DOCSLIB.ORG

Notch Signalling Defines Dorsal Root Ganglia Neuroglial Fate Choice

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Notch Signalling Defines Dorsal Root Ganglia Neuroglial Fate Choice Wiszniak and Schwarz BMC Neurosci (2019) 20:21 https://doi.org/10.1186/s12868-019-0501-0 BMC Neuroscience RESEARCH ARTICLE Open Access Notch signalling defnes dorsal root ganglia neuroglial fate choice during early neural crest cell migration Sophie Wiszniak and Quenten Schwarz* Abstract Background: The dorsal root ganglia (DRG) are a critical component of the peripheral nervous system, and func- tion to relay somatosensory information from the body’s periphery to sensory perception centres within the brain. The DRG are primarily comprised of two cell types, sensory neurons and glia, both of which are neural crest-derived. Notch signalling is known to play an essential role in defning the neuronal or glial fate of bipotent neural crest pro- genitors that migrate from the dorsal ridge of the neural tube to the sites of the DRG. However, the involvement of Notch ligands in this process and the timing at which neuronal versus glial fate is acquired has remained uncertain. Results: We have used tissue specifc knockout of the E3 ubiquitin ligase mindbomb1 (Mib1) to remove the function of all Notch ligands in neural crest cells. Wnt1-Cre; Mib1f/f mice exhibit severe DRG defects, including a reduction in glial cells, and neuronal cell death later in development. By comparing formation of sensory neurons and glia with the expression and activation of Notch signalling in these mice, we defne a critical period during embryonic develop- ment in which early migrating neural crest cells become biased toward neuronal and glial phenotypes. Conclusions: We demonstrate active Notch signalling between neural crest progenitors as soon as trunk neural crest cells delaminate from the neural tube and during their early migration toward the site of the DRG. This data brings into question the timing of neuroglial fate specifcation in the DRG and suggest that it may occur much earlier than originally considered. Keywords: Notch signalling, Mib1, Neural crest, Fate restriction, Dorsal root ganglia Background of bipotent trunk neural crest cell progenitors that are Peripheral sensory neurons and their supporting glia biased towards the sensory lineage [2]. Tis population of condense into specialised dorsal root ganglia (DRG) trunk neural crest cells migrates ventrally from the dor- that transmit somatosensory information from the sal neural tube, arrests within the somites, and is then body’s periphery to sensory perception centres within thought to gain neuronal or glial identity as they coalesce the central nervous system. A diverse array of neuronal into the DRG [3, 4]. sub-types underlies the ability of the DRG to transduce Notch signalling is known to play an important role in diferent sensations including pain, proprioception, neuroglial fate choice determination [5, 6]. Te Notch temperature and touch. Satellite glia sit in close asso- signalling pathway relies on direct cell–cell interactions ciation with neuronal cell bodies of the sensory gan- mediated by Notch receptors on the signal-receiving cell glia to modulate their microenvironment [1]. Both cell and ligands such as Delta and Jagged on the signal-send- types comprising the DRG arise from a sub-population ing cell. By a process known as lateral inhibition, Notch signalling enables a population of homogeneous progeni- tors to become specifed into diferent cell types, namely *Correspondence: [email protected] Centre for Cancer Biology, University of South Australia and SA Pathology, neurons and glia in the developing nervous system. In North Terrace, Adelaide, SA 5001, Australia the DRG, cells expressing Delta-like 1 (DLL1) adopt a © The Author(s) 2019. This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creat iveco mmons .org/licen ses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creat iveco mmons .org/ publi cdoma in/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Wiszniak and Schwarz BMC Neurosci (2019) 20:21 Page 2 of 13 neuronal fate, which then signal to adjacent cells via their diferentiate into neurons, however is maintained in neu- Notch receptors to inhibit neuronal diferentiation. Tis ral crest progenitors that diferentiate into glia, and thus in turn promotes glial diferentiation of cells in which is also used as a marker of mature glial cells [13, 14]. Tis neuronal diferentiation has been inhibited [7, 8]. early loss of Sox10 presents the possibility that a subset of Te study of Notch signalling in DRG development neural crest cells are specifed to become glia at the earli- has been complicated by the presence of multiple Notch est stages of their migration, before neurons diferentiate. receptors and ligands, all of which have the potential to In the absence of Mib1, DLL1 protein