DOCSLIB.ORG

The Pathophysiology of Spinal Bulbar Muscular Atrophy: a Longitudinal Analysis of Mouse Muscle and Spinal Cord

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
The Pathophysiology of Spinal Bulbar Muscular Atrophy: a Longitudinal Analysis of Mouse Muscle and Spinal Cord The pathophysiology of Spinal Bulbar Muscular Atrophy: a longitudinal analysis of mouse muscle and spinal cord By Leonette Victoria Naakuma Delali Annan University College London, Institute of Neurology PhD Supervisors: Professor Linda Greensmith and Professor Gyorgy Szabadkai A Thesis submitted for the degree of Doctor of Philosophy (PhD) October 2017 1 Declaration I, Leonette Victoria Naakuma Delali Annan, confirm that the work presented in this Thesis is my own. Where information has been derived from other sources, I confirm that this has been indicated in the Thesis. 2 Acknowledgements I would like to express my huge gratitude to Professor Linda Greensmith who has provided immense guidance, support and mentoring throughout my time in her lab. I would like to thank Jim Dick, the Graham Watts Lab Manager, who is simply phenomenal in his assistance to all members of the lab. I would also like to thank the Greensmith lab Post-Docs: Dr Bilal Malik, Dr Mhoriam Ahmed, Dr Barney Bryson, Dr Ching-Hua Lu and Dr Bernadett Kalmar for their day-to-day laboratory guidance and stimulating discussions. Lastly, I would like to thank my fellow students for their company and support. This Thesis was funded by a Wellcome Trust 4-year PhD in Neuroscience Studentship. This Thesis is dedicated to my beloved sisters, Anouska and Suzette Annan. All Glory and Honour be to God. 3 Abstract Spinal Bulbar Muscular Atrophy (SBMA), also known as Kennedy's disease, is an X- linked, late-onset progressive neurodegenerative disease. SBMA is characterised by the selective loss of spinal and bulbar motor neurons and progressive muscle weakness. The disease is caused by an expansion in the CAG repeat in the androgen receptor (AR) gene which encodes a polyglutamine tract in the protein. The underlying pathophysiology of the disease is thought to be related to abnormal accumulation of the pathogenic AR protein within the nucleus. The AR100 transgenic mouse model of SBMA has a progressive neuromuscular phenotype accompanied by motor neuron degeneration, thereby mirroring the human disease. Since ER stress has been suggested to play a role in motor neuron death in SBMA, I investigated the underlying mechanism by which ER stress may result in cell death. In particular, I tested whether the motor neuron-specific Fas/NO cell death pathway plays a role in SBMA. In addition, I examined whether the ER chaperone, Calreticulin forms a link between the Fas/NO MN-specific death pathway and ER stress. I found that Fas/NO induced cell death is not observed in AR100 MNs. However, an increase in Calreticulin is observed in the spinal cord of AR100 mice, suggesting it may contribute to SBMA pathology. Although SBMA is considered to be a neurodegenerative disease affecting motor neurons, emerging evidence suggests that SBMA may also involve a primary muscle deficit. I examined this possibility by characterising muscle histopathology longitudinally, at different stages of disease progression, in AR100 mice. My results show that muscle atrophy is evident during early stages of disease, prior to any loss of motor neurons. Physiological deficits were accompanied by a change in the properties of the muscle fibres such as increase in oxidative capacity and signs of myogenic and neurogenic induced muscle atrophy. Furthermore, RNA-sequencing and pathway enrichment analysis of hindlimb muscles of AR100 mice identified some of the molecular signalling pathways which may underlie the changes within the muscle. These findings indicate that muscle deficits are an early and primary manifestation of disease in SBMA. 4 Contents The pathophysiology of Spinal Bulbar Muscular Atrophy: a longitudinal analysis of mouse muscle and spinal cord .................................................................................... 1 Declaration ................................................................................................................... 2 Acknowledgements ...................................................................................................... 3 Abstract ........................................................................................................................ 4 Contents ....................................................................................................................... 5 List of Figures ............................................................................................................. 12 List of Tables ............................................................................................................... 16 Abbreviations ............................................................................................................. 