DOCSLIB.ORG

Isolation and Characterization of Six Microsatellite Loci in the Larch Budmoth Zeiraphera Diniana (Lepidoptera: Tortricidae)

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Isolation and Characterization of Six Microsatellite Loci in the Larch Budmoth Zeiraphera Diniana (Lepidoptera: Tortricidae) NOTE Eur. J. Entomol. 107: 267–269, 2010 http://www.eje.cz/scripts/viewabstract.php?abstract=1534 ISSN 1210-5759 (print), 1802-8829 (online) Isolation and characterization of six microsatellite loci in the larch budmoth Zeiraphera diniana (Lepidoptera: Tortricidae) SOPHIE DELAMAIRE1, G. DANNY ESSELINK2, LEILA SAMIEI2,3, CLAUDINE COURTIN1, EMMANUELLE MAGNOUX1, JÉRÔME ROUSSELET1 and M.J.M. SMULDERS2 1INRA UR0633 Zoologie Forestière Orléans, 2163 Avenue de la Pomme de Pin, 45075 Orléans, France; e-mail: [email protected] 2Plant Research International, Wageningen UR Plant Breeding, P.O. Box 16, NL-6700 AA Wageningen 3Dept. of Horticulture, College of Agriculture and Natural Resources, University of Tehran, Karaj, Iran Key words. Lepidoptera, Tortricidae, Zeiraphera diniana, larch budmoth, microsatellite markers, outbreak Abstract. Six microsatellite markers were developed for the larch budmoth Zeiraphera diniana Guénée 1845, using two enrichment protocols. The number of alleles ranged from 3 to 15 per locus and observed heterozygosities ranged from 0.09 to 0.98 for the 69 individuals genotyped. Using these markers significant genetic differentiation between one population from Poland and samples from Alpine populations in France and Switzerland (overall FST = 0.0298) was detected. However, the two Alpine samples did not differ significantly. These microsatellite markers are valuable tools for studying the population genetics of Zeiraphera diniana. INTRODUCTION 0.1% SDS for 10 min at 100°C. Eluted fragments were precipi- tated and re-amplified. To obtain microsatellites with a high The larch budmoth, Zeiraphera diniana Guénée 1845 (Lepi- number of repeats and sufficient flanking sequence, fraction 1 doptera: Tortricidae), is a Palaearctic species (Bovey & Grison, was used for trinucleotide motifs with 30% CG content, fraction 1975). In the Alps population densities fluctuate dramatically, 2 for motifs with 60% GC and fraction 3 for motif CGG (100% with an outbreak every eight to ten years, causing spectacular CG content). For the GT motif fraction 1 was used. Amplified defoliation of large stands of larch (Larix decidua) (Balten- fragments were cloned and for each motif 192 colonies were sweiler & Rubli, 1999). The outbreak takes the form of a wave screened as previously described (van de Wiel et al., 1999). The that spreads from the South-Western to North-Eastern Alps over most abundant trinucleotide repeat was GCT (11% positive a period of five to six years (Johnson et al., 2004). The temporal clones) followed by GCC (6%), CGT (4%), and TCT (0.5%). and spatial characteristics of this insect make it a good model For the other motifs no repeats were isolated. In total 13 for studies on population dynamics and genetics. So far, genetic sequences with a unique repeat were obtained. All sequences studies have focused on the differentiation between the host were submitted to the EMBL database (FN185943–185953, races on larch and pine, using allozymes and AFLP’s (Emeli- FN263245). Primer pairs were designed using LASERGENE anov et al., 1995, 2003a, b). Here we develop microsatellite v8.1 (DNASTAR, Inc., Madison, WI, USA). Reverse primers markers to study population genetics in space and time, which were PIG-tailed (Brownstein et al., 1996). Using this will allow us to investigate the demographic processes observed. enrichment, five polymorphic loci (Zd01, Zd02, Zd05, Zd09, MATERIAL AND METHODS and Zd16) with unambiguously scorable alleles were obtained. Second protocol (INRA, France) This paper reports two different microsatellite screening pro- cedures done in two separate laboratories: Plant Research Inter- Microsatellite loci were isolated following a biotin- national, The Netherlands and Forest Zoology Research Unit, enrichment protocol modified from Kijas & Fowler (1994) and INRA, France. Rousselet et al. (2004). Genomic DNA was extracted from 20 First protocol (Plant Research International, The Nether- caterpillar heads using the DNeasy Tissue Kit (Qiagen). Total Rsa lands) DNA was digested with I and the 300–900 bp-long frag- ments were isolated on a 1% agarose gel using the Qiaquick Gel Microsatellite loci were isolated from a genomic DNA library Extraction kit (Qiagen). Biotin-labelled oligonucleotides corre- using an enrichment procedure after Karagyozov et al. (1993). sponding to microsatellite motifs (CT)10, (GT)10, (CG)10, (AT)10, Genomic DNA was isolated from the head of a caterpillar of (AAT) , (GAA) , (AGC) , (AAC) , (TACA) , and (TACC) Zeiraphera diniana 7 7 7 7 5 5 using the DNeasy Tissue Kit (Qiagen, were hybridized to the modified DNA, and the enrichment was Venlo, The Netherlands). Five hundred nanograms of genomic completed using Streptavidine Magnesphere Paramagnetic Par- Alu Rsa Hae DNA were restricted/ligated with I, I or III, pooled ticles (Promega, Madison, WI, USA). After re-amplification and and amplified as previously described (Esselink et al., 2003; cloning, 5623 recombinant clones were screened by PCR using Schroeder et al., 2009). Microsatellite-containing fragments vector primers plus the repeat-specific primer (Rousselet et al., + were selected by hybridization with Hybond N membranes 2004). A total of 269 positive clones were purified using the using separately spotted synthetic oligonucleotides: (TCT)10, Wizard Plus SV Miniprep DNA purification System Kit (TGT)10, (GAG)8, (GTG)8, (TGA)9, (AGT)9, (CGT)8, (GCT)8, (Promega). Of the 269 clones, 34 different inserts containing (GCC)7, (GT)12. Fragments were eluted from the membranes microsatellites were found after sequencing. PCR primers were with increasing stringencies: (1) 0.5 × SSC, 1% SDS for 30 min designed for all of them, but only one locus (ZD32; FN185954) at 62°C, (2) 0.2 × SSC, 1% SDS for 30 min at 62°C, and (3) 267 TABLE 1. Characteristics of 6 polymorphic microsatellite loci from Zeiraphera diniana tested on 69 individuals (23 from France, 23 from Switzerland, and 23 from Poland). Accession Repeat 2 Allele size No. of 3 Locus Primer sequences (5'–3') Ta HO HE FIS No. motif1 range (bp) alleles Zd01 FN185943 (CAA)5 F (FAM*): TAGTGCCAACCCGCGGAAAATG 55 204–231 5 0.725 0.621 –0.167 R: GTTTCGGATATCCCACGGGGACCAG Zd02 FN185944 (CGA)34–3 F (HEX*): TGGTCAGGAACCGGGTATCCA 59 116–227 11 0.091 0.456 0.802 R: GTTTGAACCCTGGCTGGACCTCTAG Zd05 FN185946 (GCT)28–10 F (HEX*): CCTCATGCCCTTCCCTCCAG 55 193–211 3 0.217 0.200 –0.085 R: GTTTATTGCTTCGTGTTTTTACCACTTA Zd09 FN185945 (ACC)12–3 F (NED*): CCCAAGCGGCGTCTGCT 55 246–261 6 0.580 0.692 0.162 R: GTTTGTACTGACTACATCGCACGAAGTA Zd16 FN263245 (GAT)64–34 F (FAM*): TAGATTCCCCGGAACTAATGATCC 53 276–345 15 0.986 0.716 –0.377 R: GTTTAGATCCTTTGGTCTTATCTTCATT ZD32 FN185954 (CA)9 F (FAM*): ATGCCTACCTACTTGATGCC 49 181–213 13 0.580 0.871 0.334 R: AGTTTCCATACATTTGACACCTAC 1 minus denotes mismatch; 2 Ta = annealing temperature; *fluorescent dyes used; 3 GENEPOP v3.4 (Raymond & Rousset, 1995) was used to calculate HO (observed heterozygosity), HE (expected heterozygosity), and FIS (inbreeding coefficient). was polymorphic (13 alleles detected). In addition, this locus Overall FST (Fixation index measuring population differentia- has an insertion/deletion of an “A” in its microsatellite motif tion; Weir & Cockerham, 1984) was 0.0298. Pairwise FST values (determined by the sequencing of the different alleles), which (averaged across loci) were 0.0535 (P < 0.05) and 0.0428 (P < was considered as additional information when scoring. 