(Fuyuan); AR, the Amur River; SHR, the Songhua River; NR, the Nen River; JPL, Jingpo Lake and KL, Khanka Lake

Total Page：16

File Type：pdf, Size：1020Kb

(Fuyuan); AR, the Amur River; SHR, the Songhua River; NR, the Nen River; JPL, Jingpo Lake and KL, Khanka Lake

Figure S1. Historical distribution of M. terminalis in the Heilong River Basin. HLR, the Heilong River (Fuyuan); AR, the Amur River; SHR, the Songhua River; NR, the Nen River; JPL, Jingpo Lake and KL, Khanka Lake. A red dot represents that wild M. terminalis in the location has disappeared. A blue dot indicates that wild M. terminalis in the location is still present. 1 Figure S2. SRAP marker profiles generated from partial samples of 6 populations in the genus Megalobrama with primer combinations 1f5r (A), 2f9r (B), 4f20r (C) and 7f20r (D). M: pBR 322/Msp I marker; Lanes with different color represent samples of corresponding populations (MTH, M. terminalis in the Heilong River; MTQ, M. terminalis in the Qiantang River; MTJ, M.terminalis in the Jinsha River Reservoir; MPL, M. pellegrini in the Longxi River; MAL, M. amblycephala in the Liangzi Lake and MAY, M. amblycephala in the Yi River). The red arrows point to polymorphic bands with amplification stability. 2 Figure S3. Establishment of K value in STRUCTURE analysis. (A): Relationship between K and Delta K; (B): Table output following the method of Evanno et al. [37]. Yellow highlight indicates the largest value in the Delta K column. Table S1. Sampling sites and number of individuals used for mtDNA and SRAP analysis. Region mtDNA SRAP Heilong River 26 30 Qiantang River 20 30 Jinshahe Reservoir 15 30 Longxi River 20 30 Liangzi Lake 18 30 Yi River 16 30 Xi River 20 30 Total 135 210 Table S2. Information on fragments for amplification and haplotype analysis in the D-loop, ND2 and CYTB genes. Reference mtDNA sequence of Megalobrama terminalis in the Heilong River (MTH) (accession no. MH289765). Primer ID and Genes and sequence positions for Primer sequences (from 5' to 3') Size (bp) positions haplotype analysis Dl-F/Dl-R CACCCCTGGCTCCCAAAGCCA D-loop (8-937) 1115 (930) 15576-1070 ACTGCGGAGACTTGCATGTGTAA Nd-F/Nd-R GATCGAACCCATGCCCAAGAG ND2 (4999-6043) 1337 (1045) 4871-6207 GGATCGAGGCCTTCCCATCTAGT Cyt-F/Cyt-R AGGCGTAGGATTAGAAGCAACAG CYTB (15340-16480) 1393 (1141) 15192-16584 CCAGGGGTGGGAGTTAAAATC 3 Table S3. Sequences of 15 SRAP primers. Primer pair ID Primer sequences (5′→3′) 1f2r TGAGTCCAAACCGGATA GACTGCGTACGAATTTGC 1f5r TGAGTCCAAACCGGATA GACTGCGTACGAATTAAC 1f17r TGAGTCCAAACCGGATA GACTGCGTACGAATTAGC 2f5r TGAGTCCAAACCGGAGC GACTGCGTACGAATTAAC 2f9r TGAGTCCAAACCGGAGC GACTGCGTACGAATTCGA 4f20r TGAGTCCAAACCGGACC GACTGCGTACGAATTGTA 7f8r TGAGTCCAAACCGGTCC GACTGCGTACGAATTCTC 7f19r TGAGTCCAAACCGGTCC GACTGCGTACGAATTCTG 7f20r TGAGTCCAAACCGGTCC GACTGCGTACGAATTGTA 10f13r TGAGTCCAAACCGGAAA GACTGCGTACGAATTGTC 10f18r TGAGTCCAAACCGGAAA GACTGCGTACGAATTCAT 10f20r TGAGTCCAAACCGGAAA GACTGCGTACGAATTGTA 12f3r TGAGTCCAAACCGGAGA GACTGCGTACGAATTGAC 12f4r TGAGTCCAAACCGGAGA GACTGCGTACGAATTTGA 12f5r TGAGTCCAAACCGGAGA GACTGCGTACGAATTAAC 4 .

