax values were found to increase with increasing doses. In CLL patients, the median Cmax values were 0.87± 1.11 and
1.08 ± 0.82 μM at doses of 10 mg/m² and 15mg/m², respectively. In AML patients, the median Cmax values were 0.93 ± 0.78 and 1.15 ± 0.94 μM at doses of 15 mg/m² and
20mg/m², respectively. The pharmacokinetics of decitabine was well characterized by a two-compartment model. The drug was found to be rapidly cleared from circulation with an average terminal half life of 18 min. Typical population values of total systemic clearance and central volume of distribution were 2.23 L/min and 6.71 L, respectively.
Body surface area was correlated with clearance. Population PK simulation of various doses from 10 mg/m2/h/d to 100 mg/m2/h/d indicated that the dosing regimens of 15 to 20
mg/m2/h would reach the target effective concentrations (0.1-10 μM) given a 1h i.v.
infusion. Based on this Population PK model, dosing regimen for decitabine is found to
be optimized based on the body surface area that has been found to correlate with
patient’s clearance.
7.2 Introduction
Decitabine (5-aza-2’-deoxycytidine, Dacogen, Fig. 7.1), a nucleoside analogue with
significant activity against a variety of solid tumors and hematologic malignancies (73-
75,173,174) has recently been approved by the FDA for the treatment of myelodysplastic
syndrome (MDS). Decitabine was found to have two different pharmacologic actions. At
192 higher doses (i.e., 50-100 mg/m2/day), it acts primarily as a cytotoxic agent due to its
incorporation into DNA, leading to inhibition of DNA synthesis and cell death (2,3),
while at lower doses (i.e., 5-20 mg/m2/day) it induces DNA demethylation, resulting in
reactivation of hypermethylation-associated silencing of tumor suppressor genes (4,5),
and hematopoietic differentiation (77,78,175). Preclinical studies indicated that
hypomethylation effect is lost at high doses (4). Several phase I/II trials for solid tumors
and different types of leukemia have been conducted in the US and Europe (225). High-
dose treatment exhibits limited efficacy against solid tumors. However, low-dose
treatment showed higher activity for the treatment of haematological malignancies (6,7).
More importantly, at these lower doses, clinical response with toxicity lower than that observed at the higher doses has been reported (8-12,226).
Sequential exposure of leukemia cell lines HL-60 and MOLT4 to histone deacetylase inhibitors (e.g. valproic acid, VA), following decitabine showed synergistic reactivation of p57KIP2 and p21CIP1 (79). A phase 1/2 clinical trial of the combination of decitabine with VA in patients with leukemia indicated that this combination therapy in leukemia was safe and active (8). A randomized study of 3 schedules of low-dose decitabine in higher-risk myelodysplastic syndrome and chronic myelomonocytic
leukemia suggested that 5-day intravenous schedule, which had the highest dose
intensity, optimizes epigenetic modulation and clinical responses in MDS (227).
193 Phase I pharmacokinetics study of high dose decitabine indicated that peak plasma
drug concentrations were achieved at 0.244 and 0.409 μM given 30 mg/m2 and 60 mg/m2 doses, respectively (76). Rapid disappearance of drug from plasma was determined, following cessation of the infusion, with a t1/2 alpha and t1/2 beta of 7 and 35 min,
respectively. High clearance values and a total urinary excretion of less than 1% of the
administered dose suggest that decitabine is eliminated rapidly and largely by metabolic
processes.
Despite its exciting anti-leukemia effects, the pharmacokinetics of decitabine, when
given at low doses, has not been well-characterized until recently, most likely due to a
lack of a sensitive and specific quantitation method of decitabine in plasma. We have
characterized the preliminary pharmacokinetics of decitabine at low doses using a
recently developed sensitive LC/MS/MS method (145). Herein, we further characterized
pharmacokinetics of decitabine at low doses using population pharmacokinetics analysis
to identify sources of variability during drug development. After establishing and
validating the model, individual empirical Bayesian estimates were used to evaluate
different dosing strategies.
7.3 Methods
194 7.3.1 Drug Administration
Decitabine was obtained from the Cancer Therapy Evaluation Program, National
Cancer Institute (NCI, Bethesda, MD). Decitabine was administered as a 1 h infusion daily x 10 for a 28 days cycle according to the dose escalation schema. Valproic acid (2- propylpentanoic acid, VA) is provided as a commercially available 250 mg capsules.
Valproic acid was given three times daily (approximately every 8 h) as oral dose following a dose escalation schema.
7.3.2 Clinical Trial Design
Patients with AML or CLL were treated with decitabine alone or in combination with valproic acid in the phase I trials (Protocol OSU #0336) at the James Cancer
Hospital at the Ohio State University. The trials involved administration of decitabine as a continuous intravenous infusion alone or in combination with VA administered orally to determine the safety, toxicity, and pharmacokinetics of decitabine. Informed consent was obtained on all patients prior to study entry. All of the patients gave written informed consent approved by the institutional review board under guidelines of the Department of
Health and Human Services. All toxicities were graded by the National Cancer Institute
Common Toxicity Criteria (version 2.0) of the Cancer Therapy Evaluation Program.
195 There were two steps for AML patients. In Step A, decitabine was given as a 1 h
i.v. infusion from the starting dose of 15 mg/m2/day in an escalating dosing schedule. In
Step B, decitabine was combined with escalating doses of VA (days 5-21) following a classic 3+3 phase I design schema to determine the MTD of the combination. VA was administered beginning at 15 mg/m2/day by mouth in three divided doses and escalated
by approximately 25% for each dose level.
7.3.3 Pharmacokinetic Sampling and Assay
Blood samples were collected before decitabine administration, then at 5, 10, 15,
30, 60, 65, 75, 90, 120, 150, 180, 240, 360 and 480 min after initiation of i.v. infusion of
decitabine on Day 1 and Day 10. Blood samples were collected on ice and plasma was
separated by centrifugation at 3,000 g for 5 minutes in a refrigerated centrifuge within 30
minutes and stored at -80°C until analysis. Decitabine was quantified in plasma using a
validated LC/MS/MS method developed in our laboratory (145). Briefly, plasma samples
(200 μL) were extracted using Oasis MCX ion exchange solid-phase extraction cartridges
(Waters Corp, Milford, MA). Decitabine was separated on a 250 x 2.1 mm Hypersil
Aquasil C18 5 μm stainless steel column (Thermo Hypersil-Keystone, Bellefonte, PA),
which was coupled to a 2 μm Aquasil pre-column (Thermo Hypersil-Keystone,
Bellefonte, PA) using the mobile phase consisting of 5% acetonitrile in 10 mM
ammonium formate at the flow rate of 0.2 mL/min and the LC eluate was introduced into
196 the ESI source of TSQ quantum EMR triple quadruple mass spectrometer (Finnigan, San
Jose, CA). Due to the instability of decitabine in plasma, all processing and handling of
decitabine samples was either carried out in an ice-bath or in a refrigerator. LC-MS/MS analysis was performed in positive-ion multiple reaction monitoring mode with ion transitions at m/z 229.1/113.0 and 247.0/115.0 for decitabine and the internal standard,
5,6-dihydro-5-azacytidne, respectively. The lower limit of quantification of decitabine was 0.2 ng/mL (0.877 nM) in human plasma.
7.3.4 Pharmacokinetic Analysis and Statistics
Individual concentration-time data were analyzed using non-compartment or compartment methods with an appropriate compartment model, using WinNonlin
Professional version 5.0 (Pharsight, Mountain View, CA). Relevant pharmacokinetic parameters (Tmax, T1/2, Cl, and Vd) were compared using a Student’s t test. One-way analysis of variance (ANOVA) was used to compare the differences in clearance as a function of dose level. ANOVA and Student’s t test were performed using JMP Statistical
Discovery software (version 4.0.4; SAS Institute, Cary, NC). The significance level was
set at p=0.10. Population pharmacokinetic analysis of decitabine was performed using
the nonlinear mixed-effects modeling approach implemented in NONMEM (version V,
level 1; GloboMax, Hanover, Md), which was compiled using Compaq Visual Fortran
version 6.6 with a Pentium M 1.4-GHz processor. The first order conditional estimation
197 (FOCE) with interaction (σ-Ω interaction) method was used to estimate population PK values of decitabine during model building procedure. The likelihood ratio test and goodness-of-fit plots were employed to select the best model. The pharmacokinetic model was developed in three steps as shown in Table 7.1: 1) pharmacostatistical base model (covariates free) development; 2) full model (with covariate) development and; 3) final model development. A predictive check and a bootstrap analysis were used to validate and evaluate the final population pharmacokinetic model. Different dosing regimens have been evaluated using final validated population pharmacokinetic model.
7.4 Results
7.4.1 Clinical Pharmacokinetic Analysis and Statistics
A decitabine plasma concentration-time profile is depicted in Figure 7.2. In order to investigate the relationship of Cmax and AUC with doses, non-compartment pharmacokinetic analysis was performed due to the fact that non-compartment PK analysis obtained Cmax and AUC from actual data points and provided a more reliable
Cmax and AUC compared to compartment PK analysis which obtained Cmax and AUC from fitted regression. Therefore, overall 33 patients’ data from phase I clinical trial of decitabine alone or in combination with valproic acid in patients with AML and CLL were analyzed in non-compartment pharmacokinetic analysis and the relevant
198 pharmacokinetic parameters obtained are listed in Table 7.2. The mean values of Cmax and AUC among different doses were compared and the results are shown in Figure 7.3.
Based on the non-compartment analysis, maximum plasma concentration (Cmax) was rapidly achieved at 0.5 hrs for most patients (57%) (Table 7.2). Mean Cmax values were 0.87± 1.11, 1.08 ± 0.82, 0.93 ± 0.78, and 1.15 ± 0.94 μM at 10 mg/m² in CLL patients, 15 mg/m² in CLL patients, 15 mg/m² in AML patients and 20 mg/m² in AML patients for decitabine alone, respectively (Table 7.2). As shown in Figure 7.3 A, mean
Cmax was found to increase with increasing doses. AUC increased from 39.59 ± 42.19
μM*min at 10 mg/m2 in CLL patients to 53.55 ± 31.35 μM*min at 20 mg/m2 in AML patients for decitabine alone (Table 7.2). As shown in Table 7.3, there were no significant differences among doses (10, 15 and 20 mg/m²) for dose adjusted AUC and dose adjusted
Cmax in CLL and AML patients treated with decitabine alone, suggesting dose independent kinetics within these single decitabine doses. The overall apparent volume of distribution and apparent clearance was 61.9 L and 2.45 L/min, respectively. It is noteworthy that no decitabine was detected in the pretreatment samples after repetitive dosing, indicating no accumulation in the pretreatment samples. However, as shown in
Table 7.4, both Cmax and AUC values decreased significantly in AML patients combined with valproic acid (step B) (p<0.1), which may result from the drug-drug interaction between decitabine and valproic acid.
199 To further investigate underlying inter-individual variability of pharmacokinetic
behaviors in patients, a two compartment model as shown in Figure 7.4 was used to
characterize the pharmacokinetics of decitabine. All of the parameters obtained from the two compartment model in AML patients were used as initial estimates for further population pharmacokinetic analysis. Two compartment pharmacokinetic parameters in
all three clinical trials are summarized in Table 7.5.
The overall central volume of distribution (V1) and peripheral volume of
distribution (V2) were 8.7 L and 16.47 L, respectively (Table 7.5). The overall clearance
(CL) and inter-compartmental clearance (Q) were 2.41 L/min and 0.42 L/min,
respectively. Inter-patient variation in CL and V1, which was defined as the difference
between the minimum and maximum value, was 3 to 10 fold.
7.4.2 Population Pharmacokinetic Analysis and Statistics
Demographic and clinical characteristics of cancer patients were summarized in
Table 7.6. Based on the results from the clinical pharmacokinetic analysis of decitabine at
different doses, a two-compartment open model with a constant input rate was
determined to be an appropriate base model. The summary of covariate data of patient
population is listed in Table 7.7.
