DOCSLIB.ORG

Mouse Krt72 Conditional Knockout Project (CRISPR/Cas9)

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Mouse Krt72 Conditional Knockout Project (CRISPR/Cas9) https://www.alphaknockout.com Mouse Krt72 Conditional Knockout Project (CRISPR/Cas9) Objective: To create a Krt72 conditional knockout Mouse model (C57BL/6J) by CRISPR/Cas-mediated genome engineering. Strategy summary: The Krt72 gene (NCBI Reference Sequence: NM_213728 ; Ensembl: ENSMUSG00000056605 ) is located on Mouse chromosome 15. 9 exons are identified, with the ATG start codon in exon 1 and the TGA stop codon in exon 9 (Transcript: ENSMUST00000071104). Exon 2 will be selected as conditional knockout region (cKO region). Deletion of this region should result in the loss of function of the Mouse Krt72 gene. To engineer the targeting vector, homologous arms and cKO region will be generated by PCR using BAC clone RP23-437J8 as template. Cas9, gRNA and targeting vector will be co-injected into fertilized eggs for cKO Mouse production. The pups will be genotyped by PCR followed by sequencing analysis. Note: Exon 2 starts from about 29.1% of the coding region. The knockout of Exon 2 will result in frameshift of the gene. The size of intron 1 for 5'-loxP site insertion: 981 bp, and the size of intron 2 for 3'-loxP site insertion: 2662 bp. The size of effective cKO region: ~715 bp. The cKO region does not have any other known gene. Page 1 of 7 https://www.alphaknockout.com Overview of the Targeting Strategy Wildtype allele gRNA region 5' gRNA region 3' 1 2 9 Targeting vector Targeted allele Constitutive KO allele (After Cre recombination) Legends Homology arm Exon of mouse Krt72 cKO region loxP site Page 2 of 7 https://www.alphaknockout.com Overview of the Dot Plot Window size: 10 bp Forward Reverse Complement Sequence 12 Note: The sequence of homologous arms and cKO region is aligned with itself to determine if there are tandem repeats. Tandem repeats are found in the dot plot matrix. It may be difficult to construct this targeting vector. Overview of the GC Content Distribution Window size: 300 bp Sequence 12 Summary: Full Length(7215bp) | A(27.69% 1998) | C(22.2% 1602) | T(24.46% 1765) | G(25.64% 1850) Note: The sequence of homologous arms and cKO region is analyzed to determine the GC content. Significant high GC-content regions are found. It may be difficult to construct this targeting vector. Page 3 of 7 https://www.alphaknockout.com BLAT Search Results (up) QUERY SCORE START END QSIZE IDENTITY CHROM STRAND START END SPAN ----------------------------------------------------------------------------------------------- browser details YourSeq 3000 1 3000 3000 100.0% chr15 - 101785275 101788274 3000 browser details YourSeq 214 19 328 3000 97.8% chr12 - 45894657 45895096 440 browser details YourSeq 204 130 337 3000 99.1% chr1 + 105945801 105946008 208 browser details YourSeq 202 133 349 3000 96.8% chr5 - 53973408 53973657 250 browser details YourSeq 201 133 418 3000 97.2% chr1 + 26946258 26946612 355 browser details YourSeq 199 133 336 3000 99.1% chr14 - 104019284 104019502 219 browser details YourSeq 198 133 341 3000 98.6% chr8 - 44232229 44232527 299 browser details YourSeq 198 133 336 3000 98.6% chr11 + 110342493 110342696 204 browser details YourSeq 198 133 332 3000 99.5% chr1 + 102460093 102460292 200 browser details YourSeq 196 133 332 3000 99.0% chr6 - 125838878 125839077 200 browser details YourSeq 196 133 333 3000 99.1% chr4 - 57872940 57873162 223 browser details YourSeq 196 133 333 3000 99.1% chr3 - 