(Oryza Sativa L.) and Defense Against Nematodes Njira

Home , Harpophora, New Rice for Africa, Penicillium purpurogenum, Serendipita, Setosphaeria rostrata

Cover_Njira.pdf 1 5/12/16 09:51 Possibilities of endophytic fungi from Kenya for growth promotion rice (Oryza sativa L.) and defense against nematodes

CMY

Possibilities of endophytic fungi from Kenya for growth promotion of rice (Oryza sativa L.) and defense against nematodes

Njira Njira Pili Njira Pili

ISBN 978-9-0598995-1-3 2016

9 789059 899513

Progress is made by trial and failure; the failures are generally a hundred times more numerous than the successes; yet they are usually left unchronicled.

William Ramsay, 1852 to 1916.

Promotors: Prof. Dr. Godelieve Gheysen

Department of Molecular Biotechnology,

Coupure Links 653, 9000 Gent.

Faculty of Bioscience Engineering, Ghent University.

Prof. Dr. Richard Kiprono Mibey

Moi University,

P.O Box 3900-30100,

Eldoret, Kenya.

Prof. Dr. ir. Monica Höfte

Department of Crop Protection,

Coupure Links 653, 9000 Gent.

Faculty of Bioscience Engineering, Ghent University

Dean: Prof. Dr. ir. Marc Van Meirvenne.

Rector: Prof. Dr. Anne De Paepe.

Possibilities of endophytic fungi from Kenya for growth promotion of rice (Oryza sativa L.) and defense against nematodes

Njira Njira Pili

Thesis submitted in fulfilment of the requirements for the degree of Doctor (PhD) in Applied Biological Sciences

iii

Dutch translation of the title:

Mogelijkheden van endofytische schimmels uit Kenia voor groeibevordering in rijst (Oryza sativa L.) en verdediging tegen nematoden.

Cover illustration

Front: An upland rice field in Kenya.

Pili, N.N. (2016). Possibilities of endophytic fungi from Kenya for growth promotion of rice (Oryza sativa L.) and defense against nematodes. PhD thesis, Ghent University, Ghent, Belgium.

ISBN-Number: 978-90-5989-951-3

This research was supported by grants from the Special Research Fund of Ghent University (GOA 01GB3013), BOF (01W02411), the MU-K VLIR-UOS program, Moi University and COST Action FA1103.

The author and the promotors give the authorisation to consult and to copy parts of this work for personal use only. Any other use is subject to the copyright laws. Permission to reproduce any material contained in this work should be obtained from the author.

Promotors Author

Prof. Dr. Godelieve Gheysen Njira Njira Pili

Prof. Dr. ir. Monica Höfte

Prof. Dr. Richard K. Mibey

Member of examination committee

Prof. Dr. ir. Patrick Van Damme (Chairman) Department of Plant Production, Coupure Links 653, B-9000, Ghent Faculty of Bioscience Engineering, Ghent University

Prof. Dr. ir. Geert Haesaert (Secretary) Department of Applied Bioscience, Ghent University, Valentyn Vaerwyckweg, 1, Schoonmeersen-gebouw C, B-9000, Ghent.

Prof. Dr. Godelieve Gheysen (Promotor) Department of Molecular Biotechnology, Coupure Links 653, B-9000, Ghent. Faculty of Bioscience Engineering, Ghent University.

Prof. Dr. Richard Kiprono Mibey (Promotor) Moi University, P.O Box 3900-30100, Eldoret, Kenya.

Prof. Dr. ir. Monica Höfte (Promotor) Department of Crop Protection, Coupure Links 653, B-9000, Ghent. Faculty of Bioscience Engineering, Ghent University.

Prof. Dr. Sofie Goormachtig VIB/ Ghent University, Department of Plant Systems Biology, Technologiepark 927, B-9052, Ghent, Belgium.

Prof. Dr. Dirk De Waele Laboratory of Tropical Crop improvement, Division of Crop Biotechnics, Willem de Croylaan 42-box 2455, 3001 K.U. Leuven. Faculty of Bioscience Engineering.

Prof. Dr. ir. Tina Kyndt Department of Molecular Biotechnology, Coupure Links 653, B-9000, Ghent, Faculty of Bioscience Engineering, Ghent University.

Prof. Dr. ir. Annemie Elsen Soil Service of Belgium, W. de Croylaan 48, 3001 Heverlee, Belgium/ Department of Biology, Nematology Unit, K.L. Ledeganckstraat 35, B-9000 Ghent, Faculty of Science, Ghent University.

Acknowledgements

My experience at the Department of Molecular Biotechnology, Ghent University, is a memory worth remembering. I have felt at home since my first day at the department. The entire Mobi- group is marvellous and more so the Nema-group led by Prof. Dr. Godelieve Gheysen -my promotor. Lieve, you are not only caring, inspirational and motivating, but also an excellent, dedicated and patient mentor. Your guidance has helped me all through my research, I appreciate you so much and I thank you abundantly. Special thanks also go to Prof. Dr. Richard K. Mibey -my co-promotor, for his continuous support, valuable comments and suggestions during my PhD study and related research. His immense knowledge about fungi has motivated me a lot and I have made it one of my dream future research disciplines. Prof. Dr. ir. Monica Höfte -my other co-promotor, I thank you for your patience, motivation, valuable suggestions, comments and immense knowledge about fungi. Prof. Dr. ir. Tina Kyndt, thank you for your insightful comments and encouragement and also for the hard questions which incented me to widen my research from various perspectives.

All members of the Department of Molecular Biotechnology (Ghent University) are highly acknowledged; particularly Sofie De Schynkel, Fien De Block, Geert Meesen, Isabel Verbeke, Isabel Tilmant, Lien De Smet, Shakhina Khanam, Lander Bauters, Kennedy Pkania, Lore Eggermont, Sofie Van Holle, Zobaida Lahari, Henry Mwaka, Diana Naalden, Yasinta Nzogela, Dora Quispe, Eliud Rugut, Henok Zemene Yimer, Mohammad Reza Atighi, Ruben Verbeek, Richard Singh and many others, for their support and encouragement in various academic and social issues.

Dr. Soraya C. França, thank you for all the support and encouragement, especially during the write-up of my first article on fungi. All members of the Phytopathology group (Ghent University) are highly acknowledged for their individual and collective contributions towards the successful completion of this PhD thesis.

My sincere thanks also go to Prof. Dr. Alexander Schouten, Prof. Dr. Florian Grundler and the entire MPM group (Bonn University) who provided me with opportunity to join their team as an exchange student, and who gave access to the laboratory and research facilities. In particular, I am grateful to Prof. Alexander for his constant guidance in setting up experiments, data collection and general supervision of my thesis abroad. Catherine Wanja Bogner and Thomas Bogner, you made our stay at Bonn really enjoyable. Big thank to you and may the Almighty GOD bless you abundantly.

I am also indebted to other members of the examination committee: Prof. Dr. ir. Patrick Van Damme (Chairman), Prof. Dr. ir. Geert Haesaert (Secretary), Prof. Dr. Sofie Goormachtig (member), Prof. Dr. ir. Annemie Elsen (member) and Prof. Dr. Dirk De Waele (member) for a friendly interaction during the examination period. Their valuable comments, suggestions, critics and professional advice on the thesis are highly appreciated and have been seriously considered in improving the text.

I am very grateful to the staff of BeCA-hub in Nairobi, particularly Dr. Robert Skilton, Dr. Francesca Stomeo and Mr. Bramwel Wanjala for their contribution toward realisation of the objectives of this thesis, especially chapter four. The farmers in Siaya, Busia, Ahero, Mwea and Kwale are highly appreciated for allowing me to collect enough samples for the lab analyses, knowing that any loss of a single plant through the destructive sampling I applied contributed to a loss of yield and/ or profit. Bravo to you farmers!

The financial support offered by BOF-UGent, VLIR-UOS, Moi University, The Commissie Wetenschappelijk Onderzoek (CWO), Faculty of Bioscience Engineering, Ghent University and COST Action FA1103 is highly appreciated.

To Dr. Rolf-Ferdinand Gehre and the family, thank you for the support that you have given us. You made our stay in Germany more comfortable. We appreciate a lot, and pray to the Almighty GOD to bless you abundantly.

To my parents, thank you for the sacrifice you made to see me through the academic ladder. I will always remember your effort. Finally, I express my very profound gratitude to my wife Lisanza Nasiali Bonciana (Kadzo) for providing me with unfailing support and continuous encouragement throughout my years of study and through the process of researching and writing of this thesis.

Njira Njira Pili

vii

viii

Table of Contents Acknowledgements ...... vi List of Abbreviations ...... xi Chapter 1: ...... 1 1.0 Problem statement ...... 1 1.1 Thesis outline ...... 3 Chapter 2: ...... 5 2.0 General introduction ...... 5 2.1 The root-knot nematode Meloidogyne graminicola ...... 10 2.2 The root-lesion nematode Pratylenchus zeae ...... 12 2.3 Management practices of rice nematodes ...... 13 2.4 Endophytic fungi ...... 14 2.5 Plant-microbe interactions ...... 18 2.6 Mode of action of endophytic fungi in plant growth promotion and defence responses ..... 30 2.6.1 Improved water consumption ...... 30 2.6.2 Nutrient acquisition ...... 30 2.6.3 Improved tolerance to abiotic factors ...... 31 2.6.4 Increased resistance (defence) to pathogens ...... 31 2.6.5 Mycoparasitism, competition and antibiosis ...... 34 2.7 The role of hormones in plant defence against pathogens ...... 35 2.7.1 Salicylic acid ...... 35 2.7.2 Jasmonic acid ...... 36 2.7.3 Ethylene ...... 36 2.7.4 Abscisic acid ...... 37 2.7.5 Auxins ...... 37 Chapter 3: ...... 39 3.0 A survey of plant-parasitic nematodes associated with irrigated and upland rice in Kenya, with a special reference to the root-lesion nematode Pratylenchus zeae...... 39 3.1 Abstract ...... 39 3.2 Introduction ...... 40 3.3 Materials and methods ...... 41 3.4 Results ...... 46 3.5 Discussion ...... 55 3.6 Acknowledgements ...... 57 Chapter 4: ...... 59 4.0 Analysis of fungal endophytes associated with rice roots from irrigated and upland ecosystems in Kenya ...... 59 4.1 Abstract ...... 59 4.2 Introduction ...... 60 4.3 Materials and methods ...... 61 4.4 Results ...... 63

4.5 Discussion ...... 67 4.6 Acknowledgements ...... 68 Chapter 5: ...... 79 5.0 The effects of the fungi Talaromyces purpurogenus (strain ABLO2D2), Piriformospora indica, Fusarium moniliforme and Fusarium oxysporum (strains Fo162, S2A1 and N2B3) on rice growth ...... 79 5.1 Abstract ...... 79 5.2 Introduction ...... 80 5.3 Material and methods ...... 80 5.4 Results ...... 83 5.5 Discussion ...... 89 5.6 Acknowledgements ...... 91 Chapter 6: ...... 93 6.0 The effects of Talaromyces purpurogenus (strain ABLO2D2) on rice growth and defence against the root-knot Meloidogyne graminicola ...... 93 6.1 Abstract ...... 93 6.2 Introduction ...... 94 6.3 Material and methods ...... 94 6.4 Results ...... 97 6.5 Discussion ...... 103 6.6 Acknowledgements ...... 104 Chapter 7: ...... 105 7.0 The effects of Fusarium oxysporum (strain S2A1) on rice growth and defence against the root-knot nematode Meloidogyne graminicola ...... 105 7.1 Abstract ...... 105 7.2 Introduction ...... 106 7.3 Materials and methods ...... 106 7.4 Results ...... 111 7.5 Discussion ...... 124 7.6 Acknowledgments ...... 127 Chapter 8: ...... 129 Summary ...... 140 Samenvatting ...... 141 References ...... 143 Curriculum vitae ...... 171

List of Abbreviations

ABA Abscisic Acid AL Aluminium AMF Arbuscular Mycorrhizal Fungi ANOVA Analysis of Variance BABA β-aminobutyric Acid BeCA Biosciences eastern and Central Africa hub BI Bayesian Inference CAT Catalase C-Endophytes Clavicipitaceous Endophytes CF Culture Filtrate CSIRO Commonwealth Scientific and Industrial Research Organisation CWE Cell-Wall Extracts DHAR Dehydroascorbate Reductase DNA Deoxyribo Nucleic Acid Dpfi Days post fungal inoculation Dpni Days post nematode infection DSE Dark Septate Endophytes DTT Dithiotreitol EBI European centre for Biotechnology Information EF Endophytic Fungi EMBO European Molecular Biology Organisation ET Ethylene ETI Effector Triggered Immunity ETS External Transcribed Spacer FAOSTAT Food and Agriculture Organisation of the United Nations Statistics Division Fe Iron FFSC Fusarium fujikuroi Species Complex Fig. Figure Fo162 Fusarium oxysporum strain Fo162 Fo47 Fusarium oxysporum strain Fo47 FOSC Fusarium oxysporum Species Complex GR Glutathione Reductase GS Glutamine Synthetase GSOR Genetic Stock Oryza Collection GTR General Time Reversible

H2O2 Hydrogen Peroxide Ha Hectare

HA Habitat Adapted HCL Hydrochloric Acid HR Hypersensitive Response IBA Indole-3-butyric Acid IGS InterGenic Spacer IH Invasive Hyphae ILRI International Livestock Research Institute IRGSP International Rice Genome Sequencing Project ISR Induced Systemic Resistance ITS Internal Transcribed Spacer J2 Second stage juveniles J3 Third stage juveniles J4 Fourth stage juveniles JA Jasmonic Acid K Potassium LM Light microscopy MAMPs Microbe-Associated Molecular Patterns Me-JA Methyl Jasmonate N Nitrogen N2B3 Fusarium oxysporum strain N2B3 NaOCl Sodium hypochlorite NCBI National Centre for Biotechnology Information NC-Endophytes Non- Clavicipitaceous Endophytes NHA Non-Habitat-Adapted NIB National Irrigation Board NLR Nucleotide-binding Leucine-rich Receptor protein no: Number NR Nitrate Reductase P Phosphorus PAL Phenylalanine Ammonia Lyase PAMPs Pathogen-Associated Molecular Patterns PCD Programmed Cell Death PCR Polymerase Chain Reaction Pf Final population PGPR Plant Growth Promoting Rhizobacteria Pi Initial population POD Peroxidase PR Pathogenesis Related protein

xii

PRRs Pattern Recognition Receptors PTI PAMP Triggered Immunity RF Reproduction Factor RLKs Receptor-Like Kinases RLPs Receptor-Like Proteins RNA RiboNucleic Acid ROS Reactive oxygen species S2A1 Fusarium oxysporum strain S2A1 SA Salicylic Acid SAP Synthetic Absorbent Polymer SAR Systemic Acquired Resistance SD Standard Deviation SE Standard Error SEM Scanning Electron Microscopy SFSA Syngenta Foundation for Sustainable Agriculture SOD Superoxide Dismutase SPSS Statistical Package for the Social Science SRI System of Rice Intensification TEF-1 Translation Elongation Factor alpha-1 TMV Tobacco Mosaic Virus UNEP United Nations Environment Programme USA United States of America V5w2 Fusarium oxysporum strain V5w2 WLB Worm Lysis Buffer Xoo Xanthomonas oryzae pv. oryzae Zn Zinc

xiii

xiv

Chapter 1

1.0 Problem statement

Rice (Oryza sativa L.) is a staple food for half of the world‟s population (Reyes and Chin, 2009), and an important model monocot crop for biological studies (Kyndt et al., 2014). The demand for rice has always exceeded production, occasionally leading to crises (Castillo, 2009). A general concern is to increase rice production to feed the ever-growing human population; however, pests and pathogens, among them plant-parasitic nematodes, continuously threaten rice production worldwide. The migratory root-lesion nematode, Pratylenchus zeae and the sedentary root-knot nematode Meloidogyne graminicola, are considered among the most damaging nematodes of rice (Kyndt et al., 2014). P. zeae has been reported to cause up to 29% yield losses of upland rice in Kenya and other countries (Kariaga and Agama, 1994; Castillo and Vovlas, 2007). Yield losses caused by M. graminicola range from 20-80% and 11-73% in upland and in simulation of intermittently flooded conditions in the Philippines, respectively (De Waele and Elsen, 2007).

Traditionally, rice has been cultivated in flooded paddy fields from transplanting to harvesting. This system uses a lot of water because most of it is wasted through evaporation, seeping and percolation (Thakur et al., 2014). Globally, water is becoming a scarce commodity, and if this condition persists, then rice production may be faced with huge water shortages (Bouman, 2007). The dwindling water resources have led researchers to think and develop technologies of rice cultivation under low-water conditions. An example of such technologies is the System of Rice Intensification (SRI) which promotes intermittent wetting and drying of rice fields, mechanical aeration of soil, early transplanting of 8-15 day-old seedlings and wide spacing of rice plants (Uphoff and Kassam, 2009). By reducing water usage, SRI promotes rice cultivation in aerobic conditions resembling those of upland rice fields. SRI was started in Madagascar in 1980s, and has currently spread to over 54 countries (Fig. 1.1) including Kenya (Mati and Nyamai, 2009; Mati et al., 2011). Currently, more than 10 million farmers practise SRI (Styger, 2014). Although this system has been shown to increase yield by 50 to 100% and reduce water consumption by 25 to 50% (Berkelaar, 2001; Sarath and Thilak, 2004), it may be vulnerable to nematodes and other pathogens as well as abiotic stresses. For instance, M. graminicola and other root-knot nematodes, which are usually adapted to aerobic conditions (upland cultivation), become more abundant and severe under SRI. Other nematode species such as Hirschmanniella oryzae, which are adapted to anaerobic conditions, become less abundant under SRI conditions (Seenivasan et al., 2010; Thiyagarajan and Gujja, 2012). Prasad et al. (2008) have hypothesised that switching rice cultivation from the traditional irrigated ecosystems to SRI (upland cultivation) may gradually decrease the population of rice nematodes that prefer

1 irrigated systems, and increase populations of more pathogenic nematodes such as root-knot and lesion nematodes that prefer upland and aerobic environments. The second stage juveniles (J2) of the root-knot nematode M. graminicola present in soil can only infect rice roots after subsidence of flooded conditions (Bridge and Page, 1982). The alternate wetting and drying conditions that is followed under SRI provides alternating periods of aerobic and anaerobic soil conditions that may favour the infection and reproduction of M. graminicola (Seenivasan et al., 2010). Recently, the root-knot nematode M. graminicola was detected for the first time in Madagascar (Chapuis et al., 2016). Whether the occurrence of this nematode species is related to SRI practices is still an open question.

Fig. 1.1 Spread and adoption of System of Rice Intensification. Adapted from Styger, 2014. A new approach capitalising on beneficial traits of endophytic fungi to promote rice growth and manage rice nematodes has been suggested. Endophytic fungi, which are microorganisms that internally colonise plant organs without causing symptoms, are involved in different responses to biotic and abiotic stresses (Rodriguez et al., 2009). The endophytic strain Fe14 of the fungus species Fusarium moniliforme (syn. F. verticillioides) has been shown to promote growth and increase rice resistance to M. graminicola (Le et al., 2009). Isolates of Harpophora oryzae (R5-6- 1 and RC-3-1) readily colonise rice plants and promote growth or defence responses to the blast disease caused by the fungus Magnaporthe oryzae (Su et al., 2013). F. culmorum strain FcRed1 and two strains of Curvularia protuberata (Cp4666D and CpYNP5C) have been shown to enhance rice tolerance to drought, cold or salt stresses (Redman et al., 2011). Yang et al. (2014a) have shown that rice plants inoculated with Phomopsis liquidambari showed improvement in yield and nitrogen use efficiency by 12% and 11.59%, respectively. Other studies have suggested that rice plants inoculated with Piriformospora indica (syn. Serendipita indica)

2 acquired more biomass and tolerated higher salt stresses (Jogawat et al., 2013; Das et al., 2014).

These examples and others show the potential benefits of endophytes to plants. However, most of these species have been isolated from other plant species or rice genotypes that are not commonly cultivated in Africa. For instance, F. culmorum strain FcRed1 and C. Protuberata (strains Cp4666D and CpYNP5C) were isolated from Leymus mollis and Dichanthelium lanuginosum grasses, respectively (Redman et al., 2002). P. liquidambari was isolated from the inner barks of Bischofia polycarpa (Shi et al., 2004), while F. moniliforme (strain Fe14) was isolated from the rice variety BR11, commonly cultivated in Bangladesh (Le et al., 2009). A meta- analysis of data has shown that the taxonomy of host plants, the identity of the fungal species/strains and the source (origin) of the endophytes contribute significantly to the outcome of endophyte-plant interactions (Mayerhofer et al., 2013). In Kenya, Basmati 370, IR279380-1, Nerica and Supa are among the most cultivated varieties. However, the cultivation of these varieties has been threatened by diseases such as blast caused by the fungus M. oryzae (Kihoro et al., 2013) and plant-parasitic nematodes (Kariaga and Agama, 1994). A cheap and environmentally benign method is required, of which endophytes have a great potential.

Moreover, the mode of action of most endophytic fungi in plant growth, tolerance and defence responses has not been studied in detail. Generally, it has been argued that fungal endophytes modulate hormone levels in plants, which may affect the expression of stress-responsive genes as well as genes involved in nutrient uptake and metabolism. For instance, inoculation of rice with the endophytic fungus H. oryzae (strains R5-6-1 and RC-3-1) modulates the salicylic acid pathway through the OsWRKY45-dependent branch to suppress disease symptoms caused by M. oryzae (Su et al., 2013). Inoculation of rice with the endophytic fungus P. liquidambari up- regulates genes involved in N-uptake and metabolism, especially under low N-levels (Yang et al., 2014b).

The goal of this dissertation was to identify endophytic fungi that can promote rice growth and/or induce its resistance to plant-parasitic nematodes. Specifically we aimed to:

1. Perform a survey to determine the presence of plant-parasitic nematodes of rice in Kenya.

2. Analyse endophytic fungi of rice from irrigated and upland ecosystems in Kenya.

3. Evaluate the effect of selected endophytic fungi on growth of rice plants.

4. Evaluate the ability of selected endophytic fungi to promote rice defence against nematodes. 1.1 Thesis outline

This dissertation includes a literature review (chapter 2) that gives the state of the art information of rice nematodes and beneficial organisms (endophytes). The role of different hormones in rice defence against nematodes and pathogenic fungi or bacteria is described, along with the impact of fungal inoculation on hormone modulations in plants.

In chapter 3, morphological, morphometric and molecular analyses were applied to identify species of plant-parasitic nematodes present in rice in Kenya. The primary hypotheses of this chapter were (i) nematodes are abundant in irrigated ecosystems practising monocropping, but few in upland ecosystems where crop rotations are practised, (ii) local Kenya rice cultivars are susceptible to nematode infections and (iii) soil characteristics such as pH, organic carbon, nitrogen and phosphorus affect the abundance and distribution of plant-parasitic nematodes in the rice ecosystems. In Kenya, rice has been cultivated in both irrigated and upland ecosystems since 1907.

Chapter 4 provides information about endophytic fungi in different rice ecosystems in Kenya by answering the questions on how the composition of these endophyte populations differs between the irrigated and upland ecosystems; how the ecosystems affect isolates of endophytic fungal species and also to which taxonomic groups these endophytic fungi belong. Considering the fact that irrigated rice is continuously under water from transplanting to harvesting, it was hypothesised that irrigated rice was not colonised by endophytic fungi. Moreover, the monocropping system that was commonly practised in irrigated ecosystems was speculated to result in low fungal diversity. The aerobic conditions in upland ecosystems were hypothesised to favour more fungal growth and diversity.

In chapters 5, 6 and 7, the following hypotheses were tested (i) some root endophytic fungi isolated from rice in Kenya can promote rice growth and defence against nematodes, (ii) resistance induced by endophytic fungi influence hormone signalling pathways, (iii) rice genotypes react differently to fungal inoculation and (iv) the effects of endophytic fungi on growth of plants is concentration-dependent.

In the final chapter 8, general discussion, conclusion and future perspectives of this work are covered.

Chapter 2

2.0 General introduction

The two species of cultivated rice are Oryza glaberrima (African rice) and Oryza sativa (Asian rice) (Linares, 2002). Domestication of O. glaberrima from the wild progenitor O. barthii (formally known as O. brevilugata) occurred some 2,000-3,000 years ago in the floodplains of the river Niger of Sub-Saharan Africa (Portères, 1976). Two sub-species of O. sativa have been identified namely japonica and indica. Available information indicates that japonica and indica were domesticated at different times in China (Crawford and Shen, 1998; Zhijun, 1998). Others have suggested that japonica rice was first domesticated in Southern China and then crossed with O. rufipogon in South and Southeast Asia to generate indica rice (Huang et al., 2012). Through evolution and successive breeding, O. sativa varieties are further sub-divided into five genetically distinct sub-groups. These sub-groups include indica, aus, aromatic, temperate japonica and tropical japonica (Garris et al., 2005; Kovach et al., 2007; Sang and Ge, 2007). O. glaberrima is tolerant to biotic and abiotic stresses such as drought, soil acidity and iron or aluminium toxicity as well as weeds (Brar et al., 1997). The New Rice for Africa (NERICAs) have been developed by crossing O. glaberrima (e.g. accession CG14) with Asian rice (Jones et al., 1997). In Kenya, the most common rice varieties are Basmati 370, IR279380-1, Supa and Nerica. Except for Nerica, the other three rice varieties belong to the Asian rice group.

As an annual plant, rice takes 3-4 months to complete its life cycle. During this period rice goes through three distinct growth stages (Fig. 2.1): the vegetative stage (germination to panicle initiation), the reproductive stage (panicle initiation to flowering) and ripening (flowering to mature grain). The duration of each growth stage depends on the rice variety. For instance, the rice variety IR64, which matures in 110 days, has a 45-day vegetative stage, whereas the rice variety IR8, which matures in 130 days, has a 65-day vegetative stage (http://www.knowledgebank.irri.org/ericeproduction/0.2._growth_stages_of_the_rice_plant.htm). In analysing rice for resistance (i.e. ability to repress pathogen reproduction) to pathogens, the vegetative tissues are important, while reproductive tissues are informative when analysing plant tolerance to biotic and abiotic stress factors (Gheysen, personal communication).

<------Vegetative stage------>

<-Reproductive stage-> <-Ripening stage->

Fig. 2.1 The growth stages of the rice plant from seeding to maturity. Adapted from http://www.knowledgebank.irri.org/ericeproduction/0.2._growth_stages_of_the_rice_plant.htm). Rice is cultivated in irrigated, deepwater, lowland and upland ecosystems (Bridge et al., 2005). Irrigated ecosystems are common in Asia, while upland ecosystems are more prevalent in Africa (Seck et al., 2012), except for a few countries like Kenya where both irrigated (Fig. 2.2) and upland (Fig. 2.3) ecosystems are found (Muhunyu, 2012). Rice was introduced in Kenya in 1907 from Asia (Ouma-Onyango, 2014).

Fig. 2.2 An irrigated rice field located in Ahero, Kenya. The red arrow on the picture shows the boundary between block A and B. Rice is irrigated from water delivered through a canal (white arrow). Photo by author.

Fig. 2.3 An upland rice field located in Busia, Kenya. Photo by author. Since then, irrigated rice has been cultivated in Mwea (Central Kenya), Ahero (Nyanza), West Kano (Nyanza) and Bunyala (Western Kenya) schemes (Fig. 2.4), that are managed by the National Irrigation Board (NIB), while upland rice has been cultivated in most parts of the country, especially in Siaya, Busia, Teso, Kwale, Kilifi and Tana River Counties. The Mwea irrigation (Figs. 2.4 and 2.5) scheme (12,140 hectares) is the largest in Kenya, with over 86% of the total irrigated rice produced there (Muhunyu, 2012). For decades, rice cultivation in Kenya has stagnated at 30,000 to 40,000 metric tonnes per year, despite an increase in cultivated area (Fig. 2.6). A number of constrains have been identified, among them diseases caused by pathogens and pests. Recently, more than 5,600 hectares of rice in Kenya were destroyed by the blast disease caused by the fungus M. oryzae (Kihoro et al., 2013).

Another study has shown that plant-parasitic nematodes, especially P. zeae, Ditylenchus sp., Criconemella sp., Hemicycliophora nyanzae, Xiphinema spp., Scutellonema spp. and Helicotylenchus spp. were present in soils from rice fields in Kenya (Kariaga and Agama, 1994). However, information on the status, distribution and the economic importance of these nematode species as parasites of rice in Kenya is scarce; nevertheless accumulating evidence has shown that they are among the most damaging nematode species of rice worldwide (Bridge et al., 2005; Castillo and Vovlas, 2007; Kyndt et al., 2014).

Fig. 2.4 Irrigation schemes in Kenya. 1 (blue arrow): Mwea; 2 (yellow arrow): Bura; 3 (red arrow): Perkerra; 4 (green arrow): Ahero; 5 (purple arrow): Bunyala and 6 (white arrow): west Kano. Rice is mainly cultivated in Mwea, Ahero, Bunyala and west Kano. In Perkerra irrigation scheme, onions, chillies, watermelon, pawpaw and cotton are the major cultivated crops, while in Bura irrigation scheme, maize and cotton are cultivated. Adapted from http://www.fao.org/docrep/008/v4050b/V4050B07.htm.

Fig. 2.5 The Mwea irrigation scheme of Kenya. More than 86% of irrigated rice in Kenya is cultivated in Mwea. It is also the largest scheme in terms of acreage (12,140 hectares). Adapted from Mutero et al. (2000).

35000 70000 30000 60000 25000 50000 20000 40000 15000 30000 10000 20000

Area cultivated (Ha) cultivated Area 5000 10000 0 0

1960 1965 1970 1975 1980 1985 1990 1995 2000 2005 2010 2015 tonnes) (metric area per Yield Years

Area cultivated (Ha) Yield per cultivated area (Metric tonnes)

Fig 2.6 Rice production in Kenya, estimates of the yield per cultivated area (Data obtained from FAOSTAT, 2016; http://faostat3.fao.org/download/Q/QC/E). Other important nematode parasites of rice are Heterodera spp. (cyst nematodes) and Meloidogyne spp. (root-knot nematodes), especially M. graminicola (Jones et al., 2013; Kyndt et al. 2014). The worldwide yield losses on rice due to plant-parasitic nematodes have been estimated to be about 10 to 25 percent annually (Bridge et al., 2005).

This dissertation will focus on root-knot and root-lesion nematodes, especially M. graminicola and P. zeae. M. graminicola has been extensively studied (Bridge et al., 2005; Nahar et al., 2011, 2013; Kyndt et al., 2014), and is a good reference nematode for studying rice-nematode interactions. Moreover, M. graminicola is a major threat of rice cultivation worldwide (Mantelin et al., 2016), and has recently been detected for the first time in rice in Madagascar and Africa as whole (Chapuis et al., 2016).

2.1 The root-knot nematode Meloidogyne graminicola

M. graminicola causes serious problems in lowland, upland and deepwater rice (Bridge et al., 2005). It is omnipresent in South and Southeast Asia. In Africa, studies have indicated its presence in South Africa, although in a different host plant than rice (Kleynhans, 1991), and recently in rice in Madagascar (Chapuis et al., 2016). According to Bridge and Page (1982), M. graminicola completes its life cycle in less than 3 weeks at 22-29C in Bangladesh. In the USA, a single life cycle requires between 25 to 27 days at 26°C (Yik and Birchfield, 1979), while in India, up to 51 days may be required for a single life cycle (Rao and Israel, 1979). The differences in lifecycles are partly caused by nematode populations, host plants and growing conditions (Jain et al., 2012). In rice, infection of M. graminicola occurs at the root elongation zone, where the juveniles (J2) penetrate and migrate intercellularly towards the root tip and then make a U-turn to the vascular cylinder where they form permanent feeding sites consisting of several giant cells. The root cells form nutrient sinks where the nematodes develop from J2 through J3 and J4 to adult, which lay eggs within the root cortex (Fig. 2.7; Kyndt et al., 2014).

Fig. 2.7 Different groups of rice nematodes (adapted from Kyndt et al., 2014). J2,-second stage juveniles; J3,-third stage juveniles; J4,-fourth stage juveniles. The symbols ♂ and ♀ represent male and female nematodes. The newly hatched J2 infect the same root or migrate to new locations. Symptoms of M. graminicola infection include yellowing, stunting, reduced tillering, delayed maturation and the characteristic hook-like galls at root tips (De Waele and Elsen, 2007; Kyndt et al., 2014). Yield losses caused by M. graminicola range from 20-80% and 11-73% in upland and in simulation of intermittently flooded conditions in the Philippines, respectively (De Waele and Elsen, 2007). However, severe damage occurs in absence of flooding conditions such as aerobic upland and drought-prone, lowland rain-fed conditions (Bridge et al., 2005; Soriano and Reversat, 2003; Padgham et al., 2004). Under flooded soil conditions, the juveniles cannot penetrate the roots but

11 remain viable for at least five months, and can only re-infect the roots after subsidence of the flood conditions (Bridge and Page, 1982). Apart from rice, M. graminicola can infect other cereal crops, grasses and dicot plants, including many weeds that are common in rice fields. The nematode can survive between rice cropping seasons in these alternative hosts (Bridge et al., 2005; Rich et al., 2008).

2.2 The root-lesion nematode Pratylenchus zeae

Pratylenchus species are third after root-knot and cyst nematodes in terms of distribution and economic importance (Castillo and Vovlas, 2007; Jones et al., 2013). They have a wide host range, although some species may show preferences to particular hosts. They are less specialised in feeding, often showing „hit and run‟ parasitic lifestyles. The migratory root-lesion nematode P. zeae causes serious problems in upland rice (Castillo and Vovlas, 2007). Studies have indicated its presence in Australia, Belize, Benin, Cuba, Cameroon, Guinea, Togo, India, Indonesia, Ivory Coast, Nigeria, Philippines and South Africa (Castillo and Vovlas, 2007).

P. zeae takes about 30 days to complete its life cycle, where reproduction is mainly by parthenogenesis. The females lay eggs either singly or in small clusters. The first stage-juveniles (J1) develop in the eggs, and then moult into J2, J3, J4 and finally the adults (Fig. 2.8). All growth stages are vermiform and motile; feeding from one cell to another (Stirling, 1991; Jones and Fosu-Nyarko, 2014). Feeding occurs through mechanical probing and secretion of compounds and effectors from gland cells, chemosensory sensilla and amphids (Zunke, 1990; Perry, 1996; Reynolds et al., 2011). Unlike the root-knot nematodes which form characteristic galls (feeding sites) on the host, symptoms of P. zeae infection are difficult to recognise. As a result the study of P. zeae and root-lesion nematodes in general has been neglected, despite these nematode species being serious pests of economic crops (Jones and Fosu-Nyarko, 2014).

According to experts, below-ground symptoms caused by this nematode include discolouration, distortion and necrosis of the roots, while above ground symptoms are stunting, chlorosis and wilting (Jones and Fosu-Nyarko, 2014; Kyndt et al., 2014). P. zeae has a wide host range, which include many cereal crops (e.g. maize) and weeds such as Dactylodenium aegyptium, Digitaria sanguinalis and Echinochloa crusgalli (Fortuner, 1976; Kimenju et al., 1998).

Fig. 2.8 A general life cycle of Pratylenchus spp. The first stage juvenile (J1) develops in the eggs to J2, which hatch and develop further to J3, J4 up to the adult. A total of four moults occur between J1 and adult. J1, first stage juvenile; J2, second stage juvenile; J3, third stage juvenile; J4, fourth stage juvenile; M1, first moulting stage; M2, second moulting stage; M3, third moulting stage and M4, fourth moulting stage. The symbols ♂ and ♀ represent male and female nematodes (Adapted from Jones and Fosu-Nyarko, 2014).

2.3 Management practices of rice nematodes

The root-knot nematode M. graminicola is difficult to manage as juveniles are able to remain viable under flooded conditions for several months and can re-infect rice roots after subsidence of water (Bridge and Page, 1982). Moreover, the nematode lays eggs inside the root cortex. These eggs hatch into second stage juveniles that re-infect the same roots or move to other locations (Kyndt et al., 2014). This lifestyle renders flooding infeasible for the management of M. graminicola. Flooding has also been criticised recently, especially with the rapid decline of water resources. Moreover, it may not be efficient to apply crop rotation to manage this nematode species based on its extensive host range including cereals, vegetables, pulses, fibre and fruit crops (Bridge et al., 2005; Rich et al., 2008). Carbofuran, a chemical nematicide, is effective in the control of M. graminicola (Prasad and Rao, 1985; Arayarungsarit, 1987; Rahman, 1991). However, this chemical is toxic to humans and animals and may have negative effects to the environment (Sikora and Fernandez, 2005). In the past, the migratory root-lesion nematode P. zeae has been managed through crop rotation with non-host crops such as legumes. Aung and Prot, (1990) achieved a 37% increase in rice yield by rotating rice with cowpea or mung bean as compared to cropping of rice with corn and sorghum. A crop rotation of sugarcane with sown

13 pasture has been shown to reduce the population of P. zeae (Pankhurst et al., 2005). Unfortunately, certain crop rotation systems that can reduce populations of particular nematode species may favour the reproduction of another species. For instance, cowpeas are non-host for P. zeae, but may be good hosts for M. graminicola (Dutta et al., 2012). Another approach of managing parasitic nematodes is by use of biological organisms, which include arbuscular mycorrhiza fungi (AMF) and endophytes. This thesis focuses on endophytic fungi.

2.4 Endophytic fungi

Plants are never alone, but grow in association with numerous fungi, bacteria and viruses. Some fungi have profound negative effects on their host and have been generally referred to as pathogens. However, there are those that exhibit asymptomatic colonisations, for part or their entire lifecycle. These fungi have been defined as endophytes (Rodriguez et al., 2009). However, classifying fungi into pathogens and endophytes is not very informative, because fungi have been shown to shift between pathogenic and endophytic lifestyles (Delaye et al., 2013), depending on the host genotypes (physiological and developmental stages), environmental conditions and mutation of essential fungal genes (Kogel et al., 2006; Fesel and Zuccaro, 2016; Schouten, 2016). For instance, the fungus Colletotrichum magna is a serious pathogen that causes anthracnose disease in cucurbit plants, but it can also occur as endophyte in various non-cucurbit plant species (Kogel et al., 2006). Moreover, mutation of a single allele (path-1) in C. magna causes a shift of lifestyle from pathogenic to endophytic. The mutants of C. magna have been shown to colonize cucurbit plants asymptomatically, with some even exhibiting mutualistic effects (Freeman and Rodriguez, 1993; Redman et al., 1999). These mutants can infect host plants that are either non-host (e.g. tomato) or resistant to its wild relative (Redman et al., 1999). In Epichloë festucae, mutation of the NoxA gene, which encodes an NADPH oxidase, causes a shift from mutualism to parasitism. Inoculation of Lolium perenne, with the mutant of E. festucae not only reduces growth but also cause early plant death (Kogel et al., 2006). Studies have shown that NoxA-mutants produce less reactive oxygen species (ROS) that hamper colonization and development of hyphae in plants (Kogel et al., 2006; Tanaka et al., 2006). Another study has found the fungus Diplodia mutila to be an endophyte of mature Iriartea deltoidea plants, but can cause disease in some young seedlings. The pathogenicity of the fungus on the seedlings was found to be triggered by light intensity. Under high light intensity, the fungus caused disease, whereas low light intensity promoted endophytism (Álvarez-Loayza et al., 2011). The high light intensity triggers the fungus to produce hydrogen peroxide (H2O2), which causes hypersensitivity, cell death and tissue necrosis in the plants (Álvarez-Loayza et al., 2011).

This thesis considers endophytic fungi (EF) as organisms residing asymptomatically inside the host plants including mutualistic, commensalistic, latent pathogens and latent saprotrophs (Porras-Alfaro and Bayman, 2011). Arbuscular mycorrhizal fungi (AMF) are separated from endophytic fungi as they are not entirely living inside the plant tissues (Brundrett, 2002; Porras- Alfaro and Bayman, 2011). Interestingly, both EF and AMF have been catalogued in most plant species including rice (Redecker et al., 2000; Arnold, 2007; Krings et al., 2007; Rodriguez et al.,

2009). Moreover, the effects of beneficial endophytic fungi (true endophytes) in plants mimic those of AMF.

Fungal endophytes have been broadly classified into clavicipitaceous (C-endophytes) and non- clavicipitaceous (NC-endophytes) groups (Table 2.1) according to phylogeny and life history traits (Rodriguez et al. 2009).

Table 2.1 Classification of endophytic fungi

Criteria Clavicipitaceous Non-Clavicipitaceous (Class 1) Class 2 Class 3 Class 4 Host range Narrow Broad Broad Broad Tissue(s) colonised Shoot and Shoot, root and Shoot Root rhizome rhizome In-planta colonisation Extensive Extensive Limited Extensive In-planta biodiversity Low Low High Unknown Transmission Vertical and Vertical and Horizontal Horizontal horizontal horizontal Fitness benefits* NHA NHA and HA NHA NHA *Non-habitat-adapted (NHA) benefits such as drought tolerance and growth enhancement are common among endophytes regardless of the habitat of origin. Habitat-adapted (HA) benefits result from habitat-specific selective pressures such as pH, temperature and salinity (adapted from Rodriguez et al., 2009). The C-endophytes also referred to as Class 1 or Balanciaceous endophytes, are commonly found within the genera Epichloë (anamorphs Neotyphodium) and Balansia (Schulz and Boyle, 2005). They mostly colonise temperate grasses (Leuchtmann et al., 2014), and are systematically distributed within shoots and rhizomes of their host plants (Table 2.1). For instance, the endophytic fungus E. festucae has been shown to grow intercellularly within the leaf tissues of its host, but can also occur on the leaf surface as an epiphyte (Fesel and Zuccaro, 2016). Moreover, Class 1 endophytes can be vertically transmitted through seeds or horizontally transmitted through mowing, grazing, water splashes and wind (Saikkonen et al., 2002; Gazis, 2012; Tadych et al., 2012; Oberhofer and Leuchtmann, 2014; Saikkonen et al., 2016). Although the majority of Class 1 endophytes have been linked with toxicity of animal feed, the fungus E. festucae produces several metabolites that can inhibit growth of pathogenic fungi such as Sclerotinia homeocarpa and Laetisaria fusiformis (Bonos et al., 2005; Clarke et al., 2006; Rodriguez et al., 2009). Conversely, Cheplick (2007) has found that colonisation of E. festucae var. lolii in L. perenne reduces the root-shoot ratio and the photosynthetic potential of the plants, which may eventually cause poor growth.

The NC-endophytes are further divided into three different groups (Class 2, 3 and 4) based on their host colonisation patterns, mechanisms of transmission, in-planta biodiversity and ecological functions (Table 2.1; Rodriguez et al., 2009). Class 2 endophytes occur extensively in both roots, shoots and rhizomes, but are less diverse in-planta. They are transmitted vertically within their host through seed coats, seeds and rhizomes or horizontally through spores. Unlike other classes of non-clavicipitaceous endophytes, class 2 endophytes promote habitat-specific

(HA) stress tolerance in their host plants (Rodriguez et al., 2008). The majority of Class 2 endophytes belong to the Ascomycota, especially within the Pezizomycotina, but there are few examples of Basidiomycota fungi in the Agaricomycotina and Pucciniomycotina subgroups (Rodriguez et al., 2009). Among the most important members of Class 2 endophytes are Phoma spp., Mycophycia ascophylli, Arthrobotrys spp., F. culmorum, C. magna and C. protuberata (Rodriguez et al., 2008). Most Class 2 endophytes can be pathogenic, e.g. Phoma spp., but there are those that are non-pathogenic and can even be mutualistic (Rodriguez et al., 2009). For instance, the fungi F. culmorum strain FcRed1 and two strains of C. protuberata (Cp4666D and CpYNP5C) have been shown to enhance tolerance of rice to drought, cold or salt stresses (Redman et al., 2011).

Class 3 endophytes occur exclusively in plant shoots and have very localised colonisations (Table 2.1). They are highly diverse, with studies indicating up to 20 different species occurring in a single leaf of a tropical plant (Arnold et al., 2003). Most members of Class 3 endophytes are pathogenic to their host plants. For instance, the fungus Ustilago maydis is a serious pathogen of maize. Other species however, are beneficial to their host. A classical example of a beneficial member of Class 3 endophytes is C. tofieldiae (Fesel and Zuccaro, 2016).

The Class 4 endophytes are restricted to the roots (Table 2.1). They show extensive colonisation patterns, forming the heterogeneous group of dark septate endophytes (DSE), named so because of the presence of darkly melanised septa in roots. The fungus Harpophora oryzae (strain R5-6-1 and RC-3-1), a member of DSE, readily colonise rice plants and promote growth or defence responses to the blast fungus M. oryzae (Su et al., 2013). In general, most endophytic fungi are horizontally transmitted among different hosts via spores, with studies showing their transmission largely influenced by air current, rain splashes and insect vectors (Bayman et al., 1998; Arnold and Herre, 2003; Santamaria and Bayman, 2005; Saunders et al., 2010).

Endophytes may be similar to pathogens. For instance, a comparison of the endophytic fungus H. oryzae and its close pathogenic relative M. oryzae showed similar genome structures, suggesting that endophytes could have originated from pathogenic ancestors (Xu et al., 2014). However, they may differ from pathogens during interactions with the host plants. These differences may relate to their colonisation patterns, gene regulations, induction of defence responses, signal transduction and nutrient preferences (Xu et al., 2014). For instance, the endophytic fungus H. oryzae exclusively colonises rice roots where it penetrates through the epidermis to the cortex without colonising the stele, whereas the pathogenic fungus M. oryzae invades the root vascular tissues and spreads systematically within the host plant (Fig. 2.9; Xu et al., 2014).

Fig. 2.9 Colonization of rice roots by H. oryzae and M. oryzae. (a) Non-germinating phialospores of H. oryzae. (b) Germinating phialidic conidia of H. oryzae. (c) Appressorium formed by H. oryzae on a rice leaf surface. (d-i) indicate the process of colonization by H. oryzae. (d) Proliferation of runner hyphae on the root surface at 2 days after inoculation (DAI2). (e) Hyphopodia formation (arrow) on the surface of rhizodermis followed by intracellular penetration of rhizodermal cells at DAI2. (f) Invasive hyphae (IH) are strictly confined to certain epidermal cells at DAI4. (g) Growth of H. oryzae is visible in the epidermal cells at DAI4. (h) Colonization of cortical cell layers by H. oryzae at DAI6. (i) No IH are detected in vascular tissues at DAI20. (j-m) indicate the process of colonization by M. oryzae. The conidia of M. oryzae germinate (j) and produce IH (k) within DAI2. Growth of M. oryzae is visible in the epidermal cells at DAI4 (l). Vascular tissues are colonized by the IH of M. oryzae at 6 DAI (m). Bars, 20 μm (Adapted from Xu et al., 2014).

Endophytes were first studied in temperate plants, but recent studies have been extended to tropical plants, with results showing a greater diversity of endophytes in tropical plants than in temperate plants (Arnold and Lutzoni, 2007). A large number of endophytes have been catalogued from rice plants through culture-dependent and –independent analyses, although the majority of them have not been analysed in-planta to determine their effect on plant health (Le et al., 2009; Yuan et al., 2010). Available data from endophytes analysed in-planta shows that they have the capacity to increase root and shoot biomass, increase yield and increase tolerance/resistance to abiotic and biotic stress factors. Among the proposed mode of actions of endophytes in growth and defence are nitrogen uptake and metabolism, phosphorus solubilisation, hormone production and defence gene activation (Le et al., 2009; Yadav and Tafafdar, 2011; Su et al., 2013; Yang et al., 2014b).

However, the outcome of the endophyte-plant interactions is influenced by the host genotypes, the physiological conditions of the host, nutrient availability, environmental conditions and the presence of other microorganisms (Porras-Alfaro et al., 2011; Fesel and Zuccaro, 2016). Currently, there are no direct rules to predict the directionality of the plant-endophyte interactions along the mutualistic-parasitic continuum (Arnold, 2007). Understanding the genetic basis of these interactions is of great importance in interpreting the functional roles of these endophytes in the ecosystems. The knowledge of fungal endophytes capable of forming symbiosis with rice in African countries, especially Kenya is scarce. Table 2.2 shows examples of endophytic fungi with ability to promote growth and/or disease resistance in rice.