200 Proportional between-patient variability for V1, V2, CL and Q and a mixed proportional and additive residual error term were incorporated into the base model.
Body surface area (BSA) was identified as the only covariate associated with clearance
(CL). Incorporating BSA into the final model can significantly decrease the objective function (ΔOBF=225.6).
As shown in Figure 7.5 A, BSA was found to be highly correlated with CL obtained from the base model. Incorporating other covariates, such as creatinine clearance, albumin, hemoglobin and total protein into the base model, did not significantly decrease the objective function. The estimation of parameters from the final model and 859 out of
1000 successful bootstrap runs of the final model are summarized in Table 7.7. The values of parameters from the final model were close to the median from the bootstrapping analysis and were all within the 90% confidence interval which indicated precision and stability of the final model. Goodness of fit (Figure 7.6) was plotted as diagnostic plot. As shown in Figure 7.6, scatter plots of weighted residuals vs individual posterior predicted or model predicted have shown random distribution of data points across the base line which indicated the goodness of fit of the model to our data. As shown in Figure 7.7 A, observed concentrations deviated slightly from predicted model values at low concentrations; however, scatter plots of observed concentrations versus individual posterior predicted values (Fig. 7.7 B) have shown an even distribution along
201 the line, which indicated that individual posterior predicted based on the final model
provided a better prediction for observed concentrations.
The visual predictive check was used to validate the predictive ability of the final
model. The results of the predictive check, between 0 and 150 min, in which 1000
datasets were simulated from the final PK parameter estimates, and observed decitabine
plasma concentrations, are depicted in Figure 7.8. The majority of the observed
decitabine plasma concentrations are within the range of the simulated upper (95%) and
lower (5%) quantiles of the simulated concentrations which validated the predictive
ability and robustness of the final population pharmacokinetics model.
Minimum and maximum decitabine plasma concentrations were identified as 0.1
μM and 10 μM in previous clinical studies to produce pharmacodynamic effects in
tumors (3,228). Since the maximum plasma concentration was reached at t=30 min for
most patients (57%) and drug concentration dropped dramatically after 1 h infusion,
decitabine plasma concentrations at t=30 and t=60 min were simulated to assess the
percentage of patients who can reach target plasma concentration during a 1 h infusion.
As shown in Table 7.8, six different clinically used dosing regimens have been compared,
based on the simulation from final population pharmacokinetic model. The dosing
regimens 15 mg/m2/h to 20 mg/m2/h appear to be the most likely to acheive target concentrations.
202
7.5 Discussion
Recently, low-dose decitabine has been investigated in several clinical trials as a
hypomethylating agent to re-activate silenced tumor suppressor genes through DNA
demethylation. The understanding of the pharmacokinetic behavior of decitabine is
important in assessing the distribution and elimination processing of decitabine as well as
optimal dosing design. However, due to the instability of decitabine in plasma and low
sensitivity of the analytical method, few studies have been performed to characterize the
pharmacokinetics of decitabine and only at high doses (76,229). Pharmacokinetics of
decitabine in cancer patients was evaluated at i.v. bolus doses between 75 to 100 mg/m²,
using a bioassay with the limit of quantitation (LOQ) at 0.1 μg/ml (76). However, the
method is incapable of measuring plasma levels of decitabine in cancer patients given
low-dose decitabine (=/<15 mg/m2). Thus, we have recently developed and validated a
highly sensitive and specific LC/MS/MS method for measurement of decitabine in
plasma with a LLOQ of 1 ng/mL. This method enables us to fully characterize the
pharmacokinetics of decitabine in AML patients following a 1 hr i.v. infusion of
decitabine at 15-20 mg/m2 (80). Herein, this report provides a full description of pharmacokinetic and a population pharmacokinetic analysis of decitabine at low dose.
Noncompartmental analysis requires fewer assumptions than necessary when
compared with compartmental analysis. Additionally, it also circumvents some of the
203 problems that are common in compartmental analysis. Especially in large population PK
analysis in the clinic, pharmacokinetic profiles of drugs for each individual patient, using compartment PK analysis, is sometimes rather difficult due to variability among patients.
On the other hand, noncompartmental PK analysis provides more reliable parameters
such as Cmax and Tmax, which utilizes actual individual plasma concentration-time data,
than that in conventional compartment analysis. Therefore, non-compartment analysis of
plasma decitabine in AML and CLL patients treated with decitabine alone was performed
first, which demonstrated dose-independent clearance as shown in Table 7.3. However,
when combined with valproic acid, both mean Cmax and AUC values decreased
statistically significantly as compared with those with the single drug (P<0.1) (shown in
Table 7.4), suggesting potential drug-drug interaction of decitabine with valproic acid.
Decitabine was found to be rapidly eliminated with a terminal half life from 11 to 49 min
and clearance values from 1.76 to 5.95 L/min (table 7.2). Previous studies indicated that
renal clearance was not the major clearance pathway for decitabine (76). This was further
confirmed in the current study with population pharmacokinetic analysis that creatinine
clearance could not explain inter-patient variability, and the incorporation of creatinine
clearance into population PK base model did not significantly decrease objective function
value. In vitro and in vivo metabolic studies of decitabine in mouse liver and spleen
indicated that decitabine was degraded by cytidine deaminase in liver and extensively
phosphorylated and incorporated into DNA in spleen (230). A lower clearance of
decitabine at low dose (15-20 mg/m2) compared to that previously reported at higher
204 doses (100 mg/m2) (76) indicated that the elimination process was not saturated at low doses.
In the current study, the pharmacokinetics of decitabine was adequately described by a two compartment open model with a constant rate infusion. The typical systematic
CL was found to be 2.23 L/min, V1 was 6.71 L, V2 was 7.74 L and Q was 0.283 L/min, based on the final population pharmacokinetic model. BSA was identified as the only covariate incorporated into the final model. Decitabine is eliminated primarily by metabolic processing as reported previously (230). Thus, patient BSA may correlate with
certain enzyme activities such as cytidine deaminase and deoxycytidine kinase in liver, which would affect the metabolism of decitabine; however, this hypothesis needs to be further confirmed by in vitro enzymatic kinetic experiments. The inter-patients variability
in V2 and V1 was large, probably due to instability of decitabine in plasma or the
variation in extent of degradation of decitabine by deamination or phosphorylation
among patients.
Recent studies suggest that the optimal dosing rate of decitabine was about 1-2
mg/kg/h based on the Km value of deoxycytidine kinase, the concentration of drug at
which the enzyme reaction takes place at 50% of its maximum velocity (228). Simulation
was then conducted to compare the currently used low dose (10-20 mg/m2) and empirically high dose regimens (75-100 mg/m2). The dosing regimens 15-20 mg/m²/h
205 provide a relatively large proportion of patients with achievable effective target concentration (0.1-10 μM), indicating that the currently used dosing regimens are suitable for reaching the desired target concentrations (0.1-10 μM). The equations for decitabine clearance as described in final population PK model (Table 7.1) could be used to individualize the dosage rate for continuous infusion administration as follows: dose
(mg/h) = 30.506*(BSA/1.85)^1.64*target Css (μM). However, further refinement of dosing regimes needs to be done to assess the clinical applicability and safety of proposed dosage rate, including accurate evaluation of nucleoside-specific transport, deoxycytidine kinase and deaminase activities.
7.6 Conclusion
In summary, the pharmacokinetics of decitabine has been described and a population pharmacokinetic model was developed to identify inter-patient variability.
Additional pharmacokinetic studies should address the impact of drug-drug interaction on pharmacokinetic characterization.
206
Base model: Final model:
CL=θ(1)*EXP(ηCL) IF (OCC.EQ.1) BOV=ETA(5) V1=θ(2)*EXP(ηv1) IF (OCC.EQ.2) BOV=ETA(6) V2=θ(3)*EXP(ηv2) Q=θ(4)*EXP(ηQ) CL= θ (1)*(BSA/1.85)**THETA(2)*EXP(ηCL +BOV) Yij=Cij *(1+εij) V1= θ (3)*EXP(ηv1+BOV) V2= θ (4)*EXP(ηv2+BOV) Q= θ (5)*EXP(ηQ +BOV) D1= θ (6)+ETA(7)+BOV
Yij= Cij + W* εij (1)+ εij (2)
Table 7.1 Population PK base model and final model.
207
Patients Dose No. of Vd (L) Cmax Tmax (mg/m²) Patients (μM) ( min) CLL 10 4 53.83±20.42 0.87±1.11 30±8.94
CLL 15 4 65.60±92.24 1.08±0.82 10±18.07
AML- 15 8 75.33±71.45 0.93±0.78 30±6695.17 step A AML- 20 6 52.84±41.05 1.15±0.94 30±6763.61 step A AML- 20 11 290.73±1426.9 0.552±0.70 60±6630.97 step B
Patients Dose No. of T1/2 AUC CL (mg/m²) Patients (min) (μM*min) (L/min) CLL 10 4 15.64 ±37.12 39.58±42.19 1.76±1.81
CLL 15 4 21.63±15.50 43.95±28.02 2.62±1.21
AML- 15 8 14.24±11.69 45.54±33.25 2.62±3.28 step A AML- 20 6 11.24±4.17 53.55±31.35 2.77±4.56 step A AML- 20 11 49.35±60.15 30.22±33.59 5.95±7.50 step B
Table 7.2 Summary of relevant pharmacokinetic parameters of decitabine in patients with hematologic malignancies based on noncompartment analysis. Vd, apparent volume of distribution; Cmax, maximum plasma concentration; Tmax, time to maximum concentration; T1/2, terminal half-life; AUC, area under the concentration; CL, clearance. Data represented the median ± SD.
208
Doses (mg/m²) T-test p-values (n=22) Parameters normalized to doses: AUC/doses Cmax (hr* (μM/mg/ V (L/m2) μM/mg/m2) m2) CL (L/hr/m2)
10 vs 15 0.455 0.506 0.708 0.543 10 vs 20 0.266 0.344 0.174 0.190 15 vs 20 0.145 0.288 0.047 0.396
Table 7. 3 T-test P-values for Non compartmental PK parameters at various doses with decitabine alone. There is no significant difference among various doses.
209
Trials with T-test decitabine given p-values (n=11) at 20 mg/m² Parameters normalized to doses: AUC/doses Cmax (hr* (μM/mg/ V (L/m2) μM/mg/m2) m2) CL (L/hr/m2)
Step A 0.1* 0.05* 0.049* 0.101 (decitabine alone) vs step B (combination treatment of decitabine and valproic acid) *Statistically significant at p<0.1
Table 7. 4 T-test P-values for Non compartmental PK parameters at 20 mg/m² dose with decitabine alone (step A) or in combination with valproic acid (step B).
210
Patients Dose No. of V1 V2 CL (L/min) Q (mg/m²) Patients (L) (L) (L/min) CLL 10 4 7.27±9.39 9.75±74.59 1.79±1.28 0.80±0.58
CLL 15 4 7.87±11.87 10.94±15.87 2.70±1.19 0.31±0.27
AML-step A 15 8 4.90±9.83 18.48±265.07 2.48±1.16 0.56±0.42
AML-step A 20 6 4.30±1.19 8.77±1.51 2.34±0.59 0.40±0.07
Overall 22 5.05±9.28 10.41±165.06 2.41±1.03 0.42±0.62
Table 7.5 Summary of relevant pharmacokinetic parameters of decitabine in patients with hematologic malignancies based on a two compartment analysis: V1, volume of distribution of central compartment; V2, volume of distribution of peripheral compartment; CL, clearance; Q, inter-compartmental clearance. Data represent the median ± SD.
211
Continuous Median Range (Min-Max) Age (years) 70 37-83 Weight (pounds) 164.2 118-243.8 Height (feet) 6’7 5’9-7’2 BSA (m²) 1.85 1.47-2.22 Serum Creatinine (mg/dL) 0.91 0.6-1.71 Albumin (g/dL) 3.5 1.8-4.0 Hemoglobin (g/L) 9.2 7.6-10.9 Total Protein 6.3 5.8-7.5 Bili 0.8 0.2-1.5 Categorical No. of patients Percentage ( % ) Sex Male 14 64 Female 8 36
Table 7.6 Summary of demographic and clinical characteristics of cancer patients.