0.05) between France and Poland and between Switzerland and Technical details and accession numbers are given in Table 1. Poland, respectively. There was no differentiation between The six loci were amplified in 69 individuals collected in 2006 France and Switzerland (FST = –0.0065, P > 0.05). within the range of the species where outbreaks occur (France, DISCUSSION coordinates 45°01´N, 6°33´E, and Switzerland, coordinates 46°25´N, 9°44´E) and outside this outbreak range (Poland, coor- Microsatellites are very suitable markers for studying popula- dinates 50°24´N, 16°96´E). The amplifications were done using tion genetics, given their high variability, their neutrality, co- a 9800 Fast thermal cycler (Applied Biosystems, Foster City, dominance, and reproducibility. Unfortunately, it is often diffi- CA, USA) and the RedTaq package (Sigma-Aldrich, Inc., St cult to develop them for species of Lepidoptera (Meglécz & Louis, MO, USA). The total reaction volume was 10 µL, con- Solignac, 1998; Nève & Meglécz, 2000; Zhang, 2004; Meglécz taining 10 ng of genomic DNA, 0.4 U of Taq DNA polymerase et al., 2004; Habel et al., 2008; Schroeder et al., 2009). Next to (Sigma), 1X buffer (100 mM Tris HCl, pH 8.3, 500 mM KCl, very low microsatellite cloning efficiencies, often multiple and 0.1% gelatin), 20 mg/L of Betain, 250 µM of each dNTP, copies of microsatellite sequences exist with similar flanking 0.4 µM of each primer, and 1.5 mM MgCl2. Twenty percent of regions and null alleles are also frequent (Meglécz & Solignac, the forward primer was 5' end-labelled with a fluorescent dye, 1998; Nève & Meglécz, 2000; Meglécz et al., 2007; Zhang, either 6-FAM (Sigma), HEX (Sigma) or NED (Applied Biosys- 2004; Vila et al., 2009). In this study two different microsatellite tems). The cycling conditions were 3 min at 95°C followed by screening procedures, processed in two independent 30 cycles of 50 s at 95°C, 1 min at annealing temperature (Table laboratories, were used. This resulted in the development of a 1), and 30 s at 72°C. The amplified products were detected on total of six polymorphic loci. These microsatellite markers will an ABI-3100 automatic sequencer and their sizes were esti- be valuable tools for studies on the population genetics of Zeira- mated using GENESCAN software (Applied Biosystems). phera diniana. GENEPOP v3.4 (Raymond & Rousset, 1995) was used to cal- Departures from Hardy-Weinberg equilibrium were found in culate observed and expected heterozygosities, to test for our data for four of the microsatellite markers, Zd02, Zd09, and Hardy-Weinberg equilibrium (HWE) deviation and linkage ZD32 with a deficit of heterozygotes, and Zd16 with an excess disequilibrium.
Load more

Recommended publications
  • Canopy Arthropod Community Structure and Herbivory in Old-Growth and Regenerating Forests in Western Oregon
    318 Canopy arthropod community structure and herbivory in old-growth and regenerating forests in western Oregon T. D. SCHOWALTER Department of Entomology, Oregon State University, Corvallis, OR 97331-2907, UtS.A. Received June 30, 1988 Accepted October 19, 1988 SCHOWALTER, T. D. 1989. Canopy arthropod community structure and herbivory in old-growth and regenerating forests in western Oregon. Can. J. For. Res. 19: 318-322. This paper describes differences in canopy arthropod community structure and herbivory between old-growth and regenerating coniferous forests at the H. 3. Andrews Experimental Forest in western Oregon. Species diversity and functional diversity were much higher in canopies of old-growth trees compared with those of young trees. Aphid bio- mass in young stands was elevated an order of magnitude over biomass in old-growth stands. This study indicated a shift in the defoliator/sap-sucker ratio resulting from forest conversion, as have earlier studies at Coweeta Hydrologic Laboratory, North Carolina. These data indicated that the taxonomically distinct western coniferous and eastern deciduous forests show similar trends in functional organization of their canopy arthropod communities. SCHOWALTER, T. D. 1989. Canopy arthropod community structure and herbivory in old-growth and regenerating forests in western Oregon. Can. J. For. Res. 19 : 318-322. Cet article expose les differences observees dans la structure communautaire des arthropodes du couvert foliace et des herbivores entre des forets de coniferes de premiere venue et en regeneration a la Foret experimentale H. J. Andrews dans louest de lOregon. La diversit y des especes ainsi que la diversit y fonctionnelle etaient beaucoup plus grandes dans les couverts foliaces des vieux arbres que dans ceux des jeunes arbres.