2.5 Plant-microbe interactions

In nature, plants interact with highly diverse microbial communities. Some micro-organisms are detrimental, but others like true endophytes are mutualistic (van Wees et al., 2008). Plants detect either beneficial or pathogenic organisms using Pattern Recognition Receptors (PRRs), which are located at the plant plasma membrane, either as Receptor-Like Kinases (RLKs) or Receptor- Like Proteins (RLPs) (Trdá et al., 2015). Examples of PRRs are FLS2 (LRR-RLK FLAGELLIN- SENSITIVE 2) that binds to flg22 of bacterial flagellin to detect bacterial invasion in Arabidopsis (Gomez-Gomez and Boller, 2000; Chinchilla et al., 2006; Sun et al., 2013). FLS2 orthologs have been found in other plant species such as rice (Takai et al., 2008). EFR (LRR-RLK ELONGATION FACTOR-TU (EF-Tu) RECEPTOR) is another example of PRR that perceives bacterial EF-Tu and its peptide elf18 (Zipfel et al., 2006). The LysM-RLK receptor binds to chitin to detect fungal infection. In rice, the OsCERK1/CHITIN ELICITOR-BINDING PROTEIN (CEBiP) is one of the best studied chitin-related PRR (Kaku et al., 2006; Miya et al., 2007; Shimizu et al., 2010). Plants initially recognize both pathogenic and beneficial organisms as harmful invaders. After recognition, plants activate defence responses. However, unlike for pathogenic organisms, the defence responses against beneficial organisms are weak, transient and strictly localized (Gianinazzi-Pearson, 1996; Verhagen et al., 2004; De Vos et al., 2005; Liu et al., 2007). In plant- AMF interactions for instance, defence responses are suppressed at later stages of symbiosis. Importantly, 40% of AMF-responsive genes have been shown to also respond to pathogen

18 infection in plants, suggesting an overlap of plant responses to beneficial and pathogenic organisms (Güimil et al., 2005).

Table 2.2 Endophytic fungi associated with rice and their beneficial activity.

Fungal Original host Study host (rice Substrate Growth conditions: Beneficial activity Reference species/strain cultivar) temperature/light Fusarium Coastal grass M-206 (subspecies Mixture of silica 26°C with 14 hour Plant growth promotion and Redman et al., culmorum strain (Leymus mollis), Japonica) and sand layer and light cycle (growth biomass accumulation, 2011 FcRed1 Redman et al., Dongjin (subspecies water agar (growth chamber) or 26-30°C increased yield and 2002) Indica) chambers), with 12 hour enhanced tolerance to salt soil/sand fluorescent light and drought stresses as well (greenhouse) regime (greenhouse) as improved water consumption Curvularia Coastal grass M-206 (subspecies Mixture of silica 26°C with 14 hour Plant growth promotion and Redman et al., Protuberata (Dichanthelium Japonica) and sand layer and light cycle (growth biomass accumulation, 2011 strains Cp4666D lanuginosum), Dongjin (subspecies water agar (growth chamber) or 26-30°C enhanced tolerance to Redman et al., Indica) chambers), with 12 hour drought and cold stresses 2002) soil/sand fluorescent light as well as improved water (greenhouse) regime (greenhouse) consumption Curvularia Coastal grass M-206 (subspecies Mixture of silica 26°C with 14 hour Plant growth promotion and Redman et al., Protuberata (Dichanthelium Japonica) and sand layer and light cycle (growth enhanced tolerance to 2011 strains CpYNP5C lanuginosum), Dongjin (subspecies water agar (growth chamber) or 26-30°C drought and cold stresses Redman et al., Indica) chambers), with 12 hour as well as water 2002) soil/sand fluorescent light consumption (greenhouse) regime (greenhouse) Fusarium Rice cultivar BR11 Mixture of sterilised 28°C with 12 hour Enhance plant resistance to Le et al., 2009 moniliforme strain BR11, Le et al., sand and silt loam light the root-knot nematode M. Fe1 2009 graminicola, but no effect on plant growth. Fusarium Rice cultivar BR11 Mixture of sterilised 28°C with 12 hour Plant growth promotion and Le et al., 2009, moniliforme strain BR11, Le et al., sand and silt loam light enhanced resistance 2016 Fe14 2009 against the root-knot nematode M. graminicola Fusarium sp. Rice cultivar BR11 Mixture of sterilised 28°C with 12 hour Enhanced plant resistance Le et al., 2009 strain Fe24 BR11, Le et al., sand and silt loam light against the root-knot 2009 nematode M. graminicola, but no effect on plant growth. Fusarium sp. Rice cultivar BR11 Mixture of sterilised 28°C with 12 hour Plant growth promotion and Le et al., 2009

20 strain Fr28 BR11, Le et al., sand and silt loam light enhanced resistance 2009 against the root-knot nematode M. graminicola Fusarium sp. Rice cultivar BR11 Mixture of sterilised 28°C with 12 hour Enhanced plant resistance Le et al., 2009 strain Fr29 BR11, Le et al., sand and silt loam light against the root-knot 2009 nematode M. graminicola, but no effect on plant growth. Fusarium sp. Rice cultivar BR11 Mixture of sterilised 28°C with 12 hour Reduced plant growth but Le et al., 2009 strain Fe32 BR11, Le et al., sand and silt loam light no effect on plant 2009 resistance to the root-knot nematode M. graminicola Fusarium sp. Rice cultivar BR11 Mixture of sterilised 28°C with 12 hour No effect on plant growth Le et al., 2009 strain Fr18 BR11, Le et al., sand and silt loam light and resistance to the root- 2009 knot nematode M. graminicola Fusarium sp. Rice cultivar BR11 Mixture of sterilised 28°C with 12 hr of No effect on plant growth Le et al., 2009 strain Fe15 BR11, Le et al., sand and silt loam supplemental light and resistance to the root- 2009 knot nematode M. graminicola Fusarium sp. Rice cultivar BR11 Mixture of sterilised 28°C with 12 hour No effect on plant growth Le et al., 2009 strain Fe9 BR11, Le et al., sand and silt loam light and resistance to the root- 2009 knot nematode M. graminicola Phomopsis Inner bark of Wuyunjing 7 Paddy soil (loam) 29/25°C day/night Plant growth promotion, Yuan et al., liquidambari strain Bischofia and a photoperiod of enhanced yield, improved 2007b; Yang et B3 polycarpa, Shi et 16 hour nitrogen accumulation and al., 2014a al., 2004 nitrogen use efficiency Harpophora Chinese wild rice CO-39 Murashige and 24/22°C with a 16-h- Promote rice growth and Yuan et al., oryzae strain R5- (O. granulata), Skoog (MS) light/8-h-dark biomass accumulation as 2010; Su et al., 6-1 Yuan et al., 2010 photoperiod well increased resistance to 2013 M. oryzae Harpophora Chinese wild rice CO-39 Murashige and 24/22°C with a 16-h- Promote rice growth and Yuan et al., oryzae strain RC- (O. granulata), Skoog (MS) light/8-h-dark biomass accumulation as 2010; Su et al., 3-1 Yuan et al., 2010 photoperiod well increased resistance to 2013 M. oryzae

Piriformospora Prosopis juliflora Khumal-4 sterilised soil - Enhanced plant growth and Prajapati et al., indica and Zizyphus biomass accumulation 2008 nummularia Pusa Basmati-1 Sand 30±2°C, 70% relative Enhanced plant growth and Jogawat et al., Verma et al., 1998 humidity, 16 hour improved salt tolerance 2013 photoperiod IARI Sand 30±2°C, 70% relative Enhanced plant growth and Jogawat et al., humidity, 16 hour improved salt tolerance 2013 photoperiod Talaromyces sp. Rice Tateishi et Tangin-bouzu Sterile soil 30°C, 100% relative Enhanced resistance to Kato et al., strain KNB422 al., 2006 humidity, 16 hour Fusarium fujikuroi 2012 photoperiod Fusarium moniliforme is currently known as F. verticillioides and belongs to the F. fujikuroi species complex, however, in this thesis; F. moniliforme will be applied as described in the referred references.

This thesis focussed on Piriformospora indica (syn. Serendipita indica), Fusarium spp. and Talaromyces spp. The choice of the endophytes was based on the literature available and also on their ability to sporulate and form inoculum. P. indica was selected because it is a model endophytic fungus for studying root symbiotic interactions. Species within the genera Fusarium and Talaromyces are among the most abundant and cosmopolitan microorganisms in the soil. Some species e.g. the non-pathogenic F. oxysporum (strain Fo162 and Fo47) have been widely studied and shown to benefit their host plants. Talaromyces sp. strains KNB422 is commercially marketed in Japan as a biocontrol agent of fungal pathogens. P. indica and species within Fusarium and Talaromyces genera sporulate well in PDA medium, and form enough inoculum within weeks. Detailed descriptions of these fungal species are presented in the following paragraphs.

2.5.1 The Serendipitaceae fungus Piriformospora indica

P. indica is a culturable and model endophyte with a broad host range (Verma et al., 1998; Varma et al., 1999; Jogawat et al., 2013; Das et al., 2014). It belongs to the order Sebacinales (Agaricomycetes, Basidiomycota). P. indica was originally isolated from the plants P. juliflora and Z. nummularia in the Thar Desert of India (Verma et al., 1998). Root colonisation by P. indica follows a similar pattern to that shown by H. oryzae and E. festucae (Fig. 2.10 a, c and d).

Fig. 2.10 Colonisation patterns of (a) Sebacinoid root endophytes e.g. P. indica (b) C. tofieldiae (c) H. oryzae and (d) E. festucae. During root colonisation, Sebacinoid root endophytes (P. indica), H. oryzae and E. festucae penetrate the host from the epidermis to the cortex but not the stele. C. tofieldiae can colonise the vascular cylinder and may be distributed within the host tissues systematically (Adapted from Fesel and Zuccaro, 2016). The fungus can colonise plants from the epidermis to the cortex without penetrating the stele (Fig. 2.10a). Unlike E. festucae, but similar to H. oryzae, P. indica can only colonise the roots. During early root colonisation stages, P. indica forms multilobed and bulbous hyphae, which

23 proliferate as the root tissue matures. Extensive proliferation of the hyphae causes cell death (Fig. 2.10 a). A recent genome analysis has shown massive expansion of genes encoding proteins and hydrolysis activities as well as genes with carbohydrate binding properties (Fesel and Zuccaro, 2016).

Like arbuscular mycorrhizal fungi (AMF), P. indica promotes growth and induces defence responses against nematodes and fungal pathogens. Recently, Bajaj et al. (2015) have shown that soil amended with 2.5% and 5% mycelia of P. indica had 29.7% and 36.7% fewer eggs of the soybean cyst nematode Heterodera glycines, respectively. In Arabidopsis, P. indica reduced the infection, development and reproduction of the cyst nematode H. schachtii (Daneshkhah et al., 2013). P. indica can also reduce the infection of the fungal pathogens F. culmorum and Blumeria graminis f sp. hordei in barley (Waller et al., 2005). In wheat, P. indica was shown to reduce disease symptoms caused by F. culmorum, Pseudocercosporella herpotrichoides and B. graminis (Deshmukh and Kogel, 2007; Serfling et al., 2007).

Moreover, inoculation of rice with P. indica has been shown to promote plant growth and yield (Table 2.2; Prajapati et al., 2008; Jogawat et al., 2013). In Coleus forskohlii, a medicinal plant, inoculation of P. indica caused early flowering, improved biomass and secondary metabolites (Das et al., 2012). Barley plants inoculated with P. indica showed improvement of biomass and grain yield (Waller et al., 2005; Achatz et al., 2010). Tomato plants inoculated with P. indica showed improvement of fruit biomass and plant dry weight (Fakhro et al., 2010). In Chinese cabbage, inoculation of P. indica improved growth rate of shoots and roots. Indeed P. indica has been constantly shown to benefit the host by being a good bio-regulator and bio-fertilizer. It also improves tolerance to water stress (dehydration), acidity, desiccation and heavy metal toxicity. Furthermore, P. indica protects plants from numerous pests, prolongs aging of callus tissues as well as improves nutritive value of the plants (Deshmukh et al., 2006; Kumar et al., 2009; Oelmüller et al., 2009; Yadav et al., 2010; Dolatabadi et al., 2011).

2.5.2 Talaromyces/Penicillium species

The genus Talaromyces was first described by Benjamin in 1955 as a sexual state (teleomorphic) of Penicillium. Members of this genus produce soft walled ascocarp or cleistothecium, which are covered by interwoven hyphae (Yilmaz et al., 2014). Talaromyces species form a distinct clade from species of other subgenera of Penicillium (Samson et al., 2011). Together with Penicillium species, Talaromyces species belong to the order Eurotiales. They are among the most abundant and cosmopolitan fungi in soils. Talaromyces species are medically and agricultural important. For instance, the endophytic fungus Talaromyces sp. (KNB422) was isolated from rice seedlings and is registered as bio-fungicide of seed-borne pathogens of rice in Japan (Kato et al., 2012). Naraghi et al. (2012) have shown that different isolates of T. flavus can promote growth of cotton and potato. Other isolates of T. flavus have demonstrated antagonistic effects on different fungal pathogens (Marois et al., 1982; Tjamos and Fravel, 1997; Miyake et al., 2012).

Recently, P. purpurogenum (syn. T. purpurogenus) was found to promote biomass (30%) and root length (21%) of pearl millet (Pennisetum glaucum L.) likely through phosphorus solubilisation

(Yadav and Tafafdar, 2011). Moreover, P. purpurogenum produces lytic enzymes (β-1, 3- glucanase and chitanase) that antagonise the pathogenic fungi Monilinia laxa and F. oxysporum f. sp., lycopersici (Larena and Melgarejo, 1996). Tomato plants inoculated with P. janthinellium (LK5) showed improvement of growth and salt tolerance (Khan et al., 2013). Murali et al. (2013) have found that P. chrysogenum (PenC-JSB9) can enhance seed germination, root length, shoot length and reduce disease incidence of pearl millet. The isolates NICS01 and DFC01 of Penicillium sp. produce different amino acids, which enhance root weight, shoot weight and dry weight of sesame (Sesamum indicum L.) plants (Radhakrishnan et al., 2014).

2.5.3 Fusarium species

Members of the genus Fusarium (order Hypocreales, class Sordariomycetes), especially F. oxysporum are among the most ubiquitous soil-borne microorganisms. Although most strains are pathogenic, grouped in formae speciales based on their host plants species, some strains are non-pathogenic exhibiting endophytic lifestyle, capable of protecting their host against biotic and abiotic stress (Schouten, 2016). Endophytic isolates of F. oxysporum have been described in more than 100 plant species worldwide (Kuldau and Yates, 2000). Hallmann and Sikora (1994) isolated the endophytic strain Fo162 of the fungal species F. oxysporum from tomato in Kenya. In Uganda, the strains V5w2, Eny1.31i and Eny7.11o of F. oxysporum were isolated from healthy banana plants (Schuster et al., 1995). Fe14, another strain of F. oxysporum was isolated from rice (Le et al., 2009). The endophytic F. culmorum strain FcRed1 was isolated from the coastal grass L. mollis (Redman et al., 2011). Apart from plant tissues, strains of Fusarium spp. have also been isolated from other substrates such as soil and litter. These strains, often referred to as non-pathogenic, are able to infect and colonise plants asymptomatically as endophytes (Kuldau and Yates, 2000). Toussoun (1975) and Schneider (1984) have hypothesised that suppressive soils contain large numbers of non-pathogenic Fusarium spp. Indeed these soils have been found to contain high populations of F. oxysporum and F. solani (Louvet et al., 1976); with the strain Fo47 of F. oxysporum being one of the most efficient biocontrol agents recovered so far (Alabouvette, 1986).

In table 2.3, some endophytic strains of F. oxysporum strains tested for growth and defence responses on different plant species (cultivars) other than rice are listed.

Table 2.3 List of endophytic Fusarium oxysporum strains and their effects on different plant species (cultivars) other than rice

Fusarium Original Study host Method of Pathogen Bio-control Growth Mode of Media and In-vivo References oxysporum host and and cultivar application controlled activity promotion actions growth conditions strain country activity conditions F. oxysporum Banana, Banana cv. Soil Radopholus Reduced Not tested Induced Mixture of soil Glasshouse Vu et al., strain A1 Indonesia, Grand Naine drench similis penetration systemic and sand, conditions 2006 reported in resistance 23±2°C, 60-70 Vu et al., humidity with 2006 16 hr of light F. oxysporum Tomato, Banana cv. Soil Radopholus Reduced Not tested Induced Mixture of soil Glasshouse Vu et al., strain Fo162 Kenya; Grand Naine drench similis penetration systemic and sand, conditions 2006 Hallman resistance 23±2°C, 60-70 and Sikora, humidity with 1994 16 hr of light Banana cv. Soil Meloidogyne Reduced Not tested Not tested Mixture of soil Glasshouse Mendoza Grand Naine drench incognita densities and sand, conditions and Sikora, 28±1°C, 60-70 2009 humidity with 16 hr of light Squash and Soil Meloidogyne Reduced An increase Not tested Mixture of clay, Climate Menjivar et Melon drench incognita race penetration in fresh silt and sand, chamber al., 2011 3 shoot 27±5°C with 13 weight of hr of light squash Tomato cv. Soil Meloidogyne Reduced Increase in Not tested Sand Greenhouse Diedhiou et Rheinlands drench incognita number of shoot dry conditions al., 2003 Ruhm galls weight Tomato cv. Soil Meloidogyne Reduced Not tested None Mixture of soil Greenhouse Dababat Hellfrucht drench incognita penetration and sand, conditions and Sikora, Frühstamm and 22°C±5 with 2007 development 16 hr of light Tomato cv. Soil Meloidogyne Reduced Not tested Not tested Mixture of soil Greenhouse Martinuz et Moneymaker drench incognita penetration, and sand, al., 2013 reproduction 27°C±3 with and 16 hr of light

development Tomato cv. Soil Meloidogyne Reduced Not tested Not tested Mixture of soil Greenhouse Dababat et Florida 91 drench incognita penetration and sand, conditions al., 2008 (xP 10091), and gall 22°C±5 with Sunguard formation 16 hr of light (xP 10089), P48024, P28026 and Hellfrucht Frühstamm Tomato cv. Soil Meloidogyne Reduced Not tested Induced Mixture of soil Greenhouse El-Fattah et Frühstamm drench incognita penetration systemic and sand, condition al., 2007a and resistance 22±5°C with formation of 16 hr of light galls Tomato cv. Soil Meloidogyne Reduced No effect Induced Mixture of soil Glass house El-Fattah et Frühstamm drench incognita penetration on plant systemic and sand, conditions al., 2007b and growth resistance 22±5°C with reproduction 16 hr of light Squash cv. Soil Aphids (Aphis Reduced Not tested Induced Mixture of soil Growth Martinuz et Eight Ball drench gossypii) number of systemic and sand, chamber al., 2012 (Cucurbita aphids resistance 25±3°C, 60-70 pepo) humidity with 16 hr of light F. oxysporum Banana, Banana cv. Soil Radopholus Reduced Not tested Induced Mixture of soil Glasshouse Vu et al., strain V5w2 Uganda; Grand Naine drench similis penetration systemic and sand, conditions 2006 Schuster et resistance 23±2°C, 60-70 al., 1995 humidity with 16 hr of light Banana cv. Inoculum Pratylenchus Reduced No effect Not tested Sandy loam Field Waweru et Grand Nain containin goodeyi, nematode on plant soil conditions al., 2014 and Giant g 2 g of Helicotylench densities growth, but Cavendish maize us and increase in bran multicinctus damage bunch weight and yield

Banana cv. Root dip Pratylenchus Reduced No effect Not tested Sandy loam Glasshouse Waweru et Grand Nain goodeyi nematode of plant soil conditions at al., 2013 and Giant densities growth 27°C and Cavendish and damage 12-h F. oxysporum Banana, Banana cv. Inoculum Pratylenchus Reduced No effect Not tested Sandy loam Field Waweru et strain Eny Uganda; Grand Nain containin goodeyi, nematode on plant soil conditions al., 2014 7.11o Schuster et and Giant g 2 g of Helicotylench densities growth, but al., 1995 Cavendish maize us and increase in bran multicinctus damage bunch weight and yield F. oxysporum Banana, Banana cv. Inoculum Pratylenchus Reduced No effect Not tested Sandy loam Field Waweru et strain Emb Uganda; Grand Nain containin goodeyi, nematode on plant soil conditions al., 2014 2.4o Schuster et and Giant g 2 g of Helicotylench densities growth, but al., 1995 Cavendish maize us and increase in bran multicinctus damage bunch weight and yield F. oxysporum Banana, Banana cv. Root dip Pratylenchus Reduced No effect Not tested Sandy loam Glass house Waweru et strain Kenya; Grand Nain goodeyi nematode of plant soil conditions at al., 2013 4MOC321 cited by and Giant densities growth 27°C and Waweru et Cavendish and 12-h al., 2013 damage F. oxysporum Banana, Banana cv. Root dip Pratylenchus Reduced No effect Not tested Sandy loam Glass house Waweru et strain 11SR23 Kenya; Grand Nain goodeyi nematode of plant soil conditions at al., 2013 cited by and Giant densities growth 27°C and Waweru et Cavendish and 12-h al., 2013 damage F. oxysporum Soil, Pepper cv. Root Verticillium Reduced No effect Induced Mixture of soil Greenhouse Veloso and strain Fo47 France; Padrón dip/soil dahliae and symptoms on plant resistance/ and perlite, condition Díaz et al., Alabouvette drench/ Phytophthora and growth completion 25°C with 16 hr 2012 et al., 1987 mycelia capsici damage (neutral) for of light plugs nutrients Tomato cv. Inoculum Fusarium Reduced Not tested Induced Hoagland Growth Aimé et al., Montfavet placed oxysporum f. colonisation resistance agar plates, chamber 2013 63-5 closer to sp. lycopersici of the 23°C (night)

the root race Fo18 pathogen and 25°C surface (day), with a night and day cycle of 8 and 16 h. Tomato cv. Soil Fusarium Suppression Not tested Systemic Rock wool, Glass house Duijff et al., Monalbo drench oxysporum f. of Fusarium induced 25°C (day) or sterile 1998 sp. lycopersici wilt resistance and 22°C cabinets (night), with 16 hr of light

2.6 Mode of action of endophytic fungi in plant growth promotion and defence responses

Endophytic fungi influence plant growth characteristics and defence. They improve water consumption, photosynthesis efficiency and enhance nutrient availability through phosphorus solubilisation, nitrogen metabolism/up-take and the production of hormones or other assimilates necessary for plant nutrition. They may reduce disease and pest pressure by activating plant defence pathways (Le Floch et al., 2003; Yang et al., 2014a).

2.6.1 Improved water consumption

Water is essential for plant growth, and a limiting factor in rice production. The majority of rice is cultivated in irrigated conditions, where rice fields are flooded from transplanting to harvesting. The water need for rice is almost two and half times the amount required to grow wheat or maize (Bouman, 2013). To reduce the over-dependency of water for rice production, some measures have been suggested to reduce water needs. This includes the System of Rice Intensification (SRI), which promotes intermittent wetting and drying of rice fields, mechanical aeration of soil, early transplanting of 8-15 day-old seedlings and wide spacing of rice plants (Uphoff and Kassam, 2009). Another approach is to use micro-organisms such as endophytes, with the capacity to reduce water consumption by plants. Examples of these endophytes are F. culmorum (strain FcRed1), and C. Protuberata (strains Cp4666D and CpYNP5C), which can reduce water consumption by up to 20-30% in rice (Table 2.2; Redman et al., 2011). These fungal isolates have also been shown to improve drought tolerance of rice by 7 to 9 days (Redman et al., 2011).

2.6.2 Nutrient acquisition

Nitrogen is of unequivocal importance in rice production worldwide, and the demand for N- fertilizer has increased dramatically over the past few decades. Plants absorb nitrogen inform of − + nitrate (NO3 ) or ammonium (NH4 ). The absorption process of these elements involves different + transporters. For instance, the OsAMT protein family is involved during the absorption of NH4 , − while the OsNRT is involved in the uptake of NO3 (Yang et al., 2014b). Rice colonisation by P. liquidambari strongly enhances the activities of these transporters, indicating a possible uptake of nitrogen (Yang et al., 2014b). In plants nitrogen is required for, among others, the synthesis of amino acids and secondary metabolites (Yang et al., 2014c). Nitrogen metabolism in plants is regulated by the nitrate reductase (NR) enzymes (Masclaux-Daubresse et al., 2010), while the glutamine synthetase (GS) enzymes regulate assimilation of ammonium (Xu et al., 2012). In rice, colonisation by the endophytic fungus P. liquidambari strongly increases the activities of these enzymes, especially under low N conditions (Yang et al., 2014a). N-uptake in rice is also regulated by OsAMT1;1, OsAMT1;3, OsAMT2;2, OsAMT3;2, OsAMT3;3 and OsNRT2;1 genes, while N-metabolism is a function of OsNR1, OsGS1, OsGS2 and OsNADH-GOGAT) genes (Yang et al., 2014b). Rice colonisation by P. liquidambari was shown to up-regulate these genes (Yang et al., 2014b). Moreover, the fungus P. liquidambari is indirectly involved in nitrogen fixation by increasing the abundance and composition of diazotrophs in rice rhizosphere soils

(Yang et al., 2014c). The diazotroph bacteria are primarily involved in nitrogen fixation because they possess the Nif genes encoding the nitrogenase (Zehr et al., 2003; Raymond et al., 2004).

Phosphorus is another essential element required by plants for growth. In the tropics, most soils are heavily weathered and acidic. Moreover, tropical soils have high rates of P-fixation due to the presence of aluminium (AL) and iron (Fe) oxides (Otinga et al., 2013). Alleviation of phosphorus deficiency in these soils can be achieved through fertilization; however, phosphorus is rapidly converted into forms not easily accessible to plants (Dobermann et al., 1998; Otinga et al., 2013). The use of microorganisms in P-recycling has been demonstrated by several authors (Whitelaw, 2000; Wakelin et al., 2004; Harvey et al., 2009). For instance, fungi in the genera Penicillium and Talaromyces can produce organic acids that can directly dissolve P precipitates or chelate P- precipitating cations (Kucey et al., 1989; Gadd, 1999). The fungus T. flavus has been shown to produce 2-methylsorbic acid, sorbic acid, bromomethylsorbic acid and bromosorbic acid. These acids play essential roles in the biogeochemical cycling of P in natural and agricultural ecosystems (Wakelin, et al., 2004). The endophytic fungus P. indica can also enhance P availability for plant up-take. Several P transporters such as PiPT from this fungus have been cloned. Maize plants inoculated with the PiPT-knock down mutant of P. indica contained less phosphorus and generally acquired less biomass compared to plants inoculated with P. indica wild-type (Yadav et al., 2010).

2.6.3 Improved tolerance to abiotic factors

Increase in air temperature coupled with persistent drought and salinity during the growth season is major cause of low rice yields worldwide. About 33% of arable land worldwide is affected by salinity (UNEP, 2008). Salinity, arising from tidal floods into rice fields, has reduced agricultural lands essential for rice production. Effort to reclaim these fields will potentially improve rice production. The fungal endophytes F. culmorum (strain FcRed1), and C. protuberata (strains Cp4666D and CpYNP5C) have been shown to improve rice tolerance to salinity, drought and cold stresses, likely through the expression of reactive oxygen species (ROS) scavenging antioxidation systems (Redman et al., 2011). Rice plants inoculated with the endophytic fungus P. indica showed salt stress tolerance and growth improvement likely through accumulation of chlorophyll, carotenoid and proline (Jogawat et al., 2013). Studies have shown that proline, an amino acid, accumulates and plays an important beneficial role in rice plants exposed to different stresses. Proline is an excellent osmolyte, metal chelator, an antioxidative defence and a signalling molecule (Lutts et al., 1999). It has been shown that chlorophyll and carotenoid play significant roles in photosynthesis and photoprotection (Jogawat et al., 2013).

2.6.4 Increased resistance (defence) to pathogens

Induction of defence by non-pathogenic organisms and endophytes has been demonstrated by several authors (Table 2.2 and 2.3). There are several types of induced resistance of which Systemic Acquired Resistance (SAR) and Induced Systemic Resistance (ISR) have been thoroughly studied. SAR is triggered by necrosis-forming microbes, which later manifests systemically throughout the plant, especially after the infection by virulent organisms (Grant and

Lamb, 2006). During the induction of SAR, the phytohormone SA has been shown to increase both locally and systemically. Induction of SAR also causes the synthesis of pathogenesis- related (PR) proteins (Ryals et al., 1996; Maleck et al., 2000; van Loon et al., 2006; Wang et al., 2006). Some of these PRs such as β-1, 3-glucanases and chitinases have antimicrobial activities against biotrophic and hemibiotrophic organisms (van Loon et al., 1998). ISR is mostly triggered by strains of non-pathogenic plant growth-promoting rhizobacteria (PGPR) such as Pseudomonas, Bacillus and Bradyrhizobium species (Kloepper et al., 2004; Ahn et al., 2007; van Loon, 2007; Cartieaux et al., 2008) or non-pathogenic fungal species (Pieterse et al., 2014). However, many studies have concentrated on ISR induction by PGPR (van Loon et al., 1998; Ramamoorthy et al., 2001; Pieterse et al., 2014) and only a few examples of fungal mediated ISR are available. Apart from AMF (Elsen et al., 2008; Vos et al., 2012b) and P. indica (Verma et al., 1998), little is known about the effect of the majority of fungi frequently isolated from rice (plant) tissues generally referred to as endophytes.

Induced resistance may remain passive for some time (Fig. 2.11), and only become active upon the introduction of abiotic and biotic stress (Schouten, 2016). This state of high alert is generally referred to as priming of defence, which occurs in three stages: the pre-challenge stage where the plant interacts with the priming stimulus, the challenge stage of priming that occurs after interaction with a pathogen has been established and the long-lasting and transgenerational priming (Gamir et al., 2014). The pre-challenge stage includes all cellular changes that prepare the plants to effectively manage subsequent responses to pathogens without major fitness cost. Studies focussing on the pre-challenge stage have mostly dealt with the analyses of gene expression profiles and protein phosphorylation (Gamir et al., 2014). The challenge stage focuses on early to late stages of defence responses. Studies have shown that this stage is strongly controlled by hormones with few exceptions of the involvement of phenolic compounds and other secondary metabolites. Long term priming occurs in the offspring of primed plants (Gamir et al., 2014).

Using the split root-experimental set-up, the endophytic fungus F. oxysporum (strain Fe14) has been shown to reduce the infection of the root-knot nematode M. graminicola on the responder side of the root system after inoculating the endophyte on the inducer side, indicating systemic effect (Le et al., 2016). Inoculating rice roots with the endophytic fungus H. oryzae (strains R5-6- 1 and RC-3-1) has been shown to reduce the infection of the blast fungus M. oryzae on rice leaves, again depicting systemic effects (Su et al., 2013). Induction of systemic resistance by the fungus was mediated by the OsWRKY45-dependent branch of the salicylic acid signalling pathway and the production of reactive oxygen species (ROS) particularly, hydrogen peroxide

(H2O2). By producing H2O2, this endophytic fungus initiated a programmed cell death (PCD) that excluded the pathogenic fungus M. oryzae and eventually enhanced host plant resistance (Su et al., 2013. The presence of H2O2 also increased the accumulation of superoxide dismutase (SOD), catalase (CAT), peroxidase (POD), dehydroascorbate reductase (DHAR) and glutathione reductase (GR) antioxidants (Su et al., 2013). An increase in antioxidant levels has been shown to correlate with an increase in plant resistance to the fungal pathogen M. oryzae (Su et al.,

2013). Other strains of endophytic fungi listed in Table 2.2 and 2.3 have been shown to reduce the infection of plant-parasitic nematodes, insect pests and fungal pathogens on different plant species.

A number of studies have analysed the effect of beneficial microbes during the pre-challenge stage of defence, especially hormone modulations as markers for plant defence (Danneberg et al., 1992; Bothe et al., 1994; Ludwig-Muller et al., 1997; Kaldorfa and Ludwig-Muller, 2000; Hause et al., 2002; Fitze et al., 2005; Meixner et al., 2005; Peškan-Berghöfer et al., 2015). However, only a few of these studies have analysed the effects of the hormone modulations on plant defence against pathogens. For instance, the endophytic fungus F. oxysporum strain Fo47 has been shown to prime defence of pepper plants against the soil-borne pathogen Verticillium dahliae by increasing the levels of JA and SA (Veloso et al., 2015). Information about hormone modulation by endophytic fungi in rice and their effects on nematode infection is lacking. Priming of defence can also be triggered using synthetic chemicals (Fig. 2.11), and has been extensively studied (Zimmerli et al., 2001; Shimono et al., 2007; De Vleesschauwer et al., 2008; Nahar et al., 2011, 2012; Xu et al., 2013; Ji et al., 2015).

Fig. 2.11 Ways to induce priming and resistance to biotic and/or abiotic stress in plants. Spray or drench pre-treatment of plants with certain natural or synthetic compounds (SA, some of its analogs, BABA, LPS etc), wounding or colonization of the roots by beneficial microorganisms (mycorrhizal fungi, growth promoting fungi and rhizobacteria), causes a primed state. In the primed condition, plants are able to respond with more robust and/or faster induction of defence responses upon exposure to pathogen attack. Ultimately, priming causes a reduction of disease symptoms through enhanced resistance (upper row) which is not seen in non-primed plants (lower row). Adapted from (Conrath, 2009).

Induction of defence responses has also been shown to enhance plant innate immunity against pathogens and pests. Jones and Dangl (2006) have proposed an elegant zigzag model to illustrate this type of immunity in plants (Fig. 2.12). Briefly, plants recognise surface features present in microbes commonly known as pathogen-associated molecular patterns (PAMPs) or microbe-associated molecular patterns (MAMPs) to activate the first line of defence known as PAMP-triggered immunity (PTI) which is characterised by callose deposition near the infection site. PTI is non-specific and can suppress most pathogens. However, there are virulent pathogens which are able to suppress PTI by injecting effectors into the host. Using mainly intracellular nucleotide-binding leucine-rich receptor proteins (NLRs), some plants may recognise these effectors and activate a stronger and effective defence response called effector triggered immunity (ETI) characterised by programmed cell death [hypersensitive response (HR)] (Jones and Dangl, 2006). This tug of war is continuous, and the success of infection always depends on the ability of the pathogen to overcome the plant defence responses.

Fig. 2.12 A zigzag model to illustrate the quantitative output of the plant immune system (Adapted from Jones and Dangl, 2006). 2.6.5 Mycoparasitism, competition and antibiosis

Other than ISR, SAR and innate immunity, beneficial microorganisms and endophytes may directly affect plant growth and disease control through mycoparasitism, competition and antibiosis (Benhamou et al., 2002; Pantelides et al., 2009). Competition for nutrients in the soil and the rhizosphere or infection sites on the roots has been identified as one of the primary biological mechanisms of many non-pathogenic strains of F. oxysporum (Couteaudier and Alabouvette, 1990; Postma and Rattink, 1991; Eparvier and Alabouvette, 1994; Larkin and

Fravel, 1999; Pantelides et al., 2009). The strain Fo47 has been shown to suppress growth of Pythium ultimatum using a combination of antibiosis and mycoparasitism (Benhamou et al., 2002). 2.7 The role of hormones in plant defence against pathogens

Activation of hormone pathways, either chemically, genetically or biologically has been shown to play key roles in plant defence and development. The activation of Systemic Acquired Resistance (SAR) in plants requires the hormone salicylic acid (SA), while jasmonic acid (JA) and ethylene (ET) hormones are required for the activation of Induced Systemic Resistance (ISR). In dicots, biotrophic pathogens are efficiently controlled by SA-dependent pathways (McDowell et al., 2005; Flors et al., 2008), whereas the JA/ET-dependent pathways are effective against necrotrophic pathogens (Glazebrook, 2005). Crosstalks between SA and JA as well as other hormone pathways have been observed before (De Vleesschauwer et al. 2010). Recently, other hormones such as abscisic acid (ABA) and auxin have been implicated with plant defence. In rice, the role of JA, ET, SA, ABA and auxin are well-documented (De Vleesschauwer et al., 2008, 2013; Nahar et al., 2011, 2012; Xu et al., 2013; Ji et al., 2015). However, most of these results are derived from exogenous application of synthetic compounds to elicit defence responses. There are few examples of hormone modulation by beneficial organisms, especially endophytic fungi. For example, inoculation of F. oxysporum strain Fo47 in pepper plants caused a slight increase of jasmonyl isoleucine, which was followed by a transient increase of SA during the pre-challenge stage and an increase of 12-oxo-phytodienoic acid after infection by Verticillium dahliae (Veloso et al., 2015).

2.7.1 Salicylic acid

Rice contains high amount of endogenous SA (8-37 μg g-1 fresh weight), which often occurs in free acid form and does not change significantly up on pathogen attack (Silverman et al., 1995). In plants, SA is synthesised through the phenylpropanoid and isochorismate pathways. Phenylalanine ammonia lyase (PAL) is a key enzyme in the phenylpropanoid pathway (Duan et al., 2014). Analysis of PAL gene has shown differential roles including defence responses to pathogens, by regulating the SA content in plants (Duan et al., 2014). Up to 4 PAL genes have been identified in rice, which show differential regulation after infection of bacteria, fungi or nematodes (Blilou et al., 2000; Tanaka et al., 2003; Yuan et al., 2007a; Tao et al., 2009; Xiao et al., 2009; Shen et al., 2011; Giberti et al., 2012; Gupta et al., 2012; Liu et al., 2012; Kumari et al., 2015). For instance the rice OsPAL1 gene has been shown to prime rice defence against the root-knot nematode M. graminicola (Kumari et al., 2015). Yang et al. (2004) have suggested that endogenous SA protects rice from oxidative damage caused by aging, pathogen attack or abiotic stress. The effect of SA application in rice is age dependent. For instance, Iwai et al. (2007) have found that exogenously administered SA induces rice resistance to M. oryzae only in mature plants, but not in young seedlings.

In rice, the SA-responses are mediated by two sub-pathways downstream of SA: the OsNPR1- and OsWRKY45-dependent pathways (Shimono et al., 2007). The activation of OsNPR1

35 enhances accumulation of pathogenesis related (PR) transcripts that eventually induce rice resistance to M. oryzae and Xanthomonas oryzae pv. oryzae (Chern et al., 2005; Yuan et al., 2007c; Sugano et al., 2010). Compared to OsNPR1, most SA-responses occur through the OsWRKY45-dependent pathway (Shimono et al., 2007; Sugano et al., 2010). Like OsNPR1, activation of the OsWRKY45 pathway has been linked with rice resistance to M. oryzae and X. oryzae pv. oryzae (De Vleesschauwer et al., 2014). Nahar et al. (2011) have found a weak role of SA in rice resistance to M. graminicola, but very strong effect on rice immunity to the root-rot nematode Hirschmanniella oryzae (Nahar et al., 2012).

2.7.2 Jasmonic acid

Jasmonic acid (JA) and its derivatives, also known as jasmonates (De Vleesschauwer et al., 2013), are involved in rice defence against nematodes, fungi and bacteria. Unlike in dicots where jasmonates have been implicated with plant defence against necrotrophic pathogens, recent findings in rice indicate the reverse (Nahar et al., 2011; De Vleesschauwer et al., 2013, 2014). For instance, resistance of rice to the biotrophic root-knot nematode M. graminicola requires the JA pathway (Nahar et al., 2011). Application of jasmonic acid has been shown to reduce by 50% the effect of rice sheath blight caused by the necrotrophic pathogen Rhizoctonia solani (Taheri and Tarighi, 2010). These examples show that jasmonic acid may be effective against biotrophic and necrotrophic pathogens in rice. The JA-inducible Myb transcription factor OsJAMyb plays a key role in rice defence against the blast fungus M. oryzae (Lee et al., 2001). Activation of OsJAMyb is an important marker for JA-responses and host plant resistance.

2.7.3 Ethylene

Ethylene (ET) can have both positive and negative roles in host defence, depending on the lifestyle and infection biology of the attacking pathogens as well as the specific interactions with other hormones. Often ET has been found to interact with JA to induce host defence. An interaction of ET and JA has been found to mediate rice defence against the root-knot nematode M. graminicola and the root-rot nematode H. oryzae (Nahar et al., 2011, 2012). ET-induced resistance works only through the JA-dependent pathway during rice resistance to M. graminicola (Nahar et al., 2011), but may act independent of JA in rice defence against H. oryzae (Nahar et al., 2012). ET biosynthesis was found to cause partial blast resistance of rice growing in anaerobic conditions (Singh et al., 2004), whereas silencing of the ET-signalling gene OsEIN2b increased rice susceptibility to M. oryzae and the bacterial pathogen Burkholderia glumae (Bailey et al., 2009; Seo et al., 2011). Conversely, application of ethephon has been shown to promote the brown spot disease caused by the fungus Cochliobolus miyabeanus in rice (De Vleesschauwer et al., 2010). Moreover, silencing of MAPKKK OsEDR1 reduces the expression of ACS genes and lowers the ethylene content in plants. Interestingly, these mutants are resistant to the bacterial pathogen X. oryzae pv. oryzae. Furthermore, these mutants contain high amount of SA and JA, and strongly express SA and JA marker genes. It can be argued that lowering of ET enhances SA and JA defence responses (De Vleesschauwer et al., 2014).

2.7.4 Abscisic acid

The effect of abscisic acid (ABA) in plant defence largely depends on the specific plant-pathogen interactions (De Vleesschauwer et al., 2014). ABA has been found to promote rice resistance to the brown spot pathogen C. miyabeanus mostly through the MAP kinase-mediated repression of the ethylene pathway (De Vleesschauwer et al., 2010). A negative cross-talk between ABA and SA has been found to be the main factor responsible for rice susceptibility to the leaf blight pathogen X. oryzae pv. oryzae (Xu et al., 2013) and M. oryzae (Jiang et al., 2010). Moreover, ABA antagonises the JA pathway to promote rice susceptibility to the root-rot nematode H. oryzae (Nahar et al., 2012).

2.7.5 Auxins

Auxins such as indole-3-acetic acid (IAA) are important in promoting plant apical dominance, tropistic growth, lateral root formation, vascular tissue development and regulation of plant senescence (De Vleesschauwer et al., 2014). The regulation of auxin in plants may be carried out by GH3 (Gretchen Hagen 3) gene family that catalyses the conjugation of IAA into various amino acids through negative feedback mechanisms (De Vleesschauwer et al., 2014). The three GH3 enzymes so far identified in rice are OsGH3.1, OsGH3.2 and OsGH3.8 (Westfall et al., 2010). Over-expression of these enzymes reduces the levels of auxin and enhance resistance to the blast fungus M. oryzae, X. oryzae pv. oryzae and X. oryzae pv. oryzicola (Ding et al., 2008; Domingo et al., 2009; Fu et al., 2011).

Chapter 3

3.0 A survey of plant-parasitic nematodes associated with irrigated and upland rice in Kenya, with a special reference to the root-lesion nematode Pratylenchus zeae.

Adapted from:

First report of Pratylenchus zeae on upland rice from Kwale County, Kenya

N.N. Pili, T. Kyndt, T. Janssen, M. Couvreur, W. Bert, R.K. Mibey and G. Gheysen

Published in Plant Disease Journal 100 (5): 1022-1022. Doi.org/10.1094/PDIS-07-15-0743-PDN.

3.1 Abstract

Plant-parasitic nematodes are serious pests of crops worldwide. They have been isolated and characterised from rice in many countries. Rice has been cultivated in irrigated and upland ecosystems in Kenya since 1907. Monocropping systems are commonly practised in the irrigated ecosystems, while in the upland ecosystems, rice can be rotated with other crops. After surveying irrigated (Mwea and Ahero) and upland (Kwale, Siaya and Busia) rice fields, two plant- parasitic nematodes namely Pratylenchus zeae and Aphelenchoides sp. were identified from samples collected in Kwale. P. zeae was selected and analysed further to validate its taxonomy and phylogeny as well as its effect on local (Kenyan) rice varieties. Results from morphological (SEM and LM), morphometric and molecular analyses were congruent with previously described characteristics of P. zeae. Host reaction tests showed that Nipponbare was susceptible to P. zeae, while Supa and Basmati were resistant. All the tested cultivars appeared to be tolerant to P. zeae. Collectively, this study provides evidence that nematodes are present in upland rice ecosystems in Kenya, but they appear limited in distribution. Some rice genotypes are resistant and tolerant to P. zeae. Cultivation of these genotypes has significantly reduced the occurrence and distribution of plant-parasitic nematodes in Kenya.

Keywords: Pratylenchus zeae, Aphelenchoides sp., upland rice, morphometrics, microscopy.

3.2 Introduction

Rice (Oryza sativa L.) is the third most important food crop in Kenya after maize and wheat, with the current consumption greatly exceeding the annual production. The coastal region (Kwale, Kilifi, and Tana River) and some parts of western Kenya have potential for expanding the production of rain-fed rice (Muhunyu, 2012). Analysis of soil samples showed that P. zeae Graham 1951, Ditylenchus sp., Criconemella sp., Hemicycliophora nyanzae, Xiphinema spp., Scutellonema spp. and Helicotylenchus spp. could be present in rice fields in western Kenya (Kariaga and Agama, 1994). Unfortunately, the report did not mention whether these nematodes species were able to infect and reproduce in rice roots. Moreover, the method used for nematode identification or the response of local (Kenyan) rice varieties to these nematodes was not specified. Previously, some nematodes such as P. zeae were found to parasitize rice. Indeed in many countries, P. zeae is one of the most damaging nematodes of upland rice (Castillo and Vovlas, 2007).

Accurate identification of nematodes, a hallmark in implementing good management practices, requires combination of complementary approaches such as symptomatology, morphological, morphometric and molecular analyses (Eisenback et al., 1981; Blok and Powers, 2009; Múnera et al., 2009; Mokrini et al., 2016; Troccoli et al., 2016). Symptoms caused by nematodes on their host plants overlap among different nematodes species (Kyndt et al., 2014; Troccoli et al., 2016). Root infection by nematodes can cause poor uptake of water and minerals resulting in stunted growth, yellowing and wilting of plants (Sikora and Fernandez, 2005). Species within the genus Meloidogyne cause characteristic root-knots (galls) on their hosts, while migratory nematodes such as Pratylenchus spp. cause root-lesions symptoms (Bridge et al., 2005; Kyndt et al., 2014). Although symptomatology can give an indication of nematode infection, it does not conclusively discriminate species of plant-parasitic nematodes.

The tail shape, body length (size), stylet length, shape of stylet knobs, vulva position, the number and arrangement of incisures in the lateral field, lip annuli, tail annuli, spermatheca (presence and shape), de Man ratios, and shapes of perineal patterns are some of the important morphological and morphometric features that can distinguish species of plant-parasitic nematodes (Roman and Hirschmann, 1969; Al-Banna et al., 2004; Castillo and Vovlas, 2007; Múnera et al., 2009; Wang et al., 2015; Monteiro et al., 2016). However, certain species such as those within the genus Pratylenchus are difficult to differentiate morphologically (Roman and Hirschmann, 1969; Múnera et al., 2009). These species are highly similar to one another in having strong intra-specific variations and few species-specific diagnostic characteristics (Loof, 1978; Orui, 1996; Al-Banna et al., 2004). Moreover, there are over 70 described species in this genus, some of which have been taxonomically reviewed (Castillo and Vovlas, 2007). For instance, the isolate FJ643590 which was classified as Pratylenchus zeae by Chen et al. (2009) was recently renamed as Pratylenchus parazeae (Wang et al., 2015). Moreover, P. zeae is closely related to P. bolivianus, P. bhattii, P. delattrei, P. parazeae and P. curvicauda (Castillo and Vovlas, 2007; Wang et al. 2015; Troccoli et al., 2016).