17 Chapter 1 General Introduction ........................................................................... 19 Introduction ............................................................................................................... 20 1.1 Patient Symptoms ....................................................................................... 20 1.2 Genetic cause of SBMA ............................................................................... 21 1.3 Polyglutamine Disorders ............................................................................. 21 1.3.1 Toxicity of the expanded polyglutamine tract ............................................... 21 1.4 The androgen receptor structure and function .......................................... 24 1.4.1 Non-genomic roles of the Androgens ............................................................ 26 1.5 Pathogenic mechanisms of SBMA ............................................................... 26 1.5.1 Impaired protein homeostasis ....................................................................... 26 1.5.2 Disrupted axonal transport ............................................................................ 27 1.5.3 Reduced neurotrophic support ...................................................................... 28 1.5.4 Transcriptional dysregulation ........................................................................ 28 1.6 Cellular models of SBMA ............................................................................. 29 1.6.1 Induced pluripotent stem cell models of SBMA ............................................ 30 1.7 Chronological review of mouse models of SBMA ....................................... 31 5 1.7.1 Early mouse models of SBMA ........................................................................ 31 1.7.2 The AR97Q mouse model of SBMA ................................................................ 33 1.7.3 The AR112Q mouse model of SBMA .............................................................. 33 1.7.4 The AR100 mouse model of SBMA ................................................................ 34 1.7.5 The knock-in model of SBMA ......................................................................... 34 1.7.6 The WT over-expressor model of SBMA ........................................................ 35 1.7.7 The AR121mouse model of SBMA ................................................................. 36 1.7.8 The AR113 mouse model of SBMA ................................................................ 36 1.8 Therapeutic approaches in SBMA ............................................................... 39 1.8.1 Androgen deprivation .................................................................................... 39 1.8.2 Targeting the AR structure as a therapeutic strategy .................................... 41 1.8.3 Targeting the Heat Shock Response as a therapeutic strategy ..................... 41 1.9 Summary of Thesis Aims ............................................................................. 43 Chapter 2 Mechanisms of MN degeneration in the AR100 Mouse model of SBMA…………. ............................................................................................................. 45 2.1 Introduction ................................................................................................. 46 2.1.1 ER stress, Calreticulin and the Fas/NO Cell death pathway: Do they play a role in SBMA? ................................................................................................................. 46 2.1.2 The Unfolded Protein Response .................................................................... 46 2.1.3 Calcium Homeostasis ..................................................................................... 49 2.1.4 Endoplasmic Reticulum stress in Poly Q Diseases and Motor Neuron Diseases…. ...................................................................................................................... 50 2.1.5 ER Stress in SBMA mouse models .................................................................. 52 2.1.6 ER stress and the Fas/NO cell death pathway ............................................... 53 2.1.7 Aims of this Chapter ....................................................................................... 57 2.2 Materials and Methods ............................................................................... 58 2.2.1 Maintenance and identification of AR100 and SOD1G93A mice ...................... 58 2.2.2 Primary Motor Neuron Cultures .................................................................... 59 6 2.2.3 Spinal Cord Dissection and storage for Western Blotting .............................. 61 2.2.4 Mouse Perfusion, Spinal Cord dissection and sectioning for immunohistochemistry .................................................................................................