accumulates at the act in a functionally redundant manner. Tis has been cell membrane, and enables visualisation of neuronally overcome to some degree by the study of recombination biased signal-sending cells attempting to undergo active signal binding protein for immunoglobulin kappa J region Notch signalling. In Wnt1-Cre; Mib1f/f embryos, aber- (Rbpj) conditional knockout mice. RBPJ is a transcription rant DLL1 accumulation was evident as early as E9.25 factor which interacts with the intracellular domain of all immediately after neural crest cells had delaminated Notch receptors and is essential to mediate downstream from the neural tube, and this was accompanied by a loss transcriptional efects upon Notch pathway stimulation. of Notch1 intracellular domain (N1ICD) in the nucleus of Terefore, knockout of Rbpj is expected to abolish all migrating neural crest cells at this stage. Tis is the frst Notch signalling. Removal of Rbpj specifcally in neural study to demonstrate active Notch signalling between crest cells leads to profound DRG defects, including a neural crest progenitors at this early stage of trunk neural signifcant reduction in glial cells [9, 10], which is consist- crest migration, and suggests that the signalling events ent with a role for Notch signalling in promoting glial cell controlling neuroglial fate specifcation in the DRG occur development. However, these studies did not defne the much earlier than originally considered. timing of Notch activation during DRG development and gliogenesis, as well as the roles for Notch ligands in this Results process. Loss of Mib1 in neural crest cells causes severe dorsal root While several Notch ligands have been ubiquitously ganglia hypoplasia removed during mouse development (e.g. Dll1-null) At E12.5, the dorsal root ganglia (DRG) appear as uni- their specifc efects on DRG formation have been dif- formly-shaped, segmented tissue structures, positioned fcult to study given the broad roles Notch ligands play bi-laterally adjacent to the neural tube. All neurons and in many organ systems during embryonic development, glia that comprise the mature DRG are derived from neu- and the severity of knockout phenotypes [11]. Also, the ral crest cells [15]. Removal of Mib1 specifcally in neural removal of individual Notch ligands may be phenotypi- crest-derived tissue using a Wnt1-Cre driver and Mib1f cally misleading if multiple ligands are able to function in allele revealed severe DRG hypoplasia (n = 3/3; Fig. 1). a redundant fashion. To overcome these difculties, we Longitudinal sections through the developing neural addressed the function of Notch ligands during neural tube and DRG at E12.5 revealed that compared to con- crest and DRG development by removing Mind bomb 1 trol littermates (Wildtype (Cre-negative) and Wnt1-Cre; (Mib1) conditionally in neural crest-derived tissue. Mib1 Mib1f/+), Wnt1-Cre; Mib1f/f embryos exhibited a dra- is an E3 ubiquitin ligase that is required in signal-send- matic reduction of DRG neuronal tissue, as labelled by ing cells to target the Notch ligands for ubiquitination. immunostaining for the mature neuronal marker Tuj1 Tis ubiquitination is required for the internalisation (Fig. 1a). Lineage tracing of neural crest-derived tis- of Notch ligands upon signalling to Notch receptors on sue was performed by examining expression of a Z/EG adjacent cells, and this internalisation is essential for the reporter gene, which permanently labels cells with EGFP correct cleavage and translocation of the Notch intracel- upon expression of the Wnt1-Cre driver. Similar to Tuj1, lular domain to the nucleus in the signal-receiving cell to EGFP immunostaining was dramatically reduced in the enable active Notch signalling [12]. Terefore, removal of DRG of Wnt1-Cre; Mib1f/f embryos (Fig. 1b), indicating Mib1 in neural crest cells is expected to abolish activity of DRG defciency at E12.5 is caused by a loss of all neural all Notch ligands. crest-derived cellular components of the DRG. Consistent with the known role for Notch signal- ling in DRG development, Wnt1-Cre; Mib1f/f embryos Loss of Mib1 results in reduced glial progenitors, exhibit severe DRG hypoplasia, with a dramatic reduc- premature neuronal diferentiation and neuronal cell tion in glial cells in the DRG. Interestingly, the loss of death in DRG glial cells was preceded by reduced SRY-related HMG- To investigate the developmental timing of DRG def- box 10 (Sox10) expression in a subset of early migrating ciency, DRG formation was examined at earlier stages neural crest cells. Sox10 is a marker of pre- and migra- of development. By E10.5, all neural crest cells that will tory neural crest cells, which is lost as neural crest cells contribute to the neuronal and glial cell subtypes of the Wiszniak and Schwarz BMC Neurosci (2019) 20:21 Page 3 of 13 Fig. 1 Loss of Mib1 in neural crest cells causes severe DRG hypoplasia.