Molecular analyses can distinguish plant-parasitic nematodes, and are often based on the amplification and sequencing of the Internal Transcribed Spacer and the D2-D3 expansion segment of the ribosomal DNA (rDNA) (Waeyenberge et al., 2000; Mizukubo et al., 2003; Al- Banna et al., 2004; De Luca et al., 2004; De la Peña et al., 2006; Subbotin et al., 2006, 2008; Mekete et al., 2011; Wang et al., 2015). The ITS region is located in the repeating arrays of rDNA between the 18S and 28S genes (Fig. 3.1). This region evolves at a faster rate than any other region of rDNA, and has become a versatile genetic marker for detecting and discriminating nematodes at the genus, species and sub-species levels (Powers et al., 1997). Also the D2-D3 expansion segment of the 28S rDNA has been effectively applied to identify different nematode species (Douda et al., 2013, Subbotin et al., 2008). Several conserved sequences have been developed into primers to amplify the ITS and the D2-D3 regions (Múnera et al., 2009; Douda et al., 2013; Troccoli et al., 2016).

Fig. 3.1 Schematic representation of the nuclear ribosomal DNA region (rDNA). IGS, -intergenic spacer; ETS, -external transcribed spacer; ITS, -Internal Transcribed Spacer. Adapted from Douda et al. 2013. The primary hypotheses of this chapter were (i) nematodes are abundant in irrigated ecosystems practising monocropping, but few in upland ecosystems where crop rotations are practised, (ii) local (Kenya) rice cultivars are susceptible to nematode infections and (iii) soil characteristics such as pH, organic carbon, nitrogen and phosphorus affect the abundance and distribution of plant-parasitic nematodes in the rice ecosystems. In Kenya, rice has been cultivated in both irrigated and upland ecosystems since 1907 (Ouma-Onyango, 2014). The objective of this study was to perform a survey to identify species of plant-parasitic nematodes present in rice in Kenya, by using a combination of symptomatology, morphological, morphometric and molecular analyses.

3.3 Materials and methods

3.3.1 Soil sampling and analysis

Soil samples were collected concurrently with the root samples using a standard soil auger. The samples from each field were mixed thoroughly into one composite sample before being dried and grounded into fine powder and finally sifted through a 2-mm sieve. Soil parameters such as pH, organic carbon, nitrogen and available phosphorus were determined for each field. Analysis of soil pH was conducted according to Otinga et al. (2013). Organic carbon and nitrogen content

41 were determined following the protocol of Okalebo et al. (2002). Extractable soil phosphorus was determined according to Olsen et al. (1954).

3.3.2 Root sampling, isolation and culturing of nematodes

Root samples were collected from five rice growing regions located in Mwea, Ahero, Siaya, Busia and Kwale (Table 3.1 and Fig. 3.2) during the 2012 growing season. The locations were selected based on the cropping systems, water regimes and the rice varieties being cultivated. Mwea and Ahero represented the irrigated fields, while Siaya, Busia and Kwale are upland rice fields (Table 3.1). Continuous monocropping of one or more rice cycles per year is a general practice in the irrigated ecosystems, while the upland ecosystems are typified by short-rotations of rice with other crops (Kuria et al., 2003). The irrigated ecosystems are continuously wet (completely submerged) from transplanting until harvesting, whereas the upland ecosystems (dryland) are characterized by fluctuating dry and wet conditions throughout the growing seasons (Grist, 1986). The rice varieties cultivated in these locations are Basmati 370 (Mwea), IR279380-1 (Ahero), Nerica (Siaya and Busia) and Supa (Kwale). Basmati 370 and IR279380-1 grow best under irrigation (Ndiiri et al., 2012). Supa is a local cultivar grown mainly in the coastal region, while Nerica 4 is an upland cultivar (Atera et al., 2011).

Table 3.1 Description of rice ecosystems sampled in Kenya: location, geographical coordinates and climatic conditions.

Annual Average Ecosystem Sites Geographical Co-ordinates Rainfall Temperature (°C) Irrigated Mwea 00‟39.357S, 037‟17.477E 950 d 24 d Ahero 00‟09.721S, 034‟55.124E 1400 b 25 b Upland Siaya 00‟03.226N, 034‟17.136E 1200 c 21 c Busia 00‟27.523N, 034‟06.888E 1500 c 28 c Kwale 04‟11.195S, 039‟22.801E 700 a 30 a a Kihoro et al., 2013 b Atieli et al., 2009 c Wambugu et al., 2012 d Ohaga et al., 2007

Fig. 3.2 A map of Kenya showing the sampling locations. Courtesy of Geert Meesen, Department of Molecular Biotechnology, Ghent University, Belgium. The number of samples collected per location varied depending on size (acreage) of land under rice cultivation. In Mwea 15 blocks were sampled, while in Ahero samples were collected from 14 blocks (refer to Fig. 2.2 for a detailed picture of a block). In Siaya, Busia and Kwale, samples were collected from 9, 5 and 3 fields (refer to Fig. 2.3 for a detailed picture of a field), respectively. At each sampling block or field, 3 plants at vegetative or early flowing stages were

43 collected. The plants were combined to form one composite sample per field or block, and then divided into groups (Fig. 3.3): one for nematode extractions and the other for fungal isolation (described in chapter 4). The samples were transported to the laboratory in coolboxes and processed within 24 hours of sampling (Rosa et al., 2010). Nematodes were extracted from roots using the Baermann method (Luc et al., 2005). Gravid females were handpicked, surface sterilised and cultured onto carrot disks (Moody et al., 1973; Kagoda et al., 2010). The discs were kept in darkness at 28°C. The reproduction of the nematodes was assessed 2-3 months after inoculation. Pure cultures that developed from individual carrot discs were regularly maintained on fresh carrot discs (Moody et al., 1973; Kagoda et al., 2010) or in the rice cv. Nipponbare. Morphological, morphometric and molecular analyses were applied to identify the nematodes, either from the mixed populations or from the pure cultures in carrot discs.

Fig. 3.3 Root sampling for isolation and identification of plant-parasitic nematodes and fungal endophytes. 3.3.3 Morphological studies

Nematodes were gently killed in 4-5 ml of hot (70°C) formalin (4% with 1% glycerine) and processed according to De Grisse (1969). The nematodes were measured with the aid of a camera lucida on an Olympus BX51 microscope (Olympus Optical). SEM and LM analyses were performed according to Múnera et al. (2009).

3.3.4 Molecular and phylogenetic analyses

DNA was extracted by adding several nematodes into a 50 µl of worm lysis buffer (WLB) [10mM Tris-HCl (pH 8.0), 1mM dithiotreitol (DTT) and 0.45% tween-20]. After sonicating 10 times, a 1:10 volume of proteinase K (0.6 mg/ml) was added to the suspension and incubated for 30 min at 37°C and then transferred into a boiling water bath for 5 min. Finally, the suspension was centrifuged for 5 min at maximum speed and the supernatant (crude DNA) transferred into new collection tubes. PCRs were performed by amplifying the ITS and the D2-D3 regions. The ITS region was amplified using TW81F (5-GTTTCCGTAGGTGAACCTGC-3) and AB28 (5-

ATATGCTTAAGTTCAGCGGGT-3) universal primers (Subbotin et al., 2001). The D2-D3 region was amplified using D2A (5-ACAAGTACCGTGAGGGAAAGTTG-3) and D3B (5- TCGGAAGGAACCAGCTACTA-3) primers (Subbotin et al., 2006). Some PCR products were run on a 1.5% TAE buffered agarose gel, stained in ethidium bromide and photographed. The other PCR products were cloned into pJET1.2/blunt vector (Fermentas, Waltham, MA) and sequenced at LGC genomics (Berlin, Germany). Sequences were edited and assembled using the CLC Main Workbench (version 6.9.1) software (CLC-Qiagen, Denmark). Blast searches were performed on the NCBI database. The new sequences of P. zeae obtained in this study were deposited at the NCBI database under the accession numbers KT032997, KT032998, KT032999 and KT033000 for the D2-D3 sequences, and KT033001 for the ITS sequence.

For phylogenetic analyses, 12 ITS sequences and 22 D2-D3 sequences of closely related P. zeae populations were downloaded from the GenBank. Six other sequences (2 ITS and 4 D2-D3 sequences) were included as out-group according to the results of previously published data (Subbotin et al., 2008; Múnera et al., 2009). The sequences were aligned using Clustal Omega (clustalo) software on the EBI server with FASTA (Pearson) as output format (http://www.ebi.ac.uk/Tools/msa/clustalo/). The software Readseq was used to convert the alignments to nexus format (http://www.ebi.ac.uk/Tools/sfc/readseq/), while the online SequenceMatrix 1.8 software was used to estimate their genetic distances. The nexus files were analysed using the Bayesian inference (BI) in the program MrBayes 3.2.5, with the general-time- reversible (GTR+I+G) substitution model (Ronquist and Huelsenbeck, 2003). The parameters of the model were set as follows: nst=2, rates=invgamma, mcmc ngen=50,000, samplefreq=100, printfreq=250 and diagnfied=1250. Analyses were performed until a standard deviation of ≤0.05 was achieved. The output files was visualised in Figtree (v1.4.2) program (Rambaut, 2016).

3.3.5 Host response tests

The host responses of three rice cultivars: Nipponbare (GSOR-100; genetic stocks Oryza collection, Washington DC, USA), Supa and Basmati to P. zeae were tested in greenhouse experiments. De-husked rice seeds were surface-sterilised by soaking in 70% ethanol for 2 min and 6% sodium hypochlorite (NaOCl) for 15 min. The seeds were rinsed thoroughly with sterilised autoclaved water. Surface sterilised seeds were pre-germinated for three days at 30°C. After germination, seedlings were transplanted singly in PVC tubes filled with autoclaved Synthetic Absorbent Polymer (SAP) substrate (Reversat et al., 1999). The potting tubes with the seedlings were transferred in a rice room at 28°C under 12/12-h light regime (Nahar et al., 2011). They were watered and fertilised three times a week with 10 mL of full-strength Hoagland solution. Two weeks later, the plants were inoculated with 300 nematodes (obtained from pure cultures in carrot discs) or water as a control (Fig. 3.4).

There were two experiments; one to determine the effect of P. zeae on the growth of Nipponbare, Supa and Basmati, while the other experiment evaluated the reproduction of P. zeae on these cultivars. To determine the effect of P. zeae on growth, plant height and weight were measured from 8 control plants and 8 nematode-inoculated plants. Height of each plant was measured from the base to the end of longest leaf (Plowright et al., 1990). To minimise root

45 damage or loss during data collection, each plant taken from the SAP tubes was submerged in water, and lightly shaken to release it from the substrate. The roots were rinsed thoroughly with tap water until all visible SAP particles were removed (Bashan and de-Bashan, 2005). Later, they were placed in-between absorbent papers to drain-off excess water. Roots were separated from the shoots, and placed in paper bags. The samples were dried in an oven at 60°C for 48 hours (Atugala and Deshappriya, 2015). Roots and shoots were weighed on a laboratory scale (Bashan and de-Bashan, 2005). The sum of root and shoot dry weight gave total dry weight of the plants.

To determine the reproduction factor (Seinhorst, 1981; RF= final/initial population or Pf/Pi where Pf=final population and Pi=initial population) of P. zeae on the cultivar Nipponbare, Supa and Basmati, nematodes were extracted from roots and soil, 45 days after transplanting (Fig. 3.4). The roots were washed with tap water to remove the SAP, placed in-between absorbent paper, and weighed to determine the fresh weight. Later, the roots were boiled in acid fuchsin for 3-5 minutes, washed several times in running tap-water and placed in acidified glycerol to de-stain (Nahar et al., 2011). Nematodes were extracted from soils of each replicate through a modified Baermann extraction method. The final nematode population was estimated by counting, under the microscope, nematodes inside the plant tissues and those in soil. The number of nematodes per plant or gram of fresh root weight was obtained for each replicate. Cultivars were classified as susceptible (RF≥1) and resistant (RF<1) according to Oostenbrink, (1966).

Fig. 3.4 A schematic presentation of the host response tests for P. zeae. C; -degree Celsius. 3.3.6 Data analysis

All statistical analyses were performed in SPSS statistical software (SPSS Inc., Chicago, IL, USA). Normality tests were checked by applying the Kolmogorov-Smirnov test and visualised by box plots, while Levene tests were applied to analyse the homogeneity of data. Later, the data on the number of nematodes, plant height and weight (total, root and shoot dry weight) was analysed using ANOVA. Data was considered significant at P<0.05.

3.4 Results

3.4.1 Identification of nematodes through symptomatology

Root samples collected from Mwea, Ahero, Siaya and Busia did not shown typical symptoms of nematode infection like galling and root-lesions (data not shown). However, the root samples collected from Kwale, showed lesion characteristics resembling those caused by migratory root nematodes such as Pratylenchus spp. (data not shown). After a 48-hour extraction through the

Baermann method, there were no nematodes from the rice roots collected in Mwea, Ahero, Siaya and Busia. Conversely, nematodes were present in rice roots collected from Kwale (data not shown). 3.4.2 Identification of nematodes through molecular analysis

The results of colony-PCR showed variations in sizes of the bands, indicating a possibility of multiple species or intraspecific variations within species (Fig. 3.5). After plasmid extraction and sequencing, two plant-parasitic nematodes namely Aphelenchoides sp. and Pratylenchus zeae were obtained. Multiple efforts to start pure cultures on carrot discs and in rice plants was only successful for P. zeae. More PCRs were performed to verify the results, where comparisons of the obtained ITS and the D2-D3 sequences with all P. zeae reference sequences in GenBank revealed nucleotide divergence of 0.28 to 8.4% and 0.13 to 2.36%, respectively. After Bayesian analysis (BI) with closely related sequences, our population shared a maximally supported clade with P. zeae populations (Figs. 3.6 and 3.7).

Fig. 3.5 Gel picture of colony PCR. M: marker ladder (2 kb); K13-24: different bacterial colonies. The amplicons were visualised in a 1.5% TAE buffered agarose gel.

00328718-eoo::oous_sp._- 00328717_ Basiria _grad/is_ USA 00328719-~-ro.tcil5_- 00328710_f?ftoclaiiiXJs_ krfta~Xialus_ U SA ·· ·· ·· ······ ·· ······ ··· JX261947_ ~us_ oojedus_lran 100 ,....---100.;-~ ·············· ············· JX26 1 946_~us_oojedus_lran ~.....-___1-100 .AM231924_Pnl~s_ bizesl

w ••• • • • ••••• •••••••• • • • FJ463261_~us_aa~_Cdartlia ··· ··· ······ ··· ····· ······ · ························· JN244270_Pmlyieoollu s_b'Ja#L Chrn ···················· ··············· ··············· ····················JN244269 _ Pmlyieoollu s_b'Ja#i_ Chrn

,...._~ w • w ••• • • • • • • • • • • ••• JX261949_ Pra~ndlus _delallrei_lran ...... ·... JX261948_ Pra~ndlus _delallrei _I ran ······· ······· ·········· ······· ······ ··· ···· JX261959_ Pm~us_ sp._lran EU1I692_Pra~s_zeae_ Japan EU1ll891_Pra~s _zeae _ Japan ··· JN020031J_~us_zeae_USA JN020031_~us- zeae_ USA EU1ll893_ Pra~us_zeae_ SoJ _ MOCa AF30ml_~us_zeae_ USA JN020029_ ~us- zeae_ USA EU1ll896_ Pra~us_zeae_ SoJ _ MOCa EU1ll890_Pra~s_zeae_ Japan ·············· · ················ KF300234_ Pra~ us_zeae_China ··· ·· ··············· ········ · ~- Pra•_zeae_Japan ·································· .AB933458_ ~us_zeae _ Japan 76 .AB933461_Pra~ us_zeae_Ja~ ·································· ·.AB933463 _ Pra~us_zeae _Japan 100 .. · ...... ·...... AB933457_ Pra~us _zeae _ Japan ·· ··· ··· EU 1 ll889_Pra~s_zeae_Japan ················· ······· KF?m_ Praty1ench us_zeae_Chi na ···· ··· ··· ··· KT032997_ Pra~ us-zeae_ Kerrya KT03IOO_ Pra-_zeae _ Kerrya ··· .AB933462_ Pra _ _zeae _ Japan KT032999_ Pratyleochus _ zeae _ Kenya ·JN020032_~us_zeae_USA ············ KT032998_ Pra-_zeae _ Kerrya ······· ·· ···· EU 1 30095_Pnl~us_zeae_SoJ_MOCa ··············· EU1ll894_Pnll}1endlus_zeae_ SoJ_MOCa ··············· .AB933459_ Pral}1endlus_zeae _ Japan Fig. 3.6 Phylogenetic relationships based on the D2-D3 sequences of P. zeae isolates and other Pratylenchus spp.: A Bayesian inference (BI) majority rule of consensus tree reconstructed using the GTR+I+G model. The tree was rooted using Boleodorus sp., Basiria gracilis, Coslenchus costatus and Belonolaimus longicaudatus according to results of previously published data (Subbotin et al., 2008). In bold is an example of Kenyan isolate.

..------AF498389 Heteradera scllaclmï Iran -~ 100 - - - DQ309585 _Helicoo ·lencluiS _dilv·srera _Taiwan_and _Kimuen Fn I19 I2 _ PratylencluiS _crenahiS _Ftnland 56 JX04694I Prnn•lencli!IS negleehls China ...... ------4 100 - ...J - - Fn I2956 _ Pralylenclu1s _neglech1s _Italy FJI5495I_ Pral)•lencl111s _araucensis _Colombia Fn I294I _Prmylenclu1s jaelmi _Belgium 81 Fni 2938 _Pral) •lenchus jaelllli _Belgium ...._ __-11 00 AY56I 436_ Pral) ·lenchus _coffeae _Nigeria AB053485 _Pral) •lencluiS _coffeae _Japm1 JN244273 _Pral)•lerJcii! IS_bhillhï _Clu'tut 68 JN144275 _Prao•lenclu1s _bllathï _China ,.----4 100 JN244272 _Pra~ ·lenclms _bilalti i_China 88 JN24427 4_ Pral)•lenchus _bl1attii _China 95 ...... ----4 100 JN24427 I_PraQ •Ienchus _bhattii_China FJ643590 _Pral)•lench!IS yara:eae _Taiwm1 LC030347_ Pral) •lenchus _::eae _Japan 86 Y.T03 .~00I -Pra~·lench11s. -- ::tt:l Kenra. LC030345_ Pral) •lencluiS _::eae _Japm1 LC030346_ Pral) ·lencl111s _:eae _Japm1 JQ966893 _Pral)•lenclu1s _:eae _Cluna JN020934 Pral)•lencl1us :eae USA 9 ico30344~PraQ ·IencluiS ~:eae~ Japm1 KF765428 _PraQ•Iencllus _::eae _China 87 JN0209 35_ Pral) ·lenchus _:eae _USA 8 JN010933 _Pral) •lenchus _:eae _USA LC030349 Prnn•lenclliiS ::eae Jap(IJl 100 - "'J - - LC030348 _Pral) •lenclliiS _:eae _Japm1

0.2 Fig. 3.7 Phylogenetic relationships based on the ITS sequences of P. zeae isolates and other Pratylenchus spp.: A Bayesian inference (BI) majority rule of consensus tree reconstructed using the GTR+I+G model. The tree was rooted using Heterodera schachtii (AF498389) and Helicotylenchus dihystera (DQ309585) according to results of previously published data (Uribe et al., 2010). In red is the Kenyan isolate.

3.4.3 Identification of P. zeae through morphometric and morphological analysis

A random selection of the nematodes showed a relatively large number of females. This prompted us to start pure cultures from single gravid female on carrot disc and rice plants in vivo. Analyses of the cultures from individual discs (15-20) showed only one population of P. zeae. Ten nematodes from fresh cultures on carrots were selected and measured to determine their body length, stylet length, tail length and body width. Other specimens were fixed and observed under the microscope for typical morphological features of P. zeae such as three non-distinct lip annuli, tubular stylet shaft, rounded basal knobs of the stylet, conical tail with a finely pointed terminus, spermatheca which are round, small and without sperms, distinct body annulations and lateral field with four, smooth incisures at mid-body (Baujard e al., 1990; Castillo and Vovlas, 2007; Troccoli et al., 2016). Table 3.2 and Fig. 3.8 show the results of morphometric and morphological data.

Table 3.2 Morphometric data of Pratylenchus zeae. Measurements in µm and expressed as means±standard deviation (range).

Characters Pratylenchus zeae After Troccoli et al., 2016 female Pratylenchus zeae female n 10 11 L 437±39.01 (383 to 502) 413±37 (350-470) a (ratio) 20.72±1.01 (19.78 to 22.88) 25.7 ± 2.5 (20.3-29.3) b (ratio) 6.43±0.75 (5.25 to 7.25) 5.9 ± 0.6 (5.1-7.3) c (ratio) 16.13±1.48 (13.41 to 18.2) 14 ± 1.8 (12.1-18.5) V 71.84±1.05 (69.75 to 73.21) 72.5 ± 2.6 (68.9-77.3) Posterior end to vulva 123.1±11.29 (105-136) - Tail length 27.1±1.66 (24 to 29) 29.5 ± 3.1 (23.5-33.6) Anterior end to cardia 68±5.3 (60-79) 69 ± 4.6 (63-78) Maximum body width 21.1±5.56 (17-25) 16.0 ± 1.6 (13.9-18.8) Stylet length 14.76±0.44 (13.8 to 15.3) 15.5 ± 0.5 (15.0-16.0)

Abbreviations are defined as in Siddiqi (2000). n Number of specimens on which measurements are based L Overall body length a body length / greatest body diameter b body length / distance from anterior to esophago-intestinal valve c body length / tail length V % distance of vulva from anterior

Fig. 3.8 Light (A-H) and SEM (I-M) pictures of Pratylenchus zeae from upland rice in Kenya. A: entire body (vulva is visible-red arrow), B-C: female anterior regions (stylet visible-red arrows), D: pharyngeal region, E: detail of spermatheca (round, small and empty-red arrow), F-H: tail regions, I: head region (three lip annuli visible-double red arrows, J: lateral fields at the vulva region (four annuli-double yellow arrows; vulva-red arrow and distinct body annulations-green arrow, K: vulva and L-M: tail regions (27 tail annuli-red arrow and conical tail ending with a sharp terminus-green arrow). Photo by author

3.4.4 Rice response tests to P. zeae

After 30 days (a single life cycle) of infection, root-lesions were observed in all inoculated cultivars (data not shown), but a significant reduction in plant height was detected only in Nipponbare (Fig. 3.9A). There were no significant differences in dry weight (total, root and shoot) between control and nematode-inoculated plants of the three cultivars (Figs. 3.9B, 3.10B and 3.11B). The reproduction factors (Pf/Pi where Pf=final population and Pi=initial population) for Nipponbare, Supa and Basmati were 2.86±0.69, 0.45±0.12 and 0.70±0.28, respectively. A significantly, higher number of nematodes were found in soils and roots of Nipponbare than in Supa or Basmati (Figs. 3.12A and 3.12B).

Fig. 3.9 Effect of P. zeae on the rice cultivar Nipponbare. A; -plant height while B; -dry weight. Data represent mean and standard error of 8 plants per treatment. These are results of a single experiment

Fig. 3.10 Effect of P. zeae on the rice cultivar Supa. A; -plant height while B; -dry weight. Data represent mean and standard error of 8 plants per treatment. These are results of a single experiment.

Fig. 3.11 Effect of P. zeae on the rice cultivar Basmati. A; -plant height while B; -dry weight. Data represent mean and standard error of 8 plants per treatment. These are results of a single experiment.

Fig. 3.12 Effect of P. zeae on the rice cultivars Nipponbare, Supa and Basmati. A; -number of nematodes per plant while B; -number of nematodes per gram of fresh root weight. Data represent mean and standard error of 8 plants per treatment. These are results of a single experiment. 3.4.5 Soil characteristics

Table 3.3 shows the results of the soil composition tests for the different sampling locations. Strikingly, soils from Kwale had less carbon, nitrogen and phosphorus. However, the C/N ratio was the highest in soils from Kwale compared to soils from other locations. In Ahero, soils were found to contain high amount of phosphorus. All soils from the five locations are slightly acidic, although those from Kwale could be somewhat more acidic than those from other locations (Table 3.3).

Table 3.3 Soil analysis results.

Phosphorus Ecosystem Sites pH % Carbon % Nitrogen C/N ration (mg P kg−1) Irrigated Mwea 5.88 2.15 0.12 6.36 17.9 Ahero 5.83 3.72 0.21 29.97 17.7 Upland Siaya 5.13 2.08 0.14 4.90 14.9 Busia 5.12 2.52 0.12 6.38 21.0 Kwale 5.10 0.82 0.03 6.23 27.3 Analysis of soil pH was conducted according to Otinga et al. (2013). Organic carbon and nitrogen contents were determined following the protocol of Okalebo et al. (2002), while extractable soil phosphorus was determined according to Olsen et al. (1954). 3.5 Discussion

The objective of this study was to perform a survey to determine the presence of plant-parasitic nematodes of rice in Kenya and the factors influencing their occurrence or distribution. After surveying irrigated and upland rice fields, only two parasitic nematodes namely P. zeae and Aphelenchoides sp. were found. Considering its economic importance, P. zeae was selected and studied further to validate its taxonomy and phylogeny as well as its effect on local (Kenyan) rice varieties. Additional morphological (SEM and LM), morphometric and DNA-based results were congruent with previously described characteristics of P. zeae (Castillo and Vovlas, 2007). The nematode showed a pointed tail shape, four lateral fields, round, small and empty spermatheca, 27 tail annuli and three labial annuli (Fig. 3.8). These observations are key features of P. zeae (Baujard et al., 1990; Castillo and Vovlas, 2007; Troccoli et al., 2016). The intraspecific variations among D2-D3 and ITS sequences of P. zeae detected in this study were within the accepted ranges reported in the literature. For example, Subbotin et al. (2008) and Wang et al. (2015) have detected D2-D3 sequence variations of 0.1-5.9% and 0-8.3% among P. zeae populations, respectively. Another study has detected an intraspecific variation of 19.4-21.3% among ITS sequence of P. zeae populations (Wang et al., 2015). Other studies have also detected intraspecific variations among sequences of different plant-parasitic nematodes (Blok et al., 1998; Subbotin et al., 2008; De Luca et al., 2012).

No plant-parasitic nematodes were isolated from the irrigated ecosystems, which contrasted the hypothesis that monocropping, that is followed in the irrigated ecosystems, favoured the reproduction and multiplication of nematodes. It has been suggested that certain long-term monocultures can reduce populations of Pratylenchus spp. (Andersen, 1975; Castillo and Vovlas, 2007). For instance, continuous monocropping of barley has been shown to increase steadily the populations of P. crenatus and P. neglectus in the first three years of cultivation, however, as cultivation is extended beyond the third year, the populations of these nematodes were found to decrease gradually and stabilise at lower levels (Andersen, 1975). Importantly, the rice cultivars Basmati and Supa, which are commonly cultivated in Kenya are resistant to P. zeae (reproduction <1), again confirming the results as to why there were only few nematodes recovered in rice in Kenya. Basmati, popularly known as Kenya Pishori, is preferentially cultivated in Mwea, the largest irrigation scheme in Kenya. Continuous cultivation of resistant

55 cultivars has been shown to reduce nematode populations below the economic threshold levels (Castillo and Vovlas, 2007).

It can also be argued that the soil properties in Kwale were favourable for the growth and reproduction of P. zeae. Kwale soils contained the lowest amount of carbon and nitrogen, an indication of low organic matter amendment. Conversely, the highest C/N ratio was found in soils from Kwale. It has been suggested that the efficacy of organic matter in nematode control increases with an increase of % N in amendment and a decrease of C/N ratio (Rodriguez- Kabana et al., 1987). Moreover, a C/N ratio > 20 may cause low nematicidal activity, probably due to slow decomposition of organic matter and inadequate concentration of released ammonia and other toxins capable of reducing nematode populations (Rodriguez-Kabana et al., 1987). Zasada, (2005) have shown that an increase in soil pH can increase nematode suppressiveness + by shifting the equilibrium in favour of the conversion of ammonium ion (NH4 ) to ammonia (NH3) which is more toxic to nematodes. Another study has shown that high P nutrition reduces the number of the burrowing nematode Radopholus citrophilus biotype 1 (currently Radopholus similis) in roots of rough lemon plants (Smith and Kaplan, 1988). Taken together, it seemed logical why nematodes were not found in Mwea, Ahero, Siaya and Busia. The presence of P. zeae on upland rice was not surprising. Indeed, in many countries, P. zeae has been found as one of the most damaging nematodes of upland-rice (Castillo and Vovlas, 2007; Biela et al., 2015). It is also a serious pest of maize, sugarcane and tobacco (Kimenju et al., 1998; Castillo and Vovlas, 2007).

The response of rice to P. zeae was shown to be cultivar-dependent. Supa and Basmati are resistant (reproduction factor <1) compared to Nipponbare which is susceptible (reproduction factor >1), thus corroborating the results of Plowright et al. (1999) who found O. Sativa genotypes to be susceptible to P. zeae. Moreover, all the three tested cultivars were tolerant to P. zeae infection, based on the results that data of plant variables (total, root and shoot dry weight) was not significantly different between control and nematode-infected plants. Recently, Supa was found be partially resistant to the root-knot nematode M. graminicola (Nzogela, unpublished). Genetically, Nipponbare, Supa and Basmati belong to different ecotypes and sub- populations, and probably have different effects on nematode reproduction. Nipponbare is a temperate japonica, while Supa and Basmati belong to indica and aromatic rice ecotypes, respectively (Kayeke et al., 2007; Bourgis et al., 2008). Rice genotypes belonging to the temperate japonica have been found to be generally highly susceptible to the root-knot nematode M. graminicola followed by those in tropical japonica, aromatic, indica and aus rice genotypes (Dimkpa et al., 2015).

In summary, evidence is provided that nematodes are present in upland rice ecosystems, but not in the irrigated rice ecosystems in Kenya. Soil properties and cropping systems could affect the distribution of plant-parasitic nematodes. Some rice genotypes are resistant and tolerant to the migratory root-lesion nematode P. zeae. Importantly, these genotypes have been included in cropping systems and have greatly reduced populations of P. zeae and probably other nematode species.

3.6 Acknowledgements

The study was supported by grants from the Special Research Fund of Ghent University (GOA 01GB3013). Tina Kyndt is supported by an FWO postdoctoral fellowship, while Njira Njira Pili and T. Janssen have BOF scholarships from Ghent University.

Chapter 4

Adapted from: 4.0 Analysis of fungal endophytes associated with rice roots from irrigated and upland ecosystems in Kenya

Njira Njira Pili, Soraya C. França, Tina Kyndt, Billy A. Makumba, Robert Skilton, Monica Höfte, Richard K. Mibey and Godelieve Gheysen.

Published in Plant and Soil 405: 371-380. Doi: 10.1007/s11104-015-2590-6.

4.1 Abstract

Fungal endophytes are commonly associated with plants, and are considered an important component of crop production. They can influence plant growth and tolerance to biotic and abiotic stresses. The aim of this study was to analyse and identify endophytic fungi associated with rice roots in irrigated and upland ecosystems in Kenya, as an inventory for a future search for biological control and growth promoting agents. Fungi were isolated from the roots and selected based on culture characteristics. All selected isolates were sequenced using primers targeting the Internal Transcribed Spacer (ITS) region, Intergenic spacer (IGS) region and the gene encoding the translation elongation factor (TEF-1α). The species were determined by comparing their sequences with those of well characterised or type strains. Phylogenetic relationships among the species were used to identify their taxonomic groups, and distribution in the agroecosystems, especially for the Fusarium spp. Based on sequencing of the ITS region, 75 fungal isolates were identified as Fusarium-like, while the remaining 98 isolates were found to belong to different species representing other genera than Fusarium. A further analysis of the Fusarium spp., using concatenated IGS and TEF-1α sequences showed that these isolates belong to the F. oxysporum (FOSC) and F. fujikuroi (FFSC) species complexes. Within the FOSC isolates, a clear divergence was observed between isolates from irrigated and upland ecosystems, while in the FFSC this phenomenon was not observed. When the total number of species was considered, 27 species were identified in the irrigated ecosystems, while only 18 species were found in the upland ecosystems. More fungal species were found in the irrigated ecosystems than in the upland ecosystems. The fungi Talaromyces purpurogenus and Westerdykella angulata are recorded for the first time in rice roots. We propose that flooding may affect the assembly of endophytic fungi in rice roots, however, other factors such as rice cultivars, geographical locations, water and soil types and their movement down streams could also be important.

Keywords: Endophytic fungi, Paddy fields, Phoma epicoccina. Fusarium spp., Talaromyces spp., Curvularia spp.

4.2 Introduction

Fungal endophytes are microorganisms that internally colonise plant organs without causing symptoms, and they are broadly classified into clavicipitaceous (C-endophytes) and non- clavicipitaceous (NC-endophytes) groups according to phylogeny and life history traits (Rodriguez et al., 2009). The C-endophytes infect economically important grass species in the genera Festuca and Lolium and have been studied for more than 100 years (Clay, 1990; Di Menna et al., 2012). More recently, many other fungi, taxonomically distinct (NC-endophytes) and diverse, have been found to associate endophytically not only with grasses, but also with several other monocot and dicot plant species (Rodriguez et al., 2009; Higgins et al., 2011; Márquez et al., 2012).

The functional roles of endophytic fungi on plant communities are diverse and can vary depending on many factors, such as host, interaction with other microorganisms and environmental conditions. Several studies have shown the potential benefits of endophytic fungi for crops, especially concerning the stimulation of biomass production and the enhancement of resistance to herbivores, pathogens and abiotic stresses (Hamilton and Bauerle, 2012; Kleczewski et al., 2012; Aimé et al., 2013; Martinuz et al., 2013). However, fungal endophytes can be deleterious in some cases. Decrease of plant growth and facilitation of pathogen infection have been reported. In addition, endophytes can be latent pathogens (Márquez et al., 2012).

In spite of the potential impact of endophytes on crop performance, and considering the extent of studies on endophytic fungi on other grasses (Márquez et al., 2008; Ghimire et al., 2011; Higgins et al., 2011, 2014), it is remarkable that this group of fungi has received little attention in rice. Over the past two decades, only a few publications are available about their communities in rice. These fungi have been studied in few countries, more specifically in Italy, China, Malaysia and India (Fisher and Petrini, 1992; Tian et al., 2004; Naik et al., 2009; Vallino et al., 2009; Zakaria et al., 2010). Most of these studies have used morphology to characterise the fungal endophytes, but literature has shown that few taxonomic features can distinguish species especially those occurring in complexes (Jiménez-Fernández et al., 2010). Moreover, no studies have investigated root microbiota of rice in different ecosystems. Therefore, a more comprehensive study, which takes advantage of molecular tools, is required not only to describe the endophytic fungal communities in different rice ecosystems, but also to investigate their phylogenetic relationships.

In Kenya, as in other countries, rice faces many biotic and abiotic stresses that cause serious yield reductions. Among the biotic factors, diseases caused by Magnaporthe oryzae, Xanthomonas oryzae pv. oryzae (Xoo) and nematodes are serious, while salinity, drought, radiation and nutrition are primary abiotic stress factors (e.g. Dean et al., 2012; Mansfield et al., 2012; Kyndt et al., 2014; Nhamo et al., 2014). As the demand for rice is expected to increase by 50 million tonnes in the future (Mohanty, 2009), new technologies will be required to improve and sustain its production. The knowledge on rice ecosystems, including the characterization and management of above and below ground microbial communities is of great relevance towards achieving this goal (Lenné and Wood, 2011). Rice endophytic fungi may benefit their host by

60 protecting them from biotic and abiotic stresses as well as promoting their growth (Le et al., 2009; Redman et al., 2011; Su et al., 2013).

The two rice ecosystems found in Kenya are irrigated and upland. However, 95% of rice is grown under irrigation and only 5% is rain-fed (upland), grown mainly by smallholder farmers across the country (Muhunyu, 2012). Continuous monocropping of one or more rice cycles per year is a general practise in the irrigated ecosystems, while the upland ecosystems are typified by short- rotations of rice with other crops (Kuria et al., 2003). The irrigated ecosystems are continuously wet (completely submerged) from transplanting until harvesting, whereas the upland ecosystems (dryland) are characterised by fluctuating dry and wet conditions throughout the growing seasons (Grist, 1986). Only few plant species such as rice are adapted to grow in both ecosystems, and for that reason, this crop is an excellent model to study the dynamics of plant-endophyte interactions in different ecosystems.

The research questions on this study were: how the composition of different endophytic fungal populations differs between the irrigated and upland ecosystems, how the ecosystems affect isolates of endophytic fungal species, and to which taxonomic groups these endophytic fungi belong. Considering the fact that irrigated rice is continuously under water from transplanting to harvesting, it was hypothesised that irrigated rice was not colonised by endophytic fungi. Moreover, the monocropping system that was commonly practised in irrigated ecosystems was speculated to result in low fungal diversity. The aerobic conditions in upland ecosystems were hypothesised to favour more fungal growth and diversity. The objective of the present study was to characterise endophytic fungi of rice roots in irrigated and upland ecosystems in Kenya. The long-term goal is to identify endophytic strains that can promote rice growth or induce its resistance to plant-parasitic nematodes.

4.3 Materials and methods

4.3.1 Sampling and isolation of endophytic fungi

Root samples were collected as described in chapter 3. The roots were gently washed under running tap water and then surface-sterilised by immersion in 75% ethanol (v/v) for 30 s and 1% sodium hypochlorite (w/v) for 10 min (Yuan et al., 2010). They were rinsed with sterile distilled water and dried in between sterile paper towels before being cut into short (~ 6 mm) segments (Yuan et al., 2010). Thirty segments per sample were plated on potato dextrose agar (PDA) medium containing 150 mg L-1 tetracycline. The plates were incubated at 25°C in darkness and observed periodically for developing hyphae, which were sub-cultured onto fresh PDA media until pure cultures were obtained (Rosa et al., 2010).

4.3.2 Identification of endophytic fungi

The isolates were first selected according to phenotypic characteristics such as colony appearance, mycelium colour and growth rate on PDA medium (Gazis and Chaverri, 2010). All selected isolates were sequenced. Total genomic DNA was extracted from two-week-old cultures, using the ZR Fungal/Bacteria DNA MiniPrep™ kit (Zymo Research, USA), following the manufacturer‟s instructions. The ITS region, which is a general barcode for fungi, was primarily

61 used to identify all the isolates (Schoch et al., 2012). Isolates identified as Fusarium spp. using the ITS-sequences, were further characterised by amplifying their intergenic spacer (IGS) region and the gene encoding the translation elongation factor (TEF-1α). The IGS region has been recommended for the identification of F. oxysporum (Edel et al., 1995), while TEF-1α gives high resolution at species level for most Fusarium spp. (Geiser et al., 2004).

The ITS region was amplified using the ITS1-F (5′-TCCGTAGGTGAACCTGCGG-3΄) and the ITS4-R (5′-TCCTCCGCTTATTGATATGC-3′) primers (White et al., 1990). The 20 μl PCR mixture contained Bioneer pre-mix (Bioneer Corporation, South Korea), sterile-distilled water, 0.125 μM of each primer and 4.5 ng/μl DNA template. PCR reactions were performed as follows: 95°C for 5 min, followed by 40 cycles of 94°C for 30 s, 53°C for 45 s, 72°C for 30 s, and finally 72°C for 10 min. The IGS region was amplified using the PNFo-F (5‟-CCCGCCTGGCGCGTCCGACTC-3‟) and the PN22-R (5‟-CAAGCATATGACTACTGGC-3‟) primers (Edel et al., 1995). The 30 μl PCR mixture contained distilled water, 1xPCR buffer, 0.25 mM MgCl2, 0.5 mM dNTPs, 0.75 μM of each primer, 0.125U/μl Taq DNA polymerase (Fermentas, USA) and 3ng/μl DNA template. PCR reactions were performed as follows: 95°C for 5 min, followed by 35 cycles of 95°C for 35 s, 52°C for 35 s, 72°C for 45 s, and finally 72°C for 5 min. The primers EF1 (5'- ATGGGTAAGGA(A/G)GACAAGAC-3') and EF2 (5'-GGA(G/A)GTACCAGT(G/C)ATCATGTT-3') were used to amplify the TEF-1α region (Geiser et al., 2004). The 25-μl PCR mixture contained distilled water, 5xPCR buffer (Bioline, cat BIO-21106), 10 μM of each primer, 0.15U/μl MyTaq DNA polymerase (Bioline, cat BIO-21106) and 5ng/μl DNA template. The PCR products were purified using the GeneJET™ PCR purification kit (Fermentas, USA) and directly sequenced by the Sanger method at ILRI-BeCA Hub (Nairobi, Kenya) or sent to LGC genomics (Berlin, Germany) using the ITS4-R, PN22-R and EF1 primers for the ITS, IGS and TEF-1α sequences, respectively.

Sequences were edited and assembled using the CLC Main Workbench (version 6.9.1) software (CLC bio-Qiagen, Denmark). Blast searches were performed against the NCBI nucleotide databases. Isolates identified as Fusarium spp. were further analysed in the Fusarium-ID and Fusarium MLST Fusarium-specific databases (Aoki et al., 2014). Because there are many ITS reference sequences in public databases that are wrongly characterised, identification of isolates with this marker relied on sequences of type (well-characterised sequences from peer-reviewed publications) strains and phylogeny (Ko-Ko et al., 2011). Sequences with ≥ 98% identity to the most homologous type (well-characterised) strain-sequences were identified up to species level. Sequences with identities ≥ 95% but < 98% were identified up to genus level, and “unknown species” were assigned to sequences with identity < 95% (Rosa et al., 2010; Gonçalves et al., 2012). The nucleotide sequences obtained in this study with 95% to 99% identity to type (well- characterised) strain-sequences were deposited at the NCBI database (Supplementary Table 4.1 and 4.2). Accession numbers of sequences with 100% identity to our sequences were adopted. Fusarium spp. only identified using the ITS-region were classified as Fusarium-like.

4.3.3 Phylogenetic analysis

Phylogenetic relationships among the species were analysed using MEGA 5.05 (Tamura et al., 2011), where the neighbour-joining method was used to draw the phylogenetic trees and to estimate the evolutionary distances. Bootstrap analysis was run using 1000 replicates to estimate the robustness of the phylogenetic clusters. Cantharellales and Mucorales, also collected in this survey, were used as out-group for non-Fusarium species. ITS sequences of the most homologous type or well-characterised strains were included during these analyses. For isolates identified as Fusarium spp. unrooted phylogenetic tree was constructed using concatenated IGS and TEF-1α sequences.

4.4 Results

4.4.1 Rice endophytic fungi from irrigated and upland ecosystems

A total of 173 fungal isolates were obtained: 88 from irrigated and 85 from upland ecosystems. Based on sequencing of the internal transcribed spacer of the rDNA, 75 fungal isolates were identified as Fusarium-like, while the remaining 98 isolates were found to belong to different species representing other genera than Fusarium (Supplementary Table 4.1 and 4.2). When the total number of species was considered, 27 species were identified in the irrigated ecosystems, while only 18 species were found in the upland ecosystems. Fusarium spp. dominated the upland ecosystems, while an assortment of species including Fusarium spp., Phoma epicoccina, Curvularia spp. and Talaromyces spp. were found in the irrigated ecosystems. Six species i.e. P. epicoccina (Syn. Epicoccum nigrum, E. purpurescens), Fusarium sp., F. nygamai, F. oxysporum, Penicillium thomii and Trichoderma harzianum were present in both ecosystems. Next to Fusarium spp., the other common taxa in the irrigated ecosystems were Curvularia and Talaromyces (Supplementary Table 4.1 and 4.2).

4.4.2 Phylogenetic relationships among fungal endophytes

A phylogenetic relationship of species representing other genera than Fusarium is shown in Fig. 4.1. The most frequently isolated species were ascomycetes, accounting for 25 species from the irrigated ecosystem and 16 species from the upland ecosystem. Two basidiomycetes were isolated only from the irrigated ecosystem whereas two zygomycetes were isolated from the upland ecosystem. Species from the irrigated ecosystem were found to belong to seven orders, whereas those from the upland ecosystem occurred in six orders. Eurotiales, Hypocreales and Pleosporales occurred in both ecosystems. Cantharellales, Capnodiales, Magnaporthales and Sordariales were present only in the irrigated ecosystem. The orders Botryosphaeriales, Mucorales and Trichosphaeriales were only represented in the upland ecosystem. Members of Pleosporales [eight species (29.6%)] and Eurotiales [seven species (25.9%)] were dominant in the irrigated ecosystem, while Hypocreales [seven species (38.9%)] dominated the upland ecosystems (Fig 4.2). A phylogenetic analysis of the Fusarium spp. using concatenated IGS and TEF-1α sequences showed that the isolated Fusarium specimens belonged to the F. oxysporum (FOSC) and F. fujikuroi (FFSC) species complexes. Within the FOSC isolates, a clear divergence was observed between isolates from irrigated and upland ecosystems, while in

FFSC, this phenomenon was not observed. Five clades were identified; two of them were formed within the FOSC representing isolates from either upland or irrigated ecosystems, while the remaining three clades (F. nygamai, Fusarium spp. 1 and Fusarium spp. 2) occurred within the FFSC (Fig. 4.3).

MBLA921-irrigated Penicillium ochrochloron (CBS 357.48) S5B1-upland Penicillium chrysogenum (CBS 355.48) ABLO4C2-irrigated and upland Penicillium thomii (FRR 2077) MBLA1142-irrigated Aspergillus terreus (ATCC 1012) KWAZ2B24-upland Eu rotiales Aspergillus flavus (CBS 100927) ABLN2B2-irigated Talaromyces radicus (CBS 100489) ABLO3A3-irrigated Talaromyces ucrainicus (CBS 162.67) T a laromycês spp. MBLA1012-irrigated 41 KWAZ2C11-upland ABLO2D2-irrigated Talaromyces purpurogenus (CBS 184.27)

1 00 MBLA941-irrigated Harpophora radicicola (CBS 149.85) ABLN3A1-irrigated and upland

100 Trichoderma harzianum (CBS 226.95) 67 33 MBLA412-irrigated Trichoderma asperellum (CBS 433.97) MBLA122-irrigated Cladorrhinum samala (CBS 303.90) ABLO7D2-irrigated 36 Chaetomium globosum (CBS 418.80) Ascomycota KWAZ2B13-upland JBotrvosp hae ria les Macrophomina phaseolina (UAMH 10586) ABLN1B1-irrigated Capnodiales 1 00 J Cladosporium cladosporioides (CBS 170.54) B5B1-upland Trichosp hae ria les 96 100 J Nigrospora oryzae (CBS 113884) MBLA231-irrigated Westerdykella angulata (CBS 610.74) ABLO1B2-irrigated Westerdykella purpurea (CBS 297.75) S2B3-upland Periconia macrospinosa (KS00100) MBLA1313-irrigated Microsphaeropsis arundinis (CBS 100243) MBLA414-irrigated Pyrenochaetopsis leptospora (CBS 101635) B4B1-irrigated and upland P loosporales 73 Phoma epicoccina (CBS 173.73) 90 B2B1-upland Peyronellaea prosopidis (CPC 21698) KWAZ2B2A-upland 65 100 Edenia gomezpompae (JLCC 34533) ABLK1A1-irrigated Alternaria alternata (CBS 916.96) ABLK2B3-irrigated Curvularia aeria (CBS 294.61) MBLA133-irrigated Setosphaeria rostrata (CBS 467.75)

1 00 MBLA212-irrigated Thanatephorus sp. CBS 273.38 98 ABLK3B1-irrigated ~""""'"'"' ~ --·~"""' 100 l Ceratorhiza oryzae-sativae CBS439.80

100 S6B1-upland Mucor ramosissimus CBS 135.65 KWAZ2A12-upland l""~- ,.. ,~,,~--' 100 Gongronella butleri CBS 216.58

0 .05

Fig. 4.1 Phylogenetic relationships of the fungal endophytes and their reference sequences (in bold). The tree was constructed using the neighbour-joining method based on ITS-sequences and rooted with Cantharellales (basidiomycetes) and Mucorales (zygomycetes) species. Bootstrap values in percentage (based on 1000 replicates) are shown on the nodes. Species were classified into orders according to Thongkantha et al. (2009); Chomnunti et al. (2011); Zhang et al. (2012); Hyde et al. (2013) and MB: MycoBank, (http://www.mycobank.org/).