Load more

Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Generation and Characterization of a Novel Mouse Line, Keratocan-Rtta (Kerart), for Corneal Stroma and Tendon Research
    Cornea Generation and Characterization of a Novel Mouse Line, Keratocan-rtTA (KeraRT), for Corneal Stroma and Tendon Research Yujin Zhang,1 Winston W.-Y. Kao,2 Yasuhito Hayashi,3 Lingling Zhang,1 Mindy Call,2 Fei Dong,2 Yong Yuan,2 Jianhua Zhang,2 Yen-Chiao Wang,1 Okada Yuka,1,4 Atsushi Shiraishi,3 and Chia-Yang Liu1 1School of Optometry, Indiana University, Bloomington, Indiana, United States 2Edith J. Crawley Vision Research Center/Department of Ophthalmology, University of Cincinnati College of Medicine, Cincinnati, Ohio, United States 3Department of Ophthalmology, School of Medicine, Ehime University, Ehime, Japan 4Department of Ophthalmology, School of Medicine, Wakayama Medical University, Wakayama, Japan RT Correspondence: Yujin Zhang, Indi- PURPOSE. We created a novel inducible mouse line Keratocan-rtTA (Kera ) that allows ana University School of Optometry, specific genetic modification in corneal keratocytes and tenocytes during development and in 800 Atwater Avenue, Bloomington, adults. IN 47405, USA; [email protected]. METHODS. A gene-targeting vector (Kera- IRES2-rtTA3) was constructed and inserted right after Chia-Yang Liu, Indiana University the termination codon of the mouse Kera allele via gene targeting techniques. The resulting RT RT School of Optometry, 800 Atwater Kera mouse was crossed to tet-O-Hist1H2B-EGFP (TH2B-EGFP) to obtain Kera /TH2B-EGFP Avenue, Bloomington, IN 47405, compound transgenic mice, in which cells expressing Kera are labeled with green USA; fluorescence protein (GFP) by doxycycline (Dox) induction. The expression patterns of [email protected]. RT RT GFP and endogenous Kera were examined in Kera /TH2B-EGFP. Moreover, Kera was bred Submitted: July 21, 2017 with tet-O-TGF-a to generate a double transgenic mouse, KeraRT/tet-O-TGF-a, to overexpress Accepted: August 16, 2017 TGF-a in corneal keratocytes upon Dox induction.
    [Show full text]
  • List of Abbreviation
    Exploring and Potentiating Human Bone Marrow Derived Mesenchymal Stem Cells [hBMSCs] and Differentiated Islets for Effective Diabetes Therapy ABBREVIATION LIST OF ABBREVIATION AF555-Alexa Fluor 555 EBs- Embryoid bodies AGE- advanced glycosylation end-product EDTA- Ethylenediaminetetraacetic acid aPKC- Atypical protein kinase C EGF-Epidermal growth factor ANOVA-Analysis of variance EGFR- epidermal growth factor receptor Arx- Aristaless-related homeobox gene EL- Enicostemma littorale ATP- Adenosine triphosphate ELISA- Enzyme linked immunosorbent bHLH- Basic helix–loop–helix assay BM- Bone marrow EMT - epithelial–mesenchymal transition BMC- Bioactive molecules cocktail ESCs- Embryonic stem cells BMP-bone morphogenic protein FACS- Fluorescent activated cell sorter BSA- Bovine serum albumin FBS- Fetal Bovine Serum cAMP- Cyclic Adenosine monophosphate FDA- Food and Drug Administration CaCl2 –Calcium chloride FGF- Fibroblast growth factor CD-Cluster of differentiation FITC- Fluorescein isothiocyanate cDNA –Complementary DNA FOXO1-Forkhead box protein O1 ChIP-Chromatin immunoprecipitation FOXA2 - Forkhead box protein A2 CCl4- Carbon tetrachloride GAD- Glutamate decarboxylase CDK- Cyclin dependent kinase GATA4 -(GATA Binding Protein 4) CK-Cytokeratin GATA6- (GATA Binding Protein 6) CNS- Central Nervous System GCK- Glucokinase CPCSEA- Committee for the purpose of GFP- Green Fluorescent protein control and supervision of experiments on GLP-1- Glucagon-like peptide-1 animals GLUT- Glucose Transporter DAPI- 4’6’-diamidino-2-phenylindole GPx- Glutathione peroxidase Dihydrochloride GSH- Reduced glutathione DCFDA- 2',7' –dichlorofluorescin diacetate GSIS- Glucose-stimulated insulin secretion DM-Diabetes mellitus GTT- Glucose tolerance test DMEM- KO -Dulbecco’s Modified Eagle H & E- Hematoxylin and Eosin Media-Knock out hBMSCs: Human bone marrow-derived DMSO- Dimethyl Sulphoxide mesenchymal stem cell DTZ- Dithizone HGF- Hepatocyte Growth Factor Mitul Vakani.
