(Fuyuan); AR, the Amur River; SHR, the Songhua River; NR, the Nen River; JPL, Jingpo Lake and KL, Khanka Lake

(Fuyuan); AR, the Amur River; SHR, the Songhua River; NR, the Nen River; JPL, Jingpo Lake and KL, Khanka Lake

Figure S1. Historical distribution of M. terminalis in the Heilong River Basin. HLR, the Heilong River (Fuyuan); AR, the Amur River; SHR, the Songhua River; NR, the Nen River; JPL, Jingpo Lake and KL, Khanka Lake. A red dot represents that wild M. terminalis in the location has disappeared. A blue dot indicates that wild M. terminalis in the location is still present. 1 Figure S2. SRAP marker profiles generated from partial samples of 6 populations in the genus Megalobrama with primer combinations 1f5r (A), 2f9r (B), 4f20r (C) and 7f20r (D). M: pBR 322/Msp I marker; Lanes with different color represent samples of corresponding populations (MTH, M. terminalis in the Heilong River; MTQ, M. terminalis in the Qiantang River; MTJ, M.terminalis in the Jinsha River Reservoir; MPL, M. pellegrini in the Longxi River; MAL, M. amblycephala in the Liangzi Lake and MAY, M. amblycephala in the Yi River). The red arrows point to polymorphic bands with amplification stability. 2 Figure S3. Establishment of K value in STRUCTURE analysis. (A): Relationship between K and Delta K; (B): Table output following the method of Evanno et al. [37]. Yellow highlight indicates the largest value in the Delta K column. Table S1. Sampling sites and number of individuals used for mtDNA and SRAP analysis. Region mtDNA SRAP Heilong River 26 30 Qiantang River 20 30 Jinshahe Reservoir 15 30 Longxi River 20 30 Liangzi Lake 18 30 Yi River 16 30 Xi River 20 30 Total 135 210 Table S2. Information on fragments for amplification and haplotype analysis in the D-loop, ND2 and CYTB genes. Reference mtDNA sequence of Megalobrama terminalis in the Heilong River (MTH) (accession no. MH289765). Primer ID and Genes and sequence positions for Primer sequences (from 5' to 3') Size (bp) positions haplotype analysis Dl-F/Dl-R CACCCCTGGCTCCCAAAGCCA D-loop (8-937) 1115 (930) 15576-1070 ACTGCGGAGACTTGCATGTGTAA Nd-F/Nd-R GATCGAACCCATGCCCAAGAG ND2 (4999-6043) 1337 (1045) 4871-6207 GGATCGAGGCCTTCCCATCTAGT Cyt-F/Cyt-R AGGCGTAGGATTAGAAGCAACAG CYTB (15340-16480) 1393 (1141) 15192-16584 CCAGGGGTGGGAGTTAAAATC 3 Table S3. Sequences of 15 SRAP primers. Primer pair ID Primer sequences (5′→3′) 1f2r TGAGTCCAAACCGGATA GACTGCGTACGAATTTGC 1f5r TGAGTCCAAACCGGATA GACTGCGTACGAATTAAC 1f17r TGAGTCCAAACCGGATA GACTGCGTACGAATTAGC 2f5r TGAGTCCAAACCGGAGC GACTGCGTACGAATTAAC 2f9r TGAGTCCAAACCGGAGC GACTGCGTACGAATTCGA 4f20r TGAGTCCAAACCGGACC GACTGCGTACGAATTGTA 7f8r TGAGTCCAAACCGGTCC GACTGCGTACGAATTCTC 7f19r TGAGTCCAAACCGGTCC GACTGCGTACGAATTCTG 7f20r TGAGTCCAAACCGGTCC GACTGCGTACGAATTGTA 10f13r TGAGTCCAAACCGGAAA GACTGCGTACGAATTGTC 10f18r TGAGTCCAAACCGGAAA GACTGCGTACGAATTCAT 10f20r TGAGTCCAAACCGGAAA GACTGCGTACGAATTGTA 12f3r TGAGTCCAAACCGGAGA GACTGCGTACGAATTGAC 12f4r TGAGTCCAAACCGGAGA GACTGCGTACGAATTTGA 12f5r TGAGTCCAAACCGGAGA GACTGCGTACGAATTAAC 4 .

View Full Text

Details

  • File Type
    pdf
  • Upload Time
    -
  • Content Languages
    English
  • Upload User
    Anonymous/Not logged-in
  • File Pages
    4 Page
  • File Size
    -

Download

Channel Download Status
Express Download Enable

Copyright

We respect the copyrights and intellectual property rights of all users. All uploaded documents are either original works of the uploader or authorized works of the rightful owners.

  • Not to be reproduced or distributed without explicit permission.
  • Not used for commercial purposes outside of approved use cases.
  • Not used to infringe on the rights of the original creators.
  • If you believe any content infringes your copyright, please contact us immediately.

Support

For help with questions, suggestions, or problems, please contact us