Fig. 4.2 Distribution of fungal species within ..~ :J ·o 1 individual orders ..f]; ïi ~ s -u • ~ 3 ( ;) 2 . L. l " [ o.L ~ I I I I 0 n

Funeal orders • lrrleated ecosystem 0 Uplllnd eeosystem

F. oxysporum (S9B4) F. oxysporum (S9A3) F. oxysporum (S9A4) F. oxysporum (S3A2) F. oxysporum (S3B1) F. oxysporum (S2B1) F. oxysporum (S1A1) F. oxysporum (S7A1) F. oxysporum (S6A5)

F. oxysporum (S8B2) FC:SC': JUil11 :»!:ttP31U11 t :ec tl OOMDitiC F. oxysporum (S9A2) F. oxysporum (B2A1) F. oxysporum (S1B2) F. oxysporum (S4B1) F. oxysporum (S2A4) F. oxysporum (ABLK3A3) F. oxysporum (MBLA1031) F. oxysporum (ABLN2A3) Fusarium sp. (ABLN2B3) F. nygamai (ABLO5A1) F. nygamai (ABLN2A2) F. nygamai (KWAZ2B11) .. F. nygamai (MBLA1421) F. nygamai (MBLA413) t · · "-~-· ··~ Fusarium sp. (S9B3) ] r.t.:odc:? r .. :o:... ri .ur .c,;:;: ?.unl.n;: Fusarium sp. (S9B2) Fusarium sp. (S4A4) Fusarium sp. (S4A3) Fusarium sp. (S4A1) Fusarium sp. (S2A3) " Fusarium sp. (S9B5) Fusarium sp. (S9B1) Cade 1:fJnro.T;co.1-Joald Fusarium sp. (S6A4) Fusarium sp. (KWAZ2B22) Fusarium sp. (KWAZ1B22) Fusarium sp. (B4A4) Fusarium sp. (KWAZ1A15)

11 I ~

Fig. 4.3 Tree of endophytic Fusarium isolates based on IGS and TEF-1α sequences. Bootstrap values in percentage (based on 1000 replicates) are shown on the nodes.

4.5 Discussion

This study has isolated and identified the endophytic fungal community of rice roots from irrigated and upland ecosystems in Kenya, where a total number of 39 different fungal species were identified. When compared with previous studies in other countries, this amount of species indicates the existence of a highly diverse community of fungal endophytes associated with rice in Kenya. In Italy, 31 fungal endophytes were isolated from leaves, sheaths and roots of rice cultivars grown in wet and dry conditions (Fisher and Petrini, 1992). A survey performed in Bhadra River Project Area, India, has detected 19 species of endophytes in leaves and roots of rice (Naik et al., 2009). The differences in communities among studies may not only reflect the influence of rice varieties and environmental conditions (Fisher and Petrini, 1992; Tian et al., 2004), but also be the result of heterogeneous methodological approaches used in plant sampling, surface sterilization, fungal isolation and identification (Porras-Alfaro and Bayman, 2011).

Remarkably, this study found more different fungal taxa in the irrigated than in the upland ecosystems. Continuous monocropping in the irrigated fields for instance may increase propagules of soil-borne fungi. In addition, flooding may increase the frequency of infection of endophytic fungi (De Battista, 2005; Manici and Caputo, 2009). Nevertheless, this difference may also be caused by site-specific factors in each agroecosystem; particularly the cropping systems, water regimes, rice cultivars, geographical locations and soil types (Fisher and Petrini, 1992; Carroll, 1995; Tian et al., 2004; Naik et al., 2009).

In agreement with previous studies on grass endophytes (Márquez et al., 2012) and references therein), ascomycetes were highly represented in our rice endophyte collection, followed by basidiomycetes and zygomycetes. Within the ascomycetes, most species belonged to Pleosporales, Eurotiales and Hypocreales. A clear difference in species between ecosystems has been detected in this study: in the irrigated rice, most species belonged to the Pleosporales and Eurotiales, while in the upland rice; members of the order Hypocreales were highly represented. The taxa Epicoccum and Talaromyces (formerly Biverticillium, a subgenus of Penicillium; (Samson et al., 2011) were dominant within the Pleosporales and Eurotiales, respectively. Among the Hypocreales, Fusarium species were the most common root endophytes of upland rice. Previously, these species were described in dryland rice and other plant species (Fisher and Petrini, 1992; Maciá-Vicente et al., 2008). However, we also found these species in rice roots from irrigated fields, which indicate that they are also present in wet conditions, although at a lower frequency. A phylogenetic analysis of the Fusarium spp. has shown that isolates from irrigated and upland ecosystems are different. The differences were detected even in isolates of the same species, supporting further the idea that ecosystems may play fundamental roles in species assemblages.

In the past, F. oxysporum, Aspergillus flavus, Cladosporium cladosporioides, Chaetomium globosum, Penicillium chrysogenum and P. epicoccina (syn. E. nigrum; E. purpurescens) were isolated, not only from rice roots but also from other tissues and organs (Fisher and Petrini, 1992; Naik et al., 2009). Some species such as Alternaria alternata, E. purpurescens, F. equiseti and

Nigrospora oryzae are seed-borne endophytes of rice (Fisher and Petrini, 1992). This forms a new record of T. purpurogenus and W. angulata from rice roots. Many species in this study have also been described in other plant species as endophytes, saprobes or pathogens (Márquez et al., 2012). F. oxysporum for instance is a serious pathogen of many crops (Fisher and Petrini, 1992; Dean et al., 2012) and references therein), but evidence also shows that some strains are non-pathogenic with endophytic life styles and may be beneficial to plants (Sikora et al., 2008) and references therein). An isolate of E. nigrum (strain P16) has been found to promote growth of sugarcane (Fávaro et al., 2012). ATCC 96794, another strain of E. nigrum was found to control brown rot disease of stone fruits (De Cal et al., 2009), yet emerging information has shown that E. nigrum can cause leaf spot disease in Lablab purpureus (Mahadevakumar et al., 2014). A. alternata is an opportunistic pathogen, but can occur as endophyte or saprobe on several crops (Fisher and Petrini, 1992; Guo et al., 2004; and references therein).

Endophytic fungi were isolated and identified from rice roots collected from agroecosystems in Kenya with most of the species were previously associated with rice and other plant species as endophytes, saprobes or pathogens. However, this study forms a new record of T. purpurogenus and W. angulata from rice roots. Our study has provided evidence that fungal communities colonising rice roots may be ecosystem-driven. Flooding may mediate the assembly of endophytic communities in rice, however, other factors such as rice cultivars, geographical locations and soil types should be investigated further. Fusarium spp. preferentially colonised roots of upland rice, while irrigated rice supported different fungal communities including Fusarium spp., P. epicoccina, Curvularia spp. and Talaromyces spp.

4.6 Acknowledgements

The study was supported by grants from the Special Research Fund of Ghent University (GOA 01GB3013), the MU-K VLIR-UOS program and Moi University. The authors wish to thank Alexander Schouten for technical advice on the analysis of Fusarium isolates. Bramwel Wanjala, Lien De Smet, Isabel Verbeke, Isabel Tilmant, Francesca Stomeo and the two anonymous reviewers are also highly acknowledged. Tina Kyndt is supported by an FWO postdoctoral fellowship, while Njira Njira Pili has a BOF-DOS scholarship from Ghent University. The authors are grateful for the financial support provided to the Biosciences eastern and central Africa Hub at the International Livestock Research Institute (BeCA-ILRI Hub) by the Australian Agency for International Development (AusAID) through a partnership between Australia's Commonwealth Scientific and Industrial Research Organisation (CSIRO) and the BeCA-ILRI Hub; and by the Syngenta Foundation for Sustainable Agriculture (SFSA); the Bill & Melinda Gates Foundation (BMGF); and the Swedish Ministry of Foreign Affairs through the Swedish International Development Agency (Sida), which made this work possible. They also acknowledge the technical support provided by SegoliP, the BeCA-ILRI Hub's sequencing and genotyping research support unit.

Conflict of interests

The authors declare that they have no conflict of interest.

Supplementary material

Supplementary Table 4.1: A total of 173 isolates from irrigated and upland rice ecosystems

Irrigated ecosystems/rice Upland ecosystems/rice Accession cultivars cultivars GenBank Representa Fungal species Most homologous Identity number Total accessio tive isolate (Current name) strain (%) (this Ahero Mwea Siaya Busia Kwale n number (this study) (IR2793801) (Basmati) (Nerica) (Nerica) (Supa) study) Alternaria 1 1 0 0 0 2 Alternaria alternata 99 KF46576 ABLK1A1 KJ584616 alternata CBS 916.96T (Syn. 1 Torula alternata MB#452904) Aspergillus 0 1 0 0 0 1 Aspergillus terreus 99 AY37387 MBLA1142 KJ584617 terreus ATCC 1012T 1 Aspergillus flavus 0 0 0 0 1 1 Aspergillus flavus 100 HM5600 KWAZ2B2 CBS 100927T (Syn. 55 4 Monilia flava MB#496075) Ceratorhiza 1 0 0 0 0 1 Ceratorhiza oryzae- 100 FJ23139 ABLK3B1 oryzae-sativae sativae CBS439.80 1 Chaetomium 1 0 0 0 0 1 Chaetomium 99 JN20991 ABLO7D2 KJ584619 globosum globosum CBS 4 418.80A Cladorrhinum 0 1 0 0 0 1 Cladorrhinum samala 99 FM95544 MBLA122 KJ159570 samala CBS 303.90 7 Cladosporium 1 0 0 0 0 1 Cladosporium 99 AY21364 ABLN1B1 KJ584620 cladosporioides cladosporioides CBS 0 170.54T(Syn. Penicillium cladosporioides MB#164821) Curvularia sp. 5 2 0 0 0 7 Curvularia aeria CBS 96 HE86185 ABLK2B3 KJ584621 294.61T (Syn. 0 Malustela aeria MB#333616) Edenia 0 0 0 0 1 1 Edenia 99 KC19360 KWAZ2B2 KJ159589

69 gomezpompae gomezpompae JLCC 1 A 34533 Gongronella 0 0 0 0 1 1 Gongronella butleri 99 JN20628 KWAZ2A1 KJ584630 butleri CBS 216.58 5 2 Harpophora 0 1 0 0 0 1 Harpophora 99 KM48484 MBLA941 KJ159572 radicicola radicicola CBS 4 149.85T Macrophomina 0 0 3 0 1 4 Macrophomina 99 EF57050 KWAZ2B1 KJ159594 phaseolina phaseolina UAMH 0 3 10586 Microsphaeropsis 0 1 0 0 0 1 Microsphaeropsis 98 JX49601 MBLA1313 KJ159574 arundinis arundinis CBS 0 100243 Mucor sp. 0 0 1 0 0 1 Mucor ramosissimus 96 JN20593 S6B1 KJ159595 CBS 135.65T 2 Nigrospora 0 0 0 2 0 2 Nigrospora oryzae 98 DQ21943 B5B1 KJ159597 oryzae CBS 113884 3 Penicillium 0 0 1 0 0 1 Penicillium 99 JX99710 S5B1 KJ584632 chrysogenum chrysogenum CBS 2 355.48T (Syn. Penicillium notatum MB#160571) Penicillium 0 4 0 0 0 4 Penicillium 99 GU98160 MBLA921 KJ159576 ochrochloron ochrochloron CBS 4 357.48T Penicillium thomii 1 0 0 2 0 3 Penicillium thomii 99 AY37393 ABLO4C2 KJ159577 FRR 2077T 4 Periconia 0 0 2 0 0 2 Periconia 99 FJ53620 S2B3 KJ159598 macrospinosa macrospinosa 7 KS00100 Peyronellaea 0 0 0 1 0 1 Peyronellaea 99 KF77718 B2B1 KJ159599 prosopidis prosopidis CPC 0 21698 Phoma 10 13 0 4 1 28 Phoma epicoccina 100 FJ42699 B4B1 epicoccina CBS 173.73T (Syn. 6 Epicoccum nigrum*) Pyrenochaetopsis 0 4 0 0 0 4 Pyrenochaetopsis 99 JF74026 MBLA414 KJ159586

70 leptospora leptospora CBS 2 101635 Setosphaeria 0 1 0 0 0 1 Setosphaeria rostrata 99 HE66403 MBLA133 KJ159579 rostrata CBS 467.75T 4 Talaromyces 6 1 0 0 0 7 Talaromyces 98 JN89937 ABLO2D2 KJ159580 purpurogenus purpurogenus CBS 3 184.27T (Syn. Penicillium rubrum MB#208886) Talaromyces sp. 1 0 0 0 0 1 Talaromyces radicus 96 JN89932 ABLN2B2 KJ159587 1 CBS 100489T (Syn. 4 Penicillium radicum MB#445182) Talaromyces sp. 2 0 0 0 0 2 Talaromyces 96 JN89939 ABLO3A3 KJ159581 2 ucrainicus CBS 4 162.67 Talaromyces sp. 1 1 0 0 0 2 Talaromyces 95 JN89934 MBLA1012 KJ159582 3 purpurogenus CBS 8 184.27T (Syn. Penicillium rubrum MB#208886) Talaromyces sp. 0 0 0 0 1 1 Talaromyces 96 JN89936 KWAZ2C1 KJ159602 4 verruculosus CBS 7 1 388.48T (Syn. Penicillium verruculosum MB#166576) Thanatephorus 0 1 0 0 0 1 Thanatephorus sp. 98 DQ27895 MBLA212 KJ159583 sp. CBS 273.38 0 Trichoderma 0 3 0 0 0 3 Trichoderma 99 AY38091 MBLA412 KJ584627 asperellum asperellum CBS 2 433.97 Trichoderma 2 0 3 0 4 9 Trichoderma 98 AY60571 ABLN3A1 KJ584626 harzianum harzianum CBS 3 226.95T Westerdykella 0 1 0 0 0 1 Westerdykella 99 GQ2037 MBLA231 KJ159584 angulata angulata CBS 57

610.74T (Syn. Eremodothis angulata MB#313944) Westerdykella 1 0 0 0 0 1 Westerdykella 98 AY94305 ABLO1B2 KJ159585 purpurea purpurea CBS 0 297.75 Fusarium-like. 8 11 36 6 14 75 Total 41 47 46 15 24 173 This identification is based on ITS sequences. ATCC: American Type Culture Collection. CBS: Centraalbureau voor Schimmelcultures, Utrecht, Netherlands. MB: MycoBank, (http://www.mycobank.org/). T: type strain (indicated with superscript ‟T” after the strain code). According to Arenal et al. (2000), P. epicoccina is a synonym of E. nigrum (*). Fusarium-like is a group of species hence it is not arranged in alphabetical order like the other species.

Supplementary Table 4.2: A total of 55 Fusarium spp. identified using IGS and/ or TEF-1α sequences.

Accession Identity Isolate Strain/isolate ID Most homologous sequence number (this (%) (this study) Fungal species study) NRRL/CBS number Fusarium-ID/MLST TEF-1α IGS

Fusarium armeniacum F. armeniacum NRRL 29133 FD_01305 HM744659 - 98 MBLA421 KT032958 Fusarium laceratum F. laceratum NRRL 20423 FD_01619 GQ505593 - 98 KWAZ1B23 KT032947 F. laceratum NRRL 20423 MLST type 4-a GQ505593 - 98 ” ” Fusarium nygamai F. nygamai NRRL13488 FD_01301 AF160273 - 99 KWAZ2B11 KJ159606 F. nygamai PUF025 - - HQ165892 99 ” KT032961 Fusarium nygamai NRRL 26421 MLST type 4-a HM347121 - 98.534 ” - Fusarium nygamai F. nygamai NRRL13488 FD_01301 AF160273 - 98 MBLA413 KJ159586 F. nygamai PUF025 - - HQ165892 99 ” KT032991 Fusarium nygamai NRRL 26421 MLST type 4-a HM347121 - 98 ” Fusarium nygamai F. nygamai NRRL13488 FD_01301 AF160273 - 99 S4A2 KT032955 Fusarium nygamai NRRL 26421 MLST type 4-a HM347121 - 99 ” ” Fusarium nygamai F. nygamai NRRL13488 FD_01301 AF160273 - 99 MBLA1421 KJ159639 F. nygamai PUF025 - - HQ165892 99 ” KT032993 Fusarium nygamai NRRL 26421 MLST type 4-a HM347121 - 99 ” Fusarium nygamai F. nygamai NRRL13488 FD_01301 AF160273 - 99 ABLN2A2 KJ159642 F. nygamai PUF025 - - HQ165892 98 ” KT032995 Fusarium nygamai NRRL 26421 MLST type 4-a HM347121 - 99 ” Fusarium nygamai F. nygamai NRRL13488 FD_01301 AF160273 - 99 ABLO5A1 KJ159636 F. nygamai PUF025 - - HQ16589 98 ” KT032990 Fusarium nygamai NRRL 26421 MLST type 4-a HM347121 - 99 ” Fusarium inflexum F. inflexum NRRL 20433T FD_01216 AF008479 - 99 S6A1 KT032952 F. inflexum NRRL 20433T AF008479 - 98.82 ” Fusarium oxysporum F. oxysporum NRRL 38551 FD_00745 - - 99.69 KWAZ2A22 KT032948 F. oxysporum NRRL 36471 - FJ985356 99.675 ” Fusarium oxysporum F. oxysporum NRRL 26225 FD_00117 (TEF-1 FJ985285 FJ985491 100 (99) B2A1 KJ159608 α) F. oxysporum NRRL 26437 FD_00151 - FJ985502 99 ” KT032963 F. oxysporum NRRL 22902 - - AY249409 99.072 ” F. oxysporum NRRL 38271 MLST type 171 FJ985361 - 100.000 ” Fusarium oxysporum F. oxysporum NRRL 26225 FD_00117 FJ985285 - 98 B2A2 KT032964

F. oxysporum NRRL 38271 MLST type 171 FJ985361 - 98.358 ” Fusarium oxysporum F. oxysporum NRRL 26225 FD_00117 FJ985285 - 99 S2A1 KT032951 F. oxysporum NRRL 38545 MLST type 222 FJ985409 - 99.681 ” Fusarium oxysporum F. oxysporum NRRL 38591 FD_00785 (TEF-1 FJ985379 FJ985613 99 (98) S9A4 KJ159613 α) F. oxysporum NRRL 45902 FD_00813 (IGS) - - 97.67 ” KT032969 F. oxysporum NRRL 26227T - DQ837683 DQ831898 98 (99) ” F. oxysporum NRRL 22902 - - AY249409 99.192 ” F. oxysporum NRRL 38270 MLST type 170 FJ985360 99.839 ” Fusarium oxysporum F. oxysporum NRRL 26225 FD_00117 (TEF-1 FJ985285 FJ985491 99 (99) S7A1 KJ159614 α) F. oxysporum NRRL 38315 FD_00594 (IGS) - - 99.14 ” KT032970 F. oxysporum NRRL 22902 - - AY249409 98.635 ” F. oxysporum NRRL 38545 MLST type 222 FJ985409 - 99.206 ” Fusarium oxysporum F. oxysporum NRRL 26225 FD_00117 (TEF-1 FJ985285 FJ985491 99 (98) S3B1 KJ159615 α) F. oxysporum F6337 FD_00922 (IGS) - - 98.58 ” KT032971 F. oxysporum NRRL 38545 MLST type 222 FJ985409 - 99.675 ” F. oxysporum NRRL 22902 - - AY249409 98.889 ” Fusarium oxysporum F. oxysporum NRRL 26178 FD_01194 (TEF-1 AF008503 - 99 S8B2 KJ159619 α) F. oxysporum NRRL 38315 FD_00594 (IGS) - - 99.15 ” KT032974 F. oxysporum NRRL 38591 MLST type 191 FJ985379 - 98.522 ” F. oxysporum NRRL 22902 - - AY249409 98.805 ” Fusarium oxysporum F. oxysporum NRRL 26225 FD_00117 (TEF-1 FJ985285 FJ985491 99 (98) S3A2 KJ159623 α) F. oxysporum NRRL 45902 FD_00813 (IGS) - - 98.58 ” KT032978 F. oxysporum NRRL 38545 MLST type 222 FJ985409 - 99.675 ” F. oxysporum NRRL 22902 - - AY249409 99.069 ” Fusarium oxysporum F. oxysporum NRRL 38591 FD_00785 (TEF-1 FJ985379 FJ985613 99 (99) S9A3 KJ159625 α) F. oxysporum NRRL 45902 FD_00813 (IGS) - - 98.57 ” KT032980 F. oxysporum NRRL 38591 MLST type 191 FJ985379 - 98.055 ” F. oxysporum NRRL 22902 - - AY249409 99.165 ” Fusarium oxysporum F. oxysporum NRRL 38591 FD_00785 (TEF-1 FJ985379 FJ985613 99 (98) S9B4 KJ159626 α) F. oxysporum NRRL 45902 FD_00813 (IGS) - - 98.01 ” KT032981

F. oxysporum NRRL 38591 MLST type 191 FJ985379 - 99.351 ” F. oxysporum NRRL 22902 - - AY249409 99.093 ” Fusarium oxysporum F. oxysporum NRRL 26225 FD_00117 (TEF-1 FJ985285 FJ985491 99 (98) S1A1 KJ159632 α) F. oxysporum NRRL 45902 FD_00813 (IGS) - - 98.22 ” KT032986 F. oxysporum NRRL 38545 MLST type 222 FJ985409 - 99.838 ” F. oxysporum NRRL 22902 - - AY249409 98.992 ” Fusarium oxysporum F. oxysporum NRRL 38591 FD_00785 FJ985379 - 99.68 S2A2 KT032954 F. oxysporum NRRL 38591 MLST type 191 FJ985379 - 99.676 ” Fusarium oxysporum F. oxysporum NRRL 26225 FD_00117 (TEF-1 FJ985285 FJ985491 99 (99) S6A5 KJ159634 α) F. oxysporum NRRL22546 - DQ837690 DQ831901 99 (99) ” KT032988 F. oxysporum NRRL 38545 MLST type 222 FJ985409 - 99.838 ” F. oxysporum NRRL 22902 - - AY249409 99.285 ” Fusarium oxysporum F. oxysporum NRRL 38591 FD_00785 FJ985379 - 99.53 S9A5 KT032956 F. oxysporum NRRL 38591 MLST type 191 FJ985379 - 99.522 ” ” Fusarium oxysporum F. oxysporum NRRL 38591 FD_00785 FJ985379 - 99.18 S1B3 KJ159633 F. oxysporum NRRL 38591 MLST type 191 FJ985379 - 99.494 ” KT032987 Fusarium oxysporum F. oxysporum NRRL 34087 FD_00386 (TEF-1 - - 99.84 S1B2 KJ159610 α) F. oxysporum NRRL 45990 FD_00891 (IGS) - - 98.11 ” KT032966 F. oxysporum NRRL 26227T - DQ837683 DQ831898 99 (99) ” F. oxysporum NRRL 38308 MLST type 189 FJ985377 - 99.839 ” F. oxysporum NRRL 22902 - AY249409 98.330 ” Fusarium oxysporum F. oxysporum NRRL 45990 FD_00891 (IGS) - - 97.89 MBLA1411 KJ159641 F. oxysporum NRRL 26227T - DQ831898 99 ” ” F. oxysporum NRRL 22902 - - AY249409 98.641 ” ” Fusarium oxysporum F. oxysporum NRRL 26225 FD_00117 (TEF-1 FJ985285 FJ985491 99 (98) S2B1 KJ159621 α) F. oxysporum F6337 FD_00922 - - 98.59 ” KT032976 F. oxysporum NRRL 38545 MLST type 222 FJ985409 - 99.187 ” F. oxysporum NRRL 22902 - - AY249409 98.890 ” Fusarium oxysporum F. oxysporum NRRL 26225 FD_00117 FJ985285 FJ985491 99 (99) S4B1 KJ159627 F. oxysporum CBS 280.85 FJ985285 - 100.000 ” KT032982 F. oxysporum NRRL 22902 - - AY249409 98.146 ” Fusarium oxysporum F. oxysporum NRRL 26225 FD_00117 (TEF-1 FJ985285 FJ985491 100 (99) S2A4 KJ159629 α)

F. oxysporum NRRL 38345 FD_00620 (IGS) - - 99.52 ” KT032984 F. oxysporum CBS 280.85 - FJ985285 - 100.000 ” F. oxysporum NRRL 22902 - - AY249409 98.794 ” Fusarium oxysporum F. oxysporum NRRL 38348 FD_00623 (TEF-1 FJ985389 - 98.73 MBLA1031 KJ159638 α) F. oxysporum F6156 FD_00920 (IGS) - - 96.57 ” KT032992 F. oxysporum NRRL 26227T - DQ837683 DQ831898 98 (99) ” F. oxysporum NRRL 38348 MLST type 201 FJ985389 - 98.703 ” F. oxysporum NRRL 22902 - AY249409 95.314 ” Fusarium oxysporum F. oxysporum NRRL 38348 FD_00623 (TEF-1 FJ985389 - 99 ABLK3A3 KJ159635 α) F. oxysporum F6156 FD_00920 (IGS) - - 95.58 ” KT032989 F. oxysporum NRRL 26227T - DQ837683 DQ831898 95 (97) ” F. oxysporum NRRL 38348 MLST type 201 FJ985389 - 98.856 ” F. oxysporum NRRL 22902 - - AY249409 95.108 ” Fusarium oxysporum F. oxysporum NRRL 38348 FD_00623 (TEF-1 FJ985389 - 98.91 ABLN2A3 KJ159640 α) F. oxysporum F6156 FD_00920 (IGS) - - 97.19 ” KT032994 F. oxysporum NRRL 38348 MLST type 201 FJ985389 - 99.919 ” F. oxysporum NRRL 22902 - - AY249409 95.270 ” Fusarium oxysporum F. oxysporum NRRL 38348 FD_00623 (TEF-1 FJ985389 - 99 MBLA1312 KT032957 α) F. oxysporum NRRL 22902 - AY249409 99.338 ” ” F. oxysporum NRRL 38348 MLST 201 FJ985389 - 99.338 ” ” Fusarium oxysporum F. oxysporum NRRL 38345 FD_00576 - DQ831898 (98) MBLA1323 KJ159644 F. oxysporum NRRL 22902 - AY249409 98.034 ” ” Fusarium oxysporum F. oxysporum NRRL 25420 FD_01064 (TEF-1 AF008512 FJ985472 98 (99) S9A2 KJ159622 α) F. oxysporum NRRL 45982 FD_00884 (IGS) - - 96.63 ” KT032977 F. oxysporum NRRL 38514 MLST type 219 FJ985406 - 97.815 ” F. oxysporum NRRL 22902 - AY249409 98.625 ” Fusarium oxysporum. F. oxysporum NRRL 25221 FD_00623 (TEF-1 AF160268 - 97 ABLN2B3 KJ159643 α) F. oxysporum NRRL 26227T - DQ837683 DQ831898 95 (97) ” KT022996 Fusarium sp. NRRL 26756 - - 99.171 ” Fusarium sp Fusarium sp. NRRL 26061 FD_01151 AF160303 - 99 B4A4 KT032965 Fusarium sp. NRRL 26756 - - 99.516 ” ”

Fusarium sp. Fusarium sp. NRRL 25221 FD_01179 AF160268 - 98 B5A1 KT032950 Fusarium sp. Fusarium sp. NRRL 25221 FD_01179 AF160268 - 97.75 S9B3 KT032968 Fusarium sp. NRRL 25346 - - 95.846 ” ” Fusarium sp. Fusarium sp. NRRL 25221 FD_01179 AF160268 - 98 S9B2 KJ159617 Fusarium sp. NRRL 25346 - - 95.867 ” KT032973 Fusarium sp. Fusarium sp. NRRL 25221 FD_01179 AF160268 - 99.03 S6A2 KT032953 Fusarium sp. Fusarium sp. NRRL 26061 FD_01151 AF160303 - 99 S4A1 KJ159624 Fusarium sp NRRL 26756 - - - 99.345 ” KT032979 Fusarium sp. Fusarium sp. NRRL 26061 FD_01151 AF160303 - 99 KWAZ1A15 KJ159604 Fusarium sp NRRL 26756 - - 99.836 ” KT032959 Fusarium sp NRRL 26756 (IGS) - - 99.903 ” Fusarium sp. Fusarium sp. NRRL 26061 FD_01151 AF160303 - 99 B4A5 KT032949 Fusarium sp NRRL 26756 - - 99.355 ” ” Fusarium sp. Fusarium sp. NRRL 26061 FD_01151 AF160303 - 99 S9B5 KT032967 Fusarium sp NRRL 26756 - - 99.317 ” ” Fusarium sp. Fusarium sp. NRRL 26061 FD_01151 AF160303 - 99 S6A4 KT032972 Fusarium sp NRRL 26756 - - 99.174 ” ” Fusarium sp NRRL 26756 (IGS) - - 97.345 ” ” Fusarium sp. Fusarium sp. NRRL 26061 FD_01151 AF160303 - 99 S9B1 KT032975 Fusarium sp NRRL 26756 - - 99.678 ” ” Fusarium sp. Fusarium sp. NRRL 26061 FD_01151 AF160303 - 99 S4A4 KJ159628 Fusarium sp NRRL 26756 - - 99.364 ” KT032983 Fusarium sp NRRL 26756 (IGS) - - 96.606 ” Fusarium sp. Fusarium sp. NRRL 26061 FD_01151 AF160303 - 99 S4A3 KJ159630 Fusarium sp NRRL 26756 - - 99.171 ” KT033002 Fusarium sp NRRL 26756 (IGS) - - 96.259 ” Fusarium sp. Fusarium sp. NRRL 26061 FD_01151 AF160303 - 99 S2A3 KJ159631 Fusarium sp NRRL 26756 - - 99.026 ” KT032985 Fusarium sp NRRL 26756 (IGS) - - 97.041 ” Fusarium sp. Fusarium sp. NRRL 26061 FD_01151 AF160303 - 98 KWAZ1B22 KJ159605 Fusarium sp. NRRL 26793 - - 100.00 ” KT032960 Fusarium sp NRRL 26756 - - 97.588 ” Fusarium sp. Fusarium sp. NRRL 26152 FD_01762 - - 99.35 KWAZ2B22 KJ159607 Fusarium sp. NRRL 26793 - - 99.352 ” KT032962 Fusarium sp. NRRL 26756 - - 97.603 ” Fusarium sp. Fusarium sp. NRRL 26756 - - 96.219 S8B1 KJ159618 Fusarium sp. F. oxysporum NRRL 38296 FD_00576 - DQ831898 (97) MBLA1122 KJ159645

F. oxysporum NRRL 22902 - AY249409 97.13 ” ” Note: T: type strains. Isolates were determined by comparing their sequences with those in Fusarium-ID (http://isolate.fusariumdb.org) and Fusarium MLST (http://www.cbs.knaw.nl/Fusarium) databases. Where an accession number was provided, a multiple alignment was conducted in the NCBI database. Percent similarity is provided in brackets for IGS sequences where accession numbers for both TEF-1α and IGS sequences are available. In situations where multiple strains of the same species are provided by the individual IGS or TEF-1 sequences, only the species name was adopted. The symbol,” represents similar isolate or accession number. IGS accession numbers are in-bold.

Chapter 5

5.0 The effects of the fungi Talaromyces purpurogenus (strain ABLO2D2), Piriformospora indica, Fusarium moniliforme and Fusarium oxysporum (strains Fo162, S2A1 and N2B3) on rice growth

5.1 Abstract

Endophytic fungi are potential bio-fertilizers that can be effectively utilised to improve crop production. They are abundantly found in plants. In rice, members of the genera Fusarium and Talaromyces were found in large numbers (chapter 4). The fungi Talaromyces purpurogenus (strain ABLO2D2; currently, Penicillium purpurogenum) and Fusarium oxysporum (strains S2A1 and N2B3) were selected and tested to determine their effect on the growth of Nipponbare, Kasalath and Dongjin. Piriformospora indica, F. moniliforme (currently, F. verticillioides, within the F. fujikuroi species complex) and F. oxysporum strain Fo162 were included as controls. Rice plants were inoculated separately with the six endophytic strains before being assessed for growth promotion effects in green house trials. Collectively, the effect of these endophytes on rice was largely influenced by the cultivar and the identity of the fungal strains/species. The rice cultivar Nipponbare was generally responsive to fungal inoculation, while Kasalath and Dongjin were either neutral or negatively influenced by fungal inoculations. The overall results of this study indicate that it may be possible to promote the growth of rice plants by inoculating them with endophytic fungi. However, the host-endophyte combination should be carefully selected.

Keywords: Fungal endophytes, rice cultivars, Fusarium fujikuroi, species complex

5.2 Introduction

The endophytic fungus Piriformospora indica can colonise several plant species, including rice, and stimulate biomass accumulation or seed production, most likely through increased up-take of N and P or production of hormones e.g. auxin (Sirrenberg et al., 2007; Camehl et al., 2010; Yadav et al., 2010; Jogawat et al., 2013; Varma et al., 2014; Bajaj et al., 2015). In plants, the uptake of phosphorus mostly occurs through the PiPT transporter. For instance, maize plants inoculated with the PiPT-knock down mutant of P. indica contained less phosphorus and generally acquired less biomass compared to plants inoculated with P. indica wild-type (Yadav et al., 2010). Some strains of F. moniliforme, e.g. Fe14 have been found to promote rice growth (Le et al., 2009). It should be noted that the name F. moniliforme is actually no longer in use and has been transferred to the species F. verticillioides in the F. fujikuroi complex. Species of the genera Talaromyces have been shown to colonise plants and promote growth, either by suppressing diseases and pests or producing metabolites that are directly assimilated by plants or indirectly involved in nutrient recycling. Marois et al. (1982) and Naraghi et al. (2012) have demonstrated that cotton, potato and egg-plants inoculated with T. flavus showed improvement of growth and yield compared to non-inoculated control plants. T. flavus produces 2-methylsorbic acid, sorbic acid, bromomethylsorbic acid and bromosorbic acid. These acids play essential roles in the biogeochemical cycling of phosphorus in natural and agricultural ecosystems (Wakelin, et al., 2004). The fungus Penicillium purpurogenum (syn. T. purpurogenus) has been shown to promote growth of pearl millet (Yadav and Tarafdar, 2011). The objective of this study was to determine the effect of the fungi T. purpurogenus strain ABLO2D2 and F. oxysporum (strains S2A1 and N2B3) on the growth of the rice cultivars Nipponbare, Kasalath and Dongjin. The primary hypothesis of this study was that endophytic fungi isolated from rice plants can promote growth independent of the rice cultivar.

5.3 Material and methods

5.3.1 Fungal species

The fungi used in this study are provided in table 5. 1. The strains S2A1, N2B3 and ABLO2D2 of the fungal species F. oxysporum and T. purpurogenus (syn. P. purpurogenum), respectively, were isolated from rice in Kenya (chapter 4). These isolates were selected because they were among the most abundant endophytes. They also sporulated well on PDA medium, and formed enough inocula within weeks. P. indica is a model root-endophytic fungus that can easily be cultured on artificial media, and has a wide host range (Peškan-Berghöfer et al., 2004). Like our isolates, F. oxysporum strain Fo162 was isolated in Kenya, although on a different host (tomato) (Hallmann and Sikora, 1994), and has been extensively studied in banana, tomato, squash, melon and pepper due to its beneficial effect on plant growth and resistance against different plant-parasitic nematodes (Table 2.3 and the references therein). Isolates of F. moniliforme (syn. F. verticillioides) e.g. Fe14 have been shown to promote rice growth and defence against the root-knot nematode M. graminicola (Le et al., 2009).

The fungi were cultured on PDA medium (DifcoTM) for 7-14 days at 25°C (Le et al. 2016). After incubation, 10 mL of sterilized water was added to the Petri-plates to wash the mycelia and spores (Le et al., 2009). The spores were separated from the mycelia by sieving the suspension through a 250 μM sieve-cloth (Prosep BVBA-SPRL, Zaventem, Belgium). The number of spores was determined using a hemacytometer (Thomas Scientific, Philadelphia, PA, USA), and their density was adjusted with sterilized (autoclaved) water to 1.5 x 106 spores per plant (Menjivar et al., 2012).

Table 5.1 Endophytic fungi used in the study.

Fungal species Strain Country Source of material Talaromyces purpurogenus ABLO2D2 Kenya This study Fusarium oxysporum S2A1 Kenya This study Fusarium oxysporum N2B3 Kenya This study Fusarium oxysporum Fo162 Kenya Dr. Schouten, A. (Bonn University) Piriformospora indica DSM11827 India Dr. Karl-Heinz Kogel (Giessen, Germany) Fusarium moniliforme - Uganda Dr. Schouten, A (Bonn University)

5.3.2 Plant materials and growth conditions

A preliminary study to detect endogenous endophytes of rice seeds showed that local (Kenyan) rice cultivars were already heavily infested with fungi. This prompted us to change the study cultivars to Nipponbare, Kasalath and Dongjin, which were less colonised by endogenous fungi. Nipponbare has become a model cultivar with the availability of many mutants, and the genome sequence (IRGSP, 2005). Genetically, Nipponbare, Kasalath and Dongjin belong to different rice ecotypes and sub-populations (Gamuyao et al., 2012, Kanamori et al., 2013), hence would provide good systems to test whether the responses of the endophytes to the plants are cultivar- dependent. Rice seeds were de-husked and surface-sterilised by soaking in 70% ethanol for 2 min and 6% sodium hypochlorite (NaOCl) for 15 min. Later, they were rinsed thoroughly with sterilised (autoclaved) water. Surface sterilised seeds were pre-germinated for three days at 30°C. After germination, seedlings were transplanted singly in PVC tubes filled with autoclaved Synthetic Absorbent Polymer (SAP) substrate (Reversat et al., 1999). The potting tubes with the seedlings were transferred in a climate chamber at 26°C under 12/12-h light regime (Nahar et al., 2011). The plants were watered and fertilised three times a week with 10 mL of full-strength Hoagland solution.

5.3.3 Inoculation experiments with endophytes

There were three experiments corresponding to the rice cultivar Nipponbare, Kasalath and Dongjin. In each experiment, there were two treatments consisting of 8 plants each: the non- treated controls and the fungal-treated plants. The endophyte-treated plants were inoculated twice with 1.5 × 106 fungal spores in 4.5 ml of water at the second and third week after transplanting (Fig. 5.1). The inoculum was applied as drenches at the bases of the plants (Martinuz et al., 2013). Control plants were drenched with 4.5 ml of water in a similar way. The

81 experiments were terminated six weeks after transplanting. At this data collection point, the plants were near the end of the vegetative growth stage.

Fig. 5.1 A scheme showing the inoculation process. Rice seeds were pre-germinated for 3 days and transplanted in SAP. The plants were inoculated with 1.5 x 106 spores/plant at the second and third week after transplanting. The experiments were terminated 6 weeks after transplanting. 2 wk, 3 wk, 5 wk and 6 wk represent second, third, fifth and sixth week after transplanting. 5.3.4 Measurement of shoot lengths

To determine the effect of the endophytic fungi on plants during the period of interaction, shoot lengths were measured weekly from the base of the plant to the top of the longest leaf (Plowright et al., 1990). At each sampling point, the mean height of 8 fungal treated plants was compared with the mean height of 8 non-treated controls using the following formula.

Mean shoot length of 8 plants treated with fungus 푏 − mean shoot length of 8 control plants = Difference in shoot length at that point.

Where, b could be any of the six endophytic fungi i.e. T. purpurogenus (strain ABLO2D2), F. oxysporum (strain S2A1, Fo162 and N2B3), F. moniliforme and P. indica.

The experiments were terminated 6 weeks after transplanting when the plants were near the end of the vegetative growth stage. Two plants per treatment (in all experiments) were taken for other analyses like plating or histological studies, but the results were not convincing and therefore are not reported.

5.3.5 Measurement of dry weight

To minimise root damage or loss during data collection, each plant from the SAP tubes was submerged in water, and lightly shaken to release it from the substrate. The roots were rinsed several times with tap water until all visible SAP particles were removed (Bashan and de- Bashan, 2005). Later, they were dried in-between absorbent papers to drain-off excess water. Roots were separated from the shoots, and placed in paper bags. The samples were dried in an oven at 60°C for 48 hours (Atugala and Deshappriya, 2015). Roots and shoots of six plants in each treatment were weighed on a laboratory scale (Bashan and de-Bashan, 2005). The sum of root and shoot dry weight gave total dry weight of the plants.

5.3.6 Data analysis

All statistical analyses were performed in SPSS statistical software (SPSS Inc., Chicago, IL, USA). Normality tests were checked by applying the Kolmogorov-Smirnov test and visualised by box plots while Levene tests were applied to analyse the homogeneity of data. Later, the data on plant height and dry weight (total, root and shoot) were analysed using non-parametric tests after failing to meet the conditions of ANOVA. Data was considered significant at P<0.05.

5.4 Results

5.4.1 Shoot lengths

The purpose of this experiment was to screen different fungal strains for growth promotion of rice cultivars Nipponbare, Kasalath and Dongjin in order to select some strains for more detailed analyses of growth and defense promotion. The experiments were initially performed only once (this chapter), but selected strains were tested further (chapter 6 and 7). Rice plants were found to respond differently to fungal inoculation depending on the cultivar and the duration of the interaction. The fungus, T. purpurogenus strain ABLO2D2 did not cause a significant difference in shoot lengths of Nipponbare (Table 5.2) and Dongjin (Table 5.3) during the entire experimental period. However, a significant increase in shoot length was observed on Kasalath four weeks after inoculation (Table 5.4). F. oxysporum strain S2A1 significantly promoted shoot length of Nipponbare two and three weeks after inoculation (Table 5.2), while in Dongjin the fungus had no significant effect on shoot length at all time points (Table 5.3) and in Kasalath, a significant promotion of shoot length was only found at the second week of inoculation (Table 5.4). The strain N2B3 of the fungal species F. oxysporum significantly promoted the shoot length of Nipponbare at the second, third and fourth week of inoculation (Table 5.2), but showed no significant effect on shoot length of Dongjin at all time points (Table 5.3), and even caused a significant reduction of shoot length of Kasalath two weeks after inoculation (Table 5.4). F. oxysporum strain Fo162 significantly caused a decrease in shoot length of Nipponbare (Table 5.2) and Kasalath (Table 5.4) at the second week of inoculation. At the third week, the fungus caused a significant increase and decrease of shoot length of Nipponbare (Table 5.2) and Dongjin (Table 5.3), respectively. Moreover, F. oxysporum strain Fo162 decreased and promoted shoot lengths of Dongjin and Kasalath four weeks after inoculation, respectively (Tables 5.3 and 5.4). P. indica promoted shoot length of Nipponbare only at two weeks after inoculation (Table 5.2), while in Kasalath, growth reduction of shoot length was observed two weeks after inoculation (Table 5.4). In Dongjin, the fungus caused a significant reduction of shoot length at the third and fourth of inoculation (Table 5.3). In Nipponbare, the fungus F. moniliforme caused a strong reduction of shoot length two weeks after inoculation (Table 5.2), while in Dongjin a significant reduction of shoot lengths was observed three and four weeks after inoculation (Table 5.3) and in Kasalath, F. moniliforme caused a strong increase of shoot length two weeks after inoculation (Table 5.4).

Table 5.2 Effect of endophytic fungi on shoot length of Nipponbare. Measurements in cm.

Weeks Characte Untreated Treated Treated Treated Treated Treate Treate after fungal ristic control with TP with with with d with d with inoculation S2A1 N2B3 Fo162 PI FM 1 Height 41.50 41.13 44.25 41.31 40.44 42.79 40.44 SE ±0.95 ±0.51 ±1.56 ±1.77 ±1.44 ±0.99 ±1.80 Difference -0.37 2.75 -0.19 -1.06 1.29 -1.06 P value 0.769 0.157 0.338 0.380 0.372 0.449 2 Height 45.29 43.00 49.50 47.13 44.88 46.00 43.13 SE ±0.66 ±0.43 ±1.10 ±0.62 ±0.57 ±0.68 ±1.64 Difference -2.29 4.21* 1.84* -0.41* 0.71* -2.16* P value 0.061 0.001 0.000 0.000 0.000 0.000 3 Height 48.64 50.94 54.50 51.25 49.69 49.79 50.56 SE ±1.11 ±1.97 ±0.90 ±1.35 ±1.58 ±1.38 ±1.08 Difference 2.30 5.86* 2.61* 1.05* 1.15 1.92 P value 0.081 0.007 0.018 0.034 0.052 0.073 4 Height 52.86 57.69 56.69 53.13 53.81 52.14 53.69 SE ±1.27 ±1.92 ±1.04 ±1.47 ±1.05 ±1.73 ±1.67 Difference 4.84 3.83 0.27* 0.95 -0.72 0.83 P value 0.064 0.063 0.018 0.077 0.092 0.145 The difference in shoot length was obtained by comparing the height of fungal-treated and the control plants. Values represent means and standard error of 8 plants per treatment. The symbol * indicates significant differences at P<0.05. These are results of a single experiment. TP, -T. purpurogenus strain ABLO2D2; S2A1, -F. oxysporum strain S2A1; N2B3, -F. oxysporum strain N2B3; Fo162, -F. oxysporum strain Fo162; PI, -P. indica and FM, -F. moniliforme. Table 5.3 Effect of endophytic fungi on shoot length of Dongjin. Measurements in cm.

Weeks Characte Untreated Treated Treated Treated Treated Treated Treate after ristic control with TP with with with with PI d with fungal S2A1 N2B3 Fo162 FM inoculation 1 Height 47.81 44.75 47.50 49.83 44.44 46.13 43.69 SE 1.43 1.46 3.35 1.13 2.29 1.67 2.72 Difference -3.06 -0.31 2.02 -3.37 -1.68 -4.12 P value 0.244 0.358 0.164 0.183 0.251 0.244 2 Height 57.25 56.13 56.13 58.50 55.50 55.50 53.57 SE 0.60 1.54 3.20 0.94 1.76 1.25 2.55 Difference -1.12 -1.12 1.25 -1.75 -1.75 -3.68 P value 0.916 0.842 0.801 0.650 0.591 0.475 3 Height 60.50 59.31 59.63 62.25 55.69 60.31 58.06 SE 0.60 1.46 3.13 0.80 1.81 1.16 2.00 Difference -1.19 -0.87 1.75 -4.81* -0.19* -2.44* P value 0.832 0.307 0.170 0.024 0.036 0.033 4 Height 60.94 59.69 59.94 62.44 55.81 46.69 58.50 SE 0.59 1.39 2.48 0.84 1.80 8.87 1.74 Difference -0.95 -1.00 1.50 -5.13* -14.25* -2.44* P value 0.792 0.331 0.218 0.028 0.043 0.033 The difference in shoot length was obtained by comparing the height of fungal-treated and the control plants. Values represent means and standard error of 8 plants per treatment. The symbol * indicates significant differences at P<0.05. These are results of a single experiment. TP, -T. purpurogenus strain ABLO2D2; S2A1, -F. oxysporum strain S2A1; N2B3, -F. oxysporum strain N2B3; Fo162, -F. oxysporum strain Fo162; PI, -P. indica and FM, -F. moniliforme.

Table 5.4 Effect of endophytic fungi on shoot length of Kasalath. Measurements in cm.