    [Show full text]
  • S41598-018-33190-8.Pdf
    www.nature.com/scientificreports OPEN Ankyrin Repeat Domain 1 Overexpression is Associated with Common Resistance to Afatinib and Received: 20 February 2018 Accepted: 25 September 2018 Osimertinib in EGFR-mutant Lung Published: xx xx xxxx Cancer Akiko Takahashi1, Masahiro Seike1, Mika Chiba1, Satoshi Takahashi1, Shinji Nakamichi1, Masaru Matsumoto1, Susumu Takeuchi1, Yuji Minegishi1, Rintaro Noro1, Shinobu Kunugi2, Kaoru Kubota1 & Akihiko Gemma1 Overcoming acquired resistance to epidermal growth factor receptor tyrosine kinase inhibitors (EGFR-TKIs) is critical in combating EGFR-mutant non-small cell lung cancer (NSCLC). We tried to construct a novel therapeutic strategy to conquer the resistance to second-and third-generation EGFR-TKIs in EGFR-positive NSCLC patients. We established afatinib- and osimertinib-resistant lung adenocarcinoma cell lines. Exome sequencing, cDNA array and miRNA microarray were performed using the established cell lines to discover novel therapeutic targets associated with the resistance to second-and third-generation EGFR-TKIs. We found that ANKRD1 which is associated with the epithelial- mesenchymal transition (EMT) phenomenon and anti-apoptosis, was overexpressed in the second-and third-generation EGFR-TKIs-resistant cells at the mRNA and protein expression levels. When ANKRD1 was silenced in the EGFR-TKIs-resistant cell lines, afatinib and osimertinib could induce apoptosis of the cell lines. Imatinib could inhibit ANKRD1 expression, resulting in restoration of the sensitivity to afatinib and osimertinib of EGFR-TKI-resistant cells. In EGFR-mutant NSCLC patients, ANKRD1 was overexpressed in the tumor after the failure of EGFR-TKI therapy, especially after long-duration EGFR- TKI treatments. ANKRD1 overexpression which was associated with EMT features and anti-apoptosis, was commonly involved in resistance to second-and third-generation EGFR-TKIs.
    [Show full text]
  • Identification of Novel Pathways That Promote Anoikis Through Genome-Wide Screens
    University of Massachusetts Medical School eScholarship@UMMS GSBS Dissertations and Theses Graduate School of Biomedical Sciences 2016-10-14 Identification of Novel Pathways that Promote Anoikis through Genome-wide Screens Victoria E. Pedanou University of Massachusetts Medical School Let us know how access to this document benefits ou.y Follow this and additional works at: https://escholarship.umassmed.edu/gsbs_diss Part of the Biology Commons, and the Cancer Biology Commons Repository Citation Pedanou VE. (2016). Identification of Novel Pathways that Promote Anoikis through Genome-wide Screens. GSBS Dissertations and Theses. https://doi.org/10.13028/M27G6D. Retrieved from https://escholarship.umassmed.edu/gsbs_diss/889 This material is brought to you by eScholarship@UMMS. It has been accepted for inclusion in GSBS Dissertations and Theses by an authorized administrator of eScholarship@UMMS. For more information, please contact [email protected]. i TITLE PAGE IDENTIFICATION OF NOVEL PATHWAYS THAT PROMOTE ANOIKIS THROUGH GENOME-WIDE SCREENS A Dissertation Presented By VICTORIA ELIZABETH PEDANOU Submitted to the Faculty of the University of Massachusetts Graduate School of Biomedical Sciences, Worcester in partial fulfillment of the requirements for the degree of DOCTOR OF PHILOSOPHY OCTOBER 14TH, 2016 CANCER BIOLOGY ii SIGNATURE PAGE IDENTIFICATION OF NOVEL PATHWAYS THAT PROMOTE ANOIKIS THROUGH GENOME-WIDE SCREENS A Dissertation Presented By VICTORIA ELIZABETH PEDANOU This work was undertaken in the Graduate School of Biomedical Sciences Cancer Biology The signature of the Thesis Advisor signifies validation of Dissertation content ___________________________ Michael R. Green, Thesis Advisor The signatures of the Dissertation Defense Committee signify completion and approval as to style and content of the Dissertation __________________________________ Eric H.
    [Show full text]
  • Acetyl-Coa Synthetase 3 Promotes Bladder Cancer Cell Growth Under Metabolic Stress Jianhao Zhang1, Hongjian Duan1, Zhipeng Feng1,Xinweihan1 and Chaohui Gu2
    Zhang et al. Oncogenesis (2020) 9:46 https://doi.org/10.1038/s41389-020-0230-3 Oncogenesis ARTICLE Open Access Acetyl-CoA synthetase 3 promotes bladder cancer cell growth under metabolic stress Jianhao Zhang1, Hongjian Duan1, Zhipeng Feng1,XinweiHan1 and Chaohui Gu2 Abstract Cancer cells adapt to nutrient-deprived tumor microenvironment during progression via regulating the level and function of metabolic enzymes. Acetyl-coenzyme A (AcCoA) is a key metabolic intermediate that is crucial for cancer cell metabolism, especially under metabolic stress. It is of special significance to decipher the role acetyl-CoA synthetase short chain family (ACSS) in cancer cells confronting metabolic stress. Here we analyzed the generation of lipogenic AcCoA in bladder cancer cells under metabolic stress and found that in bladder urothelial carcinoma (BLCA) cells, the proportion of lipogenic AcCoA generated from glucose were largely reduced under metabolic stress. Our results revealed that ACSS3 was responsible for lipogenic AcCoA synthesis in BLCA cells under metabolic stress. Interestingly, we found that ACSS3 was required for acetate utilization and histone acetylation. Moreover, our data illustrated that ACSS3 promoted BLCA cell growth. In addition, through analyzing clinical samples, we found that both mRNA and protein levels of ACSS3 were dramatically upregulated in BLCA samples in comparison with adjacent controls and BLCA patients with lower ACSS3 expression were entitled with longer overall survival. Our data revealed an oncogenic role of ACSS3 via regulating AcCoA generation in BLCA and provided a promising target in metabolic pathway for BLCA treatment. 1234567890():,; 1234567890():,; 1234567890():,; 1234567890():,; Introduction acetyl-CoA synthetase short chain family (ACSS), which In cancer cells, considerable number of metabolic ligates acetate and CoA6.
    [Show full text]
  • A Genome-Wide Association Study of Body Mass Index
    International Journal of Epidemiology, 2015, 700–712 doi: 10.1093/ije/dyv077 Advance Access Publication Date: 7 May 2015 Original article Genetic Epidemiology A genome-wide association study of body mass index across early life and childhood Nicole M Warrington,1,2* Laura D Howe,3,4* Lavinia Paternoster,3,4 Marika Kaakinen,5,6,7 Sauli Herrala,6 Ville Huikari,6 Yan Yan Wu,8 Downloaded from John P Kemp,2,3 Nicholas J Timpson,3,4 Beate St Pourcain,3,4 George Davey Smith,3,4 Kate Tilling,3,4 Marjo-Riitta Jarvelin,5,6,9,10,11 Craig E Pennell,1 David M Evans,2,3,4 Debbie A Lawlor,3,4 Laurent Briollais8,† and Lyle J Palmer12,† http://ije.oxfordjournals.org/ 1School of Women’s and Infants’ Health, University of Western Australia, Perth, WA, Australia, 2University of Queensland Diamantina Institute, Translational Research Institute, Brisbane, QLD, Australia, 3MRC Integrative Epidemiology Unit, University of Bristol, Bristol, UK, 4School of Social and Community Medicine, University of Bristol, Bristol, UK, 5Biocenter Oulu, and 6Institute of Health Sciences, University of Oulu, Oulu, Finland, 7Department of Genomics of Common Disease, School of Public Health, Imperial College London, London, UK, 8Lunenfeld-Tanenbaum Research Institute, Mount 9 Sinai Hospital, Toronto, ON, Canada, Department of