    [Show full text]
  • Taxonomic Review of the Genus Zeiraphera Treitschke (Lepidoptera: Tortricidae) in Korea, with Description of a New Species
    Journal of Asia-Pacific Biodiversity 9 (2016) 22e28 HOSTED BY Contents lists available at ScienceDirect Journal of Asia-Pacific Biodiversity journal homepage: http://www.elsevier.com/locate/japb Original article Taxonomic review of the genus Zeiraphera Treitschke (Lepidoptera: Tortricidae) in Korea, with description of a new species Sat-Byul Shin a, Bong-Kyu Byun b,* a Natural Environmental Restoration Institute, Daejeon, South Korea b Department of Biological Science and Biotechnology, Hannam University, Daejeon, South Korea article info abstract Article history: This study was carried out to review the genus Zeiraphera in Korea. In this study, a total of eight species of Received 10 December 2015 the genus Zeiraphera, belonging to the tribe Eucosmini, were recognized from Korea, with description of Received in revised form a new species, Zeiraphera subvirinea sp. nov. The wing patterns, and male and female genitalic structures 30 December 2015 for the known species of the genus are examined and redescribed. Key for the species is given. Known Accepted 31 December 2015 food plants and life histories, when available, were reviewed and listed. Available online 8 January 2016 Copyright Ó 2016, National Science Museum of Korea (NSMK) and Korea National Arboretum (KNA). Production and hosting by Elsevier. This is an open access article under the CC BY-NC-ND license (http:// Keywords: Eucosmini creativecommons.org/licenses/by-nc-nd/4.0/). Korea new species Tortricidae Zeiraphera Introduction 1993). The members of the genus usually have one generation a year and hibernate in the egg stage (Medvedev 1987). The genus Zeiraphera belongs to the tribe Eucosmini, which is The first record of the genus Zeiraphera in Korea was Zeiraphera the second largest tribe in the subfamily Olethreutinae under the griseana (Hübner), which was listed in the “List of Forest Insect family Tortricidae with more than 1600 described species of 116 Pests in Korea” (Ko 1969).
    [Show full text]
  • Revised World Catalogue of Eucopina, Eucosma, Pelochrista, and Phaneta (Lepidoptera: Tortricidae: Eucosmini)
    Zootaxa 3746 (2): 301–337 ISSN 1175-5326 (print edition) www.mapress.com/zootaxa/ Article ZOOTAXA Copyright © 2013 Magnolia Press ISSN 1175-5334 (online edition) http://dx.doi.org/10.11646/zootaxa.3746.2.4 http://zoobank.org/urn:lsid:zoobank.org:pub:A7DD3F31-C3F5-4FED-BD46-157DE7464EEA Revised world catalogue of Eucopina, Eucosma, Pelochrista, and Phaneta (Lepidoptera: Tortricidae: Eucosmini) TODD M. GILLIGAN1 & DONALD J. WRIGHT2 1 Colorado State University, Department of Bioagricultural Sciences and Pest Management, Fort Collins, CO 80523 USA. E-mail: [email protected] 2 3349 Morrison Ave., Cincinnati, OH 45220 USA. E-mail: [email protected] Abstract A revised world catalogue of Eucopina, Eucosma, Pelochrista, and Phaneta is provided. Assignment to genus is based on generic redescriptions by Gilligan et al. (2013). A total of 709 names (including subspecies and synonyms) are listed, including 251 new combinations and 52 revised combinations. Key words: Olethreutinae, Lepidoptera, Tortricidae, Eucosmini Introduction The olethreutine lineage containing Eucosma, Pelochrista, and Phaneta is one of the largest in Tortricidae, with more than 500 described taxa. Its taxonomic history is a classic example of the confusion that results from a lack of clarity regarding generic concepts (Gilligan & Wright 2013, Gilligan et al. 2013). Here we present, in the form of a revised catalogue, the taxonomic implications of a phylogenetic analysis of the group by Gilligan et al. (2013). That study produced revised definitions of Eucosma and Pelochrista based on female genital morphology, concluded that nearly all North American Phaneta belong in the redefined Eucosma, and described Eucopina as a new genus of Pinaceae-feeding species that previously had been placed in Eucosma.
    [Show full text]
  • Chemical Control of the Spruce Budmoth, Zeiraphera Canadensis Mut. and Free. (Lepidoptera: Olethreuthidae) on White Spruce in Maine J
    The University of Maine DigitalCommons@UMaine Technical Bulletins Maine Agricultural and Forest Experiment Station 1-1-1984 TB112: Chemical Control of the Spruce Budmoth, Zeiraphera canadensis Mut. And Free. (Lepidoptera: Olethreuthidae) on White Spruce in Maine J. A. Holmes E. A. Osgood Follow this and additional works at: https://digitalcommons.library.umaine.edu/aes_techbulletin Part of the Entomology Commons Recommended Citation Holmes, J.A., and E.A. Osgood. 1984. Chemical control of the spruce budmoth, Zeiraphera canadensis Mut. And Free. (Lepidoptera: Olethreurtidae) on white spruce in Maine. Maine Agricultural Experiment Station Technical Bulletin 112. This Article is brought to you for free and open access by DigitalCommons@UMaine. It has been accepted for inclusion in Technical Bulletins by an authorized administrator of DigitalCommons@UMaine. For more information, please contact [email protected]. ISSN 0734 9556 CHEMICAL CONTROL OF THE SPRUCE BUDMOTH, ZEIRAPHERA CANADENSIS MUT. AND FREE. (LEPIDOPTERA: OLETHREUTIDAE) ON WHITE SPRUCE IN MAINE J.A. Holmes and E.A. Osgood MAINE AGRICULTURAL EXPERIMENT STATION UNIVERSITY OF MAINE AT ORONO Technical Bulletin 112 January 1984 CHEMICAL CONTROL OF THE SPRUCE BUDMOTH, ZEIRAPHERA CANADENSIS MUT AND FREE. (LEPIDOPTERA: OLETHREUTIDAE) ON WHITE SPRUCE IN MAINE J. A. Holmes and E. A. Osgood 1 Graduate Student, Department of Entomology 2 Professor of Entomology, Department of Entomology ACKNOWLEDGEMENTS The authors wish to express special thanks to Lester K. Hartling of he New Brunswick Department of Natural Resources (formerly with Forest protection Limited) for providing invaluable information concerning bud- moth biology, behavior and control in New Brunswick; Norman Perkins and Belmont Glidden for the use of their plantations at Patten and Mt.
    [Show full text]
  • Redalyc.Catalogue of Eucosmini from China (Lepidoptera: Tortricidae)
    SHILAP Revista de Lepidopterología ISSN: 0300-5267 [email protected] Sociedad Hispano-Luso-Americana de Lepidopterología España Zhang, A. H.; Li, H. H. Catalogue of Eucosmini from China (Lepidoptera: Tortricidae) SHILAP Revista de Lepidopterología, vol. 33, núm. 131, septiembre, 2005, pp. 265-298 Sociedad Hispano-Luso-Americana de Lepidopterología Madrid, España Available in: http://www.redalyc.org/articulo.oa?id=45513105 How to cite Complete issue Scientific Information System More information about this article Network of Scientific Journals from Latin America, the Caribbean, Spain and Portugal Journal's homepage in redalyc.org Non-profit academic project, developed under the open access initiative 265 Catalogue of Eucosmini from 9/9/77 12:40 Página 265 SHILAP Revta. lepid., 33 (131), 2005: 265-298 SRLPEF ISSN:0300-5267 Catalogue of Eucosmini from China1 (Lepidoptera: Tortricidae) A. H. Zhang & H. H. Li Abstract A total of 231 valid species in 34 genera of Eucosmini (Lepidoptera: Tortricidae) are included in this catalo- gue. One new synonym, Zeiraphera hohuanshana Kawabe, 1986 syn. n. = Zeiraphera thymelopa (Meyrick, 1936) is established. 28 species are firstly recorded for China. KEY WORDS: Lepidoptera, Tortricidae, Eucosmini, Catalogue, new synonym, China. Catálogo de los Eucosmini de China (Lepidoptera: Tortricidae) Resumen Se incluyen en este Catálogo un total de 233 especies válidas en 34 géneros de Eucosmini (Lepidoptera: Tor- tricidae). Se establece una nueva sinonimia Zeiraphera hohuanshana Kawabe, 1986 syn. n. = Zeiraphera thymelopa (Meyrick, 1938). 28 especies se citan por primera vez para China. PALABRAS CLAVE: Lepidoptera, Tortricidae, Eucosmini, catálogo, nueva sinonimia, China. Introduction Eucosmini is the second largest tribe of Olethreutinae in Tortricidae, with about 1000 named spe- cies in the world (HORAK, 1999).
    [Show full text]
  • RJ WEST,^ M KENIS,' GW Bun, and SM BENNETT Abstract
    PARASITOID COMPLEX OF ZEZZUPHERA CANADENSZS (LEPIDOPTERA: TORTRICIDAE) AND EVALUATION OF TYCHERUS OSCULATOR (HYMENOPTERA: ICHNEUMONIDAE) AS A BIOLOGICAL CONTROL AGENT RJ WEST,^ M KENIS,' GW Bun, and SM BENNETT Natural Resources Canada, P.O. Box 960, Comer Brook, Newfoundland, Canada A2H 653 Abstract The Canadian Entomologist 131: 465 - 474 (1999) A survey of larval and pupal populations of the spruce bud moth, Zeiraphera canadensis Mutuura and Freeman (Lepidoptera: Tortricidae), conducted from 1994 to 1996 in eastern Newfoundland, disclosed that the incidence of endemic parasit- ism by Hymenoptera was up to 50% for Tycherus osculator (Thiinberg) (Ichneu- monidae), up to 15% for Earinus zeirapherae (Walley), under 3% for Ascogaster (Wesmael 1835) sp. and Clinocentrus (Haliday 1833) sp. (Braconidae), and under 1% for Lamachus (Foerster 1868) sp. and Triclistus (Foerster 1868) sp. (Ichneu- monidae). Tycherus osculator, E. zeirapherae, Ascogaster sp., and Clinocentrus sp. represent new distributional range extensions to Newfoundland, and to the nearctic region in the case of Z osculator. The biology of European populations of Z osculator was studied on a natural host, Zeiraphera diniana (GuenCe). Only fe- males overwintered and ovarian maturation did not occur until after several months of exposure to near-freezing temperatures. Tycherus osculator successfully parasit- ized prepupae and pupae of Z. diniana of all ages but, in the laboratory, appeared to prefer pupae. Host feeding by Z osculator was common but not necessary for ovar- ian maturation. Tycherus osculator imported from Europe attacked and successfully developed within the spruce bud moth host in laboratory screenings. Morphological comparisons indicated that Z osculator reared from Z. canadensis were smaller than those reared from Z.
    [Show full text]
  • Genetic Differentiation in Zeiraphera Diniana (Lepidoptera: Tortricidae, the Larch Budmoth): Polymorphism, Host Races Or Sibling Species?
    Heredity 75(1995) 4 16—424 Received22 March 1995 Genetic differentiation in Zeiraphera diniana (Lepidoptera: Tortricidae, the larch budmoth): polymorphism, host races or sibling species? IGOR EMELIANOV*, JAMES MALLET & WERNER BALTENSWEILERt Ga/ton Laboratory, Department of Genetics and Biometry, University College London, 4 Stephenson Way, London NWI2HE, U.Kand Blumenbergstrasse 9, CH-8634 Hombrechtikon, Switzerland. Elevenlarch- and pine-feeding populations of the larch budmoth were studied in Western Europe using 24 allozyme loci. Hierarchical F-statistics between larch and pine forms (FSTO.O65) were much greater than those between localities within larch (FSTO.0O2) and within pine (FST 0.026), even when sympatric host-associated populations were considered. Analysis of Nei's genetic distance produced similar results, and a UPGMA tree of all populations consistently clustered samples from the same hosts together. Three loci, autosomal Pgm and Mdh-s and sex-linked Idh-s, were the most important loci involved in differences between the two forms. Previously considered to be conspecific, it is now clear that the larch and pine biotypes of Z. diniana are either host races (sensu Diehi & Bush, 1984) or good sympatric species which hybridize rarely. Regardless of taxonomic status, the distribution of larch and pine in the Pleistocene, phenological differences between the two hosts, together with the great vagility of Z. diniana, an outbreak pest, suggest that sympatric or parapatric differentiation is at least as likely as allopatric divergence.
    [Show full text]
  • Download Download
    Index to Volume 118 Compiled by Leslie Cody Abies balsamea, 46,95,124,251,268,274,361,388,401,510,530 confines, 431 lasiocarpa, 191,355,584 thomsoni, 431 Abrostola urentis, 541 Agelaius phoeniceus, 201 Acanthopteroctetes bimaculata, 532 Agelaius phoeniceus, Staging in Eastern South Dakota, Spring Acanthopteroctetidae, 532 Dispersal Patterns of Red-winged Blackbirds, 201 Acasis viridata, 539 Aglais milberti, 537 Acer,52 Agonopterix gelidella, 533 negundo, 309 Agriphila ruricolella, 536 rubrum, 41,96,136,136,251,277,361,508 vulgivagella, 536 saccharinum, 41,124,251 Agropyron spp., 400,584 saccharum, 361,507 cristatum, 300 spicatum, 362 pectiniforme, 560 Achigan à grande bouche, 523 repens, 300 à petite bouche, 523 sibiricum, 560 Achillea millefolium, 166 Agrostis sp., 169 Achnatherum richardsonii, 564 filiculmis, 558 Acipenser fulvescens, 523 gigantea, 560 Acipenseridae, 523 Aira praecox, 177 Acleris albicomana, 534 Aix sponsa, 131,230 britannia, 534 Alaska, Changes in Loon (Gavia spp.) and Red-necked Grebe celiana, 534 (Podiceps grisegena) Populations in the Lower Mata- emargana, 535 nuska-Susitna Valley, 210 forbesana, 534 Alaska, Interactions of Brown Bears, Ursus arctos, and Gray logiana, 534 Wolves, Canis lupus, at Katmai National Park and Pre- nigrolinea, 535 serve, 247 obligatoria, 534 Alaska, Seed Dispersal by Brown Bears, Ursus arctos,in schalleriana, 534 Southeastern, 499 variana, 534 Alaska, The Heather Vole, Genus Phenacomys, in, 438 Acorn, J.H., Review by, 468 Alberta: Distribution and Status, The Barred Owl, Strix varia Acossus
    [Show full text]
  • Temporal Dynamics of Arthropods on Six Tree Species in Dry Woodlands on the Caribbean Island of Puerto Rico William Beltra´N1,2,3,4 and Joseph M
    Journal of Insect Science RESEARCH Temporal Dynamics of Arthropods on Six Tree Species in Dry Woodlands on the Caribbean Island of Puerto Rico William Beltra´n1,2,3,4 and Joseph M. Wunderle Jr.2 1Department of Biology, University of Puerto Rico, San Juan, PR 00931-3360 2International Institute of Tropical Forestry, USDA Forest Service, Sabana Field Research Station, HC 02 Box 6205, Luquillo, PR 00773 3Present address: Department of Natural Sciences, University of the Pacific, A.A 10299, Buenaventura, Colombia 4Corresponding author, e-mail: [email protected] Subject Editor: Nadir Erbilgin J. Insect Sci. 14(199): 2014; DOI: 10.1093/jisesa/ieu061 ABSTRACT. The seasonal dynamics of foliage arthropod populations are poorly studied in tropical dry forests despite the importance of these studies for understanding arthropod population responses to environmental change. We monitored the abundance, temporal dis- tributions, and body size of arthropods in five naturalized alien and one native tree species to characterize arthropod seasonality in dry Downloaded from novel Prosopis–Leucaena woodlands in Puerto Rico. A branch clipping method was used monthly to sample foliage arthropod abun- dance over 39 mo. Seasonal patterns of rainfall and abundance within various arthropod taxa were highly variable from year to year. Abundance for most taxa did not show significant seasonality over the 3 yr, although most taxa had abundance peaks each year. However, Homoptera displayed high seasonality with significant temporal aggregations in each year. Formicidae, Orthoptera, and Coleoptera showed high variation in abundance between wet and dry periods, whereas Hemiptera were consistently more abundant in the wet period. Seasonal differences in mean abundance were found only in a few taxa on Tamarindus indica L., Bucida buceras L., http://jinsectscience.oxfordjournals.org/ Pithecellobium dulce, and (Roxburgh) Benth.
    [Show full text]
  • Taxonomic Review of the Genus Zeiraphera Treitschke (Lepidoptera: Tortricidae) in Korea, with Description of a New Species
    Journal of Asia-Pacific Biodiversity 9 (2016) 22e28 HOSTED BY Contents lists available at ScienceDirect Journal of Asia-Pacific Biodiversity journal homepage: http://www.elsevier.com/locate/japb Original article Taxonomic review of the genus Zeiraphera Treitschke (Lepidoptera: Tortricidae) in Korea, with description of a new species Sat-Byul Shin a, Bong-Kyu Byun b,* a Natural Environmental Restoration Institute, Daejeon, South Korea b Department of Biological Science and Biotechnology, Hannam University, Daejeon, South Korea article info abstract Article history: This study was carried out to review the genus Zeiraphera in Korea. In this study, a total of eight species of Received 10 December 2015 the genus Zeiraphera, belonging to the tribe Eucosmini, were recognized from Korea, with description of Received in revised form a new species, Zeiraphera subvirinea sp. nov. The wing patterns, and male and female genitalic structures 30 December 2015 for the known species of the genus are examined and redescribed. Key for the species is given. Known Accepted 31 December 2015 food plants and life histories, when available, were reviewed and listed. Available online 8 January 2016 Copyright Ó 2016, National Science Museum of Korea (NSMK) and Korea National Arboretum (KNA). Production and hosting by Elsevier. This is an open access article under the CC BY-NC-ND license (http:// Keywords: Eucosmini creativecommons.org/licenses/by-nc-nd/4.0/). Korea new species Tortricidae Zeiraphera Introduction 1993). The members of the genus usually have one generation a year and hibernate in the egg stage (Medvedev 1987). The genus Zeiraphera belongs to the tribe Eucosmini, which is The first record of the genus Zeiraphera in Korea was Zeiraphera the second largest tribe in the subfamily Olethreutinae under the griseana (Hübner), which was listed in the “List of Forest Insect family Tortricidae with more than 1600 described species of 116 Pests in Korea” (Ko 1969).