Weeks Charact Untreate Treated Treated Treated Treated Treated Treated after fungal eristic d control with TP with with with with PI with FM inoculation S2A1 N2B3 Fo162 1 Height 57.38 57.44 55.95 56.25 52.44 53.93 57.00 SE ±0.74 ±0.55 ±1.24 ±2.77 ±2.47 ±1.06 ±1.00 Difference 0.06 -1.43 -1.13 -4.94 -3.45 -0.38 P value 0.832 0.723 0.757 0.389 0.102 0.110 2 Height 59.44 59.88 63.13 59.38 58.81 58.94 62.44 SE ±0.64 ±0.34 ±0.81 ±1.06 ±1.51 ±0.55 ±0.85 Difference 0.44 3.69* -0.06* -0.63* -0.50* 3.00* P value 0.291 0.007 0.013 0.037 0.031 0.009 3 Height 62.75 66.88 68.50 63.38 64.19 65.69 65.25 SE ±2.04 ±1.48 ±1.72 ±1.37 ±1.88 ±1.52 ±1.60 Difference 4.13 5.75 0.63 1.44 2.94 2.50 P value 0.093 0.094 0.063 0.117 0.160 0.174 4 Height 66.56 72.63 72.69 68.88 67.94 70.44 70.38 SE ±1.90 ±1.17 ±1.57 ±1.60 ±1.34 ±1.28 ±1.50 Difference 6.07* 6.13 2.32 1.08* 3.88 3.82 P value 0.031 0.077 0.059 0.038 0.051 0.071 The difference in shoot length was obtained by comparing the height of fungal-treated and the control plants. Values represent means and standard error of 8 plants per treatment. The symbol * indicates significant differences at P<0.05. These are results of a single experiment. TP, -T. purpurogenus strain ABLO2D2; S2A1, -F. oxysporum strain S2A1; N2B3, -F. oxysporum strain N2B3; Fo162, -F. oxysporum strain Fo162; PI, -P. indica and FM, -F. moniliforme. 5.4.2 Plant dry weight

The endophytic strains S2A1 and N2B3 of the fungal species F. oxysporum strongly improved total and root dry weight of Nipponbare, but had no effect on the dry weight of Kasalath and Dongjin (Fig. 5.2A and 5.2B). The fungus T. purpurogenus (strain ABLO2D2) significantly increased the total and root dry weight of Nipponbare, decreased total, root and shoot dry weight of Dongjin and had no effect on total and shoot dry weight of Kasalath (Fig. 5.3A). However, T. purpurogenus (strain ABLO2D2) showed negative effects on the root dry weight of Kasalath (Fig. 5.3A). Inoculation of rice plants with F. moniliforme had no effect on total, root and shoot dry weight of Nipponbare, decreased total dry weight of Dongjin, but had no effect on total, root and shoot dry weight of Kasalath plants (Fig. 5.3B). Inoculation of F. oxysporum strain Fo162 had no effects on total, root and shoots dry weight of Nipponbare and Kasalath, but caused significant decrease of total, root and shoot dry weight of Dongjin (Fig. 5.4A). The endophytic fungus P. indica significantly increased the total and root dry weight of Nipponbare, but showed no effects on the dry weight of Kasalath and Dongjin plants (Fig. 5.4B).

Fig. 5.2 Effect of F. oxysporum strain S2A1 (A) and F. oxysporum strain N2B3 (B) on dry weight of Nipponbare, Kasalath and Dongjin. Values represent means and standard deviation for 6 plants per treatment. For each cultivar, means with same letters within a plant variable (total, root or shoot dry weight) are not significantly different (P<0.05, Tukey‟s standardised range test). These are results of a single experiment. wt stands for weight.

Fig. 5.3 Effect of T. purpurogenus strain ABLO2D2 (A) and F. moniliforme (B) on dry weight of Nipponbare, Kasalath and Dongjin. Values represent means and standard deviation for 6 plants per treatment. For each cultivar, means with same letters within a plant variable (total, root or shoot dry weight) are not significantly different (P<0.05, Tukey‟s standardised range test). These are results of a single experiment. wt stands for weight.

Fig. 5.4 Effect of Talaromyces F. oxysporum strains Fo162 (A) and P. indica (B) on growth of Nipponbare, Kasalath and Dongjin. Values represent means and standard deviation for 6 plants per treatment. For each cultivar, means with same letters within a plant variable (total, root or shoot dry weight) are not significantly different (P<0.05, Tukey‟s standardised range test). These are results of a single experiment. wt stands for weight.

5.5 Discussion

The objective of this work was to screen T. purpurogenus (strain ABLO2D2; syn. P. purpurogenum), P. indica, F. moniliforme (syn. F. verticillioides) and F. oxysporum (strains S2A1, Fo162 and N2B3) for their effect on rice growth. The overall results of this study indicate that it may be possible to promote the growth of rice plants by inoculating them with endophytic fungi. The rice cultivar Nipponbare was generally responsive to fungal inoculation, while Kasalath and Dongjin are either neutral or are negatively influenced by fungal inoculation. The effects of these endophytic fungi on the rice cultivars differed mainly in the time course of the interaction. Previously, inoculation of F. oxysporum (strain Fo162) in tomato was shown to cause a significant increase in shoot dry weight only at the 9th week, but not at the 12th or 15th week after inoculation (Diedhiou et al., 2003). In Arabidopsis, the fungal endophyte P. indica only improved shoot dry weight from the 6th day of inoculation (Peškan-Berghöfer et al., 2004). In our experiments, none of the tested endophytes showed significant differences in shoot lengths during the entire period of interaction, but the trend was consistent between shoot measurements and dry weight (total, root and shoot) data. Although, the variation of data could be caused by different factors, we concur with the results of Mayerhofer et al. (2013) who showed that the host genotypes, the identity of fungal strains/species and the environmental conditions could be some of the factors. Genetically, Nipponbare, Kasalath and Dongjin belong to temperate japonica, aus and indica ecotypes and sub-populations, respectively (Gamuyao et al., 2012; Kanamori et al., 2013). Previously, plant genetic factors were shown to play fundamental roles during plant interactions with microorganisms (Marsh and Schultze 2001, Kistner and Parniske 2002, Mellersh and Heath 2003).

Addition of nutrients to the growing media could be the other source of variation. Most endophytic fungi require P and N albeit in small amount to initiate symbiotic interactions with the host plant (Ravel et al., 1997; Yang et al., 2014a; Gill et al., 2016). P. indica enhances plant biomass more efficiently in P-deprived conditions than in P-rich conditions (Gill et al., 2016). Under low N conditions, P. liquidambari increases yield and N use efficiency in rice by 12% and by 11.59%, respectively, where an increase in N-levels was found to seemingly weaken the beneficial effects (Yang et al., 2014a). Similarly, the fungus Neotyphodium lolii promotes growth of perennial ryegrass under N-deficiency conditions (Ravel et al., 1997). In Medicago truncatula, addition of nitrogen-free fertilizers or low amount of nitrogen in the medium (≤ 1 mM NH4NO3) supports nodulation and probably improves the beneficial effects (Journet et al., 2006). Conversely, Cheplick et al. (1989) found that the beneficial effect of endophytic fungi on ryegrass occurred when soil nutrients were not limited under greenhouse conditions. Moreover, inoculation of Pseudomonas syringae and P. fluorescens with mineral fertilizers further enhances the growth of shoots and roots of maize seedlings than when applied alone without fertilizers (Zafar-ul-Hye et al., 2015). Taken together, these examples show that it may be possible to promote growth by using different endophytic fungi, but the choice of the host-endophyte combination and the nutrient composition of the media should be carefully selected.

Alternatively, it can be hypothesised that the response of plants to fungal endophytes may be influenced by the lifecycle biology and colonisation patterns of the endophytes. P. indica and H. oryzae have biphasic lifestyles consisting of biotrophic and cell death phases (Jacobs et al., 2011; Su et al., 2013). The biotrophic phase is characterised by germination of chlamydospores and tissue penetration by hyphae, while in cell death phase, the fungi sporulate or forms microsclerotia (Jacobs et al., 2011; Su et al., 2013). In Arabidopsis and rice, root colonisation by P. indica and H. oryzae increases with tissue age, where the maturation zone is heavily colonised, while the meristematic and elongation zones are mostly free of hyphae (Jacobs et al., 2011; Su et al., 2013). Taking these examples, it can be argued that in plants, at any moment, there are different stages of fungal growth assuming that there are fresh colonisations in newly formed roots. Moreover, gene expression studies conducted with tissues collected at 3 days post fungal inoculation (dpfi) (biotrophic phase) showed a strong suppression of the marker genes for MAMP-triggered immunity (MTI) such as WRKY22, WRKY33 and WRKY53 and genes involved for SA pathway e.g. the CaM-binding protein 60-like.g (CBP60g) and the SALICYLIC ACID INDUCTION DEFICIENT 2 (SID2) (Jacobs et al., 2011). Conversely, genes involved in JA signalling like VSP2 are strongly activated upon inoculation of P. indica (Wang et al., 2009; Jacobs et al., 2011). As plant resources are allocated for defence, it is obvious that most fungi would suppress growth when establishing relationships with host plants as observed in our inoculation studies (Table 5.2, 5.3 and 5.4). Moreover, because of the different colonisation patterns during the interaction, the plants are assumed to continuously shift resource allocation between growth and defence, and this could be the reason for differential responses at the different time points. The results of our gene expression studies in chapter 7 may confirm this hypothesis.

Individually, the endophytic strains S2A1 and N2B3 of the fungal species F. oxysporum enhanced the growth of Nipponbare plants thereby mimicking the results of Le et al. (2009), who found that different strains of Fusarium spp. had growth promotion effect on rice plants. Martinuz et al. (2015) have shown that the fungus F. oxysporum strain Fo162 can promote the growth of Arabidopsis. In banana, the strains V5w2 and Emb 2.4o of the fungal species F. oxysporum have been shown to stimulate growth and yield (Waweru et al., 2014). Inoculation of T. purpurogenus (strain ABLO2D2) to Nipponbare showed a significant improvement of dry weight (total and root) hence corroborating the results of Yadav and Tafafdar, (2011), who found growth promoting effects on pearl millet inoculated with another strain of T. purpurogenus (syn. P. purpurogenum). T. flavus, a closely related species of T. purpurogenus has been shown to promote the growth of cotton and potato (Naraghi et al., 2012). Another study has shown that Chinese mustard plants (Brassica campestris var. chinensis) inoculated with Penicillium notatum (strain KMITL99), another relative of T. purpurogenus, had higher yield compared to non-treated control plants (Phuwiwat and Soytong, 2001). Similarly, this study has observed growth promotion effect with the fungus P. indica on Nipponbare. P. indica has been shown to promote growth of different plant species including rice (Waller et al., 2005; Verma et al., 1998; Varma et al., 1999; Das et al., 2014).

A number of studies have however reported negative effect of endophytic fungi on plants. Stein et al. (2008) have observed a strong reduction of root length of Arabidopsis plants inoculated with the endophytic fungus P. indica. Das et al. (2012) showed a significant reduction of root weight and thickness of the medicinal plant Coleus Forskohlii 6 months after inoculation with P. indica. Alternately, endophytic fungi can have neutral effect on their host plants. For example P. indica cannot promote shoot and root weight of Arabidopsis plants (Stein et al., 2008). The strains V5w2, Eny 7.11o and Emb 2.4o of the fungal species F. oxysporum have neutral effects on height, girth and number of functional leaves of banana cv. Grand Nain and Giant Cavendish in trials conducted on an experimental station and a farm (Waweru et al., 2014). No differences were also observed on the number of days to flowering and harvesting of the banana cv. Grand Nain and Giant Cavendish upon inoculation with these fungal strains (Waweru et al. 2014). In banana cv. Kibuzi, the strains Emb 2.4o and V5w2 of F. oxysporum also showed no effects on the girth and number of roots or fresh root weight (Paparu et al., 2009). Moreover, F. oxysporum strain Fo162 did not improve dry shoot weight of tomato at 12 and 15 week of infection (Diedhiou et al., 2003).

The strains T. purpurogenus (strain ABLO2D2) and F. oxysporum (strain S2A1), both isolated from rice in Kenya, were selected for further studies. F. oxysporum strain S2A1 showed growth promotion effects on Nipponbare at the shoot and root level. T. purpurogenus (strain ABLO2D2) was primarily chosen because it increased total and root dry weight of the model rice cultivar Nipponbare. Detailed analyses of these strains were needed to confirm their effect on plant growth, and to analyse their effect in rice resistance against the root-knot nematode M. graminicola. Results of these experiments are provided in chapter 6 and 7, respectively.

5.6 Acknowledgements

The study was supported by grants from the Special Research Fund of Ghent University (GOA 01GB3013), Institute of Molecular Phytomedicine (Bonn University) and COST Action FA1103. The authors wish to thank Alexander Schouten, Florian M.W. Grundler, Catherine W. Bogner, Gizela Sichtermann, Lien De Smet and Isabel Verbeke. Njira Njira Pili was supported by a BOF- DOS scholarship from Ghent University.

Chapter 6

6.0 The effects of Talaromyces purpurogenus (strain ABLO2D2) on rice growth and defence against the root-knot Meloidogyne graminicola

6.1 Abstract

The effects of Talaromyces purpurogenus (strain ABLO2D2; syn. Penicillium purpurogenum) on growth and defence of rice were investigated. Inoculation of plant with the fungus caused a reduction of shoot lengths of Nipponbare, although the differences were statistically significant 2 or 3 weeks after inoculation in experiment 2, and 1 week after inoculation in experiment 3. While in the first test (chapter 5) the fungus had a stimulating effect on Nipponbare growth (total and root dry weight), the second experiment (this chapter) showed neutral effects and in the third experiment (this chapter), the fungus even caused growth reduction in terms of the total and root dry weight. Moreover, inoculation of T. purpurogenus (strain ABLO2D2) reduced the penetration of M. graminicola juveniles at 3 days post nematode infection (dpni), but later supported the development and reproduction of the nematodes in roots, based on the higher number of egg masses found in the fungus-treated plants compared to the non-treated control plants at 21 dpni. These results indicate that T. purpurogenus (strain ABLO2D2) is not an ideal endophyte because its effect on plant growth cannot be predicted, but worse still it may enhance the infection of plant-parasitic nematodes.

Keywords: Talaromyces purpurogenus, rice nematodes, Nipponbare, Kasalath, Dongjin.

6.2 Introduction

Overdependence of chemical fertilisers for plant growth has been criticised by many environmentalists, who have proposed several approaches to reduce negative impact of chemical fertilisers, including the use of microorganisms (Botelho and Hagler, 2006), generally known as bio-stimulants. These organisms play direct and indirect roles in plant growth characteristics. In direct roles, their metabolites stimulate plant growth by providing soluble elements necessary for plant nutrition. Indirectly, they may reduce the disease pressure thereby promoting growth (Le Floch et al., 2003). Among these organisms are species of the genus Talaromyces that are mostly found in soil, organic materials undergoing decomposition (Domsch et al., 1980) and in plant tissues (endophytes). For instance, the fungus T. flavus (Klocker) can promote growth and yield of cotton, potato and egg-plants (Marois et al., 1982; Naraghi et al., 2012). P. purpurogenum (syn. T. purpurogenus) has been shown to promote growth of pearl millet (Yadav and Tarafdar, 2011), while P. notatum (strain KMITL99), another closely related species of Talaromyces spp., has been shown to improve growth and yield of Chinese mustard (Brassica campestris var. chinensis) plants (Phuwiwat and Soytong, 2001).

Importantly, T. flavus has been shown to control the soil-borne pathogens Verticillium dahliae, V. albo-atrum, Rhizoctonia solani, Sclerotinia sclerotiorum and S. rolfsii in cotton, potato, tomato, egg-plants and bean (Dutta, 1981; Marois et al., 1984; Madi et al., 1997; Tjamos and Fravel, 1997; Menendez and Godeas, 1998, Naraghi et al., 2006, 2010 a, b, c). The fungus P. purpurogenum produces lytic enzymes (β-1, 3-glucanase and chitanase) that antagonise the pathogenic fungi Monilinia laxa and F. oxysporum f. sp lycopersici (Larena and Melgarejo, 1996).

In chapter 5, the fungus T. purpurogenus (strain ABLO2D2) showed a significant growth promotion effect (total and root dry weight) on the model rice cultivar Nipponbare. In this chapter, experiments were conducted to confirm the results obtained in chapter 5 and analyse the ability of T. purpurogenus strain ABLO2D2 (syn. P. purpurogenum) in promoting rice resistance to the root-knot nematode M. graminicola.

6.3 Material and methods

6.3.1 Plant material and growth conditions

The rice cv. Nipponbare (GSOR-100; genetic stocks Oryza collection, Washington DC, USA) was used in all the experiments. Nipponbare has become a model cultivar with the availability of many mutants and the genome sequence (IRGSP, 2005). The seeds were de-husked and surface-sterilised by soaking in 70% ethanol for 2 min and 6% sodium hypochlorite (NaOCl) for 15 min. Later, they were rinsed thoroughly with sterilised autoclaved water. Surface sterilised seeds were pre-germinated for three days at 30°C. After germination, seedlings were transplanted singly in PVC tubes filled with autoclaved Synthetic Absorbent Polymer (SAP) substrate (Reversat et al., 1999). The potting tubes with the seedlings were transferred to a climate chamber at 26°C (or in rice room at 28°C) under 12/12-h light regime (Nahar et al., 2011). They were watered and fertilised three times a week with 10 mL of full-strength Hoagland solution.

6.3.2 The endophytic fungus

The endophytic fungus T. purpurogenus strain ABLO2D2 was originally isolated from irrigated rice in Kenya (chapter 4). The fungus was cultured on PDA medium (DifcoTM) for 7-14 days at 25°C (Le et al. 2016). After incubation, 10 mL of sterilized water was added to the Petri-plates to wash the mycelia and spores (Le et al., 2009). The spores were separated from the mycelia by sieving the suspension through a 250 μM sieve-cloth (Prosep BVBA-SPRL, Zaventem, Belgium). The number of spores was determined using a hemacytometer (Thomas Scientific, Philadelphia, PA, USA), and their density was adjusted with sterilized (autoclaved) water to 1.5 x 106 spores per plant (Menjivar et al., 2012).

6.3.3 The root-knot nematode M. graminicola

The root-knot nematode M. graminicola was provided by Prof. Dirk De Waele (Catholic University Leuven) and was originally isolated in the Philippines. A pure nematode culture was maintained in vivo on Nipponbare plants and grasses (Echinocloa crusgalli). Nematodes were extracted from infected plants using the modified Baermann method (Luc et al., 2005). After 48-h extraction, the suspension of nematodes were concentrated and counted. An inoculum of 300 active juveniles per plant was prepared.

6.3.4. Inoculation experiments with T. purpurogenus (strain ABLO2D2).

This experiment was performed to determine the effect of T. purpurogenus (strain ABLO2D2; syn. P. purpurogenum) on the growth of Nipponbare. The experiment had two treatments consisting of 8 plants each: the non-treated controls and the fungal-treated. The endophyte- treated plants were inoculated twice with 1.5 × 106 fungal spores in 4.5 ml of water at the second and third week after transplanting (Fig. 6.1). The inoculum was applied as drenches at the bases of the plants (Martinuz et al., 2013). Control plants were drenched with 4.5 ml of water in a similar way. The experiment was terminated 6 weeks after transplanting to determine plant weight (total, root and shoot dry weight).

Fig. 6.1 A scheme showing the inoculation process. Rice seeds were pre-germinated for 3 days and transplanted in SAP. The plants were inoculated with 1.5 x 106 spores per plant at the second and third week after transplanting. The experiment was terminated 6 weeks after transplanting. 2 wk, 3 wk, 5 wk and 6 wk represent second, third, fifth and sixth week after transplanting.

6.3.5 Measurement of shoot lengths

To determine the effect of endophytic fungi on plants during the period of interaction, shoot lengths were measured weekly from the base of the plant to the top of the longest leaf (Plowright et al., 1990). At each sampling point, the mean height of 8 fungal treated plants was compared with the mean height of 8 non-treated controls using the following formula:

Mean shoot length of the fungus treated plants − mean shoot length of control plants = Difference in shoot length at that point.

The experiments were terminated 6 weeks after transplanting when the plants were near the end of the vegetative growth stage.

6.3.6 Measurement of dry weight

To minimise root damage or loss during data collection, each plant in SAP tubes was submerged in water and lightly shaken to release it from the substrate. The roots were rinsed thoroughly with tap water until all visible SAP particles were removed (Bashan and de-Bashan, 2005). Later, they were dried in-between absorbent papers to drain-off excess water. Roots were separated from the shoots and placed in paper bags. The samples were dried in an oven at 60°C for 48 hours (Atugala and Deshappriya, 2015). Roots and shoots of each treatment were weighed on a laboratory scale (Bashan and de-Bashan, 2005). The sum of root and shoot weight gave total dry weight of the plants and were used as indices for plant growth.

6.3.7 Inoculation experiment with T. purpurogenus (strain ABLO2D2) and M. graminicola

This experiment was performed to determine the effect of T. purpurogenus (strain ABLO2D2; syn. P. purpurogenum) on rice resistance to the root-knot nematode M. graminicola. The experiment had two treatments consisting of 8 plants each: the non-treated controls and the fungal-pre-treated plants. Plants were grown as described above. Two weeks after the second fungal inoculation, nematode infections with 300 active J2 of M. graminicola were performed in rice plants pre-inoculated with (Fig. 6.2) or without T. purpurogenus (strain ABLO2D2). The plants were fertilised and maintained in a climate chamber as described before. Data collection was performed at 3 and 21 days post nematode infection (dpni). At the end of the experiment (week 8), the plants were at early reproductive stage. The roots were washed with tap water to remove the SAP. Later, the roots were boiled in acid fuchsin for 3-5 minutes, washed thoroughly in running tap-water and placed in acidified glycerol to de-stain (Nahar et al., 2011). The number of galls, juveniles (J2, J3/J4), females and egg masses were counted under the microscope.

Fig. 6.2 A scheme showing the inoculation process. Rice seeds were pre-germinated for 3 days and transplanted in SAP. The plants were inoculated with 1.5 x 106 spores at the second and third week after transplanting. Two weeks after the second fungal inoculation, the plants were infected with 300 active juveniles of the root-knot nematode M. graminicola. Data was collected at 3 and 21 dpni. The roots were stained with acid fuchsin, rinsed thoroughly and de-stained in acidified glycerol. The number of galls, juveniles (J2, J3/J4), females and egg masses was determined under the microscope. 2 wk, 3 wk, 5 wk and 6 wk represent second, third, fifth and sixth weeks after transplanting. 6.3.8 Data analysis

All statistical analyses were performed in SPSS statistical software (SPSS Inc., Chicago, IL, USA). Normality tests were checked by applying the Kolmogorov-Smirnov test and visualised by box plots, while Levene tests were applied to analyse the homogeneity of data. Later, the data on plant growth (height, total, root and shoot dry weight), number of galls, juveniles (J2, J3 and J4), females and egg masses were analysed using non-parametric tests after failing to meet the requirement for ANOVA. Data was considered significant at P<0.05.

6.4 Results

6.4.1 Growth promotion experiments

Following the positive effect of the fungal strain ABLO2D2 of T. purpurogenus on Nipponbare in chapter 5, the experiment was repeated to confirm the results. Like in chapter 5, rice plants were found to respond differently to fungal inoculation depending on the duration of interaction. In two independent experiments (Table 6.1), the fungus, T. purpurogenus (strain ABLO2D2) decreased shoot lengths of Nipponbare during the entire period of the experiments. However, the results were only significant 2 and 3 weeks after inoculation in experiment 2 and 1 week after inoculation in experiment 3 (Table 6.1). When dry weight (total, root and shoot) was measured, there was no significant difference between the control and fungal-treated plants in the second experiment (Fig. 6.3A). In the third experiment however, the fungus even caused significant reductions of total and root weight of Nipponbare (Fig. 6.3B).

Table 6.1 Effect of T. purpurogenus (strain ABLO2D2) on shoot length (cm) of Nipponbare.

Weeks after Experiment 2 Experiment 3 fungal Characteristic Untreated Treated with Untreated Treated with inoculation Control TP Control TP 1 Height 36.75 35.75 36.78 33.38 SE ±2.37 ±1.74 ±0.84 ±1.26 Difference -1.00 -3.40* P-value 0.740 0.035 2 Height 43.58 39.25 42.88 40.38 SE ±1.67 ±0.98 ±1.09 ±0.62 Difference -4.33* -2.50 P-value 0.045 0.153 3 Height 45.85 40.75 42.94 41.56 SE ±1.38 ±0.72 ±1.01 ±0.49 Difference -5.10* -1.38 P-value 0.008 0.366 4 Height 52.83 52.67 45.69 47.44 SE ±1.52 ±1.17 ±0.86 ±0.86 Difference -0.16 -1.75 P-value 0.936 0.266 The difference in shoot length was obtained by comparing the height of fungal-treated and the non-treated control plants. Values represent means and standard error of 8 plants per treatment. The symbol * indicates significant difference at P<0.05. These are results of two independent experiments. TP; -T. purpurogenus strain ABLO2D2.

Fig. 6.3 Effect of T. purpurogenus strain ABLO2D2 on growth of Nipponbare. Values represent means and standard error of 8 plants per treatment. For each variable (total, root and shoot dry weight), means with same letters are not significantly different (P<0.05, Tukey‟s standardised range test). These are results of two independent experiments. A and B represent data for experiment 2 and 3, respectively, while wt stands for weight. 6.4.2 Infection experiment with M. graminicola

To analyse if T. purpurogenus (strain ABLO2D2) could stimulate rice defence against the root- knot nematode M. graminicola, Nipponbare plants pre-treated with or without the fungus were inoculated with the nematode. At 3 dpni, the number of galls per plant between the control and the fungus-inoculated plants were significantly different (Fig. 6.4A). A similar trend was observed

99 when the number of galls was expressed per gram of root weight; although the results were not statistically different (Fig. 6.4B). At 21 dpni, the number of galls (Figs. 6.5A, B, C and D), second stage juveniles (J2) (Figs. 6.5E and F), third and fourth stage juveniles (J3/J4) (Figs. 6.6A and B) and females (Figs. 6.6C and D) of the root-knot nematode M. graminicola, expressed either per plant or per gram of root weight, were not significantly different between the control and the fungus-inoculated plants. However, there was a significant increase in the number of egg- masses in fungus pre-inoculated plants compared to the controls (Figs. 6.6E and F).

Fig. 6.4 Effect of T. purpurogenus strain ABLO2D2 on rice defence to M. graminicola at 3 dpni. Plants were inoculated with 1.5 x 106 spores of the fungal endophyte on the 2nd and 3rd week after transplanting. Two weeks after the second fungal inoculation, the plants were inoculated with 300 J2. Data represent means ± standard error of 8 plants per treatment. Data was considered significant at P < 0.05. A and B represent data expressed per plant or per gram of root weight, respectively.

100

Exp. 1.2: Ghent. 2014 (2 1 dpni) Exp. 1.2: Ghent, 2014 (2 1 dpni) a 16 a 16 -&. 14 ·;;; 14 T :;:: 1 e0 12 a ~ ~ a 0.. 10 0 10 T 8 T 8 1 1 6 6

4 4 ;z: 2 0 2

0 0 +---~----~------~----~--. J4. graminicola -'"- graminicola - ;z: M. graminicola M. graminicola + T.purpurogenus T.purpurogenus A 8

Exp. 2.1: Bollll, 2014 (21 dpni) Exp. 2.1: Bollll, 2014 (21 dpni) 50.0 - 50 ij, a a . ., 45 ~ § 40.0 .2: 40 T T 0 e ss ~ 1 1 ;- 30.0 ; 30 c Ol QD "' 25 "-' 5D 0 20.0 ~ 20 a i;) a. "' 15 a T a T 1 ~ .L ~ 10.0 "-' 10 0 ~ 5 ~ 0.0 +---'-----'---..---.1.------L---..., c 0 +---~----~----~--~----~----..., M graminicola M graminicola - ;z:"' M graminico/a _\{ graminicola - I. purpuragenus I.purpura genus c D

Exp. 1.2: Ghent. 2014 (21 dpni) Exp. 1.2: Ghent. 2014 (21dpni) 0.7 a 0 .7 -&. 0.6 a -~ 0 .6 0 a 0.. 0.5 e o.s ~ 0 a ~ 0.4 ~ 0.4 ~ ~ 5;, ~ 0.3 i;; 0 .3 0.. -"' E 0.2 t-:!"' 0.2 "' 0 ;z: ;;; -"' 0 .1

0 +---~----L---,---~----L---, ;z: 0 AL graminicola Af. graminicola .'vf. graminicola .V. graminicola - T.purpurogenus T.purpurogenus E F

Fig. 6.5 Effect of T. purpurogenus strain ABLO2D2 on rice defence to M. graminicola at 21 dpni. Plants were inoculated with 1.5 x 106 spores of the fungal endophyte on the 2nd and 3rd week after transplanting. Two weeks after the second fungal inoculation, the plants were inoculated with 300 J2. Data represent means ± standard error of 8 plants per treatment. Data was considered significant at P < 0.05.

101

Exp. 1.2: Ghent, 2.0 14 (21 dpni) Exp. 1.2: Ghent, 2014 (21 dpni) 3.5 3.5 a a 3 3

~ 0 0.. 25 u e 2.s a c. a :::!; 2 ;::.; "ëa 2 ~ i;;, T ~ 1.5 5 1.5 c.. 1 1 ~ 1

:::> ~ '--'"" ;z: 0.5 0 0.5 i; .<> o +--..J..--J_ ____,.--a....- ...L._---, 0 +--....1..-~-----,-~a....-...L._~ :::> J,f. grammicola }..f. graminicola - ;z: _\,f. grammicola ,\,f. graminicola - T.pwpurogenus T.purpurogenus A B

Exp. 1. 2: Ghent, 201d4 (2 1 pni) Exp. 1.2: Ghent, 2014 (21 dpni)

25 25 0

~ a <.-.-e Ie 20 a 0 c. 20 i; c.. a g", 15 ~ ...... 15 ;-.~ a ~ T ~ ~ ~ 10 8 10 T 1 i; <..- .<> 0 1 ~ 5 .<> 5

0 +--....1..---L--r--~-----. 0 M graminicola A!. graminicola - ,\,f. graminicola ,\,f. graminicola - T.purpurogenus T.pwpurogenus c D

Exp. 1.2: Ghent, 2014 (21 dpni) Exp. 1.2: Ghent, 2014 (21 dpni)

12 1 2 b T 10 "a b 8 1 i;;, 8 5 Q. 6 ~-:= 6 a "- OD ~ · ~ 4 4 gJi a ", ~ 2 0 2 T ~ ", .L ..0 0 0 _\,f. graminicola _\,f. grammicola - }..f. graminicola ,\,f. graminicola - T.pwpurogenus T.purpurogenus E F

Fig. 6.6 Effect of T. purpurogenus strain ABLO2D2 on rice immunity to M. graminicola at 21 dpni. Plants were inoculated with 1.5 x 106 spores of the fungal endophyte on the 2nd and 3rd week after transplanting. Two weeks after the second fungal inoculation, the plants were inoculated with 300 J2. Data represent means ± standard error of 8 plants per treatment. Data was considered significant at P < 0.05.

102

6.5 Discussion

Fungi isolated from plants can have adverse effects ranging from mutualism through commensalism to parasitism (Kogel et al., 2006; Fesel and Zuccaro, 2016). In the present study, T. purpurogenus (strain ABLO2D2; syn. P. purpurogenum) was tested to ascertain its effect on rice growth and resistance to the root-knot nematode M. graminicola. Results on plant growth showed that the fungus can reduce shoot lengths, although the results were not always significant. Measurements of dry weight provided equivocal results, where the fungus showed positive, neutral and negative effects in three independent experiments (Table 6.2). Collectively, the results show that within the first two weeks after inoculation, the fungus T. purpurogenus (strain ABLO2D2) causes a reduction of shoot length and depending on whether this effect is significant or not, the plants may/ or may not recover on the third and fourth week after inoculation (Table 6.2). Rice plants can recover, when the effect on shoot length in the first two weeks of inoculation is insignificant (experiment 1). However, a significant effect on the first or second week after inoculation makes the plants unable to recover, leading to neutral or negative effects (experiment 2 and 3). A strong effect on the plants during the first week of interaction may lead to negative effects (experiment 3).

Table 6.2 Effect of T. purpurogenus strain ABLO2D2 on shoot length (cm).

Experiment 1 Experiment 2 Experiment 3 Weeks after fungal Change in shoot length, Change in shoot length, Change in shoot length, inoculation treated vs control treated vs control treated vs control 1 -0.37 -1.00 -3.40* 2 -2.29 -4.33* -2.50

3 +2.30 -5.10* -1.38

4 +4.84 -0.16 -1.75 Effect Positive effect Neutral effect Negative effect

The symbol * indicates significant differences at P<0.05; N=8 plants per treatment. Results on nematode infection showed that this fungus may limit M. graminicola infection by reducing the penetration of juveniles. This finding corroborates the results of Martínez-Medina et al. (2016) who found less infection of the root-knot nematode M. incognita in tomato plants pre- treated with the endophytic fungus Trichoderma harzianum strain T-78. Similarly, root penetration by M. incognita juveniles was severely obstructed in tomato plants inoculated with the AM fungus Funneliformis mosseae (formerly, Glomus mosseae) (Vos et al., 2012a). F. oxysporum strain Fo162 also reduces penetration of M. incognita juveniles in tomato plants (Martinuz et al., 2013). The mechanisms leading to low penetration were not determined, but we suspect formation of structural barriers like lignin and callose deposits, production of toxic compounds as well as activation of hormone-regulated-defence pathways. In pepper plants (cv. CM334) for instance, reduction of the root-knot nematode M. incognita was accompanied by accumulation of phenolic compounds like chlorogenic acid (Pegard et al., 2005), while in tomato,

103 root exudates from AMF-infected plants paralysed and immobilised M. incognita juveniles (Vos et al., 2012a). In resistant soybean plants, suppression of M. incognita was mediated by the activation of the enzymes phenylalanine ammonia lyase and 4-coumaryl CoA ligase involved in the phenylpropanoid pathway, suggesting involvement of SA signalling (Edens et al., 1995). At 21 dpni, however, the number of galls between control and fungus-treated plants were comparable. Similarly, the number of J2, J3/J4 and females were not significantly different between the fungus-treated and non-treated control plants. Moreover, the number of egg masses was significantly higher in plants pre-inoculated with the fungus compared to non-treated controls, suggesting an increased development and reproduction of the nematodes upon fungal inoculation. It will be worth investigating to find out if the egg masses from fungal inoculated plants contained more eggs than those from the non-treated controls, and also if the eggs have higher viability. Also interesting will be the study of the infection, development and reproduction of the second generation juveniles. Previously, endophytes were found to promote disease development in plants (Clay, 1990). For instance, in cotton, the fungi F. etunicatus and F. mosseae were shown to enhance infection of the root-knot nematode M. incognita. The fungi Gigaspora heterogama, F. macocarpus and Endogone calospora promoted the densities of M. incognita in fungi-treated soybean plants compared to non-inoculated controls. In peanuts, infection of M. arenaria became more severe in presence of the fungi F. etunicatus or F. margarita (Hussey and Roncadorl, 1988).

Furthermore, beneficial fungi have been shown to promote bacterial and fungal diseases. For instance, root colonisation by AMF has been shown to enhance the infection of biotrophic pathogens and viruses (Shaul et al., 1999; Pozo and Azcón-Aguilar, 2007). AM fungi favour the incidence and severity of the powdery mildew disease (Pozo and Azcón-Aguilar, 2007). Similarly, the incidence and severity of necrotic lesions caused by the leaf pathogen Botrytis cinerea or the Tobacco Mosaic Virus (TMV) were found to be significantly higher in tobacco plants inoculated with the fungus F. intraradices (Shaul et al., 1999).

The overall results of this experiment indicate that T. purpurogenus strain ABLO2D2 can reduce the penetration of M. graminicola juveniles at early time points and then promote the development and reproduction of the nematodes in roots at later time points. The fungus also causes reduction of shoot lengths and depending on the magnitude of the effect; plants may or may not recover from the fungal inoculation. These results indicate that T. purpurogenus (strain ABLO2D2) is not an ideal endophyte because its effect on plant growth cannot be predicted, but worse still it may enhance the infection of plant-parasitic nematodes.

6.6 Acknowledgements

The study was supported by grants from the Special Research Fund of Ghent University (GOA 01GB3013), Institute of Molecular Phytomedicine (Bonn University) and COST Action FA1103. The authors wish to thank Alexander Schouten, Florian Grundler, Catherine Bogner, Gizela, Lien De Smet and Isabel Verbeke. Njira Njira Pili was supported by BOF-DOS scholarship from Ghent University.

104

Chapter 7

7.0 The effects of Fusarium oxysporum (strain S2A1) on rice growth and defence against the root-knot nematode Meloidogyne graminicola

7.1 Abstract

The effect of Fusarium oxysporum (strain S2A1) on growth promotion and defence of rice was investigated. In a first experiment (chapter 5), F. oxysporum (strain S2A1) improved total and root dry weight of Nipponbare, but not that of Kasalath or Dongjin. To confirm the results, the experiment was repeated with Nipponbare, but the results could not be reproduced, instead the fungus showed no effect on the total, root and shoot dry weight of the plants. In order to understand the physiological and biochemical changes in plants upon F. oxysporum (strain S2A1) inoculation, two approaches were applied: by measuring the hormone levels during the pre-challenge stage and the analyses of gene expression at the pre-challenge and challenge stages. Unfortunately, in both methods, the data was too variable to effectively predict the changes. When plants pre-inoculated with or without F. oxysporum (strain S2A1) were challenged with the root-knot nematode M. graminicola, there were no significant differences between the fungus-inoculated and non-treated controls at 12 days post nematode inoculation (dpni). At 21 dpni, the fungus significantly reduced the number of galls in two out of the three experiments conducted. Collectively, the results indicate that F. oxysporum strain S2A1 may not be effective against M. graminicola at early time points (12 dpni). However, at later time points (21 dpni), the fungus may reduce the infection of the nematode.

Keywords: Fusarium oxysporum, Meloidogyne graminicola, jasmonic acid, salicylic acid, hormone pathways.

105

7.2 Introduction

Although notorious for their pathogenic strains, it is becoming clear that within Fusarium oxysporum species, non-pathogenic strains can be found, which show endophytic life styles and may benefit their host plants. The endophytic strain Fo162 of the fungal species F. oxysporum has been shown to promote growth of Arabidopsis and induce defence responses against the root-knot nematode M. incognita (Martinuz et al., 2015). In tomato, Fo162 has consistently been shown to reduce the penetration, reproduction and development of M. incognita (Dababat et al., 2008; Martinuz et al., 2013). In banana, colonisation of Fo162 reduced penetration of Radopholus similis (Athman et al., 2006; Vu et al., 2006; Mendoza and Sikora, 2009). Menjivar et al. (2011) have shown that application of Fo162 on squash and melon reduced the penetration of M. incognita. Martinuz et al. (2012) have observed a reduction of aphids (Aphis gossypii) population on Fo162-inoculated plants compared to non-inoculated controls. V5w2, another strain of F. oxysporum, has been shown to reduce infection of the banana weevil Cosmopolites sordidus and the root-lesion nematodes R. similis, Pratylenchus goodeyi and Helicotylenchus multicinctus (Vu et al., 2006; Paparu et al., 2013; Waweru et al., 2014). The endophytic strain Fo47 of F. oxysporum is effective against wilt diseases (Fuchs et al., 1997; Aimé et al., 2008; Veloso and Díaz, 2012; Aimé et al., 2013). Le et al. (2009) have demonstrated that F. moniliforme (strain Fe14; syn. F. verticillioides) readily colonises rice plants and promote growth or resistance to M. graminicola.

The molecular and biochemical changes occurring in plants after inoculation of endophytes have not been analysed in details, especially in rice. In tomato, the protective fungus F. oxysporum strain Fo47 has been shown to prime plant defence against F. oxysporum f. sp. lycopersici by potentiating the expression of genes encoding acidic extracellular chitinase (CHI3), acidic extracellular β-1,3-glucanase (GLUA) and the pathogen-related protein 1 (PR-1a) (Benhamou et al., 1989; Cachinero et al., 2002; Kavroulakis, et al., 2006; Aimé et al., 2013). In pepper, F. oxysporum strain Fo47 up-regulates the expression of genes encoding basic PR-1 proteins, chitinase and sesquiterpene cyclase involved in phytoalexin biosynthesis (Veloso and Díaz, 2012). Another study has suggested accumulation of hormones as part of the plant defence mechanism. For instance, F. oxysporum (strain Fo47) has been shown to induce the accumulation of JA and SA in pepper to induce host resistance against the soilborne fungus Verticillium dahliae (Veloso et al., 2015).

The objectives of the present study were to confirm the effect of S2A1 on growth promotion of rice (chapter 5), analyse the molecular and biochemical changes occurring in plants after inoculation of this fungal strain and to test the ability of F. oxysporum (strain S2A1) in promoting rice defence against the root-knot nematode M. graminicola.

7.3 Materials and methods

7.3.1 Plant materials and growth conditions

The rice cv. Nipponbare (GSOR-100; genetic stocks Oryza collection, Washington DC, USA) was used in all the experiments. Nipponbare has become a model cultivar with the availability of

106 many mutants and the genome sequence (IRGSP, 2005). The seeds were de-husked and surface-sterilised by soaking in 70% ethanol for 2 min and 6% sodium hypochlorite (NaOCl) for 15 min. Later, they were rinsed thoroughly with sterilised (autoclaved) water. Surface sterilised seeds were pre-germinated for three days at 30°C. After germination, seedlings were transplanted singly in PVC tubes filled with autoclaved Synthetic Absorbent Polymer (SAP) substrate (Reversat et al., 1999). The potting tubes with the seedlings were transferred in a climate chamber at 26°C (or in rice room at 28°C or growth chamber at 28°C) under 12/12-h light regime (Nahar et al., 2011). They were watered and fertilised three times a week with 10 mL of full-strength Hoagland solution.

7.3.2 The endophytic fungus

The endophytic fungus F. oxysporum strain S2A1 was originally isolated from upland rice in Kenya (chapter 4). The fungus was cultured on PDA medium (DifcoTM) for 7-14 days at 25°C (Le et al. 2016). After incubation, 10 mL of sterilized water was added to the Petri-plates to wash the mycelia and spores (Le et al., 2009). The spores were separated from the mycelia by sieving the suspension through a 250 μM sieve-cloth (Prosep BVBA-SPRL, Zaventem, Belgium). The number of spores was determined using a hemacytometer (Thomas Scientific, Philadelphia, PA, USA), and their density was adjusted with sterilized (autoclaved) water to 1.5 x 106 spores per plant (Menjivar et al., 2012).

7.3.3 The root-knot nematode M. graminicola

The root-knot nematode M. graminicola was provided by Prof. Dirk De Waele (Catholic University Leuven) and was originally isolated in the Philippines. A pure nematode culture was maintained in vivo on Nipponbare plants and grasses (E. crusgalli). Nematodes were extracted from infected plants using the modified Baermann method (Luc et al., 2005). After 48-h extraction, the suspension of nematodes was concentrated and counted. An inoculum of 300 active juveniles per plant was prepared (Nahar et al., 2011).

7.3.4 Inoculation experiments with F. oxysporum strain S2A1

This experiment was performed to determine the effect of F. oxysporum (strain S2A1) on the growth of Nipponbare. The experiment had two treatments consisting of 8 plants each: the non- treated controls and the fungal-treated plants. The endophyte-treated plants were inoculated twice with 1.5 × 106 fungal spores in 4.5 ml of water at the second and third week after transplanting (Fig. 7.1). The inoculum was applied as drenches at the bases of the plants (Martinuz et al., 2013). Control plants were drenched with 4.5 ml of water in a similar way. The experiment was terminated 6 weeks after transplanting to determine plant weight (total, root and shoot dry weight).

To determine the effect of inoculum density, experiments were performed as described above except that three inoculation densities of F. oxysporum strain S2A1 were applied i.e. 1.5 x 105, 1.5 x 106 and 1.5 x 107 spores per plant.

107

Fig. 7.1 A scheme showing the inoculation process. Rice seeds were pre-germinated for 3 days and transplanted in SAP. The plants were inoculated with 1.5 x 106 (or 1.5 x 105 and 1.5 x 107) at the second and third week after transplanting. The experiments were terminated 6 weeks after transplanting to determine total, root and shoot dry weight of plants. 2 wk, 3 wk, 5 wk and 6 wk represent second, third, fifth and sixth week after transplanting. 7.3.5 Measurement of dry weight

To minimise root damage or loss during data collection, each plant in the SAP tubes was submerged in water and lightly shaken to release it from the substrate. The roots were rinsed thoroughly with tap water until all visible SAP particles were removed (Bashan and de-Bashan, 2005). Later, they were dried in-between absorbent papers to drain-off excess water. Roots were separated from the shoots, and placed in paper bags. The samples were dried in an oven at 60°C for 48 hours (Atugala and Deshappriya, 2015). Roots and shoots of each treatment were weighed on a laboratory scale (Bashan and de-Bashan, 2005). The sum of root and shoot weight gave total plant dry weight, an index for plant growth.

7.3.6 Inoculation experiments with F. oxysporum strain S2A1 and M. graminicola

This experiment was performed to determine the effect of F. oxysporum strain S2A1 on rice resistance to the root-knot nematode M. graminicola. The experiment had two treatments consisting of 8 plants each: the non-treated controls and the fungal-pre-treated plants. Plants were grown as described above. Two weeks after the second fungal inoculation, nematode infections with 300 active J2 of M. graminicola were performed in rice plants pre-inoculated with or without F. oxysporum (strain S2A1) (Fig. 7.2). The plants were fertilised and maintained in rice room or climate chamber as described before. Data collection was performed at 12 and 21 days post nematode infection (dpni). At 12 dpni the plants were near the end vegetative stage, while at 21 dpni, plants were at early reproductive stage. The roots were washed with tap water to remove the SAP. Later, the roots were boiled in acid fuchsin for 3-5 min, washed thoroughly in running tap-water and placed in acidified glycerol to de-stain (Nahar et al., 2011). The number of galls, nematodes (total) and females were counted under the microscope.

108

Fig. 7.2 A scheme showing the inoculation process. Rice seeds were pre-germinated for 3 days and transplanted in SAP. The plants were inoculated with 1.5 x 106 spores at the second and third week after transplanting. Two weeks after the second fungal inoculation, the plants were infected with 300 active juveniles of the root-knot nematode M. graminicola. Data was collected at 12 and 21 dpni. The roots were stained with acid fuchsin, rinsed thoroughly and de-stained in acidified glycerol. The number of galls, nematodes (total) and female was determined under the microscope. 2 wk, 3 wk, 5 wk and 6 wk represent second, third, fifth and sixth week after transplanting. 7.3.7 Isolation of F. oxysporum (strain S2A1) from roots

Roots were randomly sampled from a pool of eight fungus-treated and eight control plants. The roots were gently washed under running tap water and then surface-sterilised by immersion in 70% ethanol (v/v) for 30 sec and 0.05% sodium hypochlorite (w/v) for 2 min. The roots were later rinsed with sterile distilled water and dried in-between sterile paper towels before being cut into short (~ 6 mm) segments (Yuan et al., 2010). Thirty segments per sample were plated on potato dextrose agar (PDA) medium containing 150 mg L-1 tetracycline. The plates were incubated at 25°C in darkness and observed periodically for developing hyphae, which were sub-cultured onto fresh PDA media. Percent root colonisation was calculated using the following formula. 푛푢푚푏푒푟 표푓 푟표표푡 푠푒푔푚푒푛푡푠 푤푖푡푕 푓푢푛푔푖 푖푛 푎 푡푟푒푎푡푚푒푛푡 % 퐶표푙표푛푖푠푎푡푖표푛 = ∗ 100 푡표푡푎푙 푛푢푚푏푒푟 표푓 푠푒푔푚푒푛푡푠 푝푙푎푡푒푑 푖푛 푎 푡푟푒푎푡푚푒푛푡

7.3.8 Hormone measurements experiments

Two biological samples of roots and shoots containing a pool of 5 plants each were collected from fungus-inoculated and non-inoculated control plants at 7, 21, 24 and 28 days post fungal inoculation (dpfi) (Fig. 7.3). The plant materials were ground in liquid nitrogen and stored at - 80°C until use. Hormones were quantified according to Haeck et al. (2015; in preparation). Briefly, 100 mg of plant tissues (materials) were dissolved in modified Bieleski solvent, followed by filtration and evaporation and later separation of the chromatographs on a U-HPLC system (Thermo Fisher Scientific) equipped with a Nucleodur C18 column (50 x 2 mm; 1.8 µm dp) using a mobile phase gradient consisting of acidified methanol and water. Mass spectrometric analysis was carried out in selected-ion monitoring (SIM) mode with a Q Exactive™ Orbitrap mass spectrometer (Thermo Fisher Scientific), operating in both positive and negative electrospray ionization mode at a resolution of 70,000 full width at half maximum.