61555097 61555302 206 browser details YourSeq 196 133 333 3000 99.1% chr16 - 86297550 86297752 203 browser details YourSeq 196 133 333 3000 99.1% chr13 - 20668316 20668517 202 browser details YourSeq 196 133 338 3000 97.6% chr12 - 38509122 38509327 206 browser details YourSeq 196 133 338 3000 96.6% chr4 + 101061053 101061255 203 browser details YourSeq 196 133 334 3000 97.6% chr2 + 87185775 87185975 201 browser details YourSeq 196 133 333 3000 99.1% chr14 + 53900329 53900541 213 browser details YourSeq 196 133 332 3000 99.0% chr12 + 101619553 101619752 200 browser details YourSeq 196 133 337 3000 96.1% chr10 + 17143278 17143479 202 Note: The 3000 bp section upstream of Exon 2 is BLAT searched against the genome. No significant similarity is found. BLAT Search Results (down) QUERY SCORE START END QSIZE IDENTITY CHROM STRAND START END SPAN -------------------------------------------------------------------------------------------------------------- browser details YourSeq 3000 1 3000 3000 100.0% chr15 - 101781560 101784559 3000 browser details YourSeq 63 897 999 3000 86.3% chr2 - 174541875 174541997 123 browser details YourSeq 62 892 973 3000 84.5% chr15 + 38572235 38572313 79 browser details YourSeq 60 904 997 3000 83.9% chr4 - 126902155 126902238 84 browser details YourSeq 57 892 997 3000 93.9% chr5 + 36737081 36737191 111 browser details YourSeq 55 892 973 3000 95.1% chr11 - 97382314 97382412 99 browser details YourSeq 55 894 1034 3000 95.1% chr10 - 71658268 71658671 404 browser details YourSeq 53 888 1001 3000 95.0% chr4 + 40891884 40892257 374 browser details YourSeq 52 894 997 3000 92.0% chr15 - 99282698 99282823 126 browser details YourSeq 51 894 975 3000 94.8% chr7 - 126651329 126651616 288 browser details YourSeq 51 904 993 3000 90.5% chr1 - 59047376 59047589 214 browser details YourSeq 50 892 975 3000 81.5% chr10 - 85156857 85156928 72 browser details YourSeq 49 873 961 3000 83.6% chr4 + 115838651 115838758 108 browser details YourSeq 48 915 997 3000 87.5% chr7 - 78780195 78780301 107 browser details YourSeq 48 2899 2958 3000 88.0% chr15 - 101558347 101558405 59 browser details YourSeq 48 894 973 3000 78.6% chr1 - 108927582 108927649 68 browser details YourSeq 48 890 997 3000 86.3% chr1 - 4848440 4848545 106 browser details YourSeq 46 895 973 3000 78.2% chrUn_JH584304 - 12809 12876 68 browser details YourSeq 46 894 973 3000 77.0% chr6 - 120352230 120352291 62 browser details YourSeq 46 874 933 3000 98.0% chr16 - 53953901 53954442 542 Note: The 3000 bp section downstream of Exon 2 is BLAT searched against the genome. No significant similarity is found. Page 4 of 7 https://www.alphaknockout.com Gene and protein information: Krt72 keratin 72 [ Mus musculus (house mouse) ] Gene ID: 105866, updated on 13-Aug-2019 Gene summary Official Symbol Krt72 provided by MGI Official Full Name keratin 72 provided by MGI Primary source MGI:MGI:2146034 See related Ensembl:ENSMUSG00000056605 Gene type protein coding RefSeq status VALIDATED Organism Mus musculus Lineage Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Mus; Mus Also known as K72; CK-72; K6irs2; Krt2-35; AI507495; Krt72-ps Expression Low expression observed in reference dataset See more Orthologs human all Genomic context Location: 15; 15 F2 See Krt72 in Genome Data Viewer Exon count: 9 Annotation release Status Assembly Chr Location 108 current GRCm38.p6 (GCF_000001635.26) 15 NC_000081.6 (101776172..101786520, complement) Build 37.2 previous assembly MGSCv37 (GCF_000001635.18) 15 NC_000081.5 (101606991..101616889, complement) Chromosome 