Children and Young People and Families, National at MPI Psycholinguistics on September 22, 2015 Institute for Health and Welfare, Oulu, Finland, 10Department of Epidemiology and Biostatistics, MRC- HPA Centre for Environment and Health, School of Public Health, Imperial College London, London, UK, 11Unit of Primary Care, Oulu University Hospital, Oulu, Finland and 12The Joanna Briggs Institute, The Robinson Research Institute, and School of Translational Health Science, University of Adelaide, Adelaide, SA, Australia *Corresponding authors.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Supplementary Materials
    1 Supplementary Materials: Supplemental Figure 1. Gene expression profiles of kidneys in the Fcgr2b-/- and Fcgr2b-/-. Stinggt/gt mice. (A) A heat map of microarray data show the genes that significantly changed up to 2 fold compared between Fcgr2b-/- and Fcgr2b-/-. Stinggt/gt mice (N=4 mice per group; p<0.05). Data show in log2 (sample/wild-type). 2 Supplemental Figure 2. Sting signaling is essential for immuno-phenotypes of the Fcgr2b-/-lupus mice. (A-C) Flow cytometry analysis of splenocytes isolated from wild-type, Fcgr2b-/- and Fcgr2b-/-. Stinggt/gt mice at the age of 6-7 months (N= 13-14 per group). Data shown in the percentage of (A) CD4+ ICOS+ cells, (B) B220+ I-Ab+ cells and (C) CD138+ cells. Data show as mean ± SEM (*p < 0.05, **p<0.01 and ***p<0.001). 3 Supplemental Figure 3. Phenotypes of Sting activated dendritic cells. (A) Representative of western blot analysis from immunoprecipitation with Sting of Fcgr2b-/- mice (N= 4). The band was shown in STING protein of activated BMDC with DMXAA at 0, 3 and 6 hr. and phosphorylation of STING at Ser357. (B) Mass spectra of phosphorylation of STING at Ser357 of activated BMDC from Fcgr2b-/- mice after stimulated with DMXAA for 3 hour and followed by immunoprecipitation with STING. (C) Sting-activated BMDC were co-cultured with LYN inhibitor PP2 and analyzed by flow cytometry, which showed the mean fluorescence intensity (MFI) of IAb expressing DC (N = 3 mice per group). 4 Supplemental Table 1. Lists of up and down of regulated proteins Accession No.
    [Show full text]
  • Comparative Analysis of a Teleost Skeleton Transcriptome Provides Insight Into Its Regulation
    Accepted Manuscript Comparative analysis of a teleost skeleton transcriptome provides insight into its regulation Florbela A. Vieira, M.A.S. Thorne, K. Stueber, M. Darias, R. Reinhardt, M.S. Clark, E. Gisbert, D.M. Power PII: S0016-6480(13)00264-5 DOI: http://dx.doi.org/10.1016/j.ygcen.2013.05.025 Reference: YGCEN 11541 To appear in: General and Comparative Endocrinology Please cite this article as: Vieira, F.A., Thorne, M.A.S., Stueber, K., Darias, M., Reinhardt, R., Clark, M.S., Gisbert, E., Power, D.M., Comparative analysis of a teleost skeleton transcriptome provides insight into its regulation, General and Comparative Endocrinology (2013), doi: http://dx.doi.org/10.1016/j.ygcen.2013.05.025 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. 1 Comparative analysis of a teleost skeleton transcriptome 2 provides insight into its regulation 3 4 Florbela A. Vieira1§, M. A. S. Thorne2, K. Stueber3, M. Darias4,5, R. Reinhardt3, M. 5 S. Clark2, E. Gisbert4 and D. M. Power1 6 7 1Center of Marine Sciences, Universidade do Algarve, Faro, Portugal. 8 2British Antarctic Survey – Natural Environment Research Council, High Cross, 9 Madingley Road, Cambridge, CB3 0ET, UK.