109

Fig. 7.3 A scheme showing the inoculation process. Rice plants were grown as described before and sampling for hormone measurements collected at 7, 14, 21 and 28 dpfi. At each sampling point, two biological replicates consisting of a pool of 5 plants each were collected. H1, H2, H3, and H4 represent the sampling points for hormone measurements. 2 wk, 3 wk, 5 wk and 6 wk represent the second, third, fifth and six week, respectively. 7.3.9 Data analysis

All statistical analyses were performed in SPSS statistical software (SPSS Inc., Chicago, IL, USA). Normality tests were checked by applying the Kolmogorov-Smirnov test and visualised by box plots, while Levene tests were applied to analyse the homogeneity of data. Later, the data on plant growth (total, root and shoot dry weight), hormone measurements and number of galls, total number of nematodes and females were analysed using non-parametric tests after failing to meet the requirements for ANOVA. The data was considered significant at P<0.05.

7.3.10 Isolation of RNA, cDNA synthesis, RT-PCR and Q-PCR

Samples for RNA extraction were collected at 7 (Ge 1), 21 (Ge 2), 24 (Ge 3) and 28 (Ge 4) dpfi (Fig. 7.4). Total RNA was extracted using NucleoSpin® RNA plant kit (Macherey-Nagel, Düren, Germany). First-strand cDNA was synthesised using the SuperScript II reverse transcriptase (Invitrogen) according to Kyndt et al. (2012). The quality of the cDNA was tested by performing a normal PCR with OsEXP reference genes (Table 7.1), and the amplicons visualised in a 1.5% agarose gel. The q-PCRs were performed using the SensiMixTM SYBR No-ROX Kit (GC biotech, Netherlands), in a 20 µl reaction mixture containing 10µl SensiMixTM, 7µl RNAse-free water, 1µl cDNA and 1µl 10mM of each primer. All reactions were performed in three technical replicates and two independent biological replicates in a q-PCR machine with the CFX ManagerTM software (Bio-Rad Laboratories, USA). The PCR conditions were as follows: 95°C for 10 min followed by 45 cycles of 95°C for 15 sec, 60°C for 15 sec and 72°C for 15 sec. Later, a melting curve was generated by a gradual increase of the temperature to 95°C to test the amplicons specificity. Two reference genes: OsEXPnarsai and OsEXP, were used to normalize the expression levels of the target genes (Table 7.1). Data was analyzed using the REST 2009 software (Qiagen).

110

Fig. 7.4 A scheme showing the inoculation process. Rice plants were grown as described before and sampling for hormone measurements collected at 7 (Ge 1), 21 (Ge 2), 24 (Ge 3) and 28 (Ge 4) dpfi. At each sampling point, two biological replicates consisting of a pool of 5 plants each were collected. Ge1, Ge 2, Ge 3, and Ge 4 represent the sampling points for gene expression studies. 2 wk, 3 wk, 5 wk and 6 wk represent the second, third, fifth and six week, respectively. Table 7.1 List of primers used in this study

Gene GenBank accession Forward and Reverse Primers (5ʹ-3ʹ) Function number OsEXP LOC_Os03g27010 F:TGTGAGCAGCTTCTCGTTTG Reference R:TGTTGTTGCCTGTGAGATCG OsEXPnarsai LOC_Os07g02340 F:AGGAACATGGAGAAGAACAAGG Reference R:CAGAGGTGGTGCAGATGAAA OsJAMyb LOC_Os11g45740 F:GAGGACCAGAGTGCAAAAGC JA response R:CATGGCATCCTTGAACCTCT OsEIN2a LOC_Os07g06130 F:TAGGGGGACTTTGACCATTG ET signalling R:TGGAAGGGACCAGAAGTGTT OsPAL1 LOC_Os02g41630 F:TGTGCGTGCTTCTGCTGCTG SA R:AGGGTGTTGATGCGCACGAG biosynthesis OsWRKY45 LOC_Os05g032390 F:AATTCGGTGGTCGTCAAGAA SA response R:AAGTAGGCCTTTGGGTGCTT OsGH3.1 LOC_Os01g57610 F:GCAATGGAACAAAAGCAAGGA Auxin response R:CAGATCATCACCCTCTAGCTTCAA 7.4 Results

7.4.1 Root colonization by F. oxysporum strain S2A1

The endophytic strain S2A1 of the fungal species F. oxysporum was only re-isolated from inoculated plants, but colonisation rate seemed to be influenced by concentration (inoculum density). At low concentrations of 1.5 x 105 and 1.5 x 106, colonisation was about 4-6 %, which increased to 26 % at a concentration of 1.5 x 107 (Fig. 7.5).

111

Fig. 7.5 Root colonisation by F. oxysporum strain S2A1. Re-isolation of F. oxysporum (strain S2A1) from the root system of rice cv. Nipponbare was determined 6 weeks after transplanting (i.e. 4 weeks after fungal inoculation). These are results of a single experiment. 7.4.2 Growth promotion assays

In a first experiment, F. oxysporum strain S2A1 at a concentration of 1.5 x 106 improved the growth of Nipponbare (chapter 5). This prompted us to repeat the experiment with Nipponbare; however the results could not be reproduced, instead we found no effects on the total, root and shoot dry weight of the plants (Figs. 7.6A, B and C).

112

Fig. 7.6 Effect of F. oxysporum strain S2A1 (concentration 1.5 x 106 spores/plant) on growth of Nipponbare. Values represent means and standard error of 8 plants per treatment. For each experiment, means with same letters within an experiment are not significantly different (P<0.05, Tukey‟s standardised range test). These are results of two independent experiments. A;-total dry weight, B;-root dry weight and C;-shoot dry weight of Nipponbare.

113

When three concentration densities of 1.5 x 105, 1.5 x 106 and 1.5 x 107 spores/plant were tested, a significant reduction of the total, root and shoot dry weight of Nipponbare was observed at a concentration of 1.5 x 107 spores per plant (Fig. 7.7).

Fig. 7.7 Effect of inoculum concentration of the F. oxysporum strain S2A1 on the growth of Nipponbare. The results were determined 6 weeks after transplanting (i.e. 4 weeks after fungal inoculation). Values represent means and standard error of 8 plants per treatment. For each plant variable, means with same letters are not significantly different (P<0.05, Tukey‟s standardised range test). S2A1 is a strain of Fusarium oxysporum. These are results of a single experiment. 7.4.3 Hormone levels after rice inoculation with F. oxysporum strain S2A1 during the pre-challenge stage

In roots

The level of JA at 7 and 21 dpfi in both experiments was not statistically different between the control and F. oxysporum strain S2A1-inoculated plants (Figs. 7.8A and B). However, when the time was extended to 24 or 28 dpfi in the second experiment, significant decreases of JA concentrations were observed in F. oxysporum strain S2A1-inoculated plants (Fig. 7.8B). Whatever, the time points, the differences in IAA level between the control and the inoculated plants were not significant in both experiments (Figs. 7.9A and B). The ABA concentrations between control and F. oxysporum strain S2A1-treated plants were only significantly different at 21 dpfi in the first experiment (Fig. 7.10A). Conversely, inoculation of F. oxysporum strain S2A1 caused significant increases of SA concentrations at 7 and 24 dpfi in the first and second experiment, respectively (Figs. 7.11A and B).

114

Fig. 7.8 Effect of F. oxysporum strain S2A1 (concentration 1.5 x 106 spores/plant) on JA levels in rice roots. Values represent means and standard error of two biological replicates consisting of a pool of 5 plants each. For each time point, means with same letters are not significantly different (P<0.05, Tukey‟s standardised range test). These are results of two (A and B) independent experiments.

Fig. 7.9 Effect of F. oxysporum strain S2A1 (conc. 1.5x106 spores/plant) on IAA levels in rice roots. Values represent means and standard error of two biological replicates consisting of a pool of 5 plants each. For each time point, means with same letters are not significantly different (P<0.05, Tukey‟s standardised range test). These are results of two (A and B) independent experiments.

115

Fig. 7.10 Effect of F. oxysporum strain S2A1 (concentration 1.5 x 106 spores/plant) on ABA levels in rice roots. Values represent means and standard error of two biological replicates consisting of a pool of 5 plants each. For each time point, means with same letters are not significantly different (P<0.05, Tukey‟s standardised range test). These are results of two (A and B) independent experiments.

Fig. 7.11 Effect of F. oxysporum strain S2A1 (concentration 1.5 x 106 spores/plant) on SA levels in rice roots. Values represent means and standard error of two biological replicates consisting of a pool of 5 plants each. For each time point, means with same letters are not significantly different (P<0.05, Tukey‟s standardised range test). These are results of two (A and B) independent experiments. In shoots

The JA concentrations were similar in the control and the inoculated plants at all time points tested except at 28 dpfi where there was a significant decrease upon F. oxysporum strain S2A1- inoculation (Fig. 7.12B). There was a significant increase of IAA at 21 dpfi upon F. oxysporum strain S2A1-inoculation in the first experiment (Fig. 7.13A); however, in the second experiment whatever, the time points, the IAA concentrations between the control and inoculated plants were not significantly different (Fig. 7.13B). At 7 and 21 dpfi, especially in the first experiment, the ABA

116 levels in the controls and the inoculated plants were not significantly different (Fig. 7.14A), however, in the second experiment; F. oxysporum strain S2A1-treatment significantly reduced the concentrations of ABA at 21 and 28 dpfi (Fig. 7.14B). The SA concentrations were only significantly different between control and inoculated plants at 7 dpfi in the first experiment (Fig. 7.15A), while in the second experiment there were no differences in SA concentrations between control and inoculated plants at all tested time points (Fig.7.15B).

Fig 7.12 Effect of F. oxysporum strain S2A1 (concentration 1.5 x 106 spores/plant) on JA levels in rice shoots. Values represent means and standard error of two biological replicates consisting of a pool of 5 plants each. For each time point, means with same letters are not significantly different (P<0.05, Tukey‟s standardised range test). These are results of two (A and B) independent experiments.

Fig. 7.13 Effect of F. oxysporum strain S2A1 (concentration 1.5 x 106 spores/plant) on IAA levels in rice shoots. Values represent means and standard error of two biological replicates consisting of a pool of 5 plants each. For each time point, means with same letters are not significantly different (P<0.05, Tukey‟s standardised range test). These are results of two (A and B) independent experiments.

117

Fig. 7.14 Effect of F. oxysporum strain S2A1 (concentration 1.5 x 106 spores/plant) on ABA levels in rice shoots. Values represent means and standard error of two biological replicates consisting of a pool of 5 plants each. For each time point, means with same letters are not significantly different (P<0.05, Tukey‟s standardised range test). These are results of two (A and B) independent experiments.

Fig 7.15 Effect of F. oxysporum strain S2A1 (concentration 1.5 x 106 spores/plant) on SA levels in rice roots. Values represent means and standard error of two biological replicates consisting of a pool of 5 plants each. For each time point, means with same letters are not significantly different (P<0.05, Tukey‟s standardised range test). These are results of two (A and B) independent experiments.

118

7.4.4 Comparison of gene expression profiles in rice plants treated with or without F. oxysporum strain S2A1 then challenged with the root-knot nematode Meloidogyne graminicola.

Q-RT-PCR was used to quantify the RNA levels of marker genes relevant for the different hormone pathways. Inoculation of F. oxysporum strain S2A1 alone significantly induced the expression of the JA-responsive gene OsJAMyb (Lee et al., 2001) at 7 and 24 dpfi, but this was suppressed at 28 dpfi (Fig. 7.16A). The expression levels of the ethylene (ET) signalling gene OsEIN2a (Jun et al., 2004) in F. oxysporum strain S2A1-inoculated and control plants were comparable at all tested time points (Fig. 7.16B), while the relative expression of the SA- responsive gene OsWRKY45 (Shimono et al., 2007) was strongly suppressed at 21 dpfi, but activated at 24 dpfi (Fig. 7.16C). The expression of the SA-biosynthesis gene OsPAL1 (Lee et al., 1995) was significantly activated at 24 dpfi (Fig. 7.16D). The auxin-response gene OsGH3.1 (Domingo et al., 2009) was significantly suppressed at 28 dpfi upon inoculation of F. oxysporum strain S2A1 (Fig. 7.16E).

119

Fig. 7.16 Expression patterns of OsJAMyb (A), OsEIN2 (B), OsWRKY45 (C), OsPAL1 (D) and OsGH3.1 (E) in rice inoculated with F. oxysporum strain S2A1 (concentration 1.5 x 106 spores/plant) alone. Samples were collected at 7, 21, 24 and 28 day-post-fungal inoculation (dpfi). Data represent the mean and standard error of the relative amount of transcripts in infected plants compared to the non-inoculated control at the same time-point. Data with * indicate significant difference between the fungus-treated and not-treated controls at P< 0.05.

120

When rice plants were inoculated with M. graminicola alone, the levels of RNA of the JA- response gene OsJAMyb (Lee et al., 2001) were significantly higher at 24 dpfi, but normalised at 28 dpfi (Fig. 7.17A). Upon inoculation of M. graminicola, the expression levels of the ET- signalling gene OsEIN2a (Jun et al., 2004) did not differ among all time points tested (Fig. 7.17B). The SA-responsive gene OsWRKY45 (Shimono et al., 2007) was only activated at 28 dpfi (Fig. 7.17C), while the SA-biosynthesis gene OsPAL1 (Lee et al., 1995) was up-regulated and down-regulated at 24 and 28 dpfi, respectively (Fig. 7.17D) upon inoculation of M. graminicola. The auxin responsive gene OsGH3.1 (Domingo et al., 2009) was significantly activated at 24 dpfi upon inoculation of M. graminicola (Fig. 7.17E).

When plants pre-treated with F. oxysporum strain S2A1 were challenged with the root-knot nematode M. graminicola, the expression pattern of the JA-responsive gene OsJAMyb (Lee et al., 2001) and the ET-signalling gene OsEIN2a (Jun et al., 2004) did not change significantly at all time points (Fig. 7.17A and B). However, significant increases in transcript levels were observed for the SA-responsive gene OsWRKY45 (Shimono et al., 2007) at 28 dpfi (Fig. 7.17C), and the SA-biosynthesis gene OsPAL1 (Lee et al., 1995) at 24 and 28 dpfi, respectively when compared with controls without fungi and nematodes (Fig. 7.17D). Double inoculation of F. oxysporum strain S2A1 and M. graminicola also decreased the expression levels of the auxin responsive gene OsGH3.1 (Domingo et al., 2009) at 28 dpfi when compared with controls without fungi and nematodes (Fig. 7.17E).

121

Fig. 7.17 Expression pattern of OsJAMyb (A), OsEIN2 (B), OsWRKY45 (C), OsPAL1 (D) and OsGH3.1 (E) in rice inoculated with M. graminicola alone or in combination with F. oxysporum strain S2A1 (concentration 1.5 x 106 spores/plant). Samples were collected at 24 and 28 dpfi. Data represent the mean and standard error of the relative amount of transcripts in infected plants compared to the non-inoculated control at the same time-point. Data with * indicate significant difference between the fungus-treated and not-treated controls at P< 0.05.

122

Fig. 7.18 To analyze the biological control potential of F. oxysporum strain S2A1 on M. graminicola, rice plants were inoculated with 1.5x106 spores of the fungal endophyte at 2nd and 3rd week after transplanting. Two weeks later, the plants were inoculated with 300 J2 of M. graminicola or water as control. Data represent means ± standard error. Data with different letters in each experiment indicate significant difference (P ≤ 0.05; N=8 for exp. 1, 2 and 5 and 16 for exp. 3 and 4). A & B; - number of galls, C; - total number of nematodes and D; - number of females.

123

7.4.5 Influence of F. oxysporum strain S2A1 on M. graminicola infection on rice

In a first experiment, the number of galls caused by the root-knot nematode M. graminicola at 21 days post nematode infection (dpni) were significantly reduced in the F. oxysporum strain S2A1- inoculated plants when compared to the control plants without the fungus (Fig. 7.18A). To confirm the results, the experiment was repeated and data collected at 12 and 21 dpni. Unfortunately at 12 dpni, there were no significant differences in number of galls, total number of nematodes and females between fungus-treated and non-treated control plants (Figs. 7.18B, C and D). At 21 dpni, the number of galls, nematodes and females was significantly reduced in F. oxysporum strain S2A1 pre-treated plants when compared to untreated controls in one experiment, while in another experiment, there were no significant differences in these variables between the fungus-treated and non-treated plants (Figs. 7.18B, C and D).

7.5 Discussion

Certain strains of F. oxysporum have been shown to colonise plants and promote growth or defence (Martinuz et al., 2015). The endophytic fungus F. moniliforme strain Fe14 isolated from the rice cultivar BR11 has been shown to promote growth and defence of rice against the root- knot nematode M. graminicola (Le et al., 2009). In a first experiment of this study, F. oxysporum (strain S2A1) showed strong growth promoting effect (measured in terms of dry weight and shoot length) on Nipponbare, but not Kasalath or Dongjin (chapter 5). This prompted us to repeat the experiment with Nipponbare to ascertain the growth promotion effect and to test if this strain can promote rice resistance to M. graminicola. Unlike in the first experiment, there was no effect on the total, root and shoot dry weight of Nipponbare upon inoculation of F. oxysporum (strain S2A1) in two independent experiments, and when the concentration was increased to 1.5 x 107 spores per plant in another experiment, the fungus even caused a significant reduction in the total, root and shoot dry weight of the plants. At this concentration (1.5 x 107 spores/plant), the roots were more colonised than at concentrations of 1.5 x 105 and 1.5 x 1.56 spores/plant, suggesting that the effect of this fungus on the plants could be concentration-dependent. In contrast to our findings, Martinuz et al. (2015), while using the strain Fo162 of the fungal species F. oxysporum, reported a colonisation of 29-32% in Arabidopsis plants, which did not show any disease symptoms and instead had strong growth promotion effects. Some authors have argued that colonisation is not always a requirement for a beneficial plant-endophyte interaction. This hypothesis was supported by studies using autoclaved cell-wall extracts (CWE) and culture filtrate (CF) containing fungal exudates to promote plant growth (Vadassery et al., 2009) and resistance to the sugar beet cyst nematode Heterodera schachtii in Arabidopsis (Daneshkhah et al., 2013). However, a balance ought to be maintained, above which disease symptoms may appear and below which no visible effects is achieved. Schulze and Boyle (2005) even proposed the model that a plant-endophyte interaction is a continuum ranging from parasitism through commensalism to mutualism. Commensalism and mutualism represent the balanced stages of the interaction, while parasitism is the unbalanced stage (Schulze and Boyle, 2005; Kogel et al., 2006).

124

Simultaneous quantification of several hormones showed changes in concentration levels during F. oxysporum (strain S2A1) colonisation. At the pre-challenge stage, the levels of JA in roots were significantly decreased at 24 and 28 dpfi, while those of SA were significantly increased at 7 and 24 dpfi. Gene expression profiles at this stage also complement the hormone measurement data, except for the JA-responsive gene OsJAMyb (Lee et al., 2001) which showed significant increase in expression levels at 7 and 24 dpfi. These results support the finding of Veloso et al. (2015) who found transient accumulation of JA and SA in pepper plants inoculated with F. oxysporum strain Fo47. An increase of SA levels has also been reported in Arabidopsis roots upon inoculation of the strain SS10 of the bacterial species Pseudomonas fluorescens (van de Mortel et al., 2012). At the challenge stage, inoculation of M. graminicola activated the SA-responsive gene OsWRKY45 (Shimono et al., 2007) at 28 dpfi, while the SA- biosynthesis gene OsPAL1 (Lee et al., 1995) was up-regulated and down-regulated at 24 and 28 dpfi, respectively. The JA-responsive gene OsJAMyb (Lee et al., 2001) was only activated at 24 dpfi. These results fit with those of Kyndt et al. (2012) who observed that in rice roots, OsJAMyb and OsPAL1 are strongly up-regulated at 3 days post nematode infection (dpni) (equivalent to 24 dpfi) and repressed at 7 dpni (equivalent to 28 dpfi) upon infection of M. graminicola alone. Double inoculation of F. oxysporum strain S2A1 and M. graminicola had no effect on the expression of the JA-responsive gene OsJAMyb (Lee et al., 2001) at all time points, the SA- responsive gene OsWRKY45 (Shimono et al., 2007) was only significantly up-regulated at 28 dpfi, while the SA-biosynthesis gene OsPAL1 (Lee et al., 1995) was strongly up-regulated at 24 and 28 dpfi. Importantly, the expression profile of the SA-biosynthesis gene OsPAL1 (Lee et al., 1995) showed a typical priming effect, where upon inoculation of the endophytic fungus F. oxysporum strain S2A1, the gene showed a minor induction, which was strongly increased upon the infection of the root-knot nematode M. graminicola.

Considering the results on nematode infection, hormone modulations by F. oxysporum (strain S2A1) did not prime rice defence against M. graminicola especially at 12 dpni. A reduction of JA concentrations at the pre-challenge stage and the lack of the JA-response gene OsJAMyb (Lee et al., 2001) activation during the double inoculation of F. oxysporum (strain S2A1) and M. graminicola may explain the results, knowing that JA is a key hormone in rice defence against M. graminicola (Nahar et al., 2011). Although SA has been implicated with plant defence, accumulation of SA at the pre-challenge stage and the activation of the SA-responsive gene OsWRKY45 (Shimono et al., 2007) and SA-biosynthesis gene OsPAL1 (Lee et al., 1995) at the challenge stage did not reduce the infection rate of M. graminicola, again corroborating the results of Nahar et al. (2011) who have shown a minor role of SA in rice defence against the root- knot nematode M. graminicola.

Conversely, induction of host defence by AMF against the root-knot nematode M. incognita has been shown to require the SA-regulated phenylpropanoid pathway (Vos et al., 2013). Recently, induction of tomato defence by T. harzianum strain T-78 against the root-knot nematode M. incognita was found to occur in three phases (Fig. 7. 19). In the first phase, T. harzianum strain T-78 primes the SA-dependent pathway to reduce nematode invasion by increasing mortality of

125 juveniles and delaying root penetration. Later, the SA-pathway becomes less important after the nematodes attain the sedentary feeding stage. In the second phase, T. harzianum strain T-78 primes the JA-dependent pathway to counteract the suppression of defence responses by the root-knot nematode M. incognita and to reduce the development and reproduction of the nematodes. Finally in the third phase, T. harzianum strain T-78 again promotes the SA- dependent pathway after detecting eggs in the plant roots thereby reducing the invasion of new juveniles (Martínez-Medina et al., 2016). This model fits well with our gene expression data, especially for the SA-biosynthesis gene OsPAL1 (Lee et al., 1995), but unlike for the root-knot nematode M. incognita, the SA-dependent pathway has a minor role in rice defence against the root-knot nematode M. graminicola (Nahar et al., 2011).

Fig. 7.19 Model showing the three phases of priming of tomato defence by T. harzianum strain T-78 against M. incognita. (a) activation of the SA-pathway to limit nematode invasion. (b) priming of the JA-pathway to reduce nematode development and reproduction and (c) activation of the SA-pathway to limit invasion of second generation juveniles. Adapted from Martínez- Medina et al., 2016. At 21 dpni, inoculation of F. oxysporum (strain S2A1) significantly reduced the number of galls in two out of three experiments conducted. Considering that M. graminicola has a short lifecycle of 19 days at 22 to 29°C (average, 25.5°C; Bridge and Page, 1982), it was suggested that F. oxysporum strain S2A1 could have effects on the second generation nematodes according to our experimental conditions at 28°C. However, this suggestion needs to be tested carefully by performing hatching experiments to analyse the viability of nematode eggs. Also experiments can be performed to evaluate the formation and development of next generation nematodes on the plants by extending the time beyond the 21 days.

In conclusion, the results of the present study have shown that F. oxysporum strain S2A1 cannot prime the defence of rice plants against the root-knot nematode M. graminicola at early time points of infection (12 dpni). However, at later time points (21 dpni) the fungus may reduce the infection by the nematodes. This reduction of the number of galls is independent of the JA- or the SA-signalling pathways. Furthermore, F. oxysporum strain S2A1 may not have effect on the

126 growth of Nipponbare at concentration of 1.5 x 106; however, at a higher concentration of 1.5 x 107, the fungus may be pathogenic.

7.6 Acknowledgments

127

128

Chapter

8.1 General conclusions and future perspectives

Rice (Oryza sativa L.) is one of the most important staple food crops in the world and an interesting model monocot crop for biological studies (Kyndt et al., 2014). However, the production of enough rice for the ever-growing human population is at risk when threatened by diseases such as blast, rice sheath rot (Kihoro et al., 2013; Bigirimana et al., 2015) and other diseases caused by plant-parasitic nematodes (Bridge et al., 2005; Castillo and Vovlas, 2007; Kyndt et al., 2014). Several management strategies have been applied to control plant-parasitic nematodes of which the use of biological agents such as endophytic fungi is emphasised in this PhD work. Endophytic fungi are microorganisms that colonise their host plants without showing disease symptoms (Rodriguez et al., 2009). They include Piriformospora indica, a basidiomycete, with very wide host range that includes rice. Inoculation of plants with P. indica has been shown to reduce the infection of the cyst nematodes Heterodera schachtii and H. glycines on Arabidopsis and Soybean, respectively (Daneshkhah et al., 2013; Bajaj et al., 2015). Fusarium oxysporum strain Fo162 is effective against different nematodes in tomato, banana, squash, pepper and melon (Vu et al. 2006; El-Fattah et al., 2007a, b; Menjivar et al., 2011; Waweru et al., 2014); while F. oxysporum strain Fe14, has been shown to reduce the effect of the root-knot nematode Meloidogyne graminicola in rice (Le et al., 2009, 2016).

Moreover, endophytic fungi have been shown to stimulate biomass accumulation in plants. For instance, P. indica and F. oxysporum (strain Fo162) have been shown to enhance the growth of Arabidopsis plants (Camehl et al., 2011; Martinuz et al., 2015). Varma et al. (1999) achieved growth promotion effects with P. indica in different plants. Other fungal species with growth promoting effects in plants are Talaromyces flavus (Naraghi et al., 2012), F. moniliforme strain Fe14 (Le et al., 2009) and F. oxysporum strain Fo47 (Alabouvette, 1986). These beneficial endophytes can be utilised to develop more sustainable next-generation agriculture. However, apart from arbuscular mycorrhiza fungi (AMF) and P. indica, information on other fungi commonly found in association with plants hitherto referred to as endophytes is scarce. Moreover, studies on endophytic fungi in Kenya, especially in rice, were missing at the start of this PhD work.

Rice is becoming an important food among Kenyans living in urban centres. Studies have shown that rice consumption in Kenya is increasing at a rate of 12% annually, compared to wheat at 4% and 1% for maize (Muhunyu, 2012). Kenyans have been advised to diversify crop production, especially rice (Muhunyu, 2012). However, rice is susceptible to parasitic nematodes, some of which have been shown to attack the crop in different ecosystems (Bridge et al., 2005). Over 95% of rice in Kenya is cultivated in the irrigated ecosystems, mostly as monocrop (Muhunyu, 2012). Monocropping has been shown to promote nematode multiplication, with the root-knot

129 nematode M. graminicola being prevalent in such conditions in Asia (Bridge et al., 2005; Kyndt et al., 2014). In the upland ecosystems, several nematodes species such as M. graminicola, M. incognita and P. zeae are prevalent (Castillo and Vovlas, 2007). In Africa, the root-knot nematode M. graminicola was first reported in South Africa (Kleynhans, 1991), but recent information indicates that it is also present in Madagascar (Chapuis et al., 2016). The root-lesion nematode P. zeae is another important pest of rice worldwide (Castillo and Vovlas, 2007). Studies have shown its presence in Australia, Belize, Benin, Cuba, Cameroon, Guinea, Togo, India, Indonesia, Ivory Coast, Nigeria, Philippines and South Africa (Castillo and Vovlas, 2007). This nematode has a wide host range, parasitizing mostly gramineous plants. In Kenya, P. zeae is common in maize (Kimenju et al., 1998).

There is a huge potential for rice production in Kenya, which can be exploited to improve the production from the current 80,000 t to 400,000 t demanded in the country (Muhunyu, 2012). However, this initiative will only be viable after addressing the production constraints adequately. The primary hypotheses of this PhD thesis were (i) nematodes are abundant in irrigated ecosystems practising monocropping, while crop rotation practised in the upland ecosystems does not favour nematode infections, (ii) soil characteristics such as pH, organic carbon, nitrogen and phosphorus affect the distribution of plant-parasitic nematodes, (iii) local (Kenya) rice varieties are highly susceptible to plant-parasitic nematodes, (iv) irrigated rice is free from endophytic fungi, while aerobic conditions in the upland ecosystems favour more fungal endophytes (v) the composition of endophytic fungi isolated from irrigated and upland rice is not different, (vi) rice ecosystems have strong effects on endophytic fungi, (vii) rice endophytic fungi belong to diverse taxonomic groups and finally (viii) some root endophytic fungi can promote rice growth and defence against nematodes by inducing host resistance.

After surveying irrigated and upland rice fields, the root-lesion nematode P. zeae was predominately found to parasitize the upland rice, while there were no plant-parasitic nematodes isolated from the irrigated ecosystems. In many countries, P. zeae has been found to be a serious pest of upland rice (Castillo and Vovlas, 2007). A host response test showed that the rice cultivar Nipponbare was highly susceptible (reproduction factor >1), while the local Kenyan cultivars, Basmati 370 and Supa were resistant (reproduction factor <1). This finding may justify why there were only few nematodes found in the cv. Supa in Kwale (chapter 3). Basmati 370 also known as Kenya Pishori is the preferred rice variety in Kenya, because of its aroma and good cooking qualities. It is mainly cultivated in Mwea as monocrop. Previous studies have shown that continuous monocropping of resistant varieties reduces nematode populations to lower levels (Castillo and Vovlas, 2007). Moreover, it has been suggested that certain long-term monocultures can reduce populations of Pratylenchus spp. (Andersen, 1975; Castillo and Vovlas, 2007). For instance, continuous monocropping of barley has been shown to increase steadily the population of P. crenatus and P. neglectus in the first three years of cultivation; however, as cultivation is extended beyond the third year, the populations of these nematodes were found to decrease gradually and stabilise at lower levels (Andersen, 1975). Again, since rice in the irrigated ecosystems was continuously under water, nematodes, especially Pratylenchus spp.

130 could have been controlled, since flooding has been listed as one of the cultural methods of nematode control (Kinh et al., 1982). It can also be argued that the soil properties in Kwale were favourable for the growth and reproduction of nematodes. Kwale soils contained the lowest amount of carbon and nitrogen, an indication of low organic matter amendment. It also had the highest C/N ratio. It has been suggested that the efficacy of organic matter in nematode control increases with an increase of % N in amendment and a decrease of C/N ratio (Rodriguez- Kabana et al., 1987). Moreover, a C/N ratio > 20 may cause low nematicidal activity, probably due to slow decomposition of organic matter and inadequate concentration of released ammonia and other toxins capable of reducing nematode populations (Rodriguez-Kabana et al., 1987). Zasada, (2005) have shown that an increase in soil pH can increase nematode suppressiveness + by shifting the equilibrium in favour of the conversion of ammonium ion (NH4 ) to ammonia (NH3) which is more toxic to nematodes. Another study has shown that high P nutrition reduces the number of the burrowing nematode Radopholus citrophilus biotype 1 (currently Radopholus similis) in roots of rough lemon plants (Smith and Kaplan, 1988). Taken together, it seemed logical why nematodes were not found in Mwea, Ahero, Siaya and Busia. Moreover, all the three tested cultivars were tolerant to P. zeae infection, based on the results that data of plant variables (total, root and shoot dry weight) was not significantly different between control and nematode-infected plants. However, yield analysis is required to confirm this result. Importantly, Basmati 370 and Supa should continue to be promoted in Kenya to reduce nematode problems. Unfortunately, Basmati 370 is highly susceptible to blast disease caused by the fungus M. oryzae (Kihoro et al., 2013), again opening another paradox.

When plants were analysed for the presence of endophytic fungi (chapter 4), samples from the irrigated ecosystem were found to be colonised more by endophytic fungi than those from the upland ecosystems. Assemblages of these fungi were shown to be strongly influenced by the ecosystem with a bias to Fusarium oxysporum strains. Notably, the fungi Talaromyces purpurogenus and Westerdykella angulata were recorded for the first time in rice roots. The most dominant genera found in the irrigated ecosystem included Phoma epicoccina, Talaromyces spp. and Curvularia spp. The upland ecosystems were dominated by F. oxysporum strains. The differences in composition of the endophytic fungi between the ecosystems may be explained following the hypothesis of Saunders et al. (2010), who proposed that the assemblage of an endophyte in an ecosystem is mediated by habitat (abiotic and host-imposed conditions) and microbial species interactions. In the irrigated ecosystems, flooding was probably found to be one of the most striking abiotic habitat filters. This condition has many implications for the rice plant itself (host-imposed filter) and for the microbial population in the soil. Macroscopically, root biomass may increase, while root branching may decrease. Internally, the formation of aerenchyma tissues is enhanced (Nishiuchi et al., 2012; Tian et al., 2013; Vallino et al., 2014). In addition, the amount of root exudates is reduced and, consequently, a decrease in Gram- negative bacteria and fungi is provoked in the rhizosphere (Tian et al., 2013). Taken together, we hypothesise that the adverse conditions in flooded soil, among which low oxygen levels, soil- derived toxins and gases accompanied by a lack of root exudates may force several soil fungi, that normally inhabit the soil or root surface, to take refuge inside the roots. This hypothesis is

131 supported by the increased isolation frequency of some species, such as P. epicoccina and Talaromyces spp., from rice roots in the irrigated ecosystems. Both species are soil-borne fungi that seem to be able to internally colonize their hosts, but are also very commonly found on external parts of the plants. In rice, E. nigrum has been found as endophyte of the leaf blades (Fisher and Petrini, 1992), but often has been isolated from the phylloplane (Kawamata et al., 2004; Sena et al., 2013). It has also been shown that E. nigrum prefers the phylloplane in sugar cane and may be considered as facultative endophyte in this host (Fávaro et al., 2012). Furthermore, different Talaromyces species have been shown to superficially colonize the roots of rice plants and solanaceous crops (Tjamos and Fravel, 1997; Kato et al., 2012). How these fungi penetrate the roots under certain circumstances and how deep they colonize the internal tissues of rice roots are still open questions that can be pursued further in the future. Although we cannot rule out the influence of other factors (e.g. rice cultivars and distribution of fungal spores via water supply systems) on fungal endophyte diversity (Fisher and Petrini, 1992; Hageskal et al., 2006; Naik et al., 2009), we consider that the hypothesis raised above provides an interesting and consistent framework for future studies.

Interactions of rice with the fungi T. purpurogenus (strain ABLO2D2), F. oxysporum (strains S2A1, N2B3, Fo162), F. moniliforme and P. indica (chapter 5) showed different results depending on the rice cultivars. Individually, the results suggest that Nipponbare is generally responsive, while Kasalath and Dongjin show neutral to negative responses to fungal inoculations (Table 8.1). Genetically, these cultivars belong to different rice ecotypes and sub- populations (Gamuyao et al., 2012; Kanamori et al., 2013), which may affect the interactions using different cues (Table 8.1). Unfortunately, the data was generally not reproducible. We could not immediately determine the cause of variation, however, in Bonn (Germany) Schouten (personal communication) has observed that the performance of the endophytic fungus F. oxysporum (strain Fo162) was affected by seasons; experiments conducted in summer were generally very successful compared to those in winter or other seasons. The first experiment of this study, which showed growth promotion effects, was conducted in summer, while the other experiments were conducted in winter or spring. A change of location could be the other source of variation. Some experiments were conducted in Bonn, Germany, in climate chamber, while others were performed in Ghent, Belgium, in growth chambers or rice rooms. Although we tried to mimic the conditions to be as similar as possible, some variation in terms of humidity, light intensity and air flow were possible.

132 nitrogen-free fertilizers or low amount of nitrogen in the medium (≤ 1 mM NH4NO3) supports nodulation and probably improves the beneficial effects (Journet et al., 2006). Conversely, Cheplick et al. (1989) found that the beneficial effect of endophytic fungi on ryegrass occurred when soil nutrients were not limited under greenhouse conditions. Moreover, inoculation of Pseudomonas syringae and P. fluorescens with mineral fertilizers further enhanced the growth of shoots and roots of maize seedlings than when applied alone without fertilizers (Zafar-ul-Hye et al., 2015). Taken together, these examples show that it may be possible to promote plant growth by using different endophytic fungi, but the choice of the host-endophyte combination and the nutrient composition of the media should be carefully selected.

133

Table 8.1 Summary of the results from inoculation experiments

Fungal species/strain Rice cultivar Sub- Growth condition; Effect of the fungi on: population medium, temperature and light Rice growth (in terms of Nematodes infection dry weight) Talaromyces Nipponbare Temperate SAP, 28°C with 12-hr Increased growth (positive; Strong reduction on the number of purpurogenus (strain japonica light regime experiment 1), no effect galls at 3 dpni (experiment 1), no ABLO2D2) (neutral; experiment 2) and effect on the number of galls at 21 reduced growth (negative; dpni (experiment 1 & 2) and an experiment 3). increase in the number of egg masses (experiment 1). Kasalath Aus SAP, 28°C with 12-hr No effect on total and shoot Not tested light regime dry weight (neutral), but a reduction on root dry weight (negative; experiment 1) Dongjin Indica SAP, 28°C with 12-hr A strong reduction on the Not tested light regime total, root and shoot dry weight (negative; experiment 1). Fusarium oxysporum Nipponbare Temperate SAP, 28°C with 12-hr Increased growth Reduced number of galls at 21 strain S2A1 japonica light regime (positive; experiment 1), dpni (experiment 1), no effect no effect (neutral; (experiment 2), no effect experiments 2 & 3) and (experiment 3), no effect reduced growth (negative; (experiment 4) and reduced experiment 4) at higher number of galls, nematodes and concentration of 1.5 x 107 females (experiment 5). spores/plant Kasalath Aus SAP, 28°C with 12-hr No effect (neutral; Not tested light regime experiment 1). Dongjin Indica SAP, 28°C with 12-hr No effect (neutral; Not tested light regime experiment 1) Fusarium oxysporum Nipponbare Temperate SAP, 28°C with 12-hr Increased growth Not tested strain N2B3 japonica light regime (positive; experiment 1)

134

Kasalath Aus SAP, 28°C with 12-hr No effect (neutral; Not tested light regime experiment 1). Dongjin Indica SAP, 28°C with 12-hr No effect (neutral; Not tested light regime experiment 1). Fusarium oxysporum Nipponbare Temperate SAP, 28°C with 12-hr No effect (neutral; Not tested strain Fo162 japonica light regime experiment 1). Kasalath Aus SAP, 28°C with 12-hr No effect (neutral; Not tested light regime experiment 1). Dongjin Indica SAP, 28°C with 12-hr Reduced growth (negative; Not tested light regime experiment 1) Piriformospora indica Nipponbare Temperate SAP, 28°C with 12-hr Increased growth Not tested strain DSM11827 japonica light regime (positive; experiment 1) Kasalath Aus SAP, 28°C with 12-hr No effect (neutral; Not tested light regime experiment 1). Dongjin Indica SAP, 28°C with 12-hr No effect (neutral; Not tested light regime experiment 1). Fusarium moniliforme Nipponbare Temperate SAP, 28°C with 12-hr No effect (neutral; Not tested (syn. F. verticillioides) japonica light regime experiment 1). Kasalath Aus SAP, 28°C with 12-hr No effect (neutral; Not tested light regime experiment 1). Dongjin Indica SAP, 28°C with 12-hr Reduced growth (negative; Not tested light regime experiment 1)

135

Variation of plant responses may be caused by differences in inoculum density, although this idea has been contrasted by some authors. At a higher concentration of 1.5 x 107 spores/plant, F. oxysporum strain S2A1 reduced plant growth. The roots were more colonised than at a concentration of 1.5 x 105 or 1.5 x 106 spores per plant. It has been argued that the level of colonisation is not always a requirement for plant-endophyte interactions. This hypothesis was supported by studies using autoclaved cell-wall extracts (CWE) and culture filtrate (CF) containing fungal exudates to promote plant growth and resistance of Arabidopsis plants against the cyst nematode H. schachtii (Daneshkhah et al., 2013). However, a balance ought to be maintained, above which disease symptoms may appear and below which no visible effects is achieved. Schulze and Boyle, (2005) even proposed the model that plants-endophyte interaction is a continuum ranging from parasitism through commensalism to mutualism. Commensalism and mutualism represent the balanced stages of the interactions, while parasitism is the unbalanced stage (Schulze and Boyle, 2005; Kogel et al., 2006).

The fungus T. purpurogenus (strain ABLO2D2) appeared to promote rice susceptibility to the root-knot nematode M. graminicola (chapter 6). Previously, endophytic fungi were shown to promote disease development in plants (Clay, 1990). In cotton, the fungi Funneliformis etunicatus and F. mosseae were shown to enhance the infection of the root-knot nematode M. incognita. The fungi Gigaspora heterogama, F. macocarpus and Endogone calospora promoted the densities of M. incognita in treated soybean plants compared to non-inoculated controls. In peanuts, infection of M. arenaria became more severe in presence of the fungi F. etunicatus or F. margarita (Hussey and Roncadorl, 1988). Furthermore, non-pathogenic and endophytic fungi can also enhance plant susceptibility to insect pests, bacteria and even other fungi. Root colonisation by AMF promotes infection of biotrophic pathogens and viruses (Shaul et al., 1999; Pozo and Azcón-Aguilar, 2007). For instance, inoculation of plants with AM fungi has been found to favour the incidence and severity of the powdery mildew disease (Pozo and Azcón-Aguilar, 2007). Another study has found that the incidence and severity of necrotic lesions caused by the leaf pathogen Botrytis cinerea or the Tobacco Mosaic Virus (TMV) were significantly higher in tobacco plants inoculated with the fungus F. intraradices (Shaul et al., 1999).

An interaction of rice with F. oxysporum strain S2A1 showed variable results on the performance of M. graminicola (chapter 7). At 12 dpni, the fungus showed no effect on the infection of M. graminicola. However, at 21 dpni, the fungus reduced the infection of M. graminicola in two out of the three experiments conducted. Considering that M. graminicola has a short lifecycle of 19 days at 22 to 29°C (average, 25.5°C; Bridge and Page, 1982), it was suggested that F. oxysporum (strain S2A1) could have effects on the second generation nematodes in our experimental conditions at 28°C. To understand the mechanisms involved in the reduction of the number of galls between the fungus-treated and the non-treated controls, gene expression studies and measurements of key defence hormones were performed. The results of the hormone measurement and gene expression studies showed a reduction of JA concentrations at the pre-challenge stage, and a weak activation of the JA-responsive gene OsJAMyb (Lee et al., 2001) during the double inoculation of F. oxysporum (strain S2A1) and M. graminicola, resulting

136 in low defence responses. The JA-pathway has been identified to play key roles in rice defence against M. graminicola (Nahar et al., 2011). Although SA has been implicated with plant defence, accumulation of SA at the pre-challenge stage and the activation of the SA-responsive OsWRKY45 (Shimono et al., 2007) and the SA-biosynthesis OsPAL1 (Lee et al., 1995) genes at the challenge stage did not reduce the infection rate of M. graminicola, again corroborating the results of Nahar et al. (2011) who showed a minor role of SA in rice defence against the root-knot nematode M. graminicola

Similar to our study, most reports in the literature involve the use of single species (isolates) to analyse the growth promotion effect and defence responses in plants (Table 2.2 and 2.3 and the references therein). The use of multiple species has been suggested, but the practicability and cost remain a big challenge. The argument has been that plants are known to select their rhizosphere and endophytic microbiomes. During pathogen or insect attack, these plants are able to recruit different beneficial microorganisms to suppress infection (Berendsen et al., 2012). These organisms, although they may directly or indirectly protect plants, often interact synergistically or antagonistically. During these interactions, some traits may be attributed to specific organisms, but most of the times it is the total microbiome that has effect on plant health (Berendsen et al., 2012). Moreover, some microorganisms that are non-beneficial become beneficial when growing in community (de Boer et al., 2007). Therefore, working with single species in sterilised soil may eliminate this benefit as the plants are left with no option to select the best microbe for growth or disease management.

The results of this study have advanced our understanding on rice nematodes and endophytic fungi. However, there are more thematic areas (perspectives) that can be investigated further in the future, particularly focussing in;

. An in-depth survey of rice nematodes in irrigated and upland ecosystems to estimate their spatial distribution patterns. Previously, it was shown that nematodes are distributed both horizontal and vertically in the soil. The horizontal distribution is divided into micro- distribution occurring within a field and the macro-distribution which occurs within a region. Micro-distribution of nematodes largely depends on the life history of the nematodes, their feeding strategy and the availability of the host plants (Been and Schomaker, 2006). How these factors modulate the population densities of the root- lesion nematode P. zeae in rice growing in different ecosystems is worth investigating as this may provide important information that may help in determining the best management practices of this nematode species.

. Yield experiments to determine plant tolerance to plant-parasitic nematodes. In this study, it has been shown that the rice cultivars Nipponbare, Supa and Basmati are tolerant to the root-lesion nematode P. zeae although the results were analysed 6 weeks after transplanting when the plants were near the reproductive stage. For analysis of plant tolerance, reproductive tissues such as yield must be considered because they are more informative that vegetative tissues.

137

. Multiple experiments to determine the effects of F. oxysporum strain S2A1 on second generation nematodes. Endophytic fungi can target different stages of infection of the pathogen i.e. invasion, galling and reproduction (Martínez-Medina et al., 2016). In tomato, Trichoderma harzianum strain T-78 was found to prime the SA- and JA- dependent pathways to suppress the infection of the root-knot nematode M. incognita at the invasion, galling and reproduction stages (Martínez-Medina et al., 2016). F. oxysporum strain S2A1 was shown to strongly affect the infection of M. graminicola at 21 dpni, which is the beginning of the second stage generation of the nematode. Experiments can be performed to determine the viability of eggs in fungal-treated plants as well as the development and reproduction of the juveniles from these hatching tests.

. Growth analysis experiments with different nutrient concentrations to determine the optimal conditions for beneficial interactions. A recent finding has indicated that Arabidopsis can only tolerate the non-pathogenic fungus Colletotrichum tofieldiae when in need of soluble P from the soil and rejects the fungus when it can accomplish this function on its own. Phosphorus is necessary for plant growth and can be accessed through a process known as phosphate starvation response. In this process, phosphorus availability enables plants to send signals to a specific branch of plant immunity to shed off the fungus; however, during deficit, the plant nutrient sensing system communicates with another branch of immune system to recruit C. tofieldiae, whose presence triggers the synthesis of secondary metabolites essential for maintenance of symbiosis (https://www.mpg.de/10390194/plants-symbiosis-phosphate?). In the lab, the amount of P or any other element can be varied depending on the special need of the fungal endophytes and the host plants.

. Histological studies to determine the structural characteristics of endophytic fungi, the colonization process and the interaction with the host plants. Endophytes can differ in the way they colonize their host plant; some colonise locally, while others systemically colonize their host plants. The intensity of fungal colonization and proliferation can be analyzed by simple tissue plating followed by an in-depth analysis by bright field and epifluorescence microscopy.

. Multiple experiments to test the effect of environmental conditions (e.g. season, rainfall, humidity and temperature), soil characteristics (pH, soil types etc), elevation and host plant organs on the diversity of endophytic fungi in plants. For instance, Naik et al. (2009) have isolated more fungal endophytes from rice roots during the winter than in summer, with more fungi found colonising the roots than the leaves. Tian et al. (2004) have isolated more fungal endophytes from rice plants growing in acidic soils than in alkaline soils. Le et al. (2009) have isolated more endophytic fungi from rice plants growing in alluvial soils with low pH and high organic matter as compared to rice grown in sulphate or gleyic acrisol soils.

. Working with fungal communities instead of using single isolates. Although there are several studies that have analysed the interactions of one plant one microbe (Table 2.2

138

and 2.3 and this study), often these reports don‟t represent the reality in nature where plants interact with a plethora of microorganisms. A suggestion has been forwarded to work with whole plant microbiota to gain more insight on how these microbial communities form and benefit the plants. This suggestion has been tested by scientists at the Max Planck Institute in Cologne, Germany, who have set up preliminary experiments to study the microbiota of Arabidopsis roots using carefully controlled synthetic bacterial communities created by removing all the microbes from plants and then adding individual species one at a time. The results of their experiments show that bacteria that colonise Arabidopsis roots have defined taxonomic structures and preferential colonisation patterns and probably functions (Bulgarelli et al., 2012; Ravindran, 2014).