15 - NC_000081.6 Page 5 of 7 https://www.alphaknockout.com Transcript information: This gene has 2 transcripts Gene: Krt72 ENSMUSG00000056605 Description keratin 72 [Source:MGI Symbol;Acc:MGI:2146034] Gene Synonyms K6irs2, Krt72-ps Location Chromosome 15: 101,776,172-101,786,460 reverse strand. GRCm38:CM001008.2 About this gene This gene has 2 transcripts (splice variants), 80 orthologues, 68 paralogues and is a member of 1 Ensembl protein family. Transcripts Name Transcript ID bp Protein Translation ID Biotype CCDS UniProt Flags Krt72-201 ENSMUST00000071104.5 1953 520aa ENSMUSP00000065922.4 Protein coding CCDS27863 Q6IME9 TSL:2 GENCODE basic APPRIS P1 Krt72-202 ENSMUST00000127671.2 715 No protein - lncRNA - - TSL:3 30.29 kb Forward strand 101.77Mb 101.78Mb 101.79Mb Contigs AC104862.15 > Genes (Comprehensive set... < Krt72-201protein coding < Krt73-201protein coding < Krt72-202lncRNA Regulatory Build 101.77Mb 101.78Mb 101.79Mb Reverse strand 30.29 kb Regulation Legend CTCF Enhancer Open Chromatin Promoter Flank Gene Legend Protein Coding merged Ensembl/Havana Non-Protein Coding RNA gene Page 6 of 7 https://www.alphaknockout.com Transcript: ENSMUST00000071104 < Krt72-201protein coding Reverse strand 10.29 kb ENSMUSP00000065... MobiDB lite Low complexity (Seg) Coiled-coils (Ncoils) Superfamily SSF64593 SMART Intermediate filament, rod domain Prints Keratin, type II Pfam Keratin type II head Intermediate filament, rod domain PROSITE profiles Intermediate filament, rod domain PROSITE patterns Intermediate filament protein, conserved site PANTHER PTHR45616 PTHR45616:SF2 Gene3D 1.20.5.500 1.20.5.170 Intermediate filament, rod domain, coil 1B All sequence SNPs/i... Sequence variants (dbSNP and all other sources) Variant Legend missense variant synonymous variant Scale bar 0 60 120 180 240 300 360 420 520 We wish to acknowledge the following valuable scientific information resources: Ensembl, MGI, NCBI, UCSC. Page 7 of 7.
Load more

Recommended publications
  • Supplementary Materials
    1 Supplementary Materials: Supplemental Figure 1. Gene expression profiles of kidneys in the Fcgr2b-/- and Fcgr2b-/-. Stinggt/gt mice. (A) A heat map of microarray data show the genes that significantly changed up to 2 fold compared between Fcgr2b-/- and Fcgr2b-/-. Stinggt/gt mice (N=4 mice per group; p<0.05). Data show in log2 (sample/wild-type). 2 Supplemental Figure 2. Sting signaling is essential for immuno-phenotypes of the Fcgr2b-/-lupus mice. (A-C) Flow cytometry analysis of splenocytes isolated from wild-type, Fcgr2b-/- and Fcgr2b-/-. Stinggt/gt mice at the age of 6-7 months (N= 13-14 per group). Data shown in the percentage of (A) CD4+ ICOS+ cells, (B) B220+ I-Ab+ cells and (C) CD138+ cells. Data show as mean ± SEM (*p < 0.05, **p<0.01 and ***p<0.001). 3 Supplemental Figure 3. Phenotypes of Sting activated dendritic cells. (A) Representative of western blot analysis from immunoprecipitation with Sting of Fcgr2b-/- mice (N= 4). The band was shown in STING protein of activated BMDC with DMXAA at 0, 3 and 6 hr. and phosphorylation of STING at Ser357. (B) Mass spectra of phosphorylation of STING at Ser357 of activated BMDC from Fcgr2b-/- mice after stimulated with DMXAA for 3 hour and followed by immunoprecipitation with STING. (C) Sting-activated BMDC were co-cultured with LYN inhibitor PP2 and analyzed by flow cytometry, which showed the mean fluorescence intensity (MFI) of IAb expressing DC (N = 3 mice per group). 4 Supplemental Table 1. Lists of up and down of regulated proteins Accession No.
    [Show full text]
  • Investigation of Candidate Genes and Mechanisms Underlying Obesity
    Prashanth et al. BMC Endocrine Disorders (2021) 21:80 https://doi.org/10.1186/s12902-021-00718-5 RESEARCH ARTICLE Open Access Investigation of candidate genes and mechanisms underlying obesity associated type 2 diabetes mellitus using bioinformatics analysis and screening of small drug molecules G. Prashanth1 , Basavaraj Vastrad2 , Anandkumar Tengli3 , Chanabasayya Vastrad4* and Iranna Kotturshetti5 Abstract Background: Obesity associated type 2 diabetes mellitus is a metabolic disorder ; however, the etiology of obesity associated type 2 diabetes mellitus remains largely unknown. There is an urgent need to further broaden the understanding of the molecular mechanism associated in obesity associated type 2 diabetes mellitus. Methods: To screen the differentially expressed genes (DEGs) that might play essential roles in obesity associated type 2 diabetes mellitus, the publicly available expression profiling by high throughput sequencing data (GSE143319) was downloaded and screened for DEGs. Then, Gene Ontology (GO) and REACTOME pathway enrichment analysis were performed. The protein - protein interaction network, miRNA - target genes regulatory network and TF-target gene regulatory network were constructed and analyzed for identification of hub and target genes. The hub genes were validated by receiver operating characteristic (ROC) curve analysis and RT- PCR analysis. Finally, a molecular docking study was performed on over expressed proteins to predict the target small drug molecules. Results: A total of 820 DEGs were identified between
    [Show full text]
  • Cellular and Molecular Signatures in the Disease Tissue of Early
    Cellular and Molecular Signatures in the Disease Tissue of Early Rheumatoid Arthritis Stratify Clinical Response to csDMARD-Therapy and Predict Radiographic Progression Frances Humby1,* Myles Lewis1,* Nandhini Ramamoorthi2, Jason Hackney3, Michael Barnes1, Michele Bombardieri1, Francesca Setiadi2, Stephen Kelly1, Fabiola Bene1, Maria di Cicco1, Sudeh Riahi1, Vidalba Rocher-Ros1, Nora Ng1, Ilias Lazorou1, Rebecca E. Hands1, Desiree van der Heijde4, Robert Landewé5, Annette van der Helm-van Mil4, Alberto Cauli6, Iain B. McInnes7, Christopher D. Buckley8, Ernest Choy9, Peter Taylor10, Michael J. Townsend2 & Costantino Pitzalis1 1Centre for Experimental Medicine and Rheumatology, William Harvey Research Institute, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, Charterhouse Square, London EC1M 6BQ, UK. Departments of 2Biomarker Discovery OMNI, 3Bioinformatics and Computational Biology, Genentech Research and Early Development, South San Francisco, California 94080 USA 4Department of Rheumatology, Leiden University Medical Center, The Netherlands 5Department of Clinical Immunology & Rheumatology, Amsterdam Rheumatology & Immunology Center, Amsterdam, The Netherlands 6Rheumatology Unit, Department of Medical Sciences, Policlinico of the University of Cagliari, Cagliari, Italy 7Institute of Infection, Immunity and Inflammation, University of Glasgow, Glasgow G12 8TA, UK 8Rheumatology Research Group, Institute of Inflammation and Ageing (IIA), University of Birmingham, Birmingham B15 2WB, UK 9Institute of
    [Show full text]
  • The Correlation of Keratin Expression with In-Vitro Epithelial Cell Line Differentiation
    The correlation of keratin expression with in-vitro epithelial cell line differentiation Deeqo Aden Thesis submitted to the University of London for Degree of Master of Philosophy (MPhil) Supervisors: Professor Ian. C. Mackenzie Professor Farida Fortune Centre for Clinical and Diagnostic Oral Science Barts and The London School of Medicine and Dentistry Queen Mary, University of London 2009 Contents Content pages ……………………………………………………………………......2 Abstract………………………………………………………………………….........6 Acknowledgements and Declaration……………………………………………...…7 List of Figures…………………………………………………………………………8 List of Tables………………………………………………………………………...12 Abbreviations….………………………………………………………………..…...14 Chapter 1: Literature review 16 1.1 Structure and function of the Oral Mucosa……………..…………….…..............17 1.2 Maintenance of the oral cavity...……………………………………….................20 1.2.1 Environmental Factors which damage the Oral Mucosa………. ….