Load more

Recommended publications
  • Integrated and Functional Genomic Approaches to Elucidate Differential Genetic Dependencies in Melanoma
    Integrated and Functional Genomic Approaches to Elucidate Differential Genetic Dependencies in Melanoma The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters Citation Wong, Terence. 2018. Integrated and Functional Genomic Approaches to Elucidate Differential Genetic Dependencies in Melanoma. Doctoral dissertation, Harvard University, Graduate School of Arts & Sciences. Citable link http://nrs.harvard.edu/urn-3:HUL.InstRepos:42014990 Terms of Use This article was downloaded from Harvard University’s DASH repository, and is made available under the terms and conditions applicable to Other Posted Material, as set forth at http:// nrs.harvard.edu/urn-3:HUL.InstRepos:dash.current.terms-of- use#LAA Integrated and Functional Genomic Approaches to Elucidate Differential Genetic Dependencies in Melanoma A dissertation presented by Terence Cheng Wong to The Division of Medical Sciences in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the subject of Biological and Biomedical Sciences Harvard University Cambridge, Massachusetts November 2017 © 2017 Terence Cheng Wong All rights reserved. Dissertation Advisor: Levi Garraway Terence Cheng Wong Integrated and Functional Genomic Approaches to Elucidate Differential Genetic Dependencies in Melanoma ABSTRACT Genomic characterization of human cancers over the past decade has generated comprehensive catalogues of genetic alterations in cancer genomes. Many of these genetic events result in molecular or cellular changes that drive cancer cell phenotypes. In melanoma, a majority of tumors harbor mutations in the BRAF gene, leading to activation of the MAPK pathway and tumor initiation. The development and use of drugs that target the mutant BRAF protein and the MAPK pathway have produced significant clinical benefit in melanoma patients.
    [Show full text]
  • The GATA2 Transcription Factor Negatively Regulates the Proliferation of Neuronal Progenitors
    RESEARCH ARTICLE 2155 Development 133, 2155-2165 (2006) doi:10.1242/dev.02377 The GATA2 transcription factor negatively regulates the proliferation of neuronal progenitors Abeer El Wakil*, Cédric Francius*,†, Annie Wolff, Jocelyne Pleau-Varet† and Jeannette Nardelli†,§ Postmitotic neurons are produced from a pool of cycling progenitors in an orderly fashion that requires proper spatial and temporal coordination of proliferation, fate determination, differentiation and morphogenesis. This probably relies on complex interplay between mechanisms that control cell cycle, specification and differentiation. In this respect, we have studied the possible implication of GATA2, a transcription factor that is involved in several neuronal specification pathways, in the control of the proliferation of neural progenitors in the embryonic spinal cord. Using gain- and loss-of-function manipulations, we have shown that Gata2 can drive neural progenitors out of the cycle and, to some extent, into differentiation. This correlates with the control of cyclin D1 transcription and of the expression of the p27/Kip1 protein. Interestingly, this functional aspect is not only associated with silencing of the Notch pathway but also appears to be independent of proneural function. Consistently, GATA2 also controls the proliferation capacity of mouse embryonic neuroepithelial cells in culture. Indeed, Gata2 inactivation enhances the proliferation rate in these cells. By contrast, GATA2 overexpression is sufficient to force such cells and neuroblastoma cells to stop dividing but not to drive either type of cell into differentiation. Furthermore, a non-cell autonomous effect of Gata2 expression was observed in vivo as well as in vitro. Hence, our data have provided evidence for the ability of Gata2 to inhibit the proliferation of neural progenitors, and they further suggest that, in this regard, Gata2 can operate independently of neuronal differentiation.