212
Parameter description Final model Median (B) 90% CI (A) (B) Fixed parameters CL(L/min)= θ1*(BSA/1.85)**θ2 θ1 2.23 2.25 1.82-3.05 θ2 1.64 1.51 0.404-3.06 V1(L)= θ3 θ3 6.71 7.18 4.18-23.3 V2(L)= θ4 θ4 7.74 8.64 5.22-25.5 Q(L/min)= θ5 θ5 0.283 0.275 0.172-0.43 Interindividual variability CL(%CV)ωCl 24.4 24.3 4.25-56.1 V1(%CV)ωv1 81.4 81.6 40.4-134.5 V2(%CV)ωv2 88.6 79.1 39.1-132.6 Q(%CV)ωQ 40.1 42.6 5.17-89.8 Residual variability σprop(%CV) 33.7 33.76 29.6-40 σadd (nM) 3.49 3.56 0.88-7.11
Note: θ 1: typical value of CL; CL= θ1*(BSA/1.85)**θ2*EXP(η1) where 1.85 is the median value of BSA
Table 7. 7 Population pharmacokinetic parameter estimates for decitabine obtained from final model (A) and 859 bootstrap runs of the final model (B).
213
Peak Con. C30 (μM) Dosing Median 5th 95th % strategy percentile percentile percentage 2mg/kg/h/da 5.54 1.85 13.22 79.49 10mg/m2/h/da 0.727 0.226 1.67 100 15mg/m2/h/da 1.09 0.339 2.51 100 20mg/m2/h/da 1.45 0.452 3.34 100 75mg/m2/h/da 5.72 1.69 13.4 75 100mg/m2/h/da 7.62 2.26 19.6 65.6
C60 (end of infusion) (μM) Dosing Median 5th 95th % strategy percentile percentile percentage 2mg/kg/h/da 1.46 0.43 3.89 100 10mg/m2/h/da 0.174 0.0549 0.519 79.82 15mg/m2/h/da 0.262 0.0824 0.778 91.22 20mg/m2/h/da 0.349 0.11 1.04 96.49 75mg/m2/h/da 1.36 0.412 5.36 100 100mg/m2/h/da 1.82 0.55 7.15 93.7 aDecitabine was given once daily for 10 days as i.v infusion for 1 h
Table 7. 8 Comparison of different dosing strategy at C30 (Peak concentration) and C60 (end of infusion).
214
NH2
N N
N O
HO O H H H H OH Figure 7. 1 Chemical structure of decitabine.
215
10000
1000
100
10 Concentration (nM)
1
0.1 0 20 40 60 80 100 120 140 160 Time (min)
Figure 7. 2 Decitabine plasma concentration versus time profiles. Shaded, dashed lines and solid lines represent the hematologic malignancies patients treated at 10, 15 and 20 mg/m2, respectively.
216
A. B.
3500 140000
3000 120000
2500 100000
2000 80000 median median mean mean 1500 60000 Cmax (nM) AUC (min*nM)
1000 40000
500 20000
0 0 0101520 0101520 Dose (mg/m²) Dose (mg/m²)
C. D.
140000 3500
120000 3000
100000 2500
80000 2000 median median mean mean 60000 1500 Cmax (nM) AUC (min*nM) AUC 40000 1000
20000 500
0 0 20mg/m² 20mg/m² 20mg/m² 20mg/m² 0 Step A Step B 3 0 Step A Step B 3 clinical trials clinical trials
Figure 7.3 A. Decitabine AUC as a function of dose for CLL and AML patients with decitabine alone (step A) based on noncompartment ananlysis. B. Cmax values of decitabine as a function of dose in CLL and AML patients with decitabine alone (step A) based on noncompartment ananlysis. C. Decitabine AUC values as a function of dose in AML patients with decitabine alone (step A) and in combination with valporic acid (step B) based on noncompartment ananlysis. D. Cmax values as a function of dose in AML patients with decitabine alone (step A) and in combination with valporic acid (step B), based on noncompartment ananlysis. The solid line represents the median concentration. The triangles represent mean concentrations.
217
Figure 7.4 A two compartment model for pharmacokinetic analysis of decitabine in leukemia patients.
218 A)
Base model
2.00
1.50
1.00
0.50
ETA_CL 0.00 1.0 1.2 1.4 1.6 1.8 2.0 2.2 2.4 2.6 2.8 3.0 -0.50
-1.00
-1.50 BSA (m2)
B)
Final model
2.00
1.50
1.00
0.50
ETA_CL 0.00 1.0 1.2 1.4 1.6 1.8 2.0 2.2 2.4 2.6 2.8 3.0 -0.50
-1.00
-1.50 BSA (m2)
Figure 7.5 A) A scatter plot of inter-individual variability of clearance (ETA_CL) versus body surface area (BSA) in base model; B) A scatter plot of inter-individual variability of clearance (ETA_CL) versus body surface area (BSA) in final model.
219
A.
8
6
4
2
0 WRES -2
-4
-6
-8 0 50 100 150 200 250 300 350 400 IPRE
B.
8
6
4
2
0 WRES -2
-4
-6
-8 0 50 100 150 200 250 300 350 400 PRED
Figure 7.6 A) A scatter plot of weighted residuals vs individual posterior predicted (IPRED, nM); B) A scatter plot of weighted residuals vs model predicted (PRED, nM) in the whole data set (N = 22).
220
A) 3000
2000 DV
1000
0 500 1000 PRED
B) 3000
2000 DV
1000
0 1000 2000 IPRED
Figure 7.7 A) Scatter plots of observed concentration (DV, nM) versus model predicted (PRED, nM, upper); B) Scatter plots of observed concentration (DV, nM) versus individual posterior predicted (IPRED, nM, lower) in the whole data set (N = 22).
221
10000
1000
100
10
1 Concentration (nM)
0.1 0 20 40 60 80 100 120 140 160 Time (min)
Figure 7.8 Predictive check of the final two-compartment pharmacokinetic model between 0 and 150 min. A number of 1000 data sets were simulated from the final pharmacokinetic parameter estimates using NONMEM. Depicted are the observed decitabine plasma concentrations (dots), upper (95%, upper dashed line) and lower (5%, lower dashed line) quantile of the simulated concentrations and median concentration (dashed line) vs. time.
222
CHAPTER 8
CONCLUSIONS AND PERSPECTIVES
In this dissertation, quantification method development for nucleoside and
nucleotides, biochemical modulation of combination treatment of nucleoside and
ribonucleotide reductase inhibitor, and PK/PD modeling and simulation have been
extensively investigated to support the clinical assessment and development of
combination treatment for patients with acute myeloid leukemia.
In order to support the mechanistic studies of anti-cancer drug development, a
sensitive and specific quantification method for intracellular nucleotides pool
(dNTP/NTP) is needed, since a number of ribonucleotide reductase inhibitors or
nucleoside analogues such as GTI-2040 and Aracytidine interfere with DNA and RNA
synthesis and/or their nucleoside triphosphates (NTPs) and deoxynucleoside
triphosphates (dNTPs) precursors. A non-radioactive, sensitive and specific LC-MS/MS
method has been developed to quantify intracellular NTP and dNTP pools in cell
matrices. With this practical tool, it becomes possible to measure intracellular dNTP and
NTP levels in different cell lines and their perturbation by anticancer agents which would help to explore the mechanism of new anticancer drugs. Our present study provides a
223 useful tool for further measurement of biochemical modulation of nucleotide pools by
various anti-cancer nucleoside analogs and nucleotide reductase inhibitors. Direct
measurement of nucleotide pools provides important information for future combination
therapies. Furthermore, one could apply this method to accurately characterize basal level
and perturbation of dNTP and NTP levels in patient peripheral blood mononuclear cell
(PBMC) and bone marrow cell lysates during and following chemotherapies. With a
correlation of intracellular dNTP/NTP levels in patients PBMC/bone marrow cells and
plasma drug concentrations, biomarkers such as mRNA and protein levels and clinical
responses could be evaluated which could provide valuable insights in improvement of
therapeutic effect of anticancer drugs or combination treatment.
5-Azacytidine (5-AzaC) has been shown to have a wide range of antitumor
activities for the treatment of myelodysplastic syndrome (MDS), myeloid leukemia, and
other forms of neoplasia. 5-AzaC has produced remission or clinical improvements in
more than half of the patients treated at low doses (137,138). However, little or no pharmacokinetic information of 5-AzaC was available due to a lack of proper analytical
methodology. In order to characterize pharmacokinetic behavior of 5-AzaC at low doses,
a sensitive and specific method for 5-AzaC quantification is need in clinical studies. In
Chapter 3, a highly sensitive and specific HPLC-MS/MS analytic method for
quantification of 5-AzaC in human plasma has been developed with its LLOQ as low as 1
ng/ml, which is 5 times more sensitive than previous reported methods (72). This LC-
224 MS/MS assay allows the accurate characterization of pharmacokinetics of 5-AzaC at low doses in the clinic. Additionally, this method is simple and rapid and it is now possible to analyze large patient samples in a clinical setting. Thus, population pharmacokinetic analysis of 5-AzaC at low doses becomes possible, and patients covariates could be identified to identify possible variability in pharmacokinetic parameters among patients.
Furthermore, with this practical tool, one could evaluate PK/PD correlations of 5-AzaC with PD endpoints, biomarkers and disease response in the clinic.
Inside the cell, 5-AzaC needs to be phosphorylated to its active anabolite, 5-Aza-
CTP, before incorporation into RNA, leading to inhibition of DNA/RNA synthesis or epigenetic silencing of important regulatory genes. Thus, it is also critical to develop a sensitive and specific method to quantify 5-Aza-CTP in the cell. In future studies, one could adapt our dNTP/NTP assay to measure intracellular 5-Aza-CTP level. The similar physico-chemical properties, exact molecular weight and fragmentation pattern of 5-Aza-
CTP and endogenous UTP in the cell may pose a considerable challenge for the accurate separation and quantification of 5-Aza-CTP in cell matrices. Reduction of 5-Aza-CTP into dihydro-5-Aza-CTP in sample preparation may be necessary to achieve acceptable resolution of 5-Aza-CTP from endogenous nucleotides. Furthermore, the same internal standard 2-Cl-ATP used in measurement of dNTP/NTP levels could also be used in quantification of 5-Aza-CTP because base line resolution could be achieved between these two molecules.
225
Aracytidine (Ara-C) is widely used for the treatment of leukemia, including acute myeloid leukemia (146) and acute lymphocytic leukemia (147). Inside the cell, Ara-C undergoes a three-step phosphorylation to its active anabolite, Ara-CTP before incorporation into DNA, resulting in inhibition of DNA synthesis, induction of DNA
single stand breakage, and chromosome damage (85,86). The determination of Ara-CTP
is of critical importance for monitoring the effect of drug treatment and designing the optimal dose regimen of Ara-C therapy in the clinic. A non-radioactive, sensitive and specific HPLC/UV method has been developed to quantify intracellular Ara-CTP levels.
This method could be used to characterize the accumulation effect of Ara-CTP as a single drug or in combination treatment with other agents. This would facilitate examination of the therapeutic outcome. Additionally, with this sensitive method, it is possible to screen potential candidates for combination treatment with aracytidine, which would extensively increase the therapeutic options and strategies in the clinic. The successful development of this assay provides us a useful tool to further explore the mechanism and clinical pharmacology of Ara-C. In future studies, one could apply this method to clinical pharmacokinetic studies to monitor intracellular Ara-CTP in patients’ PBMC and bone marrow cells and this information would provide important insights into clinical applications of aracytidine and/or in combination with other drugs. A distribution and disposition of Ara-CTP in patient samples could also be evaluated which could assist the metabolism study of aracytidine and future clinical trials.
226
A novel ribonuclotide reductase inhibitor, GTI-2040, was found to down-regulate
R2 mRNA and protein levels in a dose dependent manner. dATP and dCTP levels were found to decrease significantly, ~2-fold (p<0.05), after GTI-2040 treatment (>5 μM) using a sensitive and validated HPLC-MS/MS method; however, no significant change has been found in other nucleoside triphosphate levels. These results confirmed the proposed mechanism of action of GTI-2040. More importantly, the inhibition of ribonuclotide reductase by GTI-2040 resulting in a decrease of dATP and dCTP levels was found for the first time and provided theoretical support for the combination treatment of GTI-2040 and aracytidine. In addition, the increase in the intracellular aracytidine triphosphate level after treatment with GTI-2040 in vitro using a HPLC-UV method provides a laboratory and mechanistic justification for the current phase I evaluation of GTI-2040 in combination with aracytidine in patients with acute myeloid leukemia. PK/PD modeling and simulation results indicated that parameters related to the cellular uptake of the drug, such as Vm and Km, are important for PD response as well as
Ara-CTP accumulation. Parameters related to the disposition of the drug in the cell, such as K30, or stimulation of R2 mRNA degradation, such as EC50, are also critical for PD response in addition to Ara-CTP accumulation. The parameter IC50 related to stimulation of Ara-CTP synthesis would affect the intracellular Ara-CTP levels but not plasma GTI-
2040 or R2 mRNA levels. In contrast, dose escalation would improve the plasma GTI-
2040 concentration, but it would not affect the R2 mRNA or Ara-CTP level. Therefore,
227 intracellular GTI-2040 levels may be a more important determinant for R2 mRNA down- regulation and Ara-CTP accumulation. In future studies, we could measure R2 mRNA and protein level in patient samples. Additionally, intracellular dNTP/NTP pool, GTI-
2040 concentrations and Ara-CTP level could also be determined. Correlation studies of these PD biomarkers, intracellular drug concentrations and nucleotides level could be conducted which would provide a complete PK/PD description. The mechanism studies of GTI-2040 and 5-AzaC indicated a potential synergistic effect on the combination treatment of these two drugs. This proposed PK-PD model may be applicable for the similar study of 5-AzaC with GTI-2040 in the future. The transporter study of 5-AzaC revealed that the transport of 5-AzaC into the cell may involve the human equilibrative nucleoside transporter 1 (hENT1). In future studies, leukemia blast cells could be obtained from patients, and nucleoside transporter expression could be evaluated using real-time PCR on seven known nucleoside transporters reported thus far (214,215). The correlation between nucleoside transporter expressions and clinical responses could be
evaluated to characterize the relationship between cellular transport of 5-azacytidine and
clinical response.
Decitabine (5-aza-2’-deoxycytidine) is a nucleoside analog with in vitro and in vivo anticancer activity against a variety of solid tumors and hematologic malignancies (73-
75,173,174). Clinical pharmacokinetics of decitabine has been characterized with maximum plasma concentration (Cmax) achieved at 0.5 hr for most patients (57%) using a
228 two compartment model. Decitabine is rapidly eliminated with the overall terminal half life 18 min. Furthermore, population pharmacokinetics of decitabine in AML patient plasma samples was studied using the NONMEM computer program. Body surface area was identified as a covariate with respect to the total systemic clearance. However, a larger patient population may be necessary to optimize dose schedule of decitabine.
In summary, a quantification assay of nucleoside and nucleotides, biochemical modulation of Ara-CTP by GTI-2040, transporter study of 5-AzaC, PK/PD modeling of combination treatment of GTI-2040 and aracytidine, and population PK study of decitabine, have been extensively investigated and studied. These results provide valuable insights in clinical development of GTI-2040, 5-AzaC, aracytidine and decitabine in single agent or in combination treatment.
229 BIBLIOGRAPHY
1. Pastor-Anglada M, Molina-Arcas M, Casado FJ, Bellosillo B, Colomer D, Gil J. Nucleoside transporters in chronic lymphocytic leukaemia. Leukemia 2004;18(3):385-93.
2. Rivard GE, Momparler RL, Demers J, Benoit P, Raymond R, Lin K, Momparler LF. Phase I study on 5-aza-2'-deoxycytidine in children with acute leukemia. Leuk Res 1981;5(6):453-62.
3. Momparler RL. Molecular, cellular and animal pharmacology of 5-aza-2'- deoxycytidine. Pharmacol Ther 1985;30(3):287-99.
4. Christman JK. 5-Azacytidine and 5-aza-2'-deoxycytidine as inhibitors of DNA methylation: mechanistic studies and their implications for cancer therapy. Oncogene 2002;21(35):5483-95.
5. Schrump DS, Fischette MR, Nguyen DM, Zhao M, Li X, Kunst TF, Hancox A, Hong JA, Chen GA, Pishchik V and others. Phase I study of decitabine-mediated gene expression in patients with cancers involving the lungs, esophagus, or pleura. Clin Cancer Res 2006;12(19):5777-85.
6. Atallah E, Kantarjian H, Garcia-Manero G. The role of decitabine in the treatment of myelodysplastic syndromes. Expert Opin Pharmacother 2007;8(1):65-73.
7. Schaefer HE, Lubbert M. The hematopathological basis for studying effects of the demethylating agent 5-aza-2'-deoxycytidine (decitabine) in myelodysplasia. Ann Hematol 2005;84 Suppl 1:67-79.
8. Garcia-Manero G, Kantarjian HM, Sanchez-Gonzalez B, Yang H, Rosner G, Verstovsek S, Rytting M, Wierda WG, Ravandi F, Koller C and others. Phase 1/2 study of the combination of 5-aza-2'-deoxycytidine with valproic acid in patients with leukemia. Blood 2006;108(10):3271-9.
230 9. Gollob JA, Sciambi CJ, Peterson BL, Richmond T, Thoreson M, Moran K, Dressman HK, Jelinek J, Issa JP. Phase I trial of sequential low-dose 5-aza-2'- deoxycytidine plus high-dose intravenous bolus interleukin-2 in patients with melanoma or renal cell carcinoma. Clin Cancer Res 2006;12(15):4619-27.
10. Kantarjian H, Issa JP, Rosenfeld CS, Bennett JM, Albitar M, DiPersio J, Klimek V, Slack J, de Castro C, Ravandi F and others. Decitabine improves patient outcomes in myelodysplastic syndromes: results of a phase III randomized study. Cancer 2006;106(8):1794-803.
11. Issa JP, Gharibyan V, Cortes J, Jelinek J, Morris G, Verstovsek S, Talpaz M, Garcia-Manero G, Kantarjian HM. Phase II study of low-dose decitabine in patients with chronic myelogenous leukemia resistant to imatinib mesylate. J Clin Oncol 2005;23(17):3948-56.
12. Issa JP, Garcia-Manero G, Giles FJ, Mannari R, Thomas D, Faderl S, Bayar E, Lyons J, Rosenfeld CS, Cortes J and others. Phase 1 study of low-dose prolonged exposure schedules of the hypomethylating agent 5-aza-2'-deoxycytidine (decitabine) in hematopoietic malignancies. Blood 2004;103(5):1635-40.
13. Plagemann PG, Behrens M, Abraham D. Metabolism and cytotoxicity of 5- azacytidine in cultured Novikoff rat hepatoma and P388 mouse leukemia cells and their enhancement by preincubation with pyrazofurin. Cancer Res 1978;38(8):2458-66.
14. John AM, Thomas NS, Mufti GJ, Padua RA. Targeted therapies in myeloid leukemia. Semin Cancer Biol 2004;14(1):41-62.
15. Wolffe AP, Matzke MA. Epigenetics: regulation through repression. Science 1999;286(5439):481-6.
16. Testa U, Riccioni R. Deregulation of apoptosis in acute myeloid leukemia. Haematologica 2007;92(1):81-94.
231 17. Senderowicz AM. Cyclin-dependent kinases as new targets for the prevention and treatment of cancer. Hematol Oncol Clin North Am 2002;16(5):1229-53.
18. Chen Z, Brand NJ, Chen A, Chen SJ, Tong JH, Wang ZY, Waxman S, Zelent A. Fusion between a novel Kruppel-like zinc finger gene and the retinoic acid receptor-alpha locus due to a variant t(11;17) translocation associated with acute promyelocytic leukaemia. Embo J 1993;12(3):1161-7.
19. Van Etten RA, Shannon KM. Focus on myeloproliferative diseases and myelodysplastic syndromes. Cancer Cell 2004;6(6):547-52.
20. Waggoner D. Mechanisms of disease: epigenesis. Semin Pediatr Neurol 2007;14(1):7-14.
21. Ting AH, McGarvey KM, Baylin SB. The cancer epigenome--components and functional correlates. Genes Dev 2006;20(23):3215-31.
22. Verma M, Maruvada P, Srivastava S. Epigenetics and cancer. Crit Rev Clin Lab Sci 2004;41(5-6):585-607.
23. Galm O, Herman JG, Baylin SB. The fundamental role of epigenetics in hematopoietic malignancies. Blood Rev 2006;20(1):1-13.
24. Ibanez de Caceres I, Cairns P. Methylated DNA sequences for early cancer detection, molecular classification and chemotherapy response prediction. Clin Transl Oncol 2007;9(7):429-37.
25. Jeltsch A, Jurkowska RZ, Jurkowski TP, Liebert K, Rathert P, Schlickenrieder M. Application of DNA methyltransferases in targeted DNA methylation. Appl Microbiol Biotechnol 2007;75(6):1233-40.
26. Bird A. DNA methylation patterns and epigenetic memory. Genes Dev 2002;16(1):6-21.
232 27. Turek-Plewa J, Jagodzinski PP. The role of mammalian DNA methyltransferases in the regulation of gene expression. Cell Mol Biol Lett 2005;10(4):631-47.
28. Yoo CB, Jones PA. Epigenetic therapy of cancer: past, present and future. Nat Rev Drug Discov 2006;5(1):37-50.
29. Weber M, Davies JJ, Wittig D, Oakeley EJ, Haase M, Lam WL, Schubeler D. Chromosome-wide and promoter-specific analyses identify sites of differential DNA methylation in normal and transformed human cells. Nat Genet 2005;37(8):853-62.
30. Rhee I, Bachman KE, Park BH, Jair KW, Yen RW, Schuebel KE, Cui H, Feinberg AP, Lengauer C, Kinzler KW and others. DNMT1 and DNMT3b cooperate to silence genes in human cancer cells. Nature 2002;416(6880):552-6.
31. Hellebrekers DM, Griffioen AW, van Engeland M. Dual targeting of epigenetic therapy in cancer. Biochim Biophys Acta 2007;1775(1):76-91.
32. Boultwood J, Wainscoat JS. Gene silencing by DNA methylation in haematological malignancies. Br J Haematol 2007;138(1):3-11.
33. Daskalakis M, Nguyen TT, Nguyen C, Guldberg P, Kohler G, Wijermans P, Jones PA, Lubbert M. Demethylation of a hypermethylated P15/INK4B gene in patients with myelodysplastic syndrome by 5-Aza-2'-deoxycytidine (decitabine) treatment. Blood 2002;100(8):2957-64.
34. Strahl BD, Allis CD. The language of covalent histone modifications. Nature 2000;403(6765):41-5.
35. Margueron R, Trojer P, Reinberg D. The key to development: interpreting the histone code? Curr Opin Genet Dev 2005;15(2):163-76.
36. Sterner DE, Berger SL. Acetylation of histones and transcription-related factors. Microbiol Mol Biol Rev 2000;64(2):435-59.
233 37. Ducasse M, Brown MA. Epigenetic aberrations and cancer. Mol Cancer 2006;5:60.
38. Lachner M, Jenuwein T. The many faces of histone lysine methylation. Curr Opin Cell Biol 2002;14(3):286-98.
39. Zhang Y, Reinberg D. Transcription regulation by histone methylation: interplay between different covalent modifications of the core histone tails. Genes Dev 2001;15(18):2343-60.
40. Esteller M, Sanchez-Cespedes M, Rosell R, Sidransky D, Baylin SB, Herman JG. Detection of aberrant promoter hypermethylation of tumor suppressor genes in serum DNA from non-small cell lung cancer patients. Cancer Res 1999;59(1):67- 70.
41. Fraga MF, Ballestar E, Villar-Garea A, Boix-Chornet M, Espada J, Schotta G, Bonaldi T, Haydon C, Ropero S, Petrie K and others. Loss of acetylation at Lys16 and trimethylation at Lys20 of histone H4 is a common hallmark of human cancer. Nat Genet 2005;37(4):391-400.
42. Gaudet F, Hodgson JG, Eden A, Jackson-Grusby L, Dausman J, Gray JW, Leonhardt H, Jaenisch R. Induction of tumors in mice by genomic hypomethylation. Science 2003;300(5618):489-92.
43. Moss TJ, Wallrath LL. Connections between epigenetic gene silencing and human disease. Mutat Res 2007;618(1-2):163-74.
44. Lapucci A, Donnini M, Papucci L, Witort E, Tempestini A, Bevilacqua A, Nicolin A, Brewer G, Schiavone N, Capaccioli S. AUF1 Is a bcl-2 A + U-rich element-binding protein involved in bcl-2 mRNA destabilization during apoptosis. J Biol Chem 2002;277(18):16139-46.
45. Blaxall BC, Dwyer-Nield LD, Bauer AK, Bohlmeyer TJ, Malkinson AM, Port JD. Differential expression and localization of the mRNA binding proteins, AU-
234 rich element mRNA binding protein (AUF1) and Hu antigen R (HuR), in neoplastic lung tissue. Mol Carcinog 2000;28(2):76-83.
46. Steube KG, Jadau A, Teepe D, Drexler HG. Expression of bcl-2 mRNA and protein in leukemia-lymphoma cell lines. Leukemia 1995;9(11):1841-6.
47. Hammond SM. RNAi, microRNAs, and human disease. Cancer Chemother Pharmacol 2006;58 Suppl 1:s63-8.
48. Tomari Y, Zamore PD. Perspective: machines for RNAi. Genes Dev 2005;19(5):517-29.
49. Lee Y, Kim M, Han J, Yeom KH, Lee S, Baek SH, Kim VN. MicroRNA genes are transcribed by RNA polymerase II. Embo J 2004;23(20):4051-60.
50. Esquela-Kerscher A, Slack FJ. Oncomirs - microRNAs with a role in cancer. Nat Rev Cancer 2006;6(4):259-69.
51. Cimmino A, Calin GA, Fabbri M, Iorio MV, Ferracin M, Shimizu M, Wojcik SE, Aqeilan RI, Zupo S, Dono M and others. miR-15 and miR-16 induce apoptosis by targeting BCL2. Proc Natl Acad Sci U S A 2005;102(39):13944-9.
52. Hayashita Y, Osada H, Tatematsu Y, Yamada H, Yanagisawa K, Tomida S, Yatabe Y, Kawahara K, Sekido Y, Takahashi T. A polycistronic microRNA cluster, miR-17-92, is overexpressed in human lung cancers and enhances cell proliferation. Cancer Res 2005;65(21):9628-32.
53. Johnson SM, Grosshans H, Shingara J, Byrom M, Jarvis R, Cheng A, Labourier E, Reinert KL, Brown D, Slack FJ. RAS is regulated by the let-7 microRNA family. Cell 2005;120(5):635-47.
54. Takamizawa J, Konishi H, Yanagisawa K, Tomida S, Osada H, Endoh H, Harano T, Yatabe Y, Nagino M, Nimura Y and others. Reduced expression of the let-7 microRNAs in human lung cancers in association with shortened postoperative survival. Cancer Res 2004;64(11):3753-6.
235 55. Shao J, Zhou B, Chu B, Yen Y. Ribonucleotide reductase inhibitors and future drug design. Curr Cancer Drug Targets 2006;6(5):409-31.
56. Fontecave M. Ribonucleotide reductases and radical reactions. Cell Mol Life Sci 1998;54(7):684-95.
57. Engstrom Y, Eriksson S, Jildevik I, Skog S, Thelander L, Tribukait B. Cell cycle- dependent expression of mammalian ribonucleotide reductase. Differential regulation of the two subunits. J Biol Chem 1985;260(16):9114-6.
58. Orr RM. GTI-2040. Lorus Therapeutics. Curr Opin Investig Drugs 2001;2(10):1462-6.
59. Wei X, Dai G, Marcucci G, Liu Z, Hoyt D, Blum W, Chan KK. A specific picomolar hybridization-based ELISA assay for the determination of phosphorothioate oligonucleotides in plasma and cellular matrices. Pharm Res 2006;23(6):1251-64.
60. Lee Y, Vassilakos A, Feng N, Lam V, Xie H, Wang M, Jin H, Xiong K, Liu C, Wright J and others. GTI-2040, an antisense agent targeting the small subunit component (R2) of human ribonucleotide reductase, shows potent antitumor activity against a variety of tumors. Cancer Res 2003;63(11):2802-11.
61. Desai AA, Schilsky RL, Young A, Janisch L, Stadler WM, Vogelzang NJ, Cadden S, Wright JA, Ratain MJ. A phase I study of antisense oligonucleotide GTI-2040 given by continuous intravenous infusion in patients with advanced solid tumors. Ann Oncol 2005;16(6):958-65.
62. Wei X. pharmacokinetics, pharmacodynamics and metabolism of GTI-2040, a phosphorothioate oligonucleotide targeting R2 subunit of ribonucleotide reductase. Dissertation, the Ohio State University 2006:115-124.
63. Kuykendall JR. 5-azacytidine and decitabine monotherapies of myelodysplastic disorders. Ann Pharmacother 2005;39(10):1700-9.
236 64. Von Hoff DD, Slavik M, Muggia FM. 5-Azacytidine. A new anticancer drug with effectiveness in acute myelogenous leukemia. Ann Intern Med 1976;85(2):237- 45.
65. Christman JK, Mendelsohn N, Herzog D, Schneiderman N. Effect of 5- azacytidine on differentiation and DNA methylation in human promyelocytic leukemia cells (HL-60). Cancer Res 1983;43(2):763-9.
66. Creusot F, Acs G, Christman JK. Inhibition of DNA methyltransferase and induction of Friend erythroleukemia cell differentiation by 5-azacytidine and 5- aza-2'-deoxycytidine. J Biol Chem 1982;257(4):2041-8.
67. Rudek MA, Zhao M, He P, Hartke C, Gilbert J, Gore SD, Carducci MA, Baker SD. Pharmacokinetics of 5-azacitidine administered with phenylbutyrate in patients with refractory solid tumors or hematologic malignancies. J Clin Oncol 2005;23(17):3906-11.
68. Quesnel B, Guillerm G, Vereecque R, Wattel E, Preudhomme C, Bauters F, Vanrumbeke M, Fenaux P. Methylation of the p15(INK4b) gene in myelodysplastic syndromes is frequent and acquired during disease progression. Blood 1998;91(8):2985-90.
69. Silverman LR. Targeting hypomethylation of DNA to achieve cellular differentiation in myelodysplastic syndromes (MDS). Oncologist 2001;6 Suppl 5:8-14.
70. Kessel D, Hall TC, Rosenthal D. Uptake and phosphorylation of cytosine arabinoside by normal and leukemic human blood cells in vitro. Cancer Res 1969;29(2):459-63.
71. Plagemann PG, Behrens M, Abraham D. Metabolism and cytotoxicity of 5- azacytidine in cultured Novikoff rat hepatoma and P388 mouse leukemia cells and their enhancement by preincubation with pyrazofurin; 1978. 2458-66 p.
237 72. Zhao M, Rudek MA, He P, Hartke C, Gore S, Carducci MA, Baker SD. Quantification of 5-azacytidine in plasma by electrospray tandem mass spectrometry coupled with high-performance liquid chromatography. J Chromatogr B Analyt Technol Biomed Life Sci 2004;813(1-2):81-8.
73. Alleman WG, Tabios RL, Chandramouli GV, Aprelikova ON, Torres-Cabala C, Mendoza A, Rogers C, Sopko NA, Linehan WM, Vasselli JR. The in vitro and in vivo effects of re-expressing methylated von Hippel-Lindau tumor suppressor gene in clear cell renal carcinoma with 5-aza-2'-deoxycytidine. Clin Cancer Res 2004;10(20):7011-21.
74. Hsi LC, Xi X, Wu Y, Lippman SM. The methyltransferase inhibitor 5-aza-2- deoxycytidine induces apoptosis via induction of 15-lipoxygenase-1 in colorectal cancer cells. Mol Cancer Ther 2005;4(11):1740-6.
75. Sorm F, Vesely J. Effect of 5-aza-2'-deoxycytidine against leukemic and hemopoietic tissues in AKR mice. Neoplasma 1968;15(4):339-43.
76. van Groeningen CJ, Leyva A, O'Brien AM, Gall HE, Pinedo HM. Phase I and pharmacokinetic study of 5-aza-2'-deoxycytidine (NSC 127716) in cancer patients. Cancer Res 1986;46(9):4831-6.
77. Guo Y, Engelhardt M, Wider D, Abdelkarim M, Lubbert M. Effects of 5-aza-2'- deoxycytidine on proliferation, differentiation and p15/INK4b regulation of human hematopoietic progenitor cells. Leukemia 2006;20(1):115-21.
78. Saunthararajah Y, Hillery CA, Lavelle D, Molokie R, Dorn L, Bressler L, Gavazova S, Chen YH, Hoffman R, DeSimone J. Effects of 5-aza-2'- deoxycytidine on fetal hemoglobin levels, red cell adhesion, and hematopoietic differentiation in patients with sickle cell disease. Blood 2003;102(12):3865-70.
79. Yang H, Hoshino K, Sanchez-Gonzalez B, Kantarjian H, Garcia-Manero G. Antileukemia activity of the combination of 5-aza-2'-deoxycytidine with valproic acid. Leuk Res 2005;29(7):739-48.
238 80. Blum W, Klisovic RB, Hackanson B, Liu Z, Liu S, Devine H, Vukosavljevic T, Huynh L, Lozanski G, Kefauver C and others. Phase I study of decitabine alone or in combination with valproic acid in acute myeloid leukemia. J Clin Oncol 2007;25(25):3884-91.
81. Peters WG, Colly LP, Willemze R. High-dose cytosine arabinoside: pharmacological and clinical aspects. Blut 1988;56(1):1-11.
82. Clarke ML, Damaraju VL, Zhang J, Mowles D, Tackaberry T, Lang T, Smith KM, Young JD, Tomkinson B, Cass CE. The role of human nucleoside transporters in cellular uptake of 4'-thio-beta-D-arabinofuranosylcytosine and beta-D-arabinosylcytosine. Mol Pharmacol 2006;70(1):303-10.
83. Hubeek I, Stam RW, Peters GJ, Broekhuizen R, Meijerink JP, van Wering ER, Gibson BE, Creutzig U, Zwaan CM, Cloos J and others. The human equilibrative nucleoside transporter 1 mediates in vitro cytarabine sensitivity in childhood acute myeloid leukaemia. Br J Cancer 2005;93(12):1388-94.
84. Kessel D, Hall TC, Wodinsky I. Transport and phosphorylation as factors in the antitumor action of cytosine arabinoside. Science 1967;156(779):1240-1.
85. Kufe DW, Spriggs DR. Biochemical and cellular pharmacology of cytosine arabinoside. Semin Oncol 1985;12(2 Suppl 3):34-48.
86. Woodcock DM. Cytosine arabinoside toxicity: molecular events, biological consequences, and their implications. Semin Oncol 1987;14(2 Suppl 1):251-6.
87. Capizzi RL, Yang JL, Cheng E, Bjornsson T, Sahasrabudhe D, Tan RS, Cheng YC. Alteration of the pharmacokinetics of high-dose ara-C by its metabolite, high ara-U in patients with acute leukemia. J Clin Oncol 1983;1(12):763-71.
88. Capizzi RL, White JC, Powell BL, Perrino F. Effect of dose on the pharmacokinetic and pharmacodynamic effects of cytarabine. Semin Hematol 1991;28(3 Suppl 4):54-69.
239 89. Cros E, Jordheim L, Dumontet C, Galmarini CM. Problems related to resistance to cytarabine in acute myeloid leukemia. Leuk Lymphoma 2004;45(6):1123-32.
90. Breithaupt H, Pralle H, Eckhardt T, von Hattingberg M, Schick J, Loffler H. Clinical results and pharmacokinetics of high-dose cytosine arabinoside (HD ARA-C). Cancer 1982;50(7):1248-57.
91. Early AP, Preisler HD, Slocum H, Rustum YM. A pilot study of high-dose 1- beta-D-arabinofuranosylcytosine for acute leukemia and refractory lymphoma: clinical response and pharmacology. Cancer Res 1982;42(4):1587-94.
92. Dow LW, Dahl GV, Kalwinsky DK, Mirro J, Nash MB, Roberson PK. Correlation of drug sensitivity in vitro with clinical responses in childhood acute myeloid leukemia. Blood 1986;68(2):400-5.
93. Zittoun R, Marie JP, Delanian S, Suberville AM, Thevenin D. Prognostic value of in vitro uptake and retention of cytosine arabinoside in acute myelogenous leukemia. Semin Oncol 1987;14(2 Suppl 1):269-75.
94. Plunkett W, Iacoboni S, Estey E, Danhauser L, Liliemark JO, Keating MJ. Pharmacologically directed ara-C therapy for refractory leukemia. Semin Oncol 1985;12(2 Suppl 3):20-30.
95. Boos J. A simple isocratic ion-pair high-performance liquid chromatographic determination of 1-beta-D-arabinofuranosylcytosine 5'-triphosphate for intracellular drug-monitoring and in vitro incubation assays. J Pharm Biomed Anal 1991;9(1):47-52.
96. Plunkett W, Hug V, Keating MJ, Chubb S. Quantitation of 1-beta-D- arabinofuranosylcytosine 5'-triphosphate in the leukemic cells from bone marrow and peripheral blood of patients receiving 1-beta-D-arabinofuranosylcytosine therapy. Cancer Res 1980;40(3):588-91.
240 97. Schilsky RL, Ordway FS. Simultaneous determination of cytosine arabinoside, its nucleotides and metabolites by ion-pair high-performance liquid chromatography. J Chromatogr 1985;337(1):63-71.
98. Ueno M, Katayama K, Yamauchi H, Nakayama H, Doi K. Cell cycle progression is required for nuclear migration of neural progenitor cells. Brain Res 2006;1088(1):57-67.
99. Antonsson BE, Avramis VI, Nyce J, Holcenberg JS. Effect of 5-azacytidine and congeners on DNA methylation and expression of deoxycytidine kinase in the human lymphoid cell lines CCRF/CEM/0 and CCRF/CEM/dCk-1. Cancer Res 1987;47(14):3672-8.
100. Esteller M. Cancer epigenomics: DNA methylomes and histone-modification maps. Nat Rev Genet 2007;8(4):286-98.
101. Oki Y, Aoki E, Issa JP. Decitabine--bedside to bench. Crit Rev Oncol Hematol 2007;61(2):140-52.
102. Fernandez-Calotti P, Jordheim LP, Giordano M, Dumontet C, Galmarini CM. Substrate cycles and drug resistance to 1-beta-D-arabinofuranosylcytosine (araC). Leuk Lymphoma 2005;46(3):335-46.
103. Gao WY, Johns DG, Mitsuya H. Enzymatic assay for quantification of deoxynucleoside triphosphates in human cells exposed to antiretroviral 2',3'- dideoxynucleosides. Anal Biochem 1994;222(1):116-22.
104. Roy B, Beuneu C, Roux P, Buc H, Lemaire G, Lepoivre M. Simultaneous determination of pyrimidine or purine deoxyribonucleoside triphosphates using a polymerase assay. Anal Biochem 1999;269(2):403-9.
105. Skoog L. An enzymatic method for the determination of dCTP and dGTP in picomole amounts. Eur J Biochem 1970;17(2):202-8.
241 106. Ferraro P, Bianchi V, Biasin MR, Celotti L. Deoxynucleotide pools and DNA synthesis in resting and PHA-stimulated human lymphocytes treated with mutagens. Exp Cell Res 1992;199(2):349-54.
107. Aherne GW, Hardcastle A, Raynaud F, Jackman AL. Immunoreactive dUMP and TTP pools as an index of thymidylate synthase inhibition; effect of tomudex (ZD1694) and a nonpolyglutamated quinazoline antifolate (CB30900) in L1210 mouse leukaemia cells. Biochem Pharmacol 1996;51(10):1293-301.
108. Piall EM, Aherne GW, Marks V. The quantitative determination of 2'- deoxycytidine-5'-triphosphate in cell extracts by radioimmunoassay. Anal Biochem 1986;154(1):276-81.
109. Decosterd LA, Cottin E, Chen X, Lejeune F, Mirimanoff RO, Biollaz J, Coucke PA. Simultaneous determination of deoxyribonucleoside in the presence of ribonucleoside triphosphates in human carcinoma cells by high-performance liquid chromatography. Anal Biochem 1999;270(1):59-68.
110. Cross DR, Miller BJ, James SJ. A simplified HPLC method for simultaneously quantifying ribonucleotides and deoxyribonucleotides in cell extracts or frozen tissues. Cell Prolif 1993;26(4):327-36.
111. Arezzo F. Determination of ribonucleoside triphosphates and deoxyribonucleoside triphosphates in Novikoff hepatoma cells by high- performance liquid chromatography. Anal Biochem 1987;160(1):57-64.
112. Di Pierro D, Tavazzi B, Perno CF, Bartolini M, Balestra E, Calio R, Giardina B, Lazzarino G. An ion-pairing high-performance liquid chromatographic method for the direct simultaneous determination of nucleotides, deoxynucleotides, nicotinic coenzymes, oxypurines, nucleosides, and bases in perchloric acid cell extracts. Anal Biochem 1995;231(2):407-12.
113. Harmenberg J, Karlsson AH, Gilljam G. Comparison of sample preparation methods for the high-performance liquid chromatographic analysis of cell culture extracts for triphosphate ribonucleosides and deoxyribonucleosides. Anal Biochem 1987;161(1):26-31.
242 114. Palmer S, Cox S. Comparison of extraction procedures for high-performance liquid chromatographic determination of cellular deoxynucleotides. J Chromatogr A 1994;667(1-2):316-21.
115. Rimerman RA, Prorok GD, Cordel KL, Shahwan AM, Vaughan WP. Improved high-performance liquid chromatographic analysis of intracellular deoxyribonucleoside triphosphate levels. J Chromatogr 1993;619(1):29-35.
116. Shewach DS. Quantitation of deoxyribonucleoside 5'-triphosphates by a sequential boronate and anion-exchange high-pressure liquid chromatographic procedure. Anal Biochem 1992;206(1):178-82.
117. Chi J, Jayewardene A, Stone J, Gambertoglio JG, Aweeka FT. A direct determination of thymidine triphosphate concentrations without dephosphorylation in peripheral blood mononuclear cells by LC/MS/MS. J Pharm Biomed Anal 2001;26(5-6):829-36.
118. Hennere G, Becher F, Pruvost A, Goujard C, Grassi J, Benech H. Liquid chromatography-tandem mass spectrometry assays for intracellular deoxyribonucleotide triphosphate competitors of nucleoside antiretrovirals. J Chromatogr B Analyt Technol Biomed Life Sci 2003;789(2):273-81.
119. Fung EN, Cai Z, Burnette TC, Sinhababu AK. Simultaneous determination of Ziagen and its phosphorylated metabolites by ion-pairing high-performance liquid chromatography-tandem mass spectrometry. J Chromatogr B Biomed Sci Appl 2001;754(2):285-95.
120. North TW, Bestwick RK, Mathews CK. Detection of activities that interfere with the enzymatic assay of deoxyribonucleoside 5'-triphosphates. J Biol Chem 1980;255(14):6640-5.
121. Becher F, Schlemmer D, Pruvost A, Nevers MC, Goujard C, Jorajuria S, Guerreiro C, Brossette T, Lebeau L, Creminon C and others. Development of a direct assay for measuring intracellular AZT triphosphate in humans peripheral blood mononuclear cells. Anal Chem 2002;74(16):4220-7.
243 122. Matuszewski BK, Constanzer ML, Chavez-Eng CM. Strategies for the assessment of matrix effect in quantitative bioanalytical methods based on HPLC-MS/MS. Anal Chem 2003;75(13):3019-30.
123. Smid K, Van Moorsel CJ, Noordhuis P, Voorn DA, Peters GJ. Interference of gemcitabine triphosphate with the measurements of deoxynucleotides using an optimized DNA polymerase elongation assay. Int J Oncol 2001;19(1):157-62.
124. Stadler WM, Desai AA, Quinn DI, Bukowski R, Poiesz B, Kardinal CG, Lewis N, Makalinao A, Murray P, Torti FM. A Phase I/II study of GTI-2040 and capecitabine in patients with renal cell carcinoma. Cancer Chemother Pharmacol 2007.
125. Auriola S, Frith J, Rogers MJ, Koivuniemi A, Monkkonen J. Identification of adenine nucleotide-containing metabolites of bisphosphonate drugs using ion-pair liquid chromatography-electrospray mass spectrometry. J Chromatogr B Biomed Sci Appl 1997;704(1-2):187-95.
126. Monkkonen H, Moilanen P, Monkkonen J, Frith JC, Rogers MJ, Auriola S. Analysis of an adenine nucleotide-containing metabolite of clodronate using ion pair high-performance liquid chromatography-electrospray ionisation mass spectrometry. J Chromatogr B Biomed Sci Appl 2000;738(2):395-403.
127. Claire RL, 3rd. Positive ion electrospray ionization tandem mass spectrometry coupled to ion-pairing high-performance liquid chromatography with a phosphate buffer for the quantitative analysis of intracellular nucleotides. Rapid Commun Mass Spectrom 2000;14(17):1625-34.
128. Tanaka K, Yoshioka A, Tanaka S, Wataya Y. An improved method for the quantitative determination of deoxyribonucleoside triphosphates in cell extracts. Anal Biochem 1984;139(1):35-41.
129. Rammler DH. Periodate oxidations of enamines. I. Oxidation of adenosine 5'- monophosphate in the presence of methylamine. Biochemistry 1971;10(25):4699- 705.
244 130. Steinschneider A. Effect of methylamine on periodate-oxidized adenosine 5'- phosphate. Biochemistry 1971;10(1):173-8.
131. Uziel M. Periodate oxidation and amino-catalyzed elimination of the terminal nucleoside from adenylate or ribonucleic acid. Products of overoxidation. Biochemistry 1973;12(5):938-42.
132. Huang D, Zhang Y, Chen X. Analysis of intracellular nucleoside triphosphate levels in normal and tumor cell lines by high-performance liquid chromatography. J Chromatogr B Analyt Technol Biomed Life Sci 2003;784(1):101-9.
133. Vasilyeva EA, Minkov IB, Fitin AF, Vinogradov AD. Kinetic mechanism of mitochondrial adenosine triphosphatase. Inhibition by azide and activation by sulphite. Biochem J 1982;202(1):15-23.
134. Klisovic RB, Blum W, Wei X, Liu S, Liu Z, Xie Z, Vukosavljevic T, Kefauver C, Huynh L, Pang J and others. Phase I study of GTI-2040, an antisense to ribonucleotide reductase, in combination with high-dose cytarabine in patients with acute myeloid leukemia. Clin Cancer Res 2008;14(12):3889-95.
135. Taylor EM, McFarlane RJ, Price C. 5-Azacytidine treatment of the fission yeast leads to cytotoxicity and cell cycle arrest. Mol Gen Genet 1996;253(1-2):128-37.
136. Issa JP. DNA methylation as a therapeutic target in cancer. Clin Cancer Res 2007;13(6):1634-7.
137. Silverman LR, Demakos EP, Peterson BL, Kornblith AB, Holland JC, Odchimar- Reissig R, Stone RM, Nelson D, Powell BL, DeCastro CM and others. Randomized controlled trial of azacitidine in patients with the myelodysplastic syndrome: a study of the cancer and leukemia group B. J Clin Oncol 2002;20(10):2429-40.
138. Chitambar CR, Libnoch JA, Matthaeus WG, Ash RC, Ritch PS, Anderson T. Evaluation of continuous infusion low-dose 5-azacytidine in the treatment of myelodysplastic syndromes. Am J Hematol 1991;37(2):100-4.
245 139. Issa JP, Kantarjian HM, Kirkpatrick P. Azacitidine. Nat Rev Drug Discov 2005;4(4):275-6.
140. Israili ZH, Vogler WR, Mingioli ES, Pirkle JL, Smithwick RW, Goldstein JH. The disposition and pharmacokinetics in humans of 5-azacytidine administered intravenously as a bolus or by continuous infusion. Cancer Res 1976;36(4):1453- 61.
141. Pittillo RF, Woolley C. 5-azacytidine: microbiological assay in mouse blood. Appl Microbiol 1969;18(2):284-6.
142. Chan KK, Giannini DD, Staroscik JA, Sadee W. 5-Azacytidine hydrolysis kinetics measured by high-pressure liquid chromatography and 13C-NMR spectroscopy. J Pharm Sci 1979;68(7):807-12.
143. Cheung YW, Vishnuvajjala BR, Morris NL, Flora KP. Stability of azacitidine in infusion fluids. Am J Hosp Pharm 1984;41(6):1156-9.
144. Rustum AM, Hoffman NE. High-performance liquid chromatographic determination of 5-azacytidine in plasma. J Chromatogr 1987;421(2):387-91.
145. Liu Z, Marcucci G, Byrd JC, Grever M, Xiao J, Chan KK. Characterization of decomposition products and preclinical and low dose clinical pharmacokinetics of decitabine (5-aza-2'-deoxycytidine) by a new liquid chromatography/tandem mass spectrometry quantification method. Rapid Commun Mass Spectrom 2006;20(7):1117-26.
146. Bodey GP, Freireich EJ, Monto RW, Hewlett JS. Cytosine arabinoside (NSC- 63878) therapy for acute leukemia in adults. Cancer Chemother Rep 1969;53(1):59-66.
147. Tedeschi A, Montillo M, Strocchi E, Cafro AM, Tresoldi E, Intropido L, Nichelatti M, Marbello L, Barate C, Camaggi CM and others. High-dose idarubicin in combination with Ara-C in patients with relapsed or refractory acute
246 lymphoblastic leukemia: a pharmacokinetic and clinical study. Cancer Chemother Pharmacol 2007;59(6):771-9.
148. Boleti H, Coe IR, Baldwin SA, Young JD, Cass CE. Molecular identification of the equilibrative NBMPR-sensitive (es) nucleoside transporter and demonstration of an equilibrative NBMPR-insensitive (ei) transport activity in human erythroleukemia (K562) cells. Neuropharmacology 1997;36(9):1167-79.
149. Coleman CN, Stoller RG, Drake JC, Chabner BA. Deoxycytidine kinase: properties of the enzyme from human leukemic granulocytes. Blood 1975;46(5):791-803.
150. Ho DH. Distribution of kinase and deaminase of 1-beta-D- arabinofuranosylcytosine in tissues of man and mouse. Cancer Res 1973;33(11):2816-20.
151. Momparler RL. A model for the chemotherapy of acute leukemia with 1-beta-D- arabinofuranosylcytosine. Cancer Res 1974;34(8):1775-87.
152. Amadori S, Papa G, Avvisati G, Fenu S, Monarca B, Petti MC, Pulsoni A, Mandelli F. Sequential combination of high dose ARA-C (HiDAC) and asparaginase (ASP) for the treatment of advanced acute leukemia and lymphoma. Leuk Res 1984;8(4):729-35.
153. Capizzi RL, Poole M, Cooper MR, Richards F, 2nd, Stuart JJ, Jackson DV, Jr., White DR, Spurr CL, Hopkins JO, Muss HB and others. Treatment of poor risk acute leukemia with sequential high-dose ARA-C and asparaginase. Blood 1984;63(3):694-700.
154. Herzig RH, Wolff SN, Lazarus HM, Phillips GL, Karanes C, Herzig GP. High- dose cytosine arabinoside therapy for refractory leukemia. Blood 1983;62(2):361- 9.
247 155. Willemze R, Zwaan FE, Colpin G, Keuning JJ. High dose cytosine arabinoside in the management of refractory acute leukaemia. Scand J Haematol 1982;29(2):141-6.
156. Ross DD, Thompson BW, Joneckis CC, Akman SA, Schiffer CA. Metabolism of ara-C by blast cells from patients with ANLL. Blood 1986;68(1):76-82.
157. Kufe D, Spriggs D, Egan EM, Munroe D. Relationships among Ara-CTP pools, formation of (Ara-C)DNA, and cytotoxicity of human leukemic cells. Blood 1984;64(1):54-8.
158. Plunkett W, Iacoboni S, Keating MJ. Cellular pharmacology and optimal therapeutic concentrations of 1-beta-D-arabinofuranosylcytosine 5'-triphosphate in leukemic blasts during treatment of refractory leukemia with high-dose 1-beta- D-arabinofuranosylcytosine. Scand J Haematol Suppl 1986;44:51-9.
159. Estey E, Plunkett W, Dixon D, Keating M, McCredie K, Freireich EJ. Variables predicting response to high dose cytosine arabinoside therapy in patients with refractory acute leukemia. Leukemia 1987;1(8):580-3.
160. Galmarini CM, Thomas X, Calvo F, Rousselot P, Rabilloud M, El Jaffari A, Cros E, Dumontet C. In vivo mechanisms of resistance to cytarabine in acute myeloid leukaemia. Br J Haematol 2002;117(4):860-8.
161. Fritzer-Szekeres M, Salamon A, Grusch M, Horvath Z, Hochtl T, Steinbrugger R, Jager W, Krupitza G, Elford HL, Szekeres T. Trimidox, an inhibitor of ribonucleotide reductase, synergistically enhances the inhibition of colony formation by Ara-C in HL-60 human promyelocytic leukemia cells. Biochem Pharmacol 2002;64(3):481-5.
162. Bauer W, Horvath Z, Hochtl T, Saiko P, Karl D, Fritzer-Szekeres M, Szekeres T. Amidox, an inhibitor of ribonucleotide reductase, potentiates the action of Ara-C in HL-60 human promyelocytic leukemia cells. Nucleosides Nucleotides Nucleic Acids 2004;23(8-9):1541-4.
248 163. Plunkett W, Chubb S, Barlogie B. Simultaneous determination of 1-beta-D- arabinofuranosylcytosine 5'-triphosphate and 3-deazauridine 5'-triphosphate in human leukemia cells by high-performance liquid chromatography. J Chromatogr 1980;221(2):425-30.
164. Rustum YM, Slocum HK, Wang G, Bakshi D, Kelly E, Buscaglia D, Wrzosek C, Early AP, Preisler H. Relationship between plasma Ara-C and intracellular Ara- CTP pools under conditions of continuous infusion and high-dose Ara-C treatment. Med Pediatr Oncol 1982;10 Suppl 1:33-43.
165. Liliemark JO, Plunkett W, Dixon DO. Relationship of 1-beta-D- arabinofuranosylcytosine in plasma to 1-beta-D-arabinofuranosylcytosine 5'- triphosphate levels in leukemic cells during treatment with high-dose 1-beta-D- arabinofuranosylcytosine. Cancer Res 1985;45(11 Pt 2):5952-7.
166. Linssen P, Drenthe-Schonk A, Wessels H, Vierwinden G, Haanen C. Determination of cytosine arabinoside triphosphate in leukemic cells by isocratic high-performance anion-exchange column chromatography. J Chromatogr 1982;232(2):424-9.
167. Schleyer E, Ehninger G, Zuhlsdorf M, Proksch B, Hiddemann W. Detection and separation of intracellular 1-beta-D-arabinofuranosylcytosine-5-triphosphate by ion-pair high-performance liquid chromatography. J Chromatogr 1989;497:109- 20.
168. Ozkaynak MF, Avramis VI, Carcich S, Ortega JA. Pharmacology of cytarabine given as a continuous infusion followed by mitoxantrone with and without amsacrine/etoposide as reinduction chemotherapy for relapsed or refractory pediatric acute myeloid leukemia. Med Pediatr Oncol 1998;31(6):475-82.
169. Avramis VI, Biener R, Krailo M, Finklestein J, Ettinger L, Willoughby M, Siegel SE, Holcenberg JS. Biochemical pharmacology of high dose 1-beta-D- arabinofuranosylcytosine in childhood acute leukemia. Cancer Res 1987;47(24 Pt 1):6786-92.
249 170. Braess J, Wegendt C, Jahns-Streubel G, Kern W, Keye S, Unterhalt M, Schleyer E, Hiddemann W. Successful modulation of high-dose cytosine arabinoside metabolism in acute myeloid leukaemia by haematopoietic growth factors: no effect of ribonucleotide reductase inhibitors fludarabine and gemcitabine. Br J Haematol 2000;109(2):388-95.
171. Ossenkoppele GJ, Graveland WJ, Sonneveld P, Daenen SM, Biesma DH, Verdonck LF, Schaafsma MR, Westveer PH, Peters GJ, Noordhuis P and others. The value of fludarabine in addition to ARA-C and G-CSF in the treatment of patients with high-risk myelodysplastic syndromes and AML in elderly patients. Blood 2004;103(8):2908-13.
172. de Vos D, van Overveld W. Decitabine: a historical review of the development of an epigenetic drug. Ann Hematol 2005;84 Suppl 1:3-8.
173. Claus R, Lubbert M. Epigenetic targets in hematopoietic malignancies. Oncogene 2003;22(42):6489-96.
174. Digel W, Lubbert M. DNA methylation disturbances as novel therapeutic target in lung cancer: preclinical and clinical results. Crit Rev Oncol Hematol 2005;55(1):1-11.
175. Jones PA, Taylor SM. Cellular differentiation, cytidine analogs and DNA methylation. Cell 1980;20(1):85-93.
176. Reichard P, Ehrenberg A. Ribonucleotide reductase--a radical enzyme. Science 1983;221(4610):514-9.
177. Jordan A, Reichard P. Ribonucleotide reductases. Annu Rev Biochem 1998;67:71-98.
178. Kolberg M, Strand KR, Graff P, Andersson KK. Structure, function, and mechanism of ribonucleotide reductases. Biochim Biophys Acta 2004;1699(1- 2):1-34.
250 179. Nocentini G. Ribonucleotide reductase inhibitors: new strategies for cancer chemotherapy. Crit Rev Oncol Hematol 1996;22(2):89-126.
180. Smith BD, Karp JE. Ribonucleotide reductase: an old target with new potential. Leuk Res 2003;27(12):1075-6.
181. Bianchi V, Borella S, Calderazzo F, Ferraro P, Chieco Bianchi L, Reichard P. Inhibition of ribonucleotide reductase by 2'-substituted deoxycytidine analogs: possible application in AIDS treatment. Proc Natl Acad Sci U S A 1994;91(18):8403-7.
182. Cory JG. Ribonucleotide reductase as a chemotherapeutic target. Adv Enzyme Regul 1988;27:437-55.
183. Estey EH. Therapeutic options for acute myelogenous leukemia. Cancer 2001;92(5):1059-73.
184. Ravindranath Y. Recent advances in pediatric acute lymphoblastic and myeloid leukemia. Curr Opin Oncol 2003;15(1):23-35.
185. Creasey WA, Papac RJ, Markiw ME, Calabresi P, Welch AD. Biochemical and pharmacological studies with 1-beta-D-arabinofuranosylcytosine in man. Biochem Pharmacol 1966;15(10):1417-28.
186. Kihslinger JE, Godley LA. The use of hypomethylating agents in the treatment of hematologic malignancies. Leuk Lymphoma 2007;48(9):1676-95.
187. Cihak A. Biological effects of 5-azacytidine in eukaryotes. Oncology 1974;30(5):405-22.
188. Karon M, Benedict WF. Chromatid breakage: differential effect of inhibitors of DNA synthesis during G 2 phase. Science 1972;178(56):62.
251 189. Sorm F, Piskala A, Cihak A, Vesely J. 5-Azacytidine, a new, highly effective cancerostatic. Experientia 1964;20(4):202-3.
190. Ghoshal K, Bai S. DNA methyltransferases as targets for cancer therapy. Drugs Today (Barc) 2007;43(6):395-422.
191. Das PM, Singal R. DNA methylation and cancer. J Clin Oncol 2004;22(22):4632- 42.
192. Leone G, Teofili L, Voso MT, Lubbert M. DNA methylation and demethylating drugs in myelodysplastic syndromes and secondary leukemias. Haematologica 2002;87(12):1324-41.
193. Meijerink J, Mandigers C, van de Locht L, Tonnissen E, Goodsaid F, Raemaekers J. A novel method to compensate for different amplification efficiencies between patient DNA samples in quantitative real-time PCR. J Mol Diagn 2001;3(2):55- 61.
194. Loke SL, Stein CA, Zhang XH, Mori K, Nakanishi M, Subasinghe C, Cohen JS, Neckers LM. Characterization of oligonucleotide transport into living cells. Proc Natl Acad Sci U S A 1989;86(10):3474-8.
195. Zhang Z, Weinschenk T, Schluesener HJ. Uptake, cellular distribution and novel cellular binding proteins of immunostimulatory CpG oligodeoxynucleotides in glioblastoma cells. Mol Cell Biochem 2005;272(1-2):35-46.
196. Yakubov LA, Deeva EA, Zarytova VF, Ivanova EM, Ryte AS, Yurchenko LV, Vlassov VV. Mechanism of oligonucleotide uptake by cells: involvement of specific receptors? Proc Natl Acad Sci U S A 1989;86(17):6454-8.
197. Nakai D, Seita T, Terasaki T, Iwasa S, Shoji Y, Mizushima Y, Sugiyama Y. Cellular uptake mechanism for oligonucleotides: involvement of endocytosis in the uptake of phosphodiester oligonucleotides by a human colorectal adenocarcinoma cell line, HCT-15. J Pharmacol Exp Ther 1996;278(3):1362-72.
252 198. Wu-Pong S, Weiss TL, Hunt CA. Antisense c-myc oligonucleotide cellular uptake and activity. Antisense Res Dev 1994;4(3):155-63.
199. Wei X. pharmacokinetic, pharmacodynamic and metabolism of GTI 2040, a phosphorothioate oligonucleotide targeting R2 subunit of ribonucleotide reductase. The Ohio State University 2006;Thesis:121-125.
200. Baker BF, Lot SS, Condon TP, Cheng-Flournoy S, Lesnik EA, Sasmor HM, Bennett CF. 2'-O-(2-Methoxy)ethyl-modified anti-intercellular adhesion molecule 1 (ICAM-1) oligonucleotides selectively increase the ICAM-1 mRNA level and inhibit formation of the ICAM-1 translation initiation complex in human umbilical vein endothelial cells. J Biol Chem 1997;272(18):11994-2000.
201. Sewell KL, Geary RS, Baker BF, Glover JM, Mant TG, Yu RZ, Tami JA, Dorr FA. Phase I trial of ISIS 104838, a 2'-methoxyethyl modified antisense oligonucleotide targeting tumor necrosis factor-alpha. J Pharmacol Exp Ther 2002;303(3):1334-43.
202. Zhang WG, Wang FX, Chen YX, Cao XM, He AL, Liu J, Ma XR, Zhao WH, Liu SH, Wang JL. Combination chemotherapy with low-dose cytarabine, homoharringtonine, and granulocyte colony-stimulating factor priming in patients with relapsed or refractory acute myeloid leukemia. Am J Hematol 2008;83(3):185-8.
203. Qian SX, Li JY, Tian T, Shen YF, Jiang YQ, Lu H, Wu HX, Zhang SJ, Xu W. Effect of low-dose cytarabine and aclarubicin in combination with granulocyte colony-stimulating factor priming (CAG regimen) on the outcome of elderly patients with acute myeloid leukemia. Leuk Res 2007;31(10):1383-8.
204. Yamauchi T, Negoro E, Arai H, Ikegaya S, Takagi K, Takemura H, Inai K, Yoshida A, Urasaki Y, Iwasaki H and others. Combined low-dose cytarabine, melphalan and mitoxantrone for older patients with acute myeloid leukemia or high-risk myelodysplastic syndrome. Anticancer Res 2007;27(4C):2635-9.
205. Plagemann PG, Marz R, Wohlhueter RM. Transport and metabolism of deoxycytidine and 1-beta-D-arabinofuranosylcytosine into cultured Novikoff rat
253 hepatoma cells, relationship to phosphorylation, and regulation of triphosphate synthesis. Cancer Res 1978;38(4):978-89.
206. Gandhi V, Nowak B, Keating MJ, Plunkett W. Modulation of arabinosylcytosine metabolism by arabinosyl-2-fluoroadenine in lymphocytes from patients with chronic lymphocytic leukemia: implications for combination therapy. Blood 1989;74(6):2070-5.
207. Gandhi V, Estey E, Plunkett W. Modulation of arabinosylcytosine metabolism during leukemia therapy. Adv Exp Med Biol 1994;370:119-24.
208. Gandhi V, Estey E, Keating MJ, Chucrallah A, Plunkett W. Chlorodeoxyadenosine and arabinosylcytosine in patients with acute myelogenous leukemia: pharmacokinetic, pharmacodynamic, and molecular interactions. Blood 1996;87(1):256-64.
209. Colly LP, Richel DJ, Arentsen-Honders MW, Kester MG, ter Riet PM, Willemze R. Increase in Ara-C sensitivity in Ara-C sensitive and -resistant leukemia by stimulation of the salvage and inhibition of the de novo pathway. Ann Hematol 1992;65(1):26-32.
210. Bhalla K, Swerdlow P, Grant S. Effects of thymidine and hydroxyurea on the metabolism and cytotoxicity of 1-B-D arabinofuranosylcytosine in highly resistant human leukemia cells. Blood 1991;78(11):2937-44.
211. Hwang TL, Yung WK, Estey EH, Fields WS. Central nervous system toxicity with high-dose Ara-C. Neurology 1985;35(10):1475-9.
212. Kantarjian HM, Estey EH, Plunkett W, Keating MJ, Walters RS, Iacoboni S, McCredie KB, Freireich EJ. Phase I-II clinical and pharmacologic studies of high- dose cytosine arabinoside in refractory leukemia. Am J Med 1986;81(3):387-94.
213. Podgorska M, Kocbuch K, Pawelczyk T. Recent advances in studies on biochemical and structural properties of equilibrative and concentrative nucleoside transporters. Acta Biochim Pol 2005;52(4):749-58.
254 214. Kong W, Engel K, Wang J. Mammalian nucleoside transporters. Curr Drug Metab 2004;5(1):63-84.
215. Belt JA, Marina NM, Phelps DA, Crawford CR. Nucleoside transport in normal and neoplastic cells. Adv Enzyme Regul 1993;33:235-52.
216. Yao SY, Ng AM, Muzyka WR, Griffiths M, Cass CE, Baldwin SA, Young JD. Molecular cloning and functional characterization of nitrobenzylthioinosine (NBMPR)-sensitive (es) and NBMPR-insensitive (ei) equilibrative nucleoside transporter proteins (rENT1 and rENT2) from rat tissues. J Biol Chem 1997;272(45):28423-30.
217. Vickers MF, Zhang J, Visser F, Tackaberry T, Robins MJ, Nielsen LP, Nowak I, Baldwin SA, Young JD, Cass CE. Uridine recognition motifs of human equilibrative nucleoside transporters 1 and 2 produced in Saccharomyces cerevisiae. Nucleosides Nucleotides Nucleic Acids 2004;23(1-2):361-73.
218. Chang C, Swaan PW, Ngo LY, Lum PY, Patil SD, Unadkat JD. Molecular requirements of the human nucleoside transporters hCNT1, hCNT2, and hENT1. Mol Pharmacol 2004;65(3):558-70.
219. Paterson AR, Oliver JM. Nucleoside transport. II. Inhibition by p- nitrobenzylthioguanosine and related compounds. Can J Biochem 1971;49(2):271-4.
220. Oliver JM, Paterson AR. Nucleoside transport. I. A mediated process in human erythrocytes. Can J Biochem 1971;49(2):262-70.
221. Beukers MW, Kerkhof CJ, AP IJ, Soudijn W. Nucleoside transport inhibition and platelet aggregation in human blood: R75231 and its enantiomers, draflazine and R88016. Eur J Pharmacol 1994;266(1):57-62.
222. Gati WP, Paterson AR, Larratt LM, Turner AR, Belch AR. Sensitivity of acute leukemia cells to cytarabine is a correlate of cellular es nucleoside transporter site
255 content measured by flow cytometry with SAENTA-fluorescein. Blood 1997;90(1):346-53.
223. Wiley JS, Brocklebank AM, Snook MB, Jamieson GP, Sawyer WH, Craik JD, Cass CE, Robins MJ, McAdam DP, Paterson AR. A new fluorescent probe for the equilibrative inhibitor-sensitive nucleoside transporter. 5'-S-(2-aminoethyl)-N6- (4-nitrobenzyl)-5'-thioadenosine (SAENTA)-chi 2-fluorescein. Biochem J 1991;273 ( Pt 3):667-72.
224. Wiley JS, Cebon JS, Jamieson GP, Szer J, Gibson J, Woodruff RK, McKendrick JJ, Sheridan WP, Biggs JC, Snook MB and others. Assessment of proliferative responses to granulocyte-macrophage colony-stimulating factor (GM-CSF) in acute myeloid leukaemia using a fluorescent ligand for the nucleoside transporter. Leukemia 1994;8(1):181-5.
225. Momparler RL, Bouffard DY, Momparler LF, Dionne J, Belanger K, Ayoub J. Pilot phase I-II study on 5-aza-2'-deoxycytidine (Decitabine) in patients with metastatic lung cancer. Anticancer Drugs 1997;8(4):358-68.
226. Oki Y, Kantarjian HM, Gharibyan V, Jones D, O'Brien S, Verstovsek S, Cortes J, Morris GM, Garcia-Manero G, Issa JP. Phase II study of low-dose decitabine in combination with imatinib mesylate in patients with accelerated or myeloid blastic phase of chronic myelogenous leukemia. Cancer 2007;109(5):899-906.
227. Kantarjian H, Oki Y, Garcia-Manero G, Huang X, O'Brien S, Cortes J, Faderl S, Bueso-Ramos C, Ravandi F, Estrov Z and others. Results of a randomized study of 3 schedules of low-dose decitabine in higher-risk myelodysplastic syndrome and chronic myelomonocytic leukemia. Blood 2007;109(1):52-7.
228. Momparler RL, Cote S, Eliopoulos N. Pharmacological approach for optimization of the dose schedule of 5-Aza-2'-deoxycytidine (Decitabine) for the therapy of leukemia. Leukemia 1997;11(2):175-80.
229. Chabot GG, Rivard GE, Momparler RL. Plasma and cerebrospinal fluid pharmacokinetics of 5-Aza-2'-deoxycytidine in rabbits and dogs. Cancer Res 1983;43(2):592-7.
256 230. Cihak A, Vesely J, Hynie S. Transformation and metabolic effects of 5-aza-2'- deoxycytidine in mice. Biochem Pharmacol 1980;29(21):2929-32.
257