    [Show full text]
  • Biodiversity Action Plan 2020-30 Rob Mackeen & Marten Lewis FRSA
    Biodiversity Action Plan 2020-30 Rob Mackeen & Marten Lewis FRSA 2 Foreword endorsements “Bluestone National Park Resort Sophie Howe, Future Generations (Bluestone) will seek to enrich the Commissioner: natural environment and create “ I have been very impressed with a net increase in the diversity the way in which Bluestone are of both habitats and species. embracing sustainability and the Empathy with the natural world Wellbeing of Future Generations will be quite literally, at the Act, from reducing their general heart of this holiday experience. waste by over 40%, to enhancing Bluestone’s ethos has to be the biodiversity, and working with care of it’s natural environment public services during the and it is this dependence that pandemic - there is lots for others will drive the need to conserve to learn from them. I hope that and enhance the vitality of the they will now take their good work surrounding countryside, as even further.” well as increasing the public Ant Rogers, Biodiversity understanding and enjoyment of it, Implementation Officer, both now and far into the future. Pembrokeshire Nature The positive economic impact Partnership: of Bluestone is very significant “Bluestone are valued members to Pembrokeshire but not at the of the Pembrokeshire Nature expense of the environment.” Partnership, working together to promote nature recovery in - William McNamara our County. The transformation (Bluestone; A New Generation at Bluestone from dairy farm to Holiday Village) 2008. nature based resort has seen increases in biodiversity and the contribution the site makes to wider ecological networks. The work that has been done to develop habitats and enhance the natural assets has taken place with reference to local and national Nature Recovery Action Plans.
    [Show full text]
  • New Arthropod Herbivores on Trees and Shrubs in Iceland and Changes in Pest Dynamics: a Review
    ICEL. AGRIC. SCI. 26 (2013), 69-84 Review article New arthropod herbivores on trees and shrubs in Iceland and changes in pest dynamics: A review GudmunduR HalldóRsson1, BjaRni d. siGuRdsson2, BRynja HRafnkelsdóttiR2,3, edda s. oddsdóttiR3, ólafuR eGGeRtsson3 and eRlinG ólafsson4 1 Soil Conservation Service of Iceland, Gunnarsholt, IS-851 Hella, Iceland. [email protected] (corresponding author) 2 Agricultural University of Iceland, Hvanneyri, IS-311 Borgarnes, Iceland. [email protected] 3 Icelandic Forest Research, Mogilsa, IS-116 Reykjavik, Iceland. [email protected]; [email protected]; [email protected] 4 Icelandic Institute of Natural History, Urriðaholtsstræti 6-8, IS-212 Garðabær, Iceland. [email protected] ABSTRACT This paper is a review of the history of the introduction of arthropod herbivore species to Iceland since the beginning of the 20th century. A total of 27 new arthropod herbivore species on trees and shrubs have become established in Iceland during this period. One of the introduced pest species, the pine woolly aphid, has been considered to be the major cause of the almost total eradication of the introduced Scots pine in Iceland. The rate of introduction was found to be highest during warm periods. Outbreaks of pests in birch woodlands were also found to be most severe during warm periods. Other pest species have shown changes in outbreak patterns since 1990. The consequences of these findings for isolated native forest ecosystems and a growing forest resource in Iceland are discussed. Keywords: Birch woodland, climate change, insect outbreaks, introduced species, native forest ecosystems YFIRLIT Nýjar tegundir liðfætlna á trjám og runnum á Íslandi Í þessari grein er rakin landnámssaga nýrra liðdýrategunda sem lifa á trjám og runnum á Íslandi.
    [Show full text]