    [Show full text]
  • Olig1 and Sox10 Interact Synergistically to Drivemyelin Basic
    The Journal of Neuroscience, December 26, 2007 • 27(52):14375–14382 • 14375 Cellular/Molecular Olig1 and Sox10 Interact Synergistically to Drive Myelin Basic Protein Transcription in Oligodendrocytes Huiliang Li,1 Yan Lu,2 Hazel K. Smith,1 and William D. Richardson1 1Wolfson Institute for Biomedical Research and Department of Biology, University College London, London WC1E 6BT, United Kingdom, and 2Medical Research Council, Clinical Sciences Centre, Imperial College London, London W12 0NN, United Kingdom The oligodendrocyte lineage genes (Olig1/2), encoding basic helix-loop-helix transcription factors, were first identified in screens for master regulators of oligodendrocyte development. OLIG1 is important for differentiation of oligodendrocyte precursors into myelin- forming oligodendrocytes during development and is thought to play a crucial role in remyelination during multiple sclerosis. However, itisstillunclearhowOLIG1interactswithitstranscriptionalcofactorsandDNAtargets.OLIG1wasreportedlyrestrictedtomammals,but we demonstrate here that zebrafish and other teleosts also possess an OLIG1 homolog. In zebrafish, as in mammals, Olig1 is expressed in the oligodendrocyte lineage. Olig1 associates physically with another myelin-associated transcription factor, Sox10, and the Olig1/Sox10 complex activates mbp (myelin basic protein) transcription via conserved DNA sequence motifs in the mbp promoter region. In contrast, Olig2 does not bind to Sox10 in zebrafish, although both OLIG1 and OLIG2 bind SOX10 in mouse. Key words: Olig1; Olig2; Sox10; Mbp; oligodendrocyte; myelin; zebrafish; mouse; evolution; development Introduction directly regulates Mbp transcription (Stolt et al., 2002), and over- Myelin, the multilayered glial sheath around axons, is one of the expression of SOX10 alone is sufficient to induce myelin gene defining features of jawed vertebrates (gnathostomes). It is expression in embryonic chick spinal cord (Liu et al., 2007).
    [Show full text]
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
    [Show full text]
  • Birth Defects Caused by Mutations in Human GLI3 and Mouse Gli3 Genescga
    doi:10.1111/j.1741-4520.2009.00266.x Congenital Anomalies 2010; 50, 1–7 1 REVIEW ARTICLE Birth defects caused by mutations in human GLI3 and mouse Gli3 genescga_ 266 1..71..7 Ichiro Naruse1, Etsuko Ueta1, Yoshiki Sumino1, Masaya Ogawa1, and Satoshi Ishikiriyama2 1School of Health Science, Faculty of Medicine, Tottori University, Yonago, and 2Division of Clinical Genetics and Cytogenetics, Shizuoka Children’s Hospital, Shizuoka, Japan ABSTRACT GLI3 is the gene responsible for Greig cepha- type-A (PAP-A) and preaxial polydactyly type-IV (PPD-IV). A lopolysyndactyly syndrome (GCPS), Pallister–Hall syndrome mimic phenomenon is observed in mice. Investigation of human (PHS) and Postaxial polydactyly type-A (PAP-A). Genetic poly- GLI3 and Gli3 genes has progressed using the knowledge of dactyly mice such as Pdn/Pdn (Polydactyly Nagoya), XtH/XtH Cubitus interruptus (Ci) in Drosophila, a homologous gene of GLI3 (Extra toes) and XtJ/XtJ (Extra toes Jackson) are the mouse and Gli3 genes. These genes have been highly conserved in the homolog of GCPS, and Gli3tmlUrtt/Gli3tmlUrt is produced as the animal kingdom throughout evolution. Now, a lot of mutant mice of mouse homolog of PHS. In the present review, relationships Gli3 gene have been known and knockout mice have been pro- between mutation points of GLI3 and Gli3, and resulting phe- duced. It is expected that the knowledge obtained from mutant and notypes in humans and mice are described. It has been con- knockout mice will be extrapolated to the manifestation mecha- firmed that mutation in the upstream or within the zinc finger nisms in human diseases to understand the diseases caused by the domain of the GLI3 gene induces GCPS; that in the post-zinc mutations in GLI3 gene.