…………..21 1.3 Structure and function of the Oral Mucosa ………………...….……….………...21 1.3.1 Skin Barrier Formation………………………………………………….……...22 1.4 Comparison of Oral Mucosa and Skin…………………………………….……...24 1.5 Developmental and Experimental Models used in Oral mucosa and Skin...……..28 1.6 Keratinocytes…………………………………………………….….....................29 1.6.1 Desmosomes…………………………………………….…...............................29 1.6.2 Hemidesmosomes……………………………………….…...............................30 1.6.3 Tight Junctions………………………….……………….…...............................32 1.6.4 Gap Junctions………………………….……………….….................................32
    [Show full text]
  • Damage of Hair Follicle Stem Cells and Alteration of Keratin Expression in External Radiation-Induced Acute Alopecia
    INTERNATIONAL JOURNAL OF MOLECULAR MEDICINE 30: 579-584, 2012 Damage of hair follicle stem cells and alteration of keratin expression in external radiation-induced acute alopecia NAOKI NANASHIMA, KOICHI ITO, TAKASHI ISHIKAWA, MANABU NAKANO and TOSHIYA NAKAMURA Department of Biomedical Sciences, Division of Medical Life Sciences, Hirosaki University Graduate School of Health Sciences, Hirosaki, Japan Received April 4, 2012; Accepted May 28, 2012 DOI: 10.3892/ijmm.2012.1018 Abstract. Alopecia is known as a symptom of acute radia- disturbances and blood and bone marrow disorders are known tion, yet little is known concerning the mechanism of this to occur within several hours to several weeks after 1-6 Gy of phenomenon and the alteration of hair protein profiles. To radiation exposure (4,6). examine this, 6-week-old male C57/BL6 mice were exposed Hair loss is also an effect of ARS, but little is known to 6 Gy of X-ray irradiation, which caused acute alopecia. about the mechanism underlying radiation-induced hair loss. Their hair and skin were collected, and hair proteins were In humans, hair loss is caused by radiation of more than analyzed with liquid chromatography/electrospray-ionization 3 Gy, and almost complete hair loss occurs within weeks of mass spectrometry and immunohistochemistry. No change exposure to 6 Gy (4,6). Since blood stem cells are sensitive to was observed in the composition of major hair keratins, such radiation (7), hair loss is thought to be caused by irradiation- as Krt81, Krt83 and Krt86. However, cytokeratin Krt15 and induced stem cell damage, yet no studies have investigated CD34, which are known as hair follicle stem cell markers, this hypothesis.
    [Show full text]
  • KRT72 Antibody Cat
    KRT72 Antibody Cat. No.: 60-728 KRT72 Antibody Specifications HOST SPECIES: Rabbit SPECIES REACTIVITY: Human HOMOLOGY: Predicted species reactivity based on immunogen sequence: Bovine This KRT72 antibody is generated from rabbits immunized with a KLH conjugated IMMUNOGEN: synthetic peptide between 313-342 amino acids from the Central region of human KRT72. TESTED APPLICATIONS: WB APPLICATIONS: For WB starting dilution is: 1:1000 PREDICTED MOLECULAR 56 kDa WEIGHT: Properties This antibody is purified through a protein A column, followed by peptide affinity PURIFICATION: purification. CLONALITY: Polyclonal ISOTYPE: Rabbit Ig CONJUGATE: Unconjugated September 27, 2021 1 https://www.prosci-inc.com/krt72-antibody-60-728.html PHYSICAL STATE: Liquid BUFFER: Supplied in PBS with 0.09% (W/V) sodium azide. CONCENTRATION: batch dependent Store at 4˚C for three months and -20˚C, stable for up to one year. As with all antibodies STORAGE CONDITIONS: care should be taken to avoid repeated freeze thaw cycles. Antibodies should not be exposed to prolonged high temperatures. Additional Info OFFICIAL SYMBOL: KRT72 Keratin, type II cytoskeletal 72, Cytokeratin-72, CK-72, Keratin-72, K72, Type II inner root ALTERNATE NAMES: sheath-specific keratin-K6irs2, Type-II keratin Kb35, KRT72, K6IRS2, KB35, KRT6, KRT6IRS2 ACCESSION NO.: Q14CN4 PROTEIN GI NO.: 166218813 GENE ID: 140807 USER NOTE: Optimal dilutions for each application to be determined by the researcher. Background and References Keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells. The type II keratins consist of basic or neutral proteins which are arranged in pairs of heterotypic keratin chains coexpressed during differentiation of simple and BACKGROUND: stratified epithelial tissues.
    [Show full text]
  • Types I and II Keratin Intermediate Filaments
    Downloaded from http://cshperspectives.cshlp.org/ on October 10, 2021 - Published by Cold Spring Harbor Laboratory Press Types I and II Keratin Intermediate Filaments Justin T. Jacob,1 Pierre A. Coulombe,1,2 Raymond Kwan,3 and M. Bishr Omary3,4 1Department of Biochemistry and Molecular Biology, Bloomberg School of Public Health, Johns Hopkins University, Baltimore, Maryland 21205 2Departments of Biological Chemistry, Dermatology, and Oncology, School of Medicine, and Sidney Kimmel Comprehensive Cancer Center, Johns Hopkins University, Baltimore, Maryland 21205 3Departments of Molecular & Integrative Physiologyand Medicine, Universityof Michigan, Ann Arbor, Michigan 48109 4VA Ann Arbor Health Care System, Ann Arbor, Michigan 48105 Correspondence: [email protected] SUMMARY Keratins—types I and II—are the intermediate-filament-forming proteins expressed in epithe- lial cells. They are encoded by 54 evolutionarily conserved genes (28 type I, 26 type II) and regulated in a pairwise and tissue type–, differentiation-, and context-dependent manner. Here, we review how keratins serve multiple homeostatic and stress-triggered mechanical and nonmechanical functions, including maintenance of cellular integrity, regulation of cell growth and migration, and protection from apoptosis. These functions are tightly regulated by posttranslational modifications and keratin-associated proteins. Genetically determined alterations in keratin-coding sequences underlie highly penetrant and rare disorders whose pathophysiology reflects cell fragility or altered
    [Show full text]
  • Induction of Therapeutic Tissue Tolerance Foxp3 Expression Is
    Downloaded from http://www.jimmunol.org/ by guest on October 2, 2021 is online at: average * The Journal of Immunology , 13 of which you can access for free at: 2012; 189:3947-3956; Prepublished online 17 from submission to initial decision 4 weeks from acceptance to publication September 2012; doi: 10.4049/jimmunol.1200449 http://www.jimmunol.org/content/189/8/3947 Foxp3 Expression Is Required for the Induction of Therapeutic Tissue Tolerance Frederico S. Regateiro, Ye Chen, Adrian R. Kendal, Robert Hilbrands, Elizabeth Adams, Stephen P. Cobbold, Jianbo Ma, Kristian G. Andersen, Alexander G. Betz, Mindy Zhang, Shruti Madhiwalla, Bruce Roberts, Herman Waldmann, Kathleen F. Nolan and Duncan Howie J Immunol cites 35 articles Submit online. Every submission reviewed by practicing scientists ? is published twice each month by Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts http://jimmunol.org/subscription http://www.jimmunol.org/content/suppl/2012/09/17/jimmunol.120044 9.DC1 This article http://www.jimmunol.org/content/189/8/3947.full#ref-list-1 Information about subscribing to The JI No Triage! Fast Publication! Rapid Reviews! 30 days* Why • • • Material References Permissions Email Alerts Subscription Supplementary The Journal of Immunology The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2012 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. This information is current as of October 2, 2021.
    [Show full text]
  • Pilot Production of Mesenchymal Stem/Stromal Freeze-Dried
    1 Supplementary materials: 2 Pilot production of mesenchymal stem/stromal 3 freeze-dried secretome for cell-free regenerative 4 nanomedicine: a validated GMP-compliant process 5 Elia Bari, Sara Perteghella, Dario Di Silvestre, Marzio Sorlini, Laura Catenacci, 6 Milena Sorrenti, Giorgio Marrubini, Rossana Rossi, Giuseppe Tripodo, Pierluigi 7 Mauri, Mario Marazzi and Maria Luisa Torre 8 9 10 11 12 Figure S1. Experimental MS/MS data processing workflows based on Discoverer 2.1 software. A) 13 Processing workflow and parameters set for processing MS/MS spectra. B) Consensus workflow 14 and parameters set for filtering the most confident proteins and peptides. 15 S1 16 17 Figure S2. Protein profile of the lyo-secretome obtained by adipose-derived mesenchymal stem cells. 18 Repeatibility of S1 (A), S2 (B) and S3 (C) technical replicate analyses; in all cases R2>0.99. D) Venn 19 diagram of proteins identified in S1, S2 and S3 biological replicates. E, F) Virtual 2D map obtained 20 plotting MW and pI of the proteins identified; blue dots: proteins identified with an average SpC<1, 21 red dots: proteins identified with an average 2<SpC<10, yellow dots: proteins identified with an 22 average SpC>10. 23 S2 24 25 Figure S3: A) Cellular components, B) molecular functions and C) biological processes enriched in 26 the proteome characterized by analyzing the lyo-secretome obtained by adipose-derived 27 mesenchymal stem cells. Fold enrichment was calculated by means of DAVID db as reported in 28 M&M section. In red are marked the most enriched categories. 29 S2 30 31 Table S1.
    [Show full text]
  • Bivalent Genes Targeting of Glioma Heterogeneity and Plasticity
    International Journal of Molecular Sciences Review Bivalent Genes Targeting of Glioma Heterogeneity and Plasticity Mariam Markouli † , Dimitrios Strepkos †, Kostas A. Papavassiliou , Athanasios G. Papavassiliou *,‡ and Christina Piperi *,‡ Department of Biological Chemistry, Medical School, National and Kapodistrian University of Athens, 11527 Athens, Greece; [email protected] (M.M.); [email protected] (D.S.); [email protected] (K.A.P.) * Correspondence: [email protected] (A.G.P.); [email protected] (C.P.); Tel.: +30-210-7462610 (C.P.); Fax: +30-210-7462703 (C.P.) † These authors equally contributed to this work. ‡ Joint last and corresponding authors. Abstract: Gliomas account for most primary Central Nervous System (CNS) neoplasms, characterized by high aggressiveness and low survival rates. Despite the immense research efforts, there is a small improvement in glioma survival rates, mostly attributed to their heterogeneity and complex pathophysiology. Recent data indicate the delicate interplay of genetic and epigenetic mechanisms in regulating gene expression and cell differentiation, pointing towards the pivotal role of bivalent genes. Bivalency refers to a property of chromatin to acquire more than one histone marks during the cell cycle and rapidly transition gene expression from an active to a suppressed transcriptional state. Although first identified in embryonal stem cells, bivalent genes have now been associated with tumorigenesis and cancer progression. Emerging evidence indicates the implication of bivalent gene regulation in glioma heterogeneity and plasticity, mainly involving Homeobox genes, Wingless-Type MMTV Integration Site Family Members, Hedgehog protein, and Solute Carrier Family members. These genes control a wide variety of cellular functions, including cellular differentiation during Citation: Markouli, M.; Strepkos, D.; early organism development, regulation of cell growth, invasion, migration, angiogenesis, therapy Papavassiliou, K.A.; Papavassiliou, resistance, and apoptosis.
    [Show full text]
  • Conditioned Medium from Canine Amniotic Membrane-Derived Mesenchymal Stem Cells Improved Dog Sperm Post-Thaw Quality-Related Parameters
    Article Conditioned Medium from Canine Amniotic Membrane-Derived Mesenchymal Stem Cells Improved Dog Sperm Post-Thaw Quality-Related Parameters Feriel Yasmine Mahiddine 1, Jin Wook Kim 1, Ahmad Yar Qamar 2,3,4, Jeong Chan Ra 5, Soo Hyun Kim 5, Eun Joong Jung 5 and Min Jung Kim 1,* 1 Department of Theriogenology and Biotechnologies, College of Veterinary Medicine, Seoul National University, Seoul 08826, Korea; [email protected] (F.Y.M.); [email protected] (J.W.K.) 2 Laboratory of Theriogenology, College of Veterinary Medicine, Chungnam National University, Daejeon 34134, Korea; [email protected] 3 Department of Clinical Sciences, College of Veterinary and Animal Sciences, Jhang 35200, Pakistan 4 Department of Clinical Sciences, Sub-Campus University of Veterinary and Animal Sciences, Lahore 54000, Pakistan 5 Cell Physiology Research Center, Naturecell Co., Ltd., Seoul 07238, Korea; [email protected] (J.C.R.); [email protected] (S.H.K.); [email protected] (E.J.J.) * Correspondence: [email protected]; Tel.: +82-2-880-1180 Received: 08 September 2020; Accepted: 14 October 2020; Published: date Supplemetary Data Confirmation of pluripotency genes expression Figure S1. Confirmation of pluripotent genes expressions in all canine amniotic membrane-derived mesenchymal stem cell lines (cAMSC) (n = 11) using qPCR. Table S1. List of primers used for quantitative polymerase chain reaction (qPCR). Product size Temperature NCBI Accession Gene Primer Sequence (5′-3′) (bp) (℃) No. β-ACT F - GCTACGTCGCCCTGGACTTC 86 60 AF021873.2 1 R - GCCCGTCGGGTAGTTCGTAG F - Oct3/4 CGAGTGAGAGGCAACCTGGAGA 114 60 XM_538830 2 R - CCACACTCGGACCACATCCTTC F - CAGACCTACATGAACGGCTCGC Sox23 147 60 XM_005639752 R - CCTGGAGTGGGAGGAGGAGGTA F - GAATAACCCGAATTGGAGCA Nanog4 125 60 XM_022411387 R - AGTTGTGGAGCGGATTGTTC Animals 2019, 9, x; doi: www.mdpi.com/journal/animals Animals 2019, 9, x 2 of 5 1 β-ACT, beta-actin; 2 Oct3/4, octamer binding transcription factor 3/4, 3 Sox2, SRY (sex determining region Y)-box 2, 4Nanog, homeobox protein.
    [Show full text]
  • Supplementary Figure S1 A
    Supplementary Figure S1 A B C 1 4 1 3 1 2 1 2 1 0 1 1 (Normalized signal values)] 2 (Normalized signal values) (Normalized 8 2 10 Log 6 AFFX-BioC AFFX-BioB AFFX-BioDn AFFX-CreX hDFs [Log 6 8 10 12 14 hOFs [Log2 (Normalized signal values)] Supplementary Figure S2 GLYCOLYSIS PENTOSE-PHOSPHATE PATHWAY Glucose Purine/pyrimidine Glucose-6-phosphate metabolism AMINO ACID Fluctose-6-phosphate AMPK METABOLISM TIGAR PFKFB2 methylgloxal GloI Ser, Gly, Thr Glyceraldehyde-3-phosphate ALDH Lactate PYRUVATE LDH METABOLISM acetic acid Ethanol Pyruvate GLYCOSPHINGOLIPID NADH BIOSYNTHESIS Ala, Cys DLD PDH PDK3 DLAT Fatty acid Lys, Trp, Leu, Acetyl CoA ACAT2 Ile, Tyr, Phe β-OXIDATION ACACA Citrate Asp, Asn Citrate Acetyl CoA Oxaloacetate Isocitrate MDH1 IDH1 Glu, Gln, His, ME2 TCA Pro, Arg 2-Oxoglutarate MDH1 CYCLE Pyruvate Malate ME2 GLUTAMINOLYSIS FH Succinyl-CoA Fumalate SUCLA2 Tyr, Phe Var, Ile, Met Supplementary Figure S3 Entrez Gene Symbol Gene Name hODs hDFs hOF-iPSCs GeneID 644 BLVRA biliverdin reductase A 223.9 259.3 253.0 3162 HMOX1 heme oxygenase 1 1474.2 2698.0 452.3 9365 KL klotho 54.1 44.8 36.5 nicotinamide 10135 NAMPT 827.7 626.2 2999.8 phosphoribosyltransferase nuclear factor (erythroid- 4780 NFE2L2 2134.5 1331.7 1006.2 derived 2) related factor 2 peroxisome proliferator- 5467 PPARD 1534.6 1352.9 330.8 activated receptor delta peroxisome proliferator- 5468 PPARG 524.4 100.8 63.0 activated receptor gamma 5621 PRNP prion protein 4059.0 3134.1 1065.5 5925 RB1 retinoblastoma 1 882.9 805.8 739.3 23411 SIRT1 sirtuin 1 231.5 216.8 1676.0 7157 TP53
    [Show full text]