In conclusion, this PhD work has shown that the root-lesion nematode P. zeae is common in upland rice, but not irrigated rice. Previous reports in Kenya have shown its prevalence in maize, but rice seem to be an alternative host, although some rice genotypes such as Supa and Basmati 370 are both tolerant and resistant. The occurrence of plant-parasitic nematodes is affected by soil characteristics such as pH, organic carbon, nitrogen and phosphorus. Irrigated rice is colonised more by endophytic fungi than the upland rice. The assemblages of these endophytes were found to be largely influenced by the ecosystems, especially for the species F. oxysporum. Notably the endophytic fungi T. purpurogenus and W. angulata were reported for the first time in rice roots. Functional analyses of selected endophytes on rice growth and/ or defence showed variable and irreproducible results mostly affected by rice genotypes (cultivars), taxonomy of the fungal strains/species and the environmental conditions.

139

Summary

Rice is a staple food for half of the world‟s population, where in Kenya it‟s the third most important food crop after maize and wheat. For decades there has been a persistent need to increase rice production to feed the ever-growing population however, different pathogens, among them plant-parasitic nematodes, are continuously threatening rice production worldwide. The root-knot nematode Meloidogyne graminicola and the root-lesion nematode Pratylenchus zeae are among the most damaging nematode species of rice. Several methods have been developed and applied to control or manage these nematode species without much success. Recently, other new methods of nematode control have been suggested, especially the use of biological agents such as bacteria and fungi. In this context, the use of endophytic fungi has shown promising results in rice and other plants. However, the effectivity of these fungi has been shown to be influenced by factors such as the host taxonomy, the fungal species/strains, and the growth conditions. The main objectives of this thesis were to perform a survey to determine the presence of endophytic fungi and plant-parasitic nematodes associated with rice in Kenya and analyse the effects of selected endophytes on rice growth and defence to nematodes, which are becoming serious pests of rice worldwide. After surveying irrigated and upland rice field, Aphelenchoides sp. and the root-lesion nematode Pratylenchus zeae were predominately found to parasitize the upland rice, while there were no plant-parasitic nematodes isolated from the irrigated ecosystems. However, analyses of the endophytic fungi showed that irrigated rice was more colonised by fungi than the upland rice. Assemblages of these fungi were shown to be strongly influenced by the ecosystem with a bias to Fusarium oxysporum strains. Notably, the fungi Talaromyces purpurogenus (syn. Penicillium purpurogenum) and Westerdykella angulata are recorded for the first time in rice roots. Functional analyses of some selected endophytes for their effect on growth and defence showed variable relationships which were mostly influenced by the type of fungal species/strain or rice cultivars.

140

Samenvatting

Rijst is een belangrijk voedingsgewasvoor meer dan de helft van de wereldbevolking en in Kenia komt het op de derde plaats na maïs en tarwe. Sinds decennia is er wereldwijd een voortdurende nood aan een verhoogde rijstproductie om de toenemende bevolking te kunnen voeden.Verschillende ziektes en plagen, waaronder nematoden, bedreigen dezerijstproductie. De wortelknobbelnematode Meloidogyne graminicola en de wortellesienematode Pratylenchus zeae behoren tot de meest schadelijke nematoden op rijst. Verschillende methoden zijn ontwikkeld en worden toegepast om de schade door deze nematoden te beperken, maar met weinig succes. Recent zijn nieuwe methoden gesuggereerd, waarbij vooral het gebruik van biologische agentia zoals bacteria en schimmels, opgang maakt. In deze context zijn reeds veelbelovende resultaten bekomen met schimmels in rijst. De effectiviteit van deze schimmels wordt sterk beïnvloed door factoren als de gastheercultivar, de schimmelstam en de teeltcondities. De belangrijkste objectievenvan dit doctoraat waren de isolatie en karakterisatie van schimmelendofytenen nematoden in associatie met rijst in Kenia en de analyse van de effectenvangeselecteerde endofytenop de groei van de gastheeren op de infectiviteit van parasitaire nematoden. Na staalname in geïrrigeerde enaerobe rijstvelden, bleek de wortellesienematode Pratylenchus zeae aanwezig in de aerobe rijstveldenmaar niet in de geïrrigeerde rijstvelden. Analyses toonden aan dat de geïrrigeerde rijst meer gekoloniseerd werd door schimmels dan de aerobe rijst. De verscheidenheid aan schimmelswordt sterk bepaald door het ecosysteem met een bias naar Fusarium oxysporum. De schimmels Talaromyces purpurogenus (syn. Penicillium purpurogenum) en Westerdykella angulata zijn voor het eerst gerapporteerd in rijst. Functionele analyses van enkele geselecteerde endofyten omtrent de bevordering van groei en afweer van rijstplantengaven zeer variabeleresultaten, afhankelijk van de gebruikte schimmelstam en rijstcultivar.

141

142

References

Achatz, B., von Rüden, S., Andrade, D., Neumann, E., Pons-Kühnemann, J., Kogel, K.-H., Franken, P. and Waller, F. 2010. Root colonization by Piriformospora indica enhances grain yield in barley under diverse nutrient regimes by accelerating plant development. Plant and Soil 333: 59-70. Ahn, I.-P., Lee, S.-W. and Suh, S.-C. 2007. Rhizobacteria-induced priming in Arabidopsis is dependent on ethylene, jasmonic, acid and NPR1. Molecular Plant-Microbe Interactions 20 (7): 759-768. Aimé, S., Cordier, C., Alabouvette, C. and Olivain, C. 2008. Comparative analysis of PR gene expression in tomato inoculated with virulent Fusarium oxysporum f. sp. lycopersici and the biocontrol strain F. oxysporum Fo47. Physiological and Molecular Plant Pathology 73 (1-3): 9-15. Aimé, S., Alabouvette, C., Steinberg, C. and Olivain, C. 2013. The endophytic strain Fusarium oxysporum Fo47: a good candidate for priming the defense responses in tomato roots. Molecular Plant-Microbe Interactions 26 (8): 918-926. Alabouvette, C. 1986. Fusarium-wilt suppressive soils from the Châteaurenard region: review of a 10-year study. Agronomie 6: 273-284. Alabouvette, C., De la Broise, D., Lemanceau, P., Couteaudier, Y. and Louvet, J. 1987. Utilisation de souches non pathog Couteaud Fusarium spp. pour lutter contre les fusarioses: Situation actuelle dans la pratique. EPPO Bulletin 17: 665-674. Al-Banna, L., Ploeg, A.T., Williamson, V.M. and Kaloshian, I. 2004. Discrimination of six Pratylenchus species using PCR and species-specific primers. Journal of Nematology 36 (2): 142-146. Álvarez-Loayza, P., White, J.F.Jr., Torres, M.S., Balslev, H., Kristiansen, T., Svenning, J.-C. and Gil, N. 2011. Light converts endosymbiotic fungus to pathogen, influencing seedling survival and niche-space filling of a common tropical tree, Iriartea deltoidea. PLoS ONE 6(1): e16386. doi:10.1371/journal.pone.0016386. Andersen, H.J. 1975. Pratylenchus population densities in barley monocultures. Nordisk Jordbrugsforskning 57 (5): 1129-1130. Aoki, T., O‟Donnell, K. and Geiser, D.M. 2014. Systematics of key phytopathogenic Fusarium species: current status and future challenges. Journal of General Plant Pathology 80: 189-201. Arayarungsarit, L. 1987. Yield ability of rice varieties in fields infested with root-knot nematode. International Rice Research Notes 12: 14. Arenal, F., Platas, G., Monte, E. and Peláez, F. 2000. ITS sequencing support for Epicoccum nigrum and Phoma epicoccina being the same biological species. Mycological Resources 104: 301-303. Doi: 10.1017/S0953756299001537. Arnold, A.E. and Herre, E.A. 2003. Canopy cover and leaf age affect colonization by tropical fungal endophytes: ecological pattern and process in Theobroma cacao (Malvaceae). Mycologia 95 (3): 388-398. Arnold, A.E., Mejía, L.C., Kyllo, D., Rojas, E.I., Maynard, Z., Robbins, N. and Herre, E.A. 2003. Fungal endophytes limit pathogen damage in a tropical tree. Proceedings of the National Academy of Sciences of the United States of America 100 (26): 15649-15654. Arnold, A.E. 2007. Understanding the diversity of foliar endophytic fungi: progress, challenges, and frontiers. Fungal Biology Reviews 21: 51-66.

143

Arnold, A.E. and Lutzoni, F. 2007. Diversity and host range of foliar fungal endophytes: are tropical leaves biodiversity hotspots? Ecology 88 (3): 541-549. Atera, E.A., Onyango, J.C., Azuma, T., Asanuma, S. and Itoh, K. 2011. Field evaluation of selected NERICA rice cultivars in western Kenya. African Journal of Agricultural. Resource 6 (1): 60-66. Athman, S.Y., Dubois, T., Coyne, D.L., Gold, C.S., Labuschagne, N. and Viljoen, A. 2006. Effect of endophytic Fusarium oxysporum on host preference of Radopholus similis to tissue culture banana plants. Journal of Nematology 38: 455-460. Atieli, H., Menya, D., Githeko, A. and Scott, T. 2009. House design modifications reduce indoor resting malaria vector densities in rice irrigation scheme area in western Kenya. Malaria Journal 8: 1-9. Doi: 10.1186/1475-2875-8-108. Atugala, D.M. and Deshappriya, N. 2015. Effect of endophytic fungi on plant growth and blast disease incidence of two traditional rice varieties. Journal of National Science Foundation of Sri Lanka 43 (2): 173-187. Aung, T. and Prot, J.-C. 1990. Effects of crop rotations on Pratylenchus zeae and on yield of rice cultivar UPL Ri-5. Revue de Nématologie 13 (4): 445-447. Bailey, T.A., Zhou, X.J., Chen, J.P. and Yang, Y. 2009. Role of ethylene, abscisic acid and MAP kinase pathways in rice blast resistance. In: Advances in Genetics, Genomics and Control of Rice Blast Disease (Eds) Wang, G.L. and Valent, B. (Dordrecht: SpringerScience), 185-190. Doi:10.1007/978-1-4020-9500-9_19. Bajaj, R., Hu, W., Huang, Y.Y., Chen, S., Prasad, R., Varma, A. and Bushley, K.E. 2015. The beneficial root endophyte Piriformospora indica reduces egg density of the soybean cyst nematode. Biological Control 90: 193-199. Bashan, Y. and de-Bashan, L. 2005. Fresh-weight measurements of roots provide inaccurate estimates of the effects of plant growth-promoting bacteria on root growth: a critical examination. Soil Biology and Biochemistry 37: 1795-1804. Baujard, P., Mounport, D. and Martiny, B. 1990. Étude au microscope électronique à balayage de quatre espèces du genre Pratylenchus Filip̕̕ev, 1936 (Nemata: Pratylenchidae). Revue de Nématologie 13: 203-210. Bayman, P., Angulo-Sandoval, P., Baez-Ortiz, Z. and Lodge, D.J. 1998. Distribution and dispersal of Xylaria endophytes in two tree species in Puerto Rico. Mycological Research 102: 944-948. Been, T.H. and Schomaker, C.H. 2006. Distribution patterns and sampling. In Perry, N. and Moans, M. Plant nematology. CABI International pp 302-326. Benhamou, N., Grenier, J., Asselin, A. and Legrand, M. 1989. Immunogold localization of β-1-3- glucanases in two plants infected by vascular wilt fungi. The Plant Cell 1: 1209-1221. Benhamou, N., Garand, C. and Goulet, A. 2002. Ability of non-pathogenic Fusarium oxysporum strain Fo47 to induce resistance against Pythium ultimum infection in Cucumber. Applied and Environmental Microbiology 68: 4044-4060. Berendsen, R.L, Pieterse, C.M.J. and Bakker, P.A.H.M. 2012. The rhizosphere microbiome and plant health. Trends Plant Science 17 (8): 478-486. Berkelaar, D. 2001. SRI, the system of rice intensification: less can be more. ECHO Development Notes 10 (70): 1-7. Biela, F., Dias-Arieira, C.R., Machado, A.C.Z., Santana-Gomes, S.D.M., Cardoso, M.R., Hernandes, I. and Puerari. H.H. 2015. .Genetic diversity of rice genotypes from Brazil based on their resistance to Pratylenchus zeae. Tropical Plant Pathology 40 (3): 208- 211.

144

Bigirimana, V.P., Hua, G.K.H., Nyamangyoku, O.I. and Höfte, M. 2015. Rice sheath rot: an emerging ubiquitous destructive disease complex. Frontier in Plant Sciences 6: 1066. Doi: 10.3389/fpls.2015.01066. Blilou, I., Ocampo, J.A. and Garcia-Garrido, J.M. 2000. Induction of Ltp (lipid transfer protein) and Pal (phenylalanine ammonia-lyase) gene expression in rice roots colonized by the arbuscular mycorrhizal fungus Glomus mosseae. Journal of Experimental Botany 51 (353): 1969-1977. Blok, V.C., Malloch, G., Narrower, B., Phillips, M.S. and Vrain, T.C. 1998. Intraspecific variation in ribosomal DNA in populations of the potato cyst nematode Globodera pallida. Journal of Nematology 30 (2): 262-274. Blok, V.C. and Powers, T.O. 2009. Biochemical and molecular identification. In: Perry, R.N., Moens, M. and Starr, J.L. (Eds). Root-knot nematodes. Wallingford, UK, CABI, pp. 98- 118. Bonos, S.A., Wilson, M.M., Meyer, W.A. and Funk, C.R. 2005. Suppression of red thread in fine fescues through endophyte-mediated resistance. Applied Turfgrass Science 10: 1094. Botelho, G.R. and Hagler, L.C.M. 2006. Fluorescent Pseudomonads associated with the rhizosphere of crops: an overview. Brazilian Journal Microbiology 37: 401-416. Bothe, H., Klingner, A., Kaldorf, M., Schmitz, O., Esch, H., Hundeshagen, B. and Kernebeck, H. 1994. Biochemical approaches to the study of plant-fungal interactions in arbuscular mycorrhiza. Experientia 50: 919-925. Bouman, B.A.M. 2007. A conceptual framework for the improvement of crop water productivity at different spatial scales. Agricultural Systems 93: 43-60. Bouman, D. 2013. Does rice really use too much water? http://irri.org/blogs/bas-bouman-s-blog- global-rice-science-partnership/does-rice-really-use-too-much-water. Bourgis, F., Guyot, R., Gherbi, H., Tailliez, E., Amabile, I., Salse, J., Lorieux, M., Delseny, M. and Ghesquière, A. 2008. Characterization of the major fragance gene from an aromatic japonica rice and analysis of its diversity in Asian cultivated rice. Theoritical and Applied Genetics 117: 353-368. Brar, D.S. and Khush, G.S. 1997. Alien introgression in rice. Plant Molecular Biology 35: 35-47. Bridge, J. and Page, S.L.J. 1982. The rice root-knot nematode, Meloidogyne graminicola, on deep water rice (Oryza sativa subsp. indica). Revue de Nematologie 5(2): 225-232. Bridge, J., Plowright, R.A. and Peng, D. 2005. Nematode parasites of rice. In: M. Luc, R.A. Sikora, J. Bridge, Eds. Plant-parasitic nematodes in sub-tropical and tropical agriculture. CAB International, Wallingford, UK, pp 87-130. Brundrett, M.C. 2002. Co-evolution of roots and mycorrhizas of land plants. New Phytologist 154: 275-304. Bulgarelli, D., Rott, M., Schlaeppi, K., van Themaat, E.V.L., Ahmadinejad, N., Assenza, F., Rauf, P., Huettel, B., Reinhardt, R., Schmelzer, E., Peplies, J., Gloeckner, F.O., Amann, R., Eickhorst, T. and Schulze-Lefert, P. 2012. Revealing structure and assembly cues for Arabidopsis root-inhabiting bacterial microbiota. Nature 488: 91-95. Cachinero, J. M., Hervas, A., Jimenez-Diaz, R. M. and Tena, M. 2002. Plant defence reactions against Fusarium wilt in chickpea induced by incompatible race 0 of Fusarium oxysporum f. sp. ciceris and non-host isolates of F. oxysporum. Plant Pathology 51: 765-776. Camehl, I., Sherameti, I., Venus, Y., Bethke, G., Varma, A., Lee, J. and Oelmuller, R. 2010. Ethylene signalling and ethylene-targeted transcription factors are required to balance beneficial and non-beneficial traits in the symbiosis between the endophytic fungus Piriformospora indica and Arabidopsis thaliana. New Phytologist 185: 1062-1073.

145

Camehl, I., Drzewiecki, C., Vadassery, J., Shahollari, B., Sherameti, I., Forzani, C., Munnik, T., Hirt, H. and Oelmueller, R. 2011. The OXI1 kinase pathway mediates Piriformospora indica-induced growth promotion in Arabidopsis. PLoS Pathogens 7 (5): e1002051. Doi:10.1371/journal.ppat.1002051. Carroll, G. 1995. Forest endophytes: pattern and process. Canadian Journal of Botany 73 (S1): 1316-1324. Cartieaux, F., Contesto, C., Gallou, A., Desbrosses, G., Kopka, J., Taconnat, L., Renou, J.-P. and Touraine, B. 2008. Simultaneous interaction of Arabidopsis thaliana with Bradyrhizobium sp. strain ORS278 and Pseudomonas syringae pv. tomato DC3000 leads to complex transcriptome changes. Molecular Plant-Microbe Interactions 21 (2): 244-259. Castillo, P. and Vovlas, N. 2007. Pratylenchus (Nematoda: Pratylenchidae): diagnosis, biology, pathogenicity and management. Nematology monographs and perspectives 3 (Series Editors: Hunt, D.J. and Perry, R.N.). Leiden, The Netherlands, Brill, 529 pp. Castillo, G.T. 2009. Can less favorable areas obtain food security? Rice Today 8: 46. Chapuis, E., Besnard, G., Andrianasetra, S., Rakotomalala, M., Nguyen, H.T. and Bellafiore, S. 2016. First report of the root-knot nematode (Meloidogyne graminicola) in Madagascar rice fields. Australasian Plant Disease Notes 11:32. Doi 10.1007/s13314-016-0222-5. Chen, D.Y., Ni, H.F., Yen, J.H. and Tsay, T.T. 2009. Identification of a new recorded root-lesion nematode Pratylenchus zeae (Nematoda: Tylenchoidea, Pratylenchidae) from corn plantations in Taiwan. Plant Pathology Bulletin 18 (2): 111-118. Cheplick, G.P., Clay, K. and Marks, S. 1989. Interactions between infection by endophytic fungi and nutrient limitation in the grasses Lolium perenne and Festuca arundinacea. New Phytologist 111: 89-97. Cheplick, G.P. 2007. Costs of fungal endophyte infection in Lolium perenne genotypes from Eurasia and North Africa under extreme resource limitation. Environmental and Experimental Botany 60: 202-210. Doi:10.1016/j.envexpbot.2006.10.001. Chern, M., Fitzgerald, H.A., Canlas, P.E., Navarre, D.A. and Ronald, P.C. 2005. Over-expression of a rice NPR1 homolog leads to constitutive activation of defense response and hypersensitivity to light. Molecular Plant-Microbe Interactions 18 (6): 511-520. Chinchilla, D., Bauer, Z., Regenass, M., Boller, T. and Felix, G. 2006. The Arabidopsis receptor kinase FLS2 binds flg22 and determines the specificity of flagellin perception. The Plant Cell 18: 465-476. Doi:10.1105/tpc.105. 036574. Chomnunti, P., Schoch, C.L., Aguirre-Hudson, B., Ko-Ko, T.W., Hongsanan, S., Jones, E.B.G., Kodsueb, R., Phookamsak, R., Chukeatirote, E., Bahkali A.H. and Hyde, K.D. 2011. Capnodiaceae. Fungal Diversity 51: 103-134. Doi: 10.1007/s13225-011-0145-6. Clarke, B.B., White, J.F.Jr., Hurley, R.H., Torres, M.S., Sun, S. and Huff, D.R. 2006. Endophyte- mediated suppression of dollar spot disease in fine fescues. Plant Disease 90: 994-998. Clay, K. 1990. Fungal endophytes of grasses. Annual Review of Ecology and Systematics 21: 275-297. Conrath, U. 2009. Priming of induced plant defense responses. In: Advances in botanical research (Eds). Kader, J.-L and Delseny, M. vol. 51 Academic press pp 361-395. Couteaudier, Y. and Alabouvette, C. 1990. Quantitative comparison of Fusarium oxysporum competitiveness in relation to carbon utilization. FEMS Microbiology Letters 74 (4): 261- 267. Crawford, G.W. and Shen, C. 1998. The origins of rice agriculture: recent progress in East Asia. Antiquity 858-866.

146

Dababat, A.A. and Sikora, R.A., 2007. Importance of application time and inoculum density of Fusarium oxysporum 162 for biological control of Meloidogyne incognita on tomato. Nematropica 37: 267-275. Dababat, A.A., Selim, M.E., Saleh, A.A. and Sikora, R.A. 2008. Influence of Fusarium wilt resistant tomato cultivars on root colonization of the mutualistic endophyte Fusarium oxysporum strain 162 and its biological control efficacy toward the root-knot nematode Meloidogyne incognita. Journal of Plant Diseases and Protection 115 (6): 273-278. Daneshkhah, R., Cabello, S., Rozanska, E., Sobczak, M., Grundler, F.M.W., Wieczorek, K. and Hofmann, J. 2013. Piriformospora indica antagonizes cyst nematode infection and development in Arabidopsis roots. Journal of Experimental Botany 64 (12): 3763-3774. Danneberg, G., Latus, C., Zimmer, W., Hundeshagen, B., Schneider-Poetsch, H. and Bothe, H. 1992. Influence of vesicular-arbuscular mycorrhiza on phytohormone balances in maize (Zea mays L.). Journal of Plant Physiology 141 (1): 33-39. Das, A., Kamal, S., Shakil, N.A., Sherameti, I., Oelmüller, R., Dua, M., Tuteja, N., Johri, A.K. and Varma, A. 2012. The root endophyte fungus Piriformospora indica leads to early flowering, higher biomass and altered secondary metabolites of the medicinal plant, Coleus forskohlii. Plant Signalling and Behaviour 7 (1): 1-10. Das, J., Ramesh, K.V., Maithri, U., Mutangana, D. and Suresh, C.K. 2014. Response of aerobic rice to Piriformospora indica. Indian Journal of Experimental Biology 52 (3): 237-251. De Battista, J. 2005. Neotyphodium Research and Application in South America. In: Neotyphodium in Cool-Season Grasses (Eds). C. A. Roberts, C. P. West and D. E. Spiers). Blackwell Publishing Ltd, Oxford, UK. Doi: 10.1002/9780470384916. De Boer, W., Wagenaar, A.-M., Gunnewiek, P.J.K. and van Veen, J.A. 2007. In vitro suppression of fungi caused by combinations of apparently non-antagonistic soil bacteria. FEMS Microbiology Ecology 59: 177-185. De Cal, A., Larena, I., Liñan, M., Torres, R., Lamarca, N., Usall, J., Domenichini, P., Bellini, A., De Eribe, X.O and Melgarejo, P. 2009. Population dynamics of Epicoccum nigrum, a biocontrol agent against brown rot in stone fruit. Journal of Applied Microbiology 106: 592-605. De Grisse, A.T. 1969. Redescription ou modification de quelques techniques utilisonown rot‟étude des ns techni phytoparasitaires. Mededelingen Rijksfakulteit Landbouwwetenschappen Gent 34: 351-369. De la Peña, E., Moens, M., van Aelst, A. and Karssen, G. 2006. Description of Pratylenchus dunensis sp. n. (Nematoda: Pratylenchidae) a root-lesion nematode associated with the dune grass Ammophila arenaria (L.) Link. Nematology 8 (1): 79-88. De Luca, F., Fanelli, E., Di Vito, M., Reyes, A. and De Giorgi, C. 2004. Comparison of the sequences of the D3 expansion of the 26S ribosomal genes reveals different degrees of heterogeneity in different populations and species of Pratylenchus from the Mediterranean region. European Journal of Plant Pathology 110: 949-957. De Luca, F., Troccoli, A., Duncan, L.W., Subbotin, S.A., Waeyenberge, L., Coyne, D.L., Brentu, F.C. and Inserra, R.N. 2012. Pratylenchus speijeri n. sp. (Nematoda: Pratylenchidae), a new root-lesion nematode pest of plantain in West Africa. Nematology 14 (8): 987-1004. De Vleesschauwer, D., Djavaheri, M., Bakker, P.A.H.M. and Höfte, M. 2008. Pseudomonas fluorescens WCS374r-induced systemic resistance in rice against Magnaporthe oryzae is based on pseudobactin-mediated priming for a salicylic acid-repressible multifaceted defense response. Plant Physiology 148: 1996-2012. De Vleesschauwer, D., Yang, Y., Cruz, C.V. and Höfte, M. 2010. Abscisic acid-induced resistance against the brown spot pathogen Cochliobolus miyabeanus in rice involves

147

MAP kinase-mediated repression of ethylene signaling. Plant Physiology 152: 2036- 2052. De Vleesschauwer, D., Gheysen, G. and Höfte, M. 2013, Hormone defense networking in rice: tales from a different world. Trends in Plant Science 18 (10): 555-565 De Vleesschauwer, D., Xu, J. and Höfte, M. 2014 Making sense of hormone-mediated defense networking: from rice to Arabidopsis. Frontier in Plant Science 5: Doi: 10.3389/fpls.2014.00611 De Vos, M., van Oosten, V.R., van Poecke, R.M.P., van Pelt, J.A., Pozo, M.J., Mueller, M.J., Buchala, A.J., Métraux, J.P., van Loon, L.C., Dicke, M. and Pieterse, C.M.J. 2005. Signal signature and transcriptome changes of Arabidopsis during pathogen and insect attack. Molecular Plant-Microbe Interactions 18 (9): 923-937. De Waele, D. and Elsen, A. 2007. Challenges in tropical plant nematology. Annual Review of Phytopathology 45: 457-485. Doi: 10.1146/annurev.phyto.45.062806.094438. Dean, R., Van Kan, J.A.L., Pretorius, Z.A., Hammond‐Kosack, K.E., Di Pietro, A., Spanu, P.D., Rudd, J.J., Dickman, M., Kahmann, R., Ellis, J. and Foster, G.D. 2012. The Top 10 fungal pathogens in molecular plant pathology. Molecular Plant Pathology 13 (4): 414- 430. Delaye, L., García-Guzmán, G. and Heil, M. 2013. Endophytes versus biotrophic and necrotrophic pathogens-are fungal lifestyles evolutionarily stable traits? Fungal Diversity 60 (1): 125-135. Deshmukh, S.D., Hückelhoven, R., Schäfer, P., Imani, J., Sharma, M., Weiss, M., Waller, F. and Kogel, K.-H. 2006. The root endophytic fungus Piriformospora indica requires host cell death for proliferation during mutualistic symbiosis with barley. Proceeding of the National Academy of Science of the United States of America 103 (49): 18450-18457. Deshmukh, S.D. and Kogel, K.-H. 2007. Piriformospora indica protects barley from root rot caused by Fusarium graminearum. Journal of Plant Diseases and Protection 114 (6): 263-268. Di Menna, M., Finch, S.C., Popay, A.J. and Smith, B.L. 2012. A review of the Neotyphodium lolii/lolium perenne symbiosis and its associated effects on animal and plant health, with particular emphasis on ryegrass staggers. New Zealand Veterinary Journal 60 (6): 315- 328. Diedhiou, P.M., Hallmann, J., Oerke, E.-C. and Dehne, H.-W. 2003. Effects of arbuscular mycorrhizal fungi and a non-pathogenic Fusarium oxysporum on Meloidogyne incognita infestation of tomato. Mycorrhiza 13: 199-204. Dimkpa, S.O.N., Lahari, Z., Shrestha, R., Douglas, A., Gheysen, G. and Price, A.H. 2016. A genome-wide association study of a global rice panel reveals resistance in Oryza sativa to root-knot nematodes. Journal of Experimental Botany 67: 1191-1200. Ding, X., Cao, Y., Huang, L., Zhao, J., Xu, C., Li, X. and Wang, S. 2008. Activation of the indole- 3-acetic acid-amido synthetase GH3-8 suppresses expansin expression and promotes salicylate- and jasmonate-independent basal immunity in rice. The Plant Cell 20: 228- 240. Dobermann, A., Cassman, K.G., Mamaril, C.P. and Sheehy, J.E. 1998. Management of phosphorus, potassium, and sulfur in intensive, irrigated lowland rice. Field Crops Research 56 (1-2): 113-138. Dolatabadi, H.K., Goltapeh, E.M., Jaimand, K., Rohani, N. and Varma, A. 2011. Effects of Piriformospora indica and Sebacina vermifera on growth and yield of essential oil in fennel (Foeniculum vulgare) under greenhouse conditions. Journal of Basic Microbiology 51: 33-39. Doi.org/10.1002/jobm.201000214.

148

Domingo, C., Andrés, F., Tharreau, D., Iglesias, D.J. and Talón, M. 2009. Constitutive expression of OsGH3.1 reduces auxin content and enhances defense response and resistance to a fungal pathogen in rice. Molecular Plant-Microbe Interactions 22: 201-210. Domsch, K.H., Gams, W. and Anderson, T.H. 1980. Compendium of soil fungi, vol 1. Academic Press, London, pp 752-759. Douda, O., Marek, M, Zouhar, M. and Ryšánek, P. 2013. Insights into the structure and phylogeny of the 28S rRNA expansion segments D2 and D3 of the plant-infecting nematodes from the genus Ditylenchus (Nematoda: Anguinidae). Phytopathologia Mediterranea 52 (1): 84-97. Duan, L., Liu, H., Li, X., Xiao, J. and Wang, S. 2014. Multiple phytohormones and phytoalexins are involved in disease resistance to Magnaporthe oryzae invaded from roots in rice. Physiologia Plantarum 152: 486-500. Duijff, B.J., Pouhair, D., Olivain, C., Alabouvette, C. and Lemanceau, P. 1998. Implication of systemic induced resistance in the suppression of Fusarium wilt of tomato by Pseudomonas fluorescens WCS417r and by non-pathogenic Fusarium oxysporum Fo47. European Journal of Plant Pathology 104: 903-910. Dutta, B.K. 1981. Studies on some fungi isolated from the rhizosphere to tomato plants and the consequent prospect for the control of Verticillium wilt. Plant and Soil 63: 209-216. Dutta, T.K., Ganguly, A.K. and Gaur, H.S. 2012. Global status of rice root-knot nematode, Meloidogyne graminicola. African Journal of Microbiology Research 6 (31): 6016-6021, Edel, V., Steinberg, C., Avelange, I., Laguerre, G. and Alabouvette, C. 1995. Comparison of three molecular methods for the characterization of Fusarium oxysporum strains. Phytopathology 85: 579-585. Edens, R.M., Anand, S.C. and Bolla, R.I. 1995. Enzymes of the phenylpropanoid pathway in soybean infected with Meloidogyne incognita or Heterodera glycines. Journal of Nematology 27: 292-303. Eisenback, J.D., Hirschmann, H., Sasser, J.N. and Triantaphyllou, A.C. 1981. A guide to the four most common species of root-knot nematode (Meloidogyne spp.), with a pictorial key. Raleigh, NC, USA, North Carolina State University Graphics. El-Fattah, A., Dababat, A.A. and Sikora, R.A. 2007a. Induced resistance by the mutualistic endophyte, Fusarium oxysporum strain 162, toward Meloidogyne incognita on tomato. Biocontrol Science and Technology 17 (9): 969-975. El-Fattah, A., Dababat, A.A. and Sikora, R.A. 2007b. Influence of the mutualistic endophyte Fusarium oxysporum 162 on Meloidogyne incognita attraction and invasion. Nematology 9 (6): 771-776. Elsen, A., Gervacio, D., Swennen, R. and De Waele, D. 2008. AMF-induced biocontrol against plant parasitic nematodes in Musa sp.: a systemic effect. Mycorrhiza 18: 251-256. Eparvier, A. and Alabouvette, C. 1994. Use of ELISA and GUS‐transformed strains to study competition between pathogenic and non‐pathogenic Fusarium oxysporum for root colonization. Biocontrol Science and Technology 4: 35-47. Fakhro, A., Andrade-Linares, D.R., von Bargen, S., Bandte, M., Büttner, C., Grosch, R., Schwarz, D. and Franken, P. 2010. Impact of Piriformospora indica on tomato growth and on interaction with fungal and viral pathogens. Mycorrhiza 20: 191-200. FAOSTAT, 2016. Food and Agriculture Organization of the United Nations. FAOSTAT Database http://faostat3.fao.org. Fávaro, L.C.L., Sebastianes, F.L.S. and Araújo, W.L. 2012. Epicoccum nigrum P16, a sugarcane endophyte, produces antifungal compounds and induces root growth. PLoS One 7(6): e36826. doi:10.1371/journal.pone.0036826.

149

Fesel, P.H. and Zuccaro, A. 2016. Dissecting endophytic lifestyle along the parasitism/mutualism continuum in Arabidopsis. Current Opinion in Microbiology 32: 103-112. Fisher, P. and Petrini, O. 1992. Fungal saprobes and pathogens as endophytes of rice (Oryza sativa L.). New Phytologist 120: 137-143. Fitze, D., Wiepning, A., Kaldorf, M. and Ludwig-Muller, J. 2005. Auxins in the development of an arbuscular mycorrhizal symbiosis in maize. Journal of Plant Physiology 162: 1210-1219. Flors, V., Ton, J., van Doorn, R., Jakab, G., García-Agustin, P. and Mauch-Mani, B. 2008. Interplay between JA, SA and ABA signalling during basal and induced resistance against Pseudomonas syringae and Alternaria brassicicola. The Plant Journal 54: 81-92. Fortuner, R. 1976. Pratylenchus zeae. C.I.H. Description of Plant-parasitic nematodes set 6 no: 77: 3 p. Freeman, S. and Rodriguez, R.J. 1993. Genetic conversion of a fungal plant pathogen to a non- pathogenic, endophytic mutualist. Science 260: 75-78. Fu, J., Liu, H.B., Li, Y., Yu, H.H., Li, X.H., Xiao, J.H. and Wang, S. 2011. Manipulating broad- spectrum disease resistance by suppressing pathogen-induced auxin accumulation in rice. Plant Physiology 155 (1): 589-602. Fuchs, J.-G., Moënne-Loccoz, Y. and Défago, G. 1997. Non-pathogenic Fusarium oxysporum strain Fo47 induces resistance to Fusarium wilt in tomato. Plant Disease 81 (5): 492-496. Gadd, G.M. 1999. Fungal production of citric and oxalic acid: importance in metal speciation, physiology and biogeochemical processes. Advances in Microbial Physiology 41: 47-92. Gamir, J., Sánchez-Bel, P. and Flors, V. 2014. Molecular and physiological stages of priming: how plants prepare for environmental challenges. Plant Cell Reports 33 (12): 1935-1949. Gamuyao, R., Chin, J.H., Pariasca-Tanaka, J., Pesaresi, P., Catausan, S., Dalid, C., Slamet- Loedin, I., Tecson-Mendoza, E.M., Wissuwa, M. and Heuer, S. 2012. The protein kinase Pstol1 from traditional rice confers tolerance of phosphorus deficiency. Nature 488: 535- 542. Garris, A.J., Tai, T.H., Coburn, J., Kresovich, S. and McCouch, S. 2005. Genetic structure and diversity in Oryza sativa L. Genetics 169: 1631-1638. Gazis, R. and Chaverri, P. 2010. Diversity of fungal endophytes in leaves and stems of wild rubber trees (Hevea brasiliensis) in Peru. Fungal Ecology 3: 240-254. Gazis, R.O. 2012. Evaluating the endophytic fungal community in planted and wild rubber trees (Hevea brasiliensis). PhD thesis, University of Maryland, College Park, USA. Geiser, D.M., del Mar Jiménez-Gasco, M., Kang, S., Makalowska, I., Veeraraghavan, N., Ward, T.J., Zhang, N., Kuldau, G.A. and O‟Donnell, K. 2004. FUSARIUM-ID v. 1.0: A DNA sequence database for identifying Fusarium. Pages 473-479 In: Molecular diversity and PCR-detection of toxigenic Fusarium Species and Ochratoxigenic Fungi, Springer. Ghimire, S.R., Charlton, N.D., Bell, J.D., Krishnamurthy, Y.L. and Craven, K.D. 2011. Biodiversity of fungal endophyte communities inhabiting switchgrass (Panicum virgatum L.) growing in the native tallgrass prairie of northern Oklahoma. Fungal Diversity 47: 19-27. Gianinazzi-Pearson, V. 1996. Plant cell responses to arbuscular mycorrhizal fungi: getting to the roots of the symbiosis. The Plant Cell 8 (10): 1871-1883. Giberti, S., Bertea, C.M., Narayana, R., Maffei, M.E. and Forlani, G. 2012. Two phenylalanine ammonia lyase isoforms are involved in the elicitor-induced response of rice to the fungal pathogen Magnaporthe oryzae. Journal of Plant Physiology 169: 249-254. Gill, S.S., Gill, R., Trivedi, D.K., Anjum, N.A., Sharma, K.K., Ansari, M.W., Ansari, A.A. Johri, A.K., Prasad, R., Pereira, E., Varma, A. and Tuteja, N. 2016. Piriformospora indica: potential and significance in plant Stress tolerance. Frontier in Microbiology 7:332. Doi: 10.3389/fmicb.2016.00332.

150

Glazebrook, J. 2005. Contrasting mechanisms of defense against biotrophic and necrotrophic pathogens. Annual Review Phytopathology 43: 205-227. Gomez-Gomez, L. and Boller, T. 2000. FLS2: an LRR receptor-like kinase involved in the perception of the bacterial elicitor flagellin in Arabidopsis. Molecular Cell 5 (6): 1003- 1011. Gonçalves, V.N., Vaz, A.B.M., Rosa, C.A. and Rosa, L.H. 2012. Diversity and distribution of fungal communities in lakes of Antarctica. FEMS Microbiology Ecology 82: 459-471. Graham, T.W. 1951. Nematode root rot of tobacco and other plants. Bulletin 390, South Carolina Agricultural Experiment Station, Clemson Agricultural College, USA. Grant, M. and Lamb, C. 2006. Systemic immunity. Current Opinion in Plant Biology 9: 414-420. Grist, D.H. 1986. Rice. Longman, New York, USA. Güimil, S., Chang, H.-S., Zhu, T., Sesma, A., Osbourn, A., Roux, C., Ionnidis, V., Oakeley, E.J., Docquier, M., Descombes, P. Steven P. Briggs, S.P. and Paszkowski, U. 2005. Comparative transcriptomics of rice reveals an ancient pattern of response to microbial colonization. Proceedings of the National Academy of Science of the United State of America 102 (22): 8066-8070. Guo, L.-D., Xu, L., Zheng, W.-H. and Hyde, K.D. 2004. Genetic variation of Alternaria alternata, an endophytic fungus isolated from Pinus tabulaeformis as determined by random amplified microsatellites (RAMS). Fungal Diversity 16: 53-65. Gupta, S.K., Rai, A.K., Kanwar, S.S., Chand, D., Singh, N.K. and Sharma, T.R. 2012. The single functional blast resistance gene Pi54 activates a complex defence mechanism in rice. Journal of Experimental Botany 63 (2): 757-772. Hageskal, G., Knutsen, A.K., Gaustad, P., de Hoog, S.G. and Skaar, I. 2006. Diversity and significance of mold species in Norwegian drinking water. Applied Environmental Microbiology 72: 7586-7593. Hallmann, J. and Sikora, R.A. 1994. Occurrence of plant prasitic nematodes and non-pathogenic species of Fusarium in tomato plants in Kenya and their role as mutualistic synergists for biological control of root-knot nematodes. International Journal of Pest and Management 40 (4): 321-325. Hamilton, C.E. and Bauerle, T.L. 2012. A new currency for mutualism? Fungal endophytes alter antioxidant activity in hosts responding to drought. Fungal Diversity 54: 39-49. Harvey, P.R., Warren, R.A. and Wakelin, S. 2009. Potential to improve root access to phosphorus: the role of non-symbiotic microbial inoculants in the rhizosphere. Crop Pasture Science 60 (2): 144-151. Hause, B., Maier, W., Miersch, O., Kramell, R. and Strack, D. 2002. Induction of jasmonate biosynthesis in arbuscular mycorrhizal barley roots. Plant Physiology 130: 1213-1220. Higgins, K.L., Coley, P.D., Kursar, T.A. and Arnold, A.E. 2011. Culturing and direct PCR suggest prevalent host generalism among diverse fungal endophytes of tropical forest grasses. Mycologia 103 (2): 247-260. Higgins, K.L., Arnold, A.E., Coley, P.D. and Kursar, T.A. 2014. Communities of fungal endophytes in tropical forest grasses: highly diverse host-and habitat generalists characterized by strong spatial structure. Fungal Ecology 8: 1-11. Huang, X., Kurata, N., Wei, X., Wang, Z.-X., Wang, A., Zhao, Q., Zhao, Y., Liu, K., Lu, H., Li, W., Guo, Y., Lu, Y., Zhou, C., Fan, D., Weng, Q., Zhu, C., Huang, T., Zhang, L., Wang, Y., Feng, L., Furuumi, H., Kubo, T., Miyabayashi, T., Yuan, X., Xu, Q., Dong, G., Zhan, Q., Li, C., Fujiyama, A., Toyoda, A., Lu, T., Feng, Q., Qian, Q., Li, J. and Han, B. 2012. A map of rice genome variation reveals the origin of cultivated rice. Nature 490: 497-501.

151

Hussey, R.S. and Ronchadorl, R.W. 1988. Vesicular-arbuscular mycorrhizae my limit nematode activity and improve plant growth. Plant disease 66 (1): 9-14. Hyde, K.D., Jones, E.B.G., Liu, J.-K., Ariyawansa, H., Boehm, E., Boonmee, S., Braun, U., Chomnunti, P., Crous, P.W., Dai, D.-Q., Diederich, P., Dissanayake, A., Doilom, M., Doveri, F., Hongsanan, S., Jayawardena, R., Lawrey, J.D., Li, Y.-M., Liu, Y.-X., Lücking, R., Monkai, J., Muggia, L., Nelsen, M.P., Pang, K.-L., Phookamsak, R., Senanayake, I.C., Shearer, C.A., Suetrong, S., Tanaka, K., Thambugala, K.M., Wijayawardene, N.N., Wikee, S., Wu, H.-X., Zhang, Y., Aguirre-Hudson, B., Alias, S.A., Aptroot, A., Bahkali, A.H., Bezerra, J.L., Bhat, D.J., Camporesi, E., Chukeatirote, E.C., Gueidan, C., Hawksworth, D.L., Hirayama, K., De Hoog, S., Kang, J.-C., Knudsen, K., Li, W.-J., Li, X.- H., Liu, Z.-Y., Mapook, A., McKenzie, E.H.C., Miller, A.N., Mortimer, P.E., Phillips, A.J.L., Raja, H.F., Scheuer, C., Schumm, F., Taylor, J.E., Tian, Q., Tibpromma, S., Wanasinghe, D.N., Wang, Y., Xu, J.-C., Yacharoen, S., Yan, J.-Y., Zhang, M. 2013. Families of Dothideomycetes. Fungal Diversity 63 (1): 1-313. Doi: 10.1007/s13225-013-0263-4. IRGSP, 2005. The Map-Based Sequence of the Rice Genome. Nature 436: 793-800. Iwai, T., Seo, S., Mitsuhara, I. and Ohashi, Y. 2007. Probenazole-induced accumulation of salicylic acid confers resistance to Magnaporthe grisea in adult rice plants. Plant and Cell Physiology 48: 915-924. Jacobs, S., Zechmann, B., Molitor, A., Trujillo, M., Petutschnig, E., Lipka, V., Kogel, K.-H. and Schäfer, P. 2011. Broad-spectrum suppression of innate immunity is required for colonization of Arabidopsis roots by the fungus Piriformospora indica. Plant Physiology 156: 726-740. Jain, R.K., Khan, M.R. and Kumar, V. 2012. Rice root-knot nematode (Meloidogyne graminicola) infestation in rice. Archives of Phytopathology and Plant Protection 45 (6): 635-645. Ji, H., Kyndt, T., He, W., Vanholme, B. and Gheysen, G. 2015. β-Aminobutyric Acid-Induced resistance against root-knot nematodes in rice is based on increased basal defense. Molecular Plant-Microbe Interactions 28: 519-533. Jiang, C.J., Shimono, M., Sugano, S., Kojima, M., Yazawa, K., Yoshida, R., Inoue, H., Hayashi, N., Sakakibara, H. and Takatsuji, H. 2010. Abscisic acid interacts antagonistically with salicylic acid signalling pathway in rice-Magnaporthe grisea interaction. Molecular Plant- Microbe Interactions 23 (6): 791-798. Jiménez-Fernández, D., Montes-Borrego, M., Navas-Cortés, J.A., Jiménez-Díaz, R.M. and Landa, B.B. 2010. Identification and quantification of Fusarium oxysporum in planta and soil by means of an improved specific and quantitative PCR assay. Applied Soil Ecology 46: 372-382. Doi:10.1016/j.apsoil.2010.10.00. Jogawat, A., Saha, S., Bakshi, M., Dayaman, V., Kumar, M., Dua, M., Varma, A., Oelmüller, R., Tuteja, N. and Johri, A.K. 2013. Piriformospora indica rescues growth diminution of rice seedlings during high salt stress. Plant Signaling and Behaviour 8:10, e26891. Jones, M.P., Dingkuhn, M., Aluko, G.K. and Semon, M. 1997. Interspecific Oryza sativa L. X O. glaberrima Steud. progenies in upland rice improvement. Euphytica 94: 237-246. Jones, J.D. and Dangl, J.L. 2006. The plant immune system. Nature 444: 323-329. Jones, J.T., Haegeman, A., Danchin, E.G.J., Gaur, H.S., Helder, J., Jones, M.G.K., Kikuchi, T., Manzanilla-Lopez, R., Palomares-Rius, J.E., Wesemael, W.M.L. and Perry, R.N. 2013. Top 10 plant-parasitic nematodes in molecular plant pathology. Molecular Plant Pathology 14 (9): 946-961. Jones, M.G.K. and Fosu-Nyarko, J. 2014. Molecular biology of root lesion nematodes (Pratylenchus spp.) and their interaction with host plants. Annual of Applied Biology 164: 163-181.