    [Show full text]
  • Identifying Isl1 Genetic Lineage in the Developing Olfactory System and in Gnrh-1 Neurons 2 3 Ed Zandro M
    bioRxiv preprint doi: https://doi.org/10.1101/2020.08.31.276360; this version posted August 31, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 1 Identifying Isl1 genetic lineage in the developing olfactory system and in GnRH-1 neurons 2 3 Ed Zandro M. Taroc1, Raghu Ram Katreddi1 and Paolo E. Forni1*. 4 5 1Department of Biological Sciences; The RNA Institute, and the Center for Neuroscience 6 Research; University at Albany, State University of New York, Albany, NY 12222, USA. 7 8 * Corresponding Author 9 [email protected] 10 11 12 Keywords: Olfactory neurons, vomeronasal sensory neurons, GnRH neurons, Islet-1/Isl1, Isl1 13 Conditional knock-out; genetic lineage tracing, olfactory placode, neural crest. 14 15 Abstract (299, at 245 after editing) 16 During embryonic development, symmetric ectodermal thickenings (olfactory placodes) give rise 17 to several cell types that comprise the olfactory system, such as those that form the terminal nerve 18 ganglion (TN), gonadotropin releasing hormone-1 (GnRH-1) neurons and other migratory 19 neurons in rodents. Even though the genetic heterogeneity among these cell types are 20 documented, unidentified cell populations arising from the olfactory placode remain. One 21 candidate to identify placodal derived neurons in the developing nasal area is the transcription 22 factor Isl1, which was recently identified in GnRH-3 neurons of the terminal nerve in fish, as well 23 as expression in neurons of the nasal migratory mass. Here, we analyzed the Isl1 genetic lineage 24 in chemosensory neuronal populations in the nasal area and migratory GnRH-1 neurons in mice 25 using in-situ hybridization, immunolabeling a Tamoxifen inducible Isl1CreERT and a constitutive 26 Isl1Cre knock-in mouse lines.
    [Show full text]
  • Ablation of Ezh2 in Neural Crest Cells Leads to Hirschsprung's Disease-Like Phenotype in Mice
    bioRxiv preprint doi: https://doi.org/10.1101/265868; this version posted February 15, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Ablation of Ezh2 in neural crest cells leads to Hirschsprung’s disease-like phenotype in mice Hana Kim, Ingeborg M. Langohr, Mohammad Faisal, Margaret McNulty, Caitlin Thorn, Joomyeong Kim* Department of Biological Sciences, Louisiana State University, Baton Rouge, LA 70803, USA. Correspondence should be forwarded to: [email protected], 225-578-7692(ph), or 225-578-2597(fax) Running title: Function of Ezh2 in enteric neural crest cell development 1 bioRxiv preprint doi: https://doi.org/10.1101/265868; this version posted February 15, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract In the current study, we examined the role of Ezh2 as an epigenetic modifier for the enteric neural crest cell development through H3K27me3. Ezh2 conditional null mice were viable up to birth, but died within the first hour of life. In addition to craniofacial defects, Ezh2 conditional null mice displayed reduced number of ganglion cells in the enteric nervous system. RT-PCR and ChIP assays indicated aberrant up-regulation of Zic1, Pax3, and Sox10 and loss of H3K27me3 marks in the promoter regions of these genes in the myenteric plexus. Overall, these results suggest that Ezh2 is an important epigenetic modifier for the enteric neural crest cell development through repression of Zic1, Pax3, and Sox10.
    [Show full text]
  • To Proliferate Or to Die: Role of Id3 in Cell Cycle Progression and Survival of Neural Crest Progenitors
    Downloaded from genesdev.cshlp.org on October 4, 2021 - Published by Cold Spring Harbor Laboratory Press To proliferate or to die: role of Id3 in cell cycle progression and survival of neural crest progenitors Yun Kee and Marianne Bronner-Fraser1 Division of Biology, California Institute of Technology, Pasadena, California 91125, USA The neural crest is a unique population of mitotically active, multipotent progenitors that arise at the vertebrate neural plate border. Here, we show that the helix–loop–helix transcriptional regulator Id3 has a novel role in cell cycle progression and survival of neural crest progenitors in Xenopus. Id3 is localized at the neural plate border during gastrulation and neurulation, overlapping the domain of neural crest induction. Morpholino oligonucleotide-mediated depletion of Id3 results in the absence of neural crest precursors and a resultant loss of neural crest derivatives. This appears to be mediated by cell cycle inhibition followed by cell death of the neural crest progenitor pool, rather than a cell fate switch. Conversely, overexpression of Id3 increases cell proliferation and results in expansion of the neural crest domain. Our data suggest that Id3 functions by a novel mechanism, independent of cell fate determination, to mediate the decision of neural crest precursors to proliferate or die. [Keywords: Xenopus; Id3; neural crest; cell cycle; survival] Received September 1, 2004; revised version accepted January 19, 2005. The neural crest is an embryonic cell population that origi- et al. 2003), c-Myc (Bellmeyer et al. 2003), and Msx1 nates from the lateral edges of the neural plate during (Tribulo et al. 2003) have been identified in Xenopus nervous system formation.
    [Show full text]
  • A Combination of GATA3 and SOX10 Is Useful for the Diagnosis of Metastatic Triple-Negative Breast Cancer☆ Gary H
    Human Pathology (2019) 85,221–227 www.elsevier.com/locate/humpath Original contribution A combination of GATA3 and SOX10 is useful for the diagnosis of metastatic triple-negative breast cancer☆ Gary H. Tozbikian MD⁎, Debra L. Zynger MD Department of Pathology, The Ohio State University Wexner Medical Center, Columbus, OH 43210, USA Received 9 July 2018; revised 2 November 2018; accepted 7 November 2018 Keywords: Summary In metastatic breast cancer (MBC), it can be difficult to establish the origin if the primary tumor is Triple negative; triple negative or if there is a loss of biomarker expression. SOX10 expression has been reported in primary Breast cancer; triple-negative breast cancer but is poorly studied in metastatic lesions. In this study, the diagnostic utility of SOX10; a panel of SOX10, GATA3, and androgen receptor (AR) in MBC negative for estrogen receptor, progester- GATA3; one receptor, and human epidermal growth factor receptor 2 was evaluated and compared with the expres- Metastatic; sion of these markers in the matched primary breast cancer. In a series of 57 triple-negative MBCs, 82% Primary were positive for GATA3, 58% for SOX10, and 25% for AR. Nearly all MBCs (95%) were positive for ei- ther GATA3 or SOX10, with 46% dual positive and 5% of cases negative for both markers. Most GATA3- negative MBC cases were SOX10 positive (70%). AR expression was only seen in GATA3-positive MBC (25%) and was significantly more frequent in SOX10-negative MBC (48%) versus SOX10-positive MBC (9%; P = .001). Concordance for GATA3, SOX10, and AR between the primary and metastasis was 89%, 88%, and 80%, respectively.
    [Show full text]
  • Spatial Distribution of Leading Pacemaker Sites in the Normal, Intact Rat Sinoa
    Supplementary Material Supplementary Figure 1: Spatial distribution of leading pacemaker sites in the normal, intact rat sinoatrial 5 nodes (SAN) plotted along a normalized y-axis between the superior vena cava (SVC) and inferior vena 6 cava (IVC) and a scaled x-axis in millimeters (n = 8). Colors correspond to treatment condition (black: 7 baseline, blue: 100 µM Acetylcholine (ACh), red: 500 nM Isoproterenol (ISO)). 1 Supplementary Figure 2: Spatial distribution of leading pacemaker sites before and after surgical 3 separation of the rat SAN (n = 5). Top: Intact SAN preparations with leading pacemaker sites plotted during 4 baseline conditions. Bottom: Surgically cut SAN preparations with leading pacemaker sites plotted during 5 baseline conditions (black) and exposure to pharmacological stimulation (blue: 100 µM ACh, red: 500 nM 6 ISO). 2 a &DUGLDFIoQChDQQHOV .FQM FOXVWHU &DFQDG &DFQDK *MD &DFQJ .FQLS .FQG .FQK .FQM &DFQDF &DFQE .FQM í $WSD .FQD .FQM í .FQN &DVT 5\U .FQM &DFQJ &DFQDG ,WSU 6FQD &DFQDG .FQQ &DFQDJ &DFQDG .FQD .FQT 6FQD 3OQ 6FQD +FQ *MD ,WSU 6FQE +FQ *MG .FQN .FQQ .FQN .FQD .FQE .FQQ +FQ &DFQDD &DFQE &DOP .FQM .FQD .FQN .FQG .FQN &DOP 6FQD .FQD 6FQE 6FQD 6FQD ,WSU +FQ 6FQD 5\U 6FQD 6FQE 6FQD .FQQ .FQH 6FQD &DFQE 6FQE .FQM FOXVWHU V6$1 L6$1 5$ /$ 3 b &DUGLDFReFHSWRUV $GUDF FOXVWHU $GUDD &DY &KUQE &KUP &KJD 0\O 3GHG &KUQD $GUE $GUDG &KUQE 5JV í 9LS $GUDE 7SP í 5JV 7QQF 3GHE 0\K $GUE *QDL $QN $GUDD $QN $QN &KUP $GUDE $NDS $WSE 5DPS &KUP 0\O &KUQD 6UF &KUQH $GUE &KUQD FOXVWHU V6$1 L6$1 5$ /$ 4 c 1HXURQDOPURWHLQV
    [Show full text]
  • Transcription Factor Gene Expression Profiling and Analysis of SOX Gene Family Transcription Factors in Human Limbal Epithelial
    Transcription factor gene expression profiling and analysis of SOX gene family transcription factors in human limbal epithelial progenitor cells Der Naturwissenschaftlichen Fakultät der Friedrich-Alexander-Universität Erlangen-Nürnberg zur Erlangung des Doktorgrades Dr. rer. nat. vorgelegt von Dr. med. Johannes Menzel-Severing aus Bonn Als Dissertation genehmigt von der Naturwissenschaftlichen Fakultät der Friedrich-Alexander-Universität Erlangen-Nürnberg Tag der mündlichen Prüfung: 7. Februar 2018 Vorsitzender des Promotionsorgans: Prof. Dr. Georg Kreimer Gutachter: Prof. Dr. Andreas Feigenspan Prof. Dr. Ursula Schlötzer-Schrehardt 1 INDEX 1. ABSTRACTS Page 1.1. Abstract in English 4 1.2. Zusammenfassung auf Deutsch 7 2. INTRODUCTION 2.1. Anatomy and histology of the cornea and the corneal surface 11 2.2. Homeostasis of corneal epithelium and the limbal stem cell paradigm 13 2.3. The limbal stem cell niche 15 2.4. Cell therapeutic strategies in ocular surface disease 17 2.5. Alternative cell sources for transplantation to the corneal surface 18 2.6. Transcription factors in cell differentiation and reprogramming 21 2.7. Transcription factors in limbal epithelial cells 22 2.8. Research question 25 3. MATERIALS AND METHODS 3.1. Human donor corneas 27 3.2. Laser Capture Microdissection (LCM) 28 3.3. RNA amplification and RT2 profiler PCR arrays 29 3.4. Real-time PCR analysis 33 3.5. Immunohistochemistry 34 3.6. Limbal epithelial cell culture 38 3.7. Transcription-factor knockdown/overexpression in vitro 39 3.8. Proliferation assay 40 3.9. Western blot 40 3.10. Statistical analysis 41 2 4. RESULTS 4.1. Quality control of LCM-isolated and amplified RNA 42 4.2.
    [Show full text]
  • GATA Factors and Hindbrain Development 5525
    Development 126, 5523-5531 (1999) 5523 Printed in Great Britain © The Company of Biologists Limited 1999 DEV2473 The transcription factor GATA3 is a downstream effector of Hoxb1 specification in rhombomere 4 Illar Pata1,‡, Michèle Studer2,‡, J. Hikke van Doorninck3,*, James Briscoe4, Sulev Kuuse1, J. Douglas Engel5, Frank Grosveld3 and Alar Karis1,3,¶ 1Institute of Molecular and Cell Biology, University of Tartu, 23 Riia St, 51010 Tartu, Estonia 2Department of Developmental Neurobiology, King’s College London, 4th Floor, New Hunts House, Guy’s Hospital, London SE1 9RT, UK 3Department of Cell Biology and Genetics, Erasmus University Rotterdam, PO Box 1738, 3000 DR Rotterdam, The Netherlands 4Department of Biochemistry and Molecular Biophysics, Howard Hughes Medical Institute, Columbia University, New York, NY10032, USA 5Department of Biochemistry, Molecular Biology and Cell Biology, North Western University, Evanston, IL 60208 USA *Present address: Rudolf Magnus Institute for Neurosciences, Utrecht University, The Netherlands ‡These authors contributed equally to this work ¶Author for correspondence at address 1 (e-mail: [email protected]) Accepted 15 September; published on WWW 9 November 1999 SUMMARY In this paper, we show that the transcription factor GATA3 Hoxb1-deficient mice. Ubiquitous expression of Hoxb1 in is dynamically expressed during hindbrain development. the hindbrain induces ectopic expression of GATA2 and Function of GATA3 in ventral rhombomere (r) 4 is GATA3 in ventral r2 and r3. These findings demonstrate dependent on functional GATA2, which in turn is under the that GATA2 and GATA3 lie downstream of Hoxb1 and control of Hoxb1. In particular, the absence of Hoxb1 provide the first example of Hox pathway transcription results in the loss of GATA2 expression in r4 and the factors within a defined population of vertebrate motor absence of GATA2 results in the loss of GATA3 expression.
    [Show full text]