Copy Link

Recommended publications

Federal Register/Vol. 86, No. 162/Wednesday, August 25, 2021
Federal Register / Vol. 86, No. 162 / Wednesday, August 25, 2021 / Proposed Rules 47457 hypothecate, assign, transfer or encumber EXHIBIT A DEPARTMENT OF THE INTERIOR funds or assets in the Escrow Account except ESCROW AGREEMENT, dated ll by and in accordance with the terms of this Fish and Wildlife Service between (Customer) and (Escrow Agent). Agreement. 20. This Agreement is for the benefit of the Passenger Vessels Owned or Chartered 50 CFR Part 17 parties hereto and, accordingly, each and ANNEX 1 [Docket No. FWS–HQ–ES–2020–0100; every provision hereof shall be enforceable FF09E22000 FXES11180900000 212] by any or each or both of them. Additionally, RECOMPUTATION CERTIFICATE this Agreement shall be enforceable by the To: Federal Maritime Commission RIN 1018–BE92 Commission. However, this Agreement shall And To: (‘‘Bank’’) Endangered and Threatened Wildlife not be enforceable by any other party, person ll The undersigned, the Controller of and Plants; Endangered Species or entity whatsoever. hereby furnishes this Recomputation Status for Amur Sturgeon 21. (a) No amendments, modifications or Certificate pursuant to the terms of the other change in the terms of this Agreement Escrow Agreement dated ll, between the AGENCY: Fish and Wildlife Service, shall be effective for any purpose whatsoever Customer and (‘‘Bank’’). Terms herein shall Interior. unless agreed upon in writing by Escrow have the same definitions as those in such ACTION: Proposed rule. Agent and Customer and approved in writing Escrow Agreement and Federal Maritime by the Commission. Commission regulations. SUMMARY: We, the U.S. Fish and (b) No party hereto may assign its rights or I.
[Show full text]
The Spatial Differentiation of the Suitability of Ice-Snow Tourist Destinations Based on a Comprehensive Evaluation Model in China
sustainability Article The Spatial Differentiation of the Suitability of Ice-Snow Tourist Destinations Based on a Comprehensive Evaluation Model in China Jun Yang 1,*, Ruimeng Yang 1, Jing Sun 1, Tai Huang 2,3,* and Quansheng Ge 3 1 Liaoning Key Laboratory of Physical Geography and Geomatics, Liaoning Normal University, Dalian 116029, China; [email protected] (R.Y.); [email protected] (J.S.) 2 Department of Tourism Management, Soochow University, Suzhou 215123, China 3 Key Laboratory of Land Surface Patterns and Simulation, Institute of Geographic Sciences and Natural Resources Research, CAS, Beijing 100101, China; [email protected] * Correspondence: [email protected] (J.Y.); [email protected] (T.H.) Academic Editors: Jun Liu, Gang Liu and This Rutishauser Received: 1 February 2017; Accepted: 4 May 2017; Published: 8 May 2017 Abstract: Ice, snow, and rime are wonders of the cold season in an alpine climate zone and climate landscape. With its pure, spectacular, and magical features, these regions attract numerous tourists. Ice and snow landscapes can provide not only visually-stimulating experiences for people, but also opportunities for outdoor play and movement. In China, ice and snow tourism is a new type of recreation; however, the establishment of snow and ice in relation to the suitability of the surrounding has not been clearly expressed. Based on multi-source data, such as tourism, weather, and trafﬁc data, this paper employs the Delphi-analytic hierarchy process (AHP) evaluation method and a spatial analysis method to study the spatial differences of snow and ice tourism suitability in China. China’s ice and snow tourism is located in the latitude from 35◦N to 53.33◦N and latitude 41.5◦N to 45◦N and longitude 82◦E to 90◦E, with the main focus on latitude and terrain factors.
[Show full text]
Supplement of a Systematic Examination of the Relationships Between CDOM and DOC in Inland Waters in China
Supplement of Hydrol. Earth Syst. Sci., 21, 5127–5141, 2017 https://doi.org/10.5194/hess-21-5127-2017-supplement © Author(s) 2017. This work is distributed under the Creative Commons Attribution 3.0 License. Supplement of A systematic examination of the relationships between CDOM and DOC in inland waters in China Kaishan Song et al. Correspondence to: Kaishan Song ([email protected]) The copyright of individual parts of the supplement might differ from the CC BY 3.0 License. Figure S1. Sampling location at three rivers for tracing the temporal variation of CDOM and DOC. The average widths at sampling stations are about 1020 m, 206m and 152 m for the Songhua River, Hunjiang River and Yalu River, respectively. Table S1 the sampling information for fresh and saline water lakes, the location information shows the central positions of the lakes. Res. is the abbreviation for reservoir; N, numbers of samples collected; Lat., latitude; Long., longitude; A, area; L, maximum length in kilometer; W, maximum width in kilometer. Water body type Sampling date N Lat. Long. A(km2) L (km) W (km) Fresh water lake Shitoukou Res. 2009.08.28 10 43.9319 125.7472 59 17 6 Songhua Lake 2015.04.29 8 43.6146 126.9492 185 55 6 Erlong Lake 2011.06.24 6 43.1785 124.8264 98 29 8 Xinlicheng Res. 2011.06.13 7 43.6300 125.3400 43 22 6 Yueliang Lake 2011.09.01 6 45.7250 123.8667 116 15 15 Nierji Res. 2015.09.16 8 48.6073 124.5693 436 83 26 Shankou Res.
[Show full text]
Report on Domestic Animal Genetic Resources in China
Country Report for the Preparation of the First Report on the State of the World’s Animal Genetic Resources Report on Domestic Animal Genetic Resources in China June 2003 Beijing CONTENTS Executive Summary Biological diversity is the basis for the existence and development of human society and has aroused the increasing great attention of international society. In June 1992, more than 150 countries including China had jointly signed the "Pact of Biological Diversity". Domestic animal genetic resources are an important component of biological diversity, precious resources formed through long-term evolution, and also the closest and most direct part of relation with human beings. Therefore, in order to realize a sustainable, stable and high-efficient animal production, it is of great significance to meet even higher demand for animal and poultry product varieties and quality by human society, strengthen conservation, and effective, rational and sustainable utilization of animal and poultry genetic resources. The "Report on Domestic Animal Genetic Resources in China" (hereinafter referred to as the "Report") was compiled in accordance with the requirements of the "World Status of Animal Genetic Resource " compiled by the FAO. The Ministry of Agriculture" (MOA) has attached great importance to the compilation of the Report, organized nearly 20 experts from administrative, technical extension, research institutes and universities to participate in the compilation team. In 1999, the first meeting of the compilation staff members had been held in the National Animal Husbandry and Veterinary Service, discussed on the compilation outline and division of labor in the Report compilation, and smoothly fulfilled the tasks to each of the compilers.
[Show full text]
Amur Leopard Fact File
AMUR LEOPARD FACTFILE NAME Amur Leopard SCIENTIFIC NAME Panthera pardus orientalis GEOGRAPHIC RANGE Southwest Primorye in the Russian Far East HABITAT Temperate forests. LIFESPAN 10-15 years in the wild. Up to 20 years in captivity. WEIGHT 25– 75kg DIET Roe deer, sika deer, badgers and hares. WILD POPULATION Approx. 100 individuals IUCN RED LIST STATUS An extremely high risk of becoming extinct in the wild. GENERAL DESCRIPTION Amur leopards are one of nine sub-species of leopard. They are the most critically endangered big cat in the world. Found in the Russian far-east, Amur leopards are well adapted to a cold climate with thick fur that can reach up to 7.5cm long in winter months. Amur leopards are much paler than other leopards, with bigger and more spaced out rosettes. This is to allow them to camouflage in the snow. In the 20th century the Amur leopard population dramatically decreased due to habitat loss and hunting. Prior to this their range extended throughout northeast China, the Korean peninsula and the Primorsky Krai region of Russia. Now the Amur leopard range is predominantly in the south of the Primorsky Krai region in Russia, however, individuals have been reported over the border into northeast China. In 2011 Amur leopard population estimates were extremely low with approximately 35 individuals remaining. Intensified protection of this species has lead to a population increase, with approximately 100 now remaining in the wild. AMUR LEOPARD RANGE THREATS • Illegal wildlife trade– poaching for furs, teeth and bones is a huge threat to Amur leopards. A hunting culture, for both sport and food across Russia, also targets the leopards and their prey species.
[Show full text]
The Human Threat to River Ecosystems at the Watershed Scale: an Ecological Security Assessment of the Songhua River Basin, Northeast China
water Article The Human Threat to River Ecosystems at the Watershed Scale: An Ecological Security Assessment of the Songhua River Basin, Northeast China Yuan Shen 1,2, Huiming Cao 1, Mingfang Tang 1 and Hongbing Deng 1,* 1 State Key Laboratory of Urban and Regional Ecology, Research Center for Eco-Environmental Sciences, Chinese Academy of Sciences, Beijing 100085, China; [email protected] (Y.S.); [email protected] (H.C.); [email protected] (M.T.) 2 University of Chinese Academy of Sciences, Beijing 100049, China * Correspondence: [email protected]; Tel.: +86-10-6284-9112 Academic Editor: Sharon B. Megdal Received: 6 December 2016; Accepted: 13 March 2017; Published: 16 March 2017 Abstract: Human disturbances impact river basins by reducing the quality of, and services provided by, aquatic ecosystems. Conducting quantitative assessments of ecological security at the watershed scale is important for enhancing the water quality of river basins and promoting environmental management. In this study, China’s Songhua River Basin was divided into 204 assessment units by combining watershed and administrative boundaries. Ten human threat factors were identified based on their significant influence on the river ecosystem. A modified ecological threat index was used to synthetically evaluate the ecological security, where frequency was weighted by flow length from the grids to the main rivers, while severity was weighted by the potential hazard of the factors on variables of river ecosystem integrity. The results showed that individual factors related to urbanization, agricultural development and facility construction presented different spatial distribution characteristics. At the center of the plain area, the provincial capital cities posed the highest level of threat, as did the municipal districts of prefecture-level cities.
[Show full text]
Amur Oblast TYNDINSKY 361,900 Sq
AMUR 196 Ⅲ THE RUSSIAN FAR EAST SAKHA Map 5.1 Ust-Nyukzha Amur Oblast TY NDINS KY 361,900 sq. km Lopcha Lapri Ust-Urkima Baikal-Amur Mainline Tynda CHITA !. ZEISKY Kirovsky Kirovsky Zeiskoe Zolotaya Gora Reservoir Takhtamygda Solovyovsk Urkan Urusha !Skovorodino KHABAROVSK Erofei Pavlovich Never SKOVO MAGDAGACHINSKY Tra ns-Siberian Railroad DIRO Taldan Mokhe NSKY Zeya .! Ignashino Ivanovka Dzhalinda Ovsyanka ! Pioner Magdagachi Beketovo Yasny Tolbuzino Yubileiny Tokur Ekimchan Tygda Inzhan Oktyabrskiy Lukachek Zlatoustovsk Koboldo Ushumun Stoiba Ivanovskoe Chernyaevo Sivaki Ogodzha Ust-Tygda Selemdzhinsk Kuznetsovo Byssa Fevralsk KY Kukhterin-Lug NS Mukhino Tu Novorossiika Norsk M DHI Chagoyan Maisky SELE Novovoskresenovka SKY N OV ! Shimanovsk Uglovoe MAZ SHIMA ANOV Novogeorgievka Y Novokievsky Uval SK EN SK Mazanovo Y SVOBODN Chernigovka !. Svobodny Margaritovka e CHINA Kostyukovka inlin SERYSHEVSKY ! Seryshevo Belogorsk ROMNENSKY rMa Bolshaya Sazanka !. Shiroky Log - Amu BELOGORSKY Pridorozhnoe BLAGOVESHCHENSKY Romny Baikal Pozdeevka Berezovka Novotroitskoe IVANOVSKY Ekaterinoslavka Y Cheugda Ivanovka Talakan BRSKY SKY P! O KTYA INSK EI BLAGOVESHCHENSK Tambovka ZavitinskIT BUR ! Bakhirevo ZAV T A M B OVSKY Muravyovka Raichikhinsk ! ! VKONSTANTINO SKY Poyarkovo Progress ARKHARINSKY Konstantinovka Arkhara ! Gribovka M LIKHAI O VSKY ¯ Kundur Innokentevka Leninskoe km A m Trans -Siberianad Railro u 100 r R i v JAO Russian Far East e r By Newell and Zhou / Sources: Ministry of Natural Resources, 2002; ESRI, 2002. Newell, J. 2004. The Russian Far East: A Reference Guide for Conservation and Development. McKinleyville, CA: Daniel & Daniel. 466 pages CHAPTER 5 Amur Oblast Location Amur Oblast, in the upper and middle Amur River basin, is 8,000 km east of Moscow by rail (or 6,500 km by air).
[Show full text]
Preparing the Shaanxi-Qinling Mountains Integrated Ecosystem Management Project (Cofinanced by the Global Environment Facility)
Technical Assistance Consultant’s Report Project Number: 39321 June 2008 PRC: Preparing the Shaanxi-Qinling Mountains Integrated Ecosystem Management Project (Cofinanced by the Global Environment Facility) Prepared by: ANZDEC Limited Australia For Shaanxi Province Development and Reform Commission This consultant’s report does not necessarily reflect the views of ADB or the Government concerned, and ADB and the Government cannot be held liable for its contents. (For project preparatory technical assistance: All the views expressed herein may not be incorporated into the proposed project’s design. FINAL REPORT SHAANXI QINLING BIODIVERSITY CONSERVATION AND DEMONSTRATION PROJECT PREPARED FOR Shaanxi Provincial Government And the Asian Development Bank ANZDEC LIMITED September 2007 CURRENCY EQUIVALENTS (as at 1 June 2007) Currency Unit – Chinese Yuan {CNY}1.00 = US $0.1308 $1.00 = CNY 7.64 ABBREVIATIONS ADB – Asian Development Bank BAP – Biodiversity Action Plan (of the PRC Government) CAS – Chinese Academy of Sciences CASS – Chinese Academy of Social Sciences CBD – Convention on Biological Diversity CBRC – China Bank Regulatory Commission CDA - Conservation Demonstration Area CNY – Chinese Yuan CO – company CPF – country programming framework CTF – Conservation Trust Fund EA – Executing Agency EFCAs – Ecosystem Function Conservation Areas EIRR – economic internal rate of return EPB – Environmental Protection Bureau EU – European Union FIRR – financial internal rate of return FDI – Foreign Direct Investment FYP – Five-Year Plan FS – Feasibility
[Show full text]
Effects of Flood on DOM and Total Dissolved Iron Concentration in Amur River
Geophysical Research Abstracts Vol. 21, EGU2019-11918, 2019 EGU General Assembly 2019 © Author(s) 2019. CC Attribution 4.0 license. Effects of Flood on DOM and Total Dissolved Iron Concentration in Amur River Baixing Yan and Jiunian Guan Northeast Institute of Geography and Agroecology, Chinese Academy of Sciences, Key Laboratory of Wetland Ecology and Environment, China ([email protected]) DOM is an important indicator for freshwater quality and may complex with metals. It is already found that the water quality was abnormal during or after the flood events in various areas, which may be due to the release and resuspending of sediment in the river and leaching of the soil in the river basin area. And flood are also a major pathway for different dissolved matter, such as DOM, transport into the river system from the flood bed, wetlands, etc., when the flood was subsided. River flood has visibly impact on DOM component and concentration. The concentration and species of DOM and dissolved iron during different floods, including watershed extreme flood event, typhoon-induced flood event, snow-thawed flood event were monitored in Amur River and its biggest trib- utary Songhua River. Also, some simulation experiments in lab were implemented. The samples were filtered by 0.45µm filter membrane in situ, then analyze the ionic iron (ferrous ion, Ferric ion) by ET7406 Iron Concentration Tester(Lovibond, Germany with Phenanthroline colorimetric method). The total dissolved iron was determined by GBC 906 AAS(Australia) in lab. DOC was analyzed by TOC VCPH, SHIMADZU(Japan). The results showed that DOC ranged 6.63-9.19 mg/L (averaged at 7.68 mg/L) during extreme Songhua-Amur flood event in 2013.The lower molecular weight of organic matter[U+FF08]<10kDa[U+FF09]was the dominant form of DOM, and the lower molecular weight of complex iron was the dominant form of total dissolved iron.
[Show full text]
Geography – Russia
Year Six RUSSIA Key Facts • Russia (o cial name: Russian Federation) is the world’s largest • Given its size, the climate in Russia varies. The mildest areas country (with an area of 17,075, 200 square kilometres) and are along the Baltic Coast. Winter in Russia is very cold, with has a population of 144, 125, 000. The currency of Russia is the temperatures in the northern regions of Siberia reaching -50 Ruble. degrees Celsius in winter. • The capital city of Russia is Moscow. It has a population 13.2 million people within the city limits and 17 million within the Food and Trade urban areas. It is situated on the Moskva River in western Russia. • Borscht is a famous Russian soup made with beetroot and sour cream. It can be enjoyed hot or cold. Physical and Human Geographical features • St Petersburg is a major trade gateway in Russia, specialising in • Major mountain ranges: Ural, Altai. oil and gas trade, shipbuilding yards and the aerospace industry. • Major rivers: Amur, Irtysh, Lena, Ob, Volga and Yenisey. Russia The ﬂ ag of Russian Federation (Russian: Флаг России) Geographical Skills Key Vocabulary • Children locate the world’s countries on a map, focusing on the • Map: a diagrammatic representation of an area of land showing environmental regions, key physical and human characteristics physical features, cities, roads etc. and major cities of Russia. • Symbol: something that represents or stands for something • Children further their locational knowledge through the else. accurate use of maps, atlases, globes and digital/computer • Key: information needed for a map to make sense.
[Show full text]
Rhinogobius Immaculatus, a New Species of Freshwater Goby (Teleostei: Gobiidae) from the Qiantang River, China
ZOOLOGICAL RESEARCH Rhinogobius immaculatus, a new species of freshwater goby (Teleostei: Gobiidae) from the Qiantang River, China Fan Li1,2,*, Shan Li3, Jia-Kuan Chen1 1 Institute of Biodiversity Science, Ministry of Education Key Laboratory for Biodiversity Science and Ecological Engineering, Fudan University, Shanghai 200433, China 2 Shanghai Ocean University, Shanghai 200090, China 3 Shanghai Natural History Museum, Branch of Shanghai Science & Technology Museum, Shanghai 200041, China ABSTRACT non-diadromous (landlocked) (Chen et al., 1999a, 2002; Chen A new freshwater goby, Rhinogobius immaculatus sp. & Kottelat, 2005; Chen & Miller, 2014; Huang & Chen, 2007; Li & Zhong, 2009). nov., is described here from the Qiantang River in In total, 44 species of Rhinogobius have been recorded in China. It is distinguished from all congeners by the China (Chen et al., 2008; Chen & Miller, 2014; Huang et al., following combination of characters: second dorsal-fin 2016; Huang & Chen, 2007; Li et al., 2007; Li & Zhong, 2007, rays I, 7–9; anal-fin rays I, 6–8; pectoral-fin rays 2009; Wu & Zhong, 2008; Yang et al., 2008), eight of which 14–15; longitudinal scales 29–31; transverse scales have been reported from the Qiantang River basin originating 7–9; predorsal scales 2–5; vertebrae 27 (rarely 28); in southeastern Anhui Province to eastern Zhejiang Province. These species include R. aporus (Zhong & Wu, 1998), R. davidi preopercular canal absent or with two pores; a red (Sauvage & de Thiersant, 1874), R. cliffordpopei (Nichols, oblique stripe below eye in males; branchiostegal 1925), R. leavelli (Herre, 1935a), R. lentiginis (Wu & Zheng, membrane mostly reddish-orange, with 3–6 irregular 1985), R.
[Show full text]
Analysis on Influence of Urban Spatial Pattern Changes on Social Vulnerability
Nature Environment and Pollution Technology ISSN: 0972-6268 Vol. 15 No. 2 pp. 719-725 2016 An International Quarterly Scientific Journal Original Research Paper Analysis on Influence of Urban Spatial Pattern Changes on Social Vulnerability Xia Quan-wei*(**)† and Sun Bai-qing* *School of Economic and Management, Harbin Institute of Technology, Harbin-150001, China **Department of Humanities and Social Sciences, Heilongjiang Institute of Technology, Harbin-150050, China †Corresponding author: Xia Quan-wei ABSTRACT Nat. Env. & Poll. Tech. Website: www.neptjournal.com This paper studies and analyses the formation and evolution of the urban spatial pattern of Harbin, a waterfront city in northern China. Considering the history and culture of this city, as well as the impetus of modern Received: 12-10-2015 urbanization, and performing Pearson’s correlation analysis it is concluded that the modelled social vulnerability Accepted: 16-11-2015 score and the flood damage in certain periods are highly correlated. The results indicate, 1. that the change Key Words: of spatial pattern and the social vulnerability to disasters are in a high coupling relationship, 2) that the social Urban spatial pattern vulnerability is closely related to the terrain of the disaster source, and the urban civilians, handicraftsmen Social vulnerability and businessmen in Daoli District and Daowai District of the first stage of terrain are the population with the Natural disasters highest social vulnerability, and 3) that there is no apparently time-varying change of socially vulnerable groups. This paper innovates to combine the research on the dynamic change of the urban spatial pattern and the research on social vulnerability, in order to supplement and perfect the assessment system for social vulnerability influencing factors, and to provide reference for the establishment of the social policy as relevant.
[Show full text]