    [Show full text]
  • Type of the Paper (Article
    Supplementary Material A Proteomics Study on the Mechanism of Nutmeg-induced Hepatotoxicity Wei Xia 1, †, Zhipeng Cao 1, †, Xiaoyu Zhang 1 and Lina Gao 1,* 1 School of Forensic Medicine, China Medical University, Shenyang 110122, P. R. China; lessen- [email protected] (W.X.); [email protected] (Z.C.); [email protected] (X.Z.) † The authors contributed equally to this work. * Correspondence: [email protected] Figure S1. Table S1. Peptide fraction separation liquid chromatography elution gradient table. Time (min) Flow rate (mL/min) Mobile phase A (%) Mobile phase B (%) 0 1 97 3 10 1 95 5 30 1 80 20 48 1 60 40 50 1 50 50 53 1 30 70 54 1 0 100 1 Table 2. Liquid chromatography elution gradient table. Time (min) Flow rate (nL/min) Mobile phase A (%) Mobile phase B (%) 0 600 94 6 2 600 83 17 82 600 60 40 84 600 50 50 85 600 45 55 90 600 0 100 Table S3. The analysis parameter of Proteome Discoverer 2.2. Item Value Type of Quantification Reporter Quantification (TMT) Enzyme Trypsin Max.Missed Cleavage Sites 2 Precursor Mass Tolerance 10 ppm Fragment Mass Tolerance 0.02 Da Dynamic Modification Oxidation/+15.995 Da (M) and TMT /+229.163 Da (K,Y) N-Terminal Modification Acetyl/+42.011 Da (N-Terminal) and TMT /+229.163 Da (N-Terminal) Static Modification Carbamidomethyl/+57.021 Da (C) 2 Table S4. The DEPs between the low-dose group and the control group. Protein Gene Fold Change P value Trend mRNA H2-K1 0.380 0.010 down Glutamine synthetase 0.426 0.022 down Annexin Anxa6 0.447 0.032 down mRNA H2-D1 0.467 0.002 down Ribokinase Rbks 0.487 0.000
    [Show full text]
  • Cellular and Molecular Signatures in the Disease Tissue of Early
    Cellular and Molecular Signatures in the Disease Tissue of Early Rheumatoid Arthritis Stratify Clinical Response to csDMARD-Therapy and Predict Radiographic Progression Frances Humby1,* Myles Lewis1,* Nandhini Ramamoorthi2, Jason Hackney3, Michael Barnes1, Michele Bombardieri1, Francesca Setiadi2, Stephen Kelly1, Fabiola Bene1, Maria di Cicco1, Sudeh Riahi1, Vidalba Rocher-Ros1, Nora Ng1, Ilias Lazorou1, Rebecca E. Hands1, Desiree van der Heijde4, Robert Landewé5, Annette van der Helm-van Mil4, Alberto Cauli6, Iain B. McInnes7, Christopher D. Buckley8, Ernest Choy9, Peter Taylor10, Michael J. Townsend2 & Costantino Pitzalis1 1Centre for Experimental Medicine and Rheumatology, William Harvey Research Institute, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, Charterhouse Square, London EC1M 6BQ, UK. Departments of 2Biomarker Discovery OMNI, 3Bioinformatics and Computational Biology, Genentech Research and Early Development, South San Francisco, California 94080 USA 4Department of Rheumatology, Leiden University Medical Center, The Netherlands 5Department of Clinical Immunology & Rheumatology, Amsterdam Rheumatology & Immunology Center, Amsterdam, The Netherlands 6Rheumatology Unit, Department of Medical Sciences, Policlinico of the University of Cagliari, Cagliari, Italy 7Institute of Infection, Immunity and Inflammation, University of Glasgow, Glasgow G12 8TA, UK 8Rheumatology Research Group, Institute of Inflammation and Ageing (IIA), University of Birmingham, Birmingham B15 2WB, UK 9Institute of
    [Show full text]