152

Journet, E.-P., de Carvalho-Niebel, F., Andriankaja, A., Huguet, T. and D.G. Barker, D.G. 2006. Rhizobial inoculation and nodulation of Medicago truncatula. Medicago truncatula handbook 1-6. Kagoda, F., Coyne, D.L., Mbiru, E., Derera, J. and Tongoona, P. 2010. Monoxenic culture of Pratylenchus zeae on carrot discs. Nématologie Mediterranea 38: 107-108. Kaku, H., Nishizawa, Y., Ishii-Minami, N., Akimoto-Tomiyama, C., Dohmae, N., Takio, K., Minami, E. and Shibuya, N. 2006. Plant cells recognize chitin fragments for defense signalling through a plasma membrane receptor. Proceedings of the National Academy of Science of the United State of America 103 (29): 11086-11091. Kaldorfa, M. and Ludwig-Muller, J. 2000. AM fungi might affect the root morphology of maize by increasing indole-3-butyric acid biosynthesis. Physiologia Plantarum 109: 58-67. Kanamori, H., Fujisawa, M., Katagiri, S., Oono, Y., Fujisawa, H., Karasawa, W., Kurita, K., Sasaki, H., Mori, S., Hamada, M., Mukai, Y., Yazawa, T., Mizuno, H., Namiki, N., Sasaki, T., Katayose, Y., Matsumoto, T. and Wu, J. 2013. A BAC physical map of aus rice cultivar „Kasalath‟, and the map-based genomic sequence of „Kasalath‟ chromosome 1. The Plant Journal 76: 699-708. Kariaga, M.G.O. and Agama, P.E. 1994. Plant parasitic nematodes associated with rain-fed rice in western Kenya. African Crop Science Conference Proceedings 1: 310-311. Kato, A., Miyake, T., Nishigata, K., Tateishi, H., Teraoka, T. and Arie, T. 2012. Use of fluorescent proteins to visualise interactions between the Bakanae disease pathogen Gibberella fujikuroi and the biological agent Talaromyces sp. KNB-422. Journal of General Plant Pathology 78: 54-61. Kavroulakis, N., Papadopoulou, K. K., Ntougias, S., Zervakis, G. I. and Ehaliotis, C. 2006. Cytological and other aspects of pathogenesis related gene expression in tomato plants grown on a suppressive compost. Annuals of Botany 98: 555-564. Kawamata, H., Narisawa, K. and Hashiba, T. 2004. Suppression of rice blast by phylloplane fungi isolated from rice plants. Journal of General Plant Pathology 70: 131-138. Kayeke, J., Sibuga, P.K., Msaky, J.J. and Mbwaga, A. 2007. Green manure and inorganic fertiliser as management strategies for witch weed and upland rice. African Crop Science Journal 15 (4): 161-171. Khan, A.L., Waqas, M., Khan, A.R., Hussain, J., Kang, S.-M., Gilani, S.A., Hamayun, M., Shin, J.-H., Kamran, M., Al-Harrasi, A., Yun, B.-W., Adnan, M. and Lee, I.-J. 2013. Fungal endophyte Penicillium janthinellium LK5 improves growth of ABA-deficient tomato under salinity. World Journal of Microbiology and Biotechnology 29: 2133-2144 Kihoro, J., Bosco, N.J., Murage, H., Ateka, E. and Makihara, D. 2013. Investigating the impact of rice blast disease on the livelihood of the local farmers in greater Mwea region of Kenya. SpringerPlus 2: 308. Doi: 10.1186/2193-1801-2-308. Kimenju, J.W., Waudo, S.W., Mwang'ombe, A.W., Sikora, R.A. and Schuster, R.P. 1998. Distribution of lesion nematodes associated with maize in Kenya and susceptibility of maize cultivars to Pratylenchus zeae. African Crop Science Journal 6 (4): 367-375. Kinh, D.-N., Huong, N.M. and Ut, N.U. 1982. Root-knot disease of rice in the Mekong Delta, Vietnam. International Rice Resource Newsletter 7: 6-7. Kistner, C. and Parniske, M. 2002. Evolution of signal transduction in intracellular symbiosis. Trends in Plant Science 7 (11): 511-518. Kleczewski, N.W., Bauer, J.T., Bever, J.D., Clay, K. and Reynolds, H.L. 2012. A survey of endophytic fungi of switch grass (Panicum virgatum) in the Midwest, and their putative roles in plant growth. Fungal Ecology 5: 521-529.

153

Kleynhans, K.P.N. 1991. The root-knot nematodes of South Africa. Technical Communication- Department of Agricultural Development, South Africa, No. 231:61 pp.; 136 ref. Kloepper, J.W., Ryu, C.-M. and Zhang, S. 2004. Induced systemic resistance and promotion of plant growth by Bacillus spp. Phytopathology 94: 1259-1266. Kogel, K.-H., Franken, P. and Hückelhoven, R. 2006. Endophyte or parasite-what decides? Current Opinion in Plant Biology 9: 358-363. Ko-Ko, T.W.K., Stephenson, S.L., Bahkali, A.H. and Hyde, K.D. 2011. From morphology to molecular biology: can we use sequence data to identify fungal endophytes? Fungal Diversity 50: 113-120. Kovach, M.J., Sweeney, M.T. and McCouch, S.R. 2007. New insights into the history of rice domestication. Trends Genetics 23: 578-587. Krings, M., Taylor, T.N., Hass, H., Kerp, H., Dotzler, N. and Hermsen, E.J. 2007. Fungal endophytes in a 400-million-yr-old land plant: infection pathways, spatial distribution, and host responses. New Phytologist 174: 648-657. Kucey, R.M.N., Janzen, H.H. and Leggett, M.E. 1989. Microbially mediated increases in plant- available phosphorus. Advanced Agronomy 42: 199-228 Kuldau, G.A. and Yates, I.E. 2000. Evidence for Fusarium endophytes in cultivated and wild plants, p 85–117. In: Bacon CW, White JF, Jr (ed), Microbial endophytes. Marcel Dekker, New York, NY. Kumar, M., Yadav, V., Tuteja, N. and Johri, A.K. 2009. Antioxidant enzyme activities in plants colonized with Piriformospora indica. Microbiology 155: 780-90. Kumari, C., Dutta, T.K., Banakar, P. and Rao, U. 2015. Comparing the defence-related gene expression changes upon root-knot nematode attack in susceptible versus resistant cultivars of rice. Scientific Report 6:22846. Doi: 10.1038/srep22846. Kuria, J.N., Ommeh, H., Kabuage, L., Mbogo, S. and Mutero, C. 2003. Technical efficiency of rice producers in Mwea Irrigation Scheme. African Crop Science Conference Proceedings 6: 668-673. Kyndt, T., Nahar, K., Haegeman, A., De Vleesschauwer, D., Höfte, M.M. and Gheysen, G. 2012. Comparing systemic defence-related gene expression changes upon migratory and sedentary nematode attack in rice. Plant Biology 14 (1): 73-82. Kyndt, T., Fernandez, D. and Gheysen, G. 2014. Plant-parasitic nematode infections in rice: molecular and cellular insights. Annual Review of Phytopathology 52: 135-153. Larena, I. and Melgarejo, P. 1996. Biological Control of Monilinia laxa and Fusarium oxysporum f. sp. lycopersici by a lytic enzyme-producing Penicillium purpurogenum. Biological Control 6: 361-367. Larkin, R.P. and Fravel, D.R. 1999. Mechanisms of action and dose-response relationships governing biological control of Fusarium wilt of tomato by non-pathogenic Fusarium spp. Phytopathology 89: 1152-1161. Le Floch, G., Rey, P., Benizri, E., Benhamou, N. and Tirilly, Y. 2003. Impact of auxin-compounds produced by the antagonistic fungus Pythium oligandrum or the minor pathogen Pythium group F on plant growth. Plant and Soil 275: 459-470. Le, H.T.T., Padgham, J.L. and Sikora, R.A. 2009. Biological control of the rice root-knot nematode Meloidogyne graminicola on rice, using endophytic and rhizosphere fungi. International Journal of Pest Management 55 (1): 31-36. Le, H.T.T., Padgham, J.L., Hagemann, M.H. Sikora, R.A. and A. Schouten, A. 2016. Developmental and behavioural effects of the endophytic Fusarium moniliforme Fe14 towards Meloidogyne graminicola in rice. Annals of Applied Biology 169: 134–143.

154

Lee, H.I., Leon, J. and Raskin, I. 1995. Biosynthesis and metabolism of salicylic acid. Proceedings of the National Academy of Sciences of the United State of America 92 (10): 4076-4079. Lee, M.W., Qi, M. and Yang, Y.O. 2001. A novel jasmonic acid-inducible rice myb gene associates with fungal infection and host cell death. Molecular Plant-Microbe Interactions 14 (4): 527-535. Lenné, J.M. and Wood, D. 2011. Agrobiodiversity management for food security: A critical review. CABI Nosworthy Way, Wallingford Oxfordshire, OX108DE, UK. Leuchtmann, A., Bacon, C.W., Schardl, C.L., White, J.F. Jr. and Tadych, M. 2014. Nomenclatural realignment of Neotyphodium species with genus Epichloë. Mycologia 106: 202-215. Linares, O. 2002. African rice (Oryza glaberrima): History and future potential. Proceedings of the National Academy of Science of the United State of America 99 (25): 6360-16365. Liu, J., Maldonado-Mendoza, I., Lopez-Meyer, M., Cheung, F., Town, C.D., Harrison, M.J. 2007. Arbuscular mycorrhizal symbiosis is accompanied by local and systemic alterations in gene expression and an increase in disease resistance in the shoots. The Plant Journal 50: 529-544. Liu, H., Li, X., Xiao, J. and Wang, S. 2012. A convenient method for simultaneous quantification of multiple phytohormones and metabolites: application in study of rice-bacterium interaction. Plant Methods 8: 2 Loof, P. A.A. 1978. The genus Pratylenchus filipjev, 1936 (Nematoda: Pratylenchidae): A review of its anatomy, morphology, distribution, systematics, and identification. Research Information Center. Swedish University of Agricultural Sciences. Uppsala, Sweden. Louvet, J., Rouxel, F. and Alabouvette, C. 1976. Recherches sur la résistance des sols aux maladies. I – Mise en évidence de la nature microbiologique de la résistance d‟un sol au développement de la fusariose vasculaire du melon. Annales de Phytopathologie 8: 425- 436. Luc, M., Sikora, R.A. and Bridge, J. 2005. Plant-parasitic nematodes in subtropical and tropical agriculture, Eds. CAB International, Wallingford, UK. Ludwig-Müller, J., Kaldorf, M., Sutter, E.G. and Epstein, E. 1997. Indole-3-butyric acid (IBA) is enhanced in young maize (Zea mays L.) roots colonised with the arbuscular mycorrhizal fungus Glomus intraradices. Plant Science 125: 153-162. Lutts, S., Majerus, V. and Kinet J.-M.1999. NaCl effects on proline metabolism in rice (Oryza sativa) seedlings. Physiologia Plantarum 105: 450-458. Maciá-Vicente, J.G., Jansson, H.-B., Abdullah, S.K., Descals, E., Salinas, J. and Lopez-Llorca, L.V. 2008. Fungal root endophytes from natural vegetation in Mediterranean environments with special reference to Fusarium spp. FEMS Microbiology Ecology 64: 90-105. Madi, L., Katan, T., Katan, J. and Henis, Y. 1997. Biological control of Sclerotium rolfsii and Verticillium dahliae by Talaromyces flavus is mediated by different mechanisms. Phytopathology 87: 1054-1060. Mahadevakumar, S., Jayaramaiah, K.M. and Janardhana, G.R. 2014. First report of leaf spot disease caused by Epicoccum nigrum on Lablab purpureus in India. Plant Disease 98 (2): 284-284. Maleck, K., Levine, A., Eulgem, T., Morgan, A., Schmid, J., Lawton, K.A., Dangl, J.L. and Dietrich, R.A. 2000. The transcriptome of Arabidopsis thaliana during systemic acquired resistance. Nature Genetics 26: 403-410.

155

Manici, L.M. and Caputo, F. 2009. Fungal community diversity and soil health in intensive potato cropping systems of the east Po valley, Northern Italy. Annals of Applied Biology 155: 245-258. Mansfield, J., Genin, S., Magori, S., Citovsky, V., Sriariyanum, M., Ronald, P., Dow, M., Verdier, V., Beer, S.V., Machado, M.A., Toth, I., Salmond, G. and Foster, G.D. 2012. Top 10 plant pathogenic bacteria in molecular plant pathology. Molecular Plant Pathology 13 (6): 614- 629. Mantelin, S., Bellafiore, S. and Kyndt, T. 2016. Meloidogyne graminicola a major threat to rice agriculture. Molecular Plant Pathology. Doi: 10.1111/mpp.12394. Marois, J.J., Johnston, S.A., Dunn, M.T. and Papavizas, G.C. 1982. Biological control of Verticillium wilt of eggplant in the field. Plant Disease 66: 1166-1168. Marois, J.J., Fravel, D.R. and Papavizas, G.C. 1984. Ability of Talaromyces flavus to occupy the rhizosphere. Soil Biology and Biochemistry 16:387-390. Márquez, S.S, Bills, G.F. and Zabalgogeazcoa, I. 2008. Diversity and structure of the fungal endophytic assemblages from two sympatric coastal grasses. Fungal Diversity 33: 87- 100. Márquez, S.S., Bills, G.F., Herrero, N. and Zabalgogeazcoa, Í. 2012. Non-systemic fungal endophytes of grasses. Fungal Ecology 5: 289-297. Marsh, J.F. and Schultze, M. 2001. Analysis of arbuscular mycorrhizas using symbiosis-defective plant mutants. New Phytologist 150: 525-532. Martínez-Medina, A., Fernandez, I., Lok, G.B., Pozo, M.J., Pieterse, C.M.J. and van Wees, S.C.M. 2016. Shifting from priming of salicylic acid- to jasmonic acid-regulated defences by Trichoderma protects tomato against the root-knot nematode Meloidogyne incognita. New Phytologist Doi: 10.1111/nph.14251. Martinuz, A., Schouten, A., Menjivar, R.D. and Sikora, R.A. 2012. Effectiveness of systemic resistance toward Aphis gossypii (Hom., Aphididae) as induced by combined applications of the endophytes Fusarium oxysporum Fo162 and Rhizobium etli G12. Biological Control 62: 206-212. Martinuz, A., Schouten, A. and Sikora, R.A. 2013. Post-infection development of Meloidogyne incognita on tomato treated with the endophytes Fusarium oxysporum strain Fo162 and Rhizobium etli strain G12. BioControl 58: 95-104. Martinuz, A., Zewdu, G., Ludwig, N., Grundler, F., Sikora, R.A. and Schouten, A. 2015. The application of Arabidopsis thaliana in studying tripartite interactions among plants, beneficial fungal endophytes and biotrophic plant-parasitic nematodes. Planta 241: 1015- 1025. Masclaux-Daubresse, C., Daniel-Vedel, F., Dechorgnat, J., Chardon, F. and Gaufichon, L., 2010. Nitrogen uptake, assimilation and remobilization in plants: challenges for sustainable and productive agriculture. Annuals of Botany 105: 1141-1157. Mati, B.M. and Nyamai, M. 2009. Promoting the system of rice intensification in Kenya: Growing more with less water: an information brochure for training on SRI in Mwea.http://www.imawesa.net/publications/trainingmanuals/IMAWESATrainingManual5- SRInotes.pdf. Mati, B.M., Wanjogu R. Odongo, B. and Home, P.G. 2011. Introduction of the System of Rice Intensification in Kenya: experiences from Mwea Irrigation Scheme. Paddy and Water Management 9 (1): 145-154. Mayerhofer, M.S., Kernaghan, G. and Harper, K.A. 2013. The effects of fungal root endophytes on plant growth: a meta-analysis. Mycorrhiza 23: 119-128.

156

McDowell, J.M., Williams, S.G., Funderburg, N.T., Eulgem, T., Dangl, J.L. 2005. Genetic analysis of developmentally regulated resistance to downy mildew (Hyaloperonospora parasitica) in Arabidopsis thaliana. Molecular Plant-Microbe Interactions 18 (11): 1226-1234. Meixner, C., Ludwig-Müller, J., Miersch, O., Gresshoff, P., Staehelin, C. and Vierheilig, H. 2005. Lack of mycorrhizal autoregulation and phytohormonal changes in the supernodulating soybean mutant nts 1007. Planta 222: 709-715. Mekete, T., Reynolds, K., Lopez-Nicora, H.D., Gray, M.E. and Niblack, T.L. 2011. Distribution and diversity of root-lesion nematode (Pratylenchus spp.) associated with Miscanthus x giganteus and Panicum virgatum used for bio-fuels and species identification in a multiplex polymerase chain reaction. Nematology 13 (6): 673-686. Mellersh, D.G. and Heath, M.C. 2003. An investigation into the involvement of defense signalling pathways in components of the non-host resistance of Arabidopsis thaliana to rust fungi also reveals a model system for studying rust fungal compatibility. Molecular Plant- Microbe Interactions 16: 398-404. Mendoza, A.R. and Sikora, R.A. 2009. Biological control of Radopholus similis in banana by combined application of the mutualistic endophyte Fusarium oxysporum strain 162, the egg pathogen Paecilomyces lilacinus strain 251 and the antagonistic bacteria Bacillus firmus. BioControl 54: 263-272. Menendez, A.B. and Godeas, A. 1998. Biological control of Sclerotinia sclerotiorum attacking soybean plants: degradation of the cell wall of this pathogen by Trichoderma harzianum. Mycopathology 142: 153-160. Menjivar, R.D., Hagemanna, M.H., Kranz, J., Cabrera, J.A., Dababat, A.A. and Sikora, R.A. 2011. Biological control of Meloidogyne incognita on cucurbitaceous crops by the non- pathogenic endophytic fungus Fusarium oxysporum strain 162. International Journal of Pest Management 57 (3): 249-253. Menjivar, R.D., Cabrera, J.A., Kranz, J. and Sikora, R.A. 2012. Induction of metabolite organic compounds by mutualistic endophytic fungi to reduce the greenhouse whitefly Trialeurodes vaporariorum (Westwood) infection on tomato. Plant and Soil 352 (1): 233- 241. Miya, A., Albert, P., Shinya, T., Desaki, Y., Ichimura, K., Shirasu, K., Narusaka, Y., Kawakami, N., Kaku, H. and Shibuya, N. 2007. CERK1, a LysM receptor kinase, is essential for chitin elicitor signaling in Arabidopsis. Proceedings of the National Academy of Science of the United State of America 104: 19613-19618. Miyake, T., Kato, A., Tateishi, H., Teraoka, T. and Arie, T. 2012. Mode of action of Talaromyces sp. KNB422, a biological agent against rice seedling diseases. Journal of Pesticide Science 37: 56-61. Mizukubo, T., Oriu, Y., Hanada, K. and Sano, Z. 2003. Micro evolutionary trend in Pratylenchus coffeae sensu stricto (Nematoda: Pratylenchidae): the diversity in PCR-RFLP phenotype, compatibility on host plants and reproductive segregation. Japanese Journal of Nematology 33: 57-76. Mohanty, S. 2009. Global rice trade: what does it mean for future food security? Rice Today 8: 44-45. Mokrini, F., Waeyenberge, L., Viaene, N., Andaloussi, F.A. and Moens, M. 2016. Diversity of root-lesion nematodes (Pratylenchus spp.) associated with wheat (Triticum aestivum and T. durum) in Morocco. Nematology 18 (7): 781-801. Monteiro, J.M.S., Cares, J.E., Momes, A.C.M.M., Correa, V.R., Mattos, V.S., Santos, M.F.A., Almeida, M.R.A., Santos, C.D.G., Castagnone-Sereno, P. and Carneiro, R.M.D.G. 2016.

157

First report of, and additional information on, Meloidogyne konaensis (Nematoda: Meloidogyninae) parasitising various crops in Brazil. Nematology 18 (7): 831-844 Moody, E.H., Lownsbery, B.F. and Ahmed, J.M. 1973. Culture of the root-lesion nematode Pratylenchus vulnus on carrot disks. Journal of Nematology 19: 125-126. Muhunyu, J.G. 2012. Is doubling rice production in Kenya by 2018 achievable? Journal of Developments in Sustainable Agriculture 7: 46-54. Múnera, G.E, Bert, W. and Decraemer, W. 2009. Morphological and molecular characterisation of Pratylenchus araucensis n. sp. (Pratylenchidae), a root-lesion nematode associated with Musa plants in Colombia. Nematology 11 (6): 799-813. Murali, M., Sudisha, J., Amruthesh, K.N. Ito, S.-I. and Shetty, H.S. 2013. Rhizosphere fungus Penicillium chrysogenum promotes growth and induces defence-related genes and downy mildew disease resistance in pearl millet. Plant Biology 15: 111-118. Mutero, C.M. Blank, H., Konradsen, F. and van de Hoek, W. 2000. Water management for controlling the breeding of Anopheles mosquitoes in rice irrigation schemes in Kenya. Act Tropica 76: 253-263. Nahar, K., Kyndt, T., De Vleesschauwer, D., Höfte, M. and Gheysen, G. 2011. The jasmonate pathway is a key player in systemically induced defense against root-knot nematodes in rice. Plant Physiology 157: 305-316. Nahar, K., Kyndt, T., Nzogela, Y.B. and Gheysen, G. 2012. Abscisic acid interacts antagonistically with classical defense pathways in rice-migratory nematode interaction. New Phytologist 196: 901-913. Nahar, K., Kyndt, T., Hause, B., Höfte, M. and Gheysen, G. 2013. Brassinosteroids suppress rice defence against root-knot nematodes through antagonism with the jasmonate pathway. Molecular Plant-Microbe Interactions 26 (1): 106-115. Naik, B.S., Shashikala, J. and Krishnamurthy, Y. 2009. Study on the diversity of endophytic communities from rice (Oryza sativa L.) and their antagonistic activities in vitro. Microbiological Research 164: 290-296. Naraghi, L., Heydari, A. and Ershad, D. 2006. Sporulation and survival of Talaromyces flavus on different plant material residues for biological control of cotton wilt caused by Verticillium dahliae. Iranian Journal of Plant Pathology 42:381-397 (in Persian with English summary). Naraghi, L., Heydari, A., Rezaee, S., Razavi, M. and Afshari-Azad, H. 2010a. Biological control of greenhouse cucumber Verticillium wilt disease by Talaromyces flavus. Phytopathologia Mediterranea 49: 321-329. Naraghi, L., Heydari, A., Rezaee, S., Razavi, M. and Jahanifar H 2010b. Study on antagonistic effects of Talaromyces flavus on Verticillium albo-atrum, the causal agent of potato wilt disease. Crop Protection 29: 658-662. Naraghi, L., Heydari, A., Rezaee, S., Razavi, M., Jahanifar, H. and Khaledi, M.E. 2010c. Biological control of tomato Verticillium wilt disease by Talaromyces flavus. Journal of Plant Protection Researc 50: 360-365. Naraghi, L., Heydari, A., Rezaee, S. and Razavi, M. 2012. Biocontrol agent Talaromyces flavus stimulates the growth of cotton and potato. Journal of Plant Growth Regulation 31: 471- 477. Ndiiri, J.A., Mati, B.M., Home, P.G., Odongo, B. and Uphoff, N. 2012. Comparison of water savings of paddy rice under System of Rice Intensification (SRI) growing rice in Mwea, Kenya. International Journal of Current Research and Review 4: 63-73.

158

Nhamo, N., Rodenburg, J., Zenna, N., Makombe, G. and Luzi-Kihupi, A. 2014. Narrowing the rice yield gap in East and Southern Africa: using and adapting existing technologies. Agricultural Systems 131: 45-55. Doi:10.1016/j.agsy.2014.08.003. Nishiuchi, S., Yamauchi, T., Takahashi, H., Kotula, L. and Nakazono, M. 2012. Mechanisms for coping with submergence and water logging in rice. Rice 5: 1-14. Oberhofer, M. and Leuchtmann, A. 2014. Horizontal transmission, persistence and competition capabilities of Epichloë endophytes in Hordelymus europaeus grass hosts using dual endophyte inocula. Fungal Ecology 11: 37-49. Oelmüller, R., Sherameti, I., Tripathi, S. and Varma, A. 2009. Piriformospora indica, a cultivable root endophyte with multiple biotechnological applications. Symbiosis 49: 1-17. Ohaga, S.O., Kokwaro, E.D., Ndiege, I.O., Hassanali, A. and Saini, R.K. 2007. Livestock farmers‟ perception and epidemiology of bovine trypanosomosis in Kwale District, Kenya. Preventive Veterinary Medicine 80: 24-33. Okalebo, J.R., Gathua, K.W. and Woomer, P.L., 2002. Laboratory methods of soil and plant analysis: a working manual. TSBF-CIAT and SACRED Africa, Nairobi, Kenya. Olsen, S.R., Cole, C.V., Wanatabe, F.S. and Dean, L.A. 1954. Estimation of available phosphorus in soils by extraction with sodium bicarbonate. U.S. Depart. of Agriculture, Circ. No. 939. Oostenbrink, R. 1966. Major characteristics of the relation between nematodes and plants. Mededeelingen Landbouwhoogeschool 66:1-46. Orui, Y. 1996. Discrimination of the main Pratylenchus species (Nematoda; Pratylenchidae) in Japan by PCR-RFLP analysis. Applied Entomology and Zoology 31: 505-514. Otinga, A.N., Pypers, P., Okalebo, J.R., Njoroge, R., Emong‟ole, M., Six, L., Vanlauwe, B. and Merckx, R. 2013. Partial substitution of phosphorus fertiliser by farmyard manure and its localised application increases agronomic efficiency and profitability of maize production. Field Crop Research 140: 32-43. Ouma-Onyango, A. 2014. Promotion of rice production: a likely step to making Kenya food secure. an assessment of current production and potential. Developing Country Studies 4 (19): 26-31. Padgham, J.L., Duxbury, J.M., Mazid, M.A., Abawi, G.S. and Hossain, M. 2004. Yield loss caused by Meloidogyne graminicola on lowland rain-fed rice in Bangladesh. Journal of Nematology 36 (1): 42-48. Pankhurst, C.E., Stirling, G.R., Magarey, R.C., Blair, B.L., Holt, J.A., Bell, M.J. and Garside, A.L. 2005. Quantification of the effects of rotation breaks on soil biological properties and their impact on yield decline in sugarcane. Soil Biology and Biochemistry 37: 1121-1130. Pantelides, I.S., Tjamos, S.E., Striglis, I.A., Chatzipavlidis, I. and Paplomatas, E.J. 2009. Mode of action of a non-pathogenic Fusarium oxysporum strain against Verticillium dahliae using Real Time QPCR analysis and biomarker transformation. Biological Control 50: 30-36. Paparu, P., Dubois, T., Coyne, D. and Viljoen, A. 2009. Dual inoculation of Fusarium oxysporum endophytes in banana: effect on plant colonization, growth and control of the root burrowing nematode and the banana weevil. Biocontrol Science and Technology 19 (6): 639-655. Paparu, P., Dubois, T., Coyne, D. and Viljoen, A. 2013. Differential gene expression in East African highland bananas (Musa spp.): Interactions between non-pathogenic Fusarium oxysporum V5w2 and Radopholus similis. Physiological and Molecular Plant Pathology 82: 56-63.

159

Pegard, A., Brizzard, G., Fazari, A., Soucaze, O., Abad, P. and Djian-Caporalino, C. 2005. Histological characterization of resistance to different root-knot nematode species related to phenolics accumulation in Capsicum annuum. Phytopathology 95: 158-165. Perry, R.N. 1996. Chemoreception in plant parasitic nematodes. Annual Review of Phytopathology 34: 181-199. Peškan-Berghöfer, T., Shahollari, B., Giong, P.H., Hehl, S., Markert, C., Blanke, V., Kost, G., Varma, A. and Oelmüller, R. 2004. Association of Piriformospora indica with Arabidopsis thaliana roots represents a novel system to study beneficial plant-microbe interactions and involves early plant protein modifications in the endoplasmic reticulum and at the plasma membrane. Physiologia Plantarum 122: 465-477. Peškan-Berghöfer, T., Vilches-Barro, A., Müller, T.M., Glawischnig, E., Reichelt, M., Gershenzon, J. and Rausch, T. 2015. Sustained exposure to abscisic acid enhances the colonisation potential of the mutualist fungus Piriformospora indica on Arabidopsis thaliana roots. New Phytologist 208: 873-886. Phuwiwat, W. and Soytong, K. 2001. The effect of Penicillium notatum on plant growth. Fungal Diversity 8: 143-148. Pieterse, C.M.J., Zamioudis, C., Berendsen, R.L., Weller, D.M., Van Wees, S.C.M. and Bakker, P.A.H.M 2014. Induced systemic resistance by beneficial microbes. Annual Review of Phytopathology 52: 347-375. Plowright, R.A., Mathias, D., Aung, T. and Mew, T.-W. 1990. The effect of Pratylenchus zeae on the growth and yield of upland rice. Review Nématologie 13 (3): 283-292. Plowright, R.A., Coyne, D.L., Nash, P. and Jones, M.P. 1999. Resistance to the rice nematodes Heterodera sacchari, Meloidogyne graminicola and M. incognita in Oryza glaberrima and O. glaberrima x O. sativa hybrids. Nematology 1 (7-8): 745-751. Porras-Alfaro, A. and Bayman, P. 2011. Hidden fungi, emergent properties: endophytes and microbiomes. Annual Review of Phytopathology 49: 291-315. Portères, R. 1976. The Origin of African plant domestication, (Eds). Harlan, J. R., de Wet, J. M. J. and Stemler, A. B. L. (Mouton, The Hague, The Netherlands), pp. 409-452. Postma, J. and Rattink, H. 1991. Biological control of Fusarium wilt of carnation with a non- pathogenic isolate of Fusarium oxysporum. Canadian Journal of Botany 70 (6): 1199- 1205. Powers, T.O., Todd, T.C., Burnell, A.M., Murray, P.C.B., Fleming, C.C., Szalanski, A.L., Adams, B.A. and Harris, T.S 1997. The rDNA Internal Transcribed Spacer Region as a taxonomic marker for nematodes. Journal of Nematology 29 (4): 441-450. Pozo, M.J. and Azcón-Aguilar, C. 2007. Unraveling mycorrhiza-induced resistance. Current Opinion in Plant Biology 10: 393-398. Prajapati, K., Yami, K.D. and Singh, A. 2008. Plant growth promotional effects of Azotobacter chroococcum, Piriformospora indica and Vermicompost of rice plant. Nepal Journal of Science and Technology 9: 85-90. Prasad, K.S.K. and Rao, Y.S. 1985. Effect of foliar application of systematic pesticides on the development of Meloidogyne graminicola in rice. Indian Journal of Nematology 14: 125- 127. Prasad, J.S., Somasekher, N. and Kumar, R.M., 2008. Nematological considerations in SRI method of rice production. In: Extended summaries of 3rd National Symposium of Rice Intensification in India, December 1-3, 2008, Tamil Nadu Agricultural University, Coimbatore, India, pp.160-162.

160

Radhakrishnan, R., Kang, S.-M., Baek, I.-Y. and Lee, I.-J. 2014. Characterization of plant growth- promoting traits of Penicillium species against the effects of high soil salinity and root disease. Journal of Plant Interactions 9 (1): 754-762. Rahman, M.L. 1991. Effect of different cropping sequences on root-knot nematode, Meloidogyne graminicola, and yield of deepwater rice. Nematologia Mediterranea 18: 213-217. Ramamoorthy, V., Viswanathan, R., Raguchander, T., Prakasam, V. and Samiyappan, R. 2001. Induction of systemic resistance by plant growth promoting rhizobacteria in crop plants against pests and diseases. Crop Protection 20: 1-11. Rambaut, A. 2016. FigTree. http://tree.bio.ed.ac.uk/software/figtree. Rao, Y.S. and Israel P. 1979. Life history and bionomics of Meloidogyne graminicola, the rice root knot nematode. Indian Phytopathology 26: 333-340. Ravel, C., Courty, C., Coudret, A. and Charmet, G. 1997. Beneficial effects of Neotyphodium lolii on the growth and the water status in perennial ryegrass cultivated under nitrogen deficiency or drought stress. Agronomie 17: 173-181. Ravindran, S. 2014. Profile of Paul Schulze-Lefert. Proceedings of the National Academy of Sciences of the United State of America 111: 570-572. Raymond, J., Siefert, J.L., Staples, C.R. and Blankenship, R.E. 2004. The natural history of nitrogen fixation. Molecular Biology and Evolution 21: 541-554. Redecker, D., Kodner, R., Graham, L.E. 2000. Glomalean fungi from the Ordovician. Science 289: 1920–1921 Redman, R.S., Ranson, J.C. and Rodriguez, R.J. 1999. Conversion of the pathogenic fungus Colletotrichum magna to a non-pathogenic, endophytic mutualist by gene disruption. Molecular Plant-Microbe Interactions 11: 969-975. Redman, R.S., Sheehan, K.B., Stout, R.G., Rodriguez, R.J., Henson, J.M. 2002. Thermotolerance conferred to plant host and fungal endophyte during mutualistic symbiosis. Science 298: 1581. Redman, R.S., Kim, Y.O., Woodward, C.J.D.A., Greer, C., Espino, L., Doty, S.L. and Rodriguez, R.J. 2011. Increased fitness of rice plants to abiotic stress via habitat adapted symbiosis: a strategy for mitigating impacts of climate change. PLoS One 6 (7):e14823. Doi:10.1371/journal.pone.0014823. Reversat, G., Boyer, J., Sannier, C. and Pando-Bahuon, A. 1999. Use of a mixture of sand and water-absorbent synthetic polymer as substrate for the xenic culturing of plant-parasitic nematodes in the laboratory. Nematology 1 (2): 209-212. Reyes, L.C. and Chin, C. 2009. The new frontier. Rice Today 8: 28-29. Reynolds, A.M., Dutta, T.K., Curtis, R.H.C., Powers, S.J., Gaur, H.S. and Kerry, B.R. 2011. Chemotaxis can take plant-parasitic nematodes to the source of a chemo attractant via the shortest possible routes. Journal of the Royal Society Interface 8: 568-577. Rich, J.R., Brito, J.A., Kaur, R. and Ferrell, J.A. 2009. Weed species as hosts of Meloidogyne: a review. Nematropica 39: 157-185. Rodriguez, R.J., Henson, J., Van Volkenburgh, E., Hoy, M., Wright, L., Beckwith, F., Kim, Y. and Redman, R.S. 2008. Stress tolerance in plants via habitat-adapted symbiosis. International Society of Microbial Ecology 2: 404-416. Rodriguez, R.J., White J.F.Jr., Arnold, A.E. and Redman, R.S. 2009. Fungal endophytes: diversity and functional roles. New Phytologist 182: 314-330. Rodriguez-Kabana, R., Morgan-Jones, G. and Chet, I. 1987. Biological control of nematodes: Soil amendments and microbial antagonists. Plant and Soil 100: 237-247. Roman, J. and Hirschmann, H. 1969. Morphology and morphometrics of six species of Pratylenchus. Journal of Nematology 1 (4): 363-386.

161

Ronquist, T.F. and Huelsenbeck, J.P. 2003. MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19: 1572-1574. Rosa, L.H., Vieira, M.D.L.A., Santiago, I.F. and Rosa, C.A. 2010. Endophytic fungi community associated with the dicotyledonous plant Colobanthus quitensis (Kunth) Bartl.(Caryophyllaceae) in Antarctica. FEMS Microbiology Ecology 73: 178-189. Ryals, J.A., Neuenschwander, U.H., Willits, M.G., Molina, A., Steiner, H.-Y. and Hunt, M.D. 1996. Systemic acquired resistance. The Plant Cell 8: 1809-1819. Saikkonen, K., Ion, D. and Gyllenberg, M. 2002. The persistence of vertically transmitted fungi in grass metapopulations. Proceedings of the Royal Society: Biological Sciences 269: 1397-1403. Saikkonen, K., Young, C.A., Helander, M. and Schardl, C.L. 2016. Endophytic Epichloë species and their grass hosts: from evolution to applications. Plant Molecular Biology 90: 665- 675. Samson, R.A., Yilmaz, N., Houbraken, J., Spierenburg, H., Seifert, K.A., Peterson, S.W., Varga, J. and Frisvad, J.C. 2011. Phylogeny and nomenclature of the genus Talaromyces and taxa accommodated in Penicillium subgenus Biverticillium. Studies in Mycology 70: 159- 183. Sang, T. and Ge, S. 2007. Genetics and phylogenetics of rice domestication. Current Opinion Genetics and Development 17: 533-538. Santamaria, J. and Bayman, P. 2005. Fungal epiphytes and endophytes of Coffee leaves (Coffea arabica). Microbial Ecology 50 (1): 1-8. Sarath, P. and Thilak, B. 2004. Comparison of productivity of system of rice intensification and conventional rice farming systems in the dry-zone region of Sri Lanka. New directions for a diverse planet. In: Proceedings of the 4th International Crop Science Congress, Brisbane. Australia, 26th September to 1st October ISBN 1 920842 20 9.http://www.cropscience.org.au Saunders, S.M., Glenn, A.E. and Kohn, L.M. 2010. Exploring the evolutionary ecology of fungal endophytes in agricultural systems: using functional traits to reveal mechanisms in community processes. Evolutionary Applications 3 (5-6): 525-537 Schneider, R.W. 1984. Effects of non-pathogenic strains of Fusarium oxysporum on celery root infection by F. oxysporum f. sp. apii and a novel use of the lineweaver-burk double reciprocal plot technique. Phytopathology 74: 646-653. Schoch, C.L., Seifert, K.A., Huhndorf, S., Robert, V., Spouge, J.L., Levesque, C.A., Chen, W., Bolchacova, E., Voigt, K. and Crous, P.W. 2012. Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi. Proceedings of the National Academy of Sciences of the United State of America 109 (16): 6241-6246. Schouten, A. 2016. Mechanisms involved in nematode control by endophytic fungi. Annual Review in Phytopathology 54 (3): 1-22 Schulz, B. and Boyle, C. 2005. The endophytic continuum. Mycological Research 109 (6): 661- 686. Schuster, R.-P, Sikora, R.A. and Amin, N. 1995. Potential of endophytic fungi for the biological control of plant parasitic nematodes. Communications in Agricultural and Applied Biological Sciences, Ghent University 60: 1047-1052. Seck, P.A., Diagne, A., Mohanty, S. and Wopereis, M.C.S. 2012. Crops that feed the world 7: Rice. Food security 4 (1): 7-12. Seenivasan, N., David, P.M.M. and Vivekanandan, P. 2010. Population dynamics of rice nematodes under a system of rice intensification. Nematologia Mediterranea 38: 159- 163.

162

Seinhorst, J.W. 1981. Water consumption of plants attached by nematodes and mechanisms of growth reduction. Nematologia 27: 34-51. Sena, A.P.A., Chaibub, A.A., Côrtes, M.V.C.B., Silva, G.B., Silva-Lobo, V.L., Prabhu, A.S., Filippi, M.C.C. and Araújo, L.G. 2013. Increased enzymatic activity in rice leaf blast suppression by crude extract of Epicoccum sp. Tropical Plant Pathology 38 (5): 387-397. Seo, Y.-S., Chern, M., Bartley, L.E., Han, M., Jung, K.-H., Lee, I., Walia, H., Richter, T., Xu, X., Cao, P., Bai, W., Ramanan, R. Amonpant, F., Arul, L., Canlas, P.E., Ruan, R., Park, C.- J., Chen, X., Hwang, S., Jeon, J.-S. and Ronald, P.C. 2011. Towards establishment of a rice stress response interactome. PLoSGenet. 7:e1002020. Doi: 10.1371/journal.pgen.1002020. Serfling, A., Wirsel, S.G.R., Lind, V. and Deising, H.B. 2007. Performance of the biocontrol fungus Piriformospora indica on wheat under greenhouse and field conditions. Phytopathology 97: 523-531. Shaul, O., Galili, S., Volpin, H., Ginzberg, I., Elad, Y., Chet, I. and Kapulnik, Y. 1999. Mycorrhiza- induced changes in disease severity and PR protein expression in tobacco leaves. Molecular Plant-Microbe Interactions 12: 1000-1007. Shen, X., Liu, H., Yuan, B., Li, X., Xu, C. and Wang, S. 2011. OsEDR1 negatively regulates rice bacterial resistance via activation of ethylene biosynthesis. Plant Cell and Environment 34: 179-191. Shi, Y., Dai, C.C., Wu, Y.C. and Yuan, Z.L. 2004. Study on the degradation of wheat straw by endophytic fungi. Acta Scientiae Circumstantiae 24: 144-149. Shimizu, T., Nakano, T., Takamizawa, D., Desaki, Y., Ishii-Minami, N., Nishizawa, Y., Minami, E., Okada, K., Yamane, H., Kaku, H. and Shibuya, S. 2010. Two LysM receptor molecules, CEBiP and OsCERK1, cooperatively regulate chitin elicitor signaling in rice. The Plant Journal 64: 204–214. Shimono, M., Sugano, S., Nakayama, A., Jiang, C.-J., Ono, K., Toki, S. and Takatsuji, H. 2007. Rice WRKY45 plays a crucial role in benzothiadiazole-inducible blast resistance. Plant Cell 19: 2064-2076. Siddiqi, M.R. 2000. Tylenchida parasites of plants and insects, 2nd edition. Wallingford, UK, CABI Publishing. Sikora, R.A. and Fernandez, E. 2005. Nematode parasites of vegetables. In: Luc, M., Sikora, R.A. and Bridge, J. (Eds.): Plant parasitic nematodes in subtropical and tropical agriculture. CAB International, London, pp 319-392. Sikora, R.A., Pocasangre, L., Felde, A., Niere, B., Vu, T.T. and Dababat, A.A. 2008. Mutualistic endophytic fungi and in-planta suppressiveness to plant parasitic nematodes. Biological Control 46: 15-23. Silverman, P., Seskar, M., Kanter, D., Schweizer, P., Metraux, J.P. and Raskin, I. 1995. Salicylic acid in rice: biosynthesis, conjugation, and possible role. Plant Physiology 108: 633-639. Singh, M.P., Lee, F.N., Counce, P.A. and Gibbons, J.H. 2004. Mediation of partial resistance to rice blast through an aerobic induction of ethylene. Phytopathology 94: 819-825. Sirrenberg, A., Grenb, C., Grond, S., Czempinski, N., Ratzinger, A., Karlovsky, P., Santos, P., Feussner, I. and Pawlowski, K. 2007. Piriformospora indica affects plant growth by auxin production. Physiologia Plantarum 131: 581-589. Smith, G.S. and Kaplan, D.T. 1988. Influence of mycorrhizal fungus, phosphorus, and burrowing nematode interactions on growth of rough lemon citrus seedlings. Journal of Nematology 20 (4): 539-544. Soriano, I.R. and Reversat, G. 2003. Management of Meloidogyne graminicola and yield of upland rice in South-Luzon, Philippines. Nematology. 5 (6): 879-884.

163

Stein, E., Molitor, A., Kogel, K.-H. and Waller, F. 2008. Systemic resistance in Arabidopsis conferred by the mycorrhizal fungus Piriformospora indica requires jasmonic acid Signaling and the cytoplasmic function of NPR1. Plant Cell Physiology 49 (11): 1747- 1751. Stirling, G.R. 1991. Biological control of plant-parasitic Nematodes, Brisbane: CAB International. Styger, E. 2014. System of Rice Intensification research: a review 1993-2013. Presentation at the international congress, Bangkok, Thailand October 31. 2014 Su, Z.-Z., Mao, L.-J., Li, N., Feng, X.-X., Yuan, Z.-L., Wang, L.-W., Lin, F.-C. and Zhang, C.-L. 2013. Evidence for biotrophic lifestyle and biocontrol potential of dark septate endophyte Harpophora oryzae to rice blast disease. PLoS ONE 8 (4):e61332. Doi: 10.1371/journal.pone.0061332. Subbotin, S.A., Vierstraete, A., De Ley, P., Rowe, J., Waeyenberge, L., Moens, M. and Vanfleteren, J.R. 2001. Phylogenetic relationships within the cyst-forming nematodes (Nematoda, Heteroderidae) based on analysis of sequences from the ITS regions of ribosomal DNA. Molecular Phylogenetics and Evolution 21 (1): 1-16. Subbotin, S.A., Sturhan, D., Chizhov, V.N., Vovlas, N. and Baldwin, J.G. 2006. Phylogenetic analsysis of Tylenchida Thorne, 1949 as inferred from D2 and D3 expansion fragments of the 28S rRNA gene sequences. Nematology 8 (3): 455-474. Subbotin, S.A., Ragsdale, E.J., Mullens, T., Roberts, P.A., Mundo-Ocampo, M. and Baldwin, J.G. 2008. A phylogenetic framework for root lesion nematodes of the genus Pratylenchus (Nematoda): Evidence from 18S and D2-D3 expansion segments of 28S ribosomal RNA genes and morphological characters. Molecular Phylogenetics and Evolution 48: 491- 505. Sugano, S., Jiang, C.-J., Miyazawa, S.-I., Masumoto, C., Yazawa, K., Hayashi, N., Shimono, M., Nakayama, A., Miyao, M. and Takatsuji, H. 2010. Role of OsNPR1 in rice defense program as revealed by genome wide expression analysis. Plant Molecular Biology 74: 549-562. Doi:10.1007/s11103-010-9695-3. Sun, Y., Li, L., Macho, A.P., Han, Z., Hu, Z., Zipfel, C., Zhou, J.-M. and Chai, J. 2013. Structural basis for flg22-induced activation of the Arabidopsis FLS2-BAK1 immune complex. Science 342: 624-628. Doi:10.1126/science.1243825. Tadych, M., Ambrose, K. V., Bergen, M. S., Belanger, F. C. and White, J.F. Jr. 2012. Taxonomic placement of Epichloë poae sp. nov. and horizontal dissemination to seedling via conidia. Fungal Diversity 54: 117-131. Taheri, P. and Tarighi, S. 2010. Riboflavin induces resistance in rice against Rhizoctonia solani via jasmonate-mediated priming of phenylpropanoid pathway. Journal of Plant Physiology 167: 201-208. Doi:10.1016/j.jplph.2009.08.003. Takai, R., Isogai, A., Takayama, S. and Che, F. 2008. Analysis of flagellin perception mediated by flg22 receptor OsFLS2 in rice. Molecular Plant-Microbe Interactions 21: 1635-1642. Doi:10.1094/MPMI-21-12-1635 Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M. and Kumar, S. 2011. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Molecular Biology and Evolution 28 (10): 2731-2739. Tanaka, N., Che, F.S., Watanabe, N., Fujiwara, S., Takayama, S. and Isogai, A. 2003. Flagellin from an incompatible strain of Acidovorax avenae mediates H2O2 generation accompanying hypersensitive cell death and expression of PAL, Cht-1, and PBZ1, but not of Lox in rice. Mol Plant-Microbe Interactions 16: 422-428.

164

Tanaka, A., Christensen, M.J., Takemoto, D., Park, P. and Scotta, B. 2006. Reactive oxygen species play a role in regulating a fungus-perennial ryegrass mutualistic interaction. Plant Cell 18: 1052-1066. Tao, Z., Liu, H., Qiu, D., Zhou, Y., Li, X., Xu, C. and Wang, S. 2009. A pair of allelic WRKY genes play opposite roles in rice-bacteria interactions. Plant Physiology 151: 936-948. Thakur, A.K., Mohanty, R.K., Patil, D.U. and Kumar, A. 2014. Impact of water management on yield and water productivity with system of rice intensification (SRI) and conventional transplanting system in rice. Paddy Water Environment 12: 413-424. Thiyagarajan, T.M. and Gujja, B. 2012. Transforming rice production with SRI (System of Rice Intensification) knowledge and practice. National Consortium on SRI (NCS). Gaffar Khan Colony Road No. 10 Banjara Hills Hyderabad-500 034 A.P, India pp 1-205. Thongkantha, S., Jeewon, R., Vijaykrishna, D., Lumyong, S., McKenzie, E.H.C. and Hyde, K.D. 2009. Molecular phylogeny of Magnaporthaceae (Sordariomycetes) with a new species Ophioceras chiangdaoense from Dracaena loureiroi in Thailand. Fungal Diversity 34: 157-173. Tian, X.L., Cao, L.X., Tan, H.M., Zeng, Q.G., Jia, Y.Y., Han, W.Q. and Zhou, S.N. 2004. Study on the communities of endophytic fungi and endophytic actinomycetes from rice and their antipathogenic activities in vitro. World Journal of Microbiology and Biotechnology 20: 303-309. Tian, J., Dippold, M., Pausch, J., Blagodatskaya, E., Fan, M., Li, X. and Kuzykov, Y. 2013. Microbial response to rhizodeposition depending on water regimes in paddy soils. Soil Biol and Biochemistry 65: 195-203. Doi:10.1016/j.soilbio.2013.05.021. Tjamos, E.C. and Fravel, D.R. 1997. Distribution and establishment of the biocontrol fungus Talaromyces flavus in soil and on roots of solanaceous crops. Crop Protection 16 (2): 135-139. Doi: 10.1016/S0261-2194(96)00087-7. Toussoun, T.A. 1975. Fusarium-suppressive soils. In: Bruehl GW, eds. Biology and control of soil-borne plant pathogen. St Paul, MN, USA: American Phytopathological Society 145- 151. Trdá, L., Boutrot, F., Claverie, J., Brulé, D., Dorey, S. and Poinssot, B. 2015. Perception of pathogenic or beneficial bacteria and their evasion of host immunity: pattern recognition receptors in the frontline. Frontier in Plant Science 6: Doi: 10.3389/fpls.2015.00219. Troccoli, A., Subbotin, S., Chitambar, J.J., Janssen, T., Waeyenberge, L., Stanley, J.D., Duncan, L.W., Agudelo, P., Uribe, G.E.M., Franco, J. and Inserra, R.N. 2016. Characterisation of amphimictic and parthenogenetic populations of Pratylenchus bolivianus Corbett, 1983 (Nematoda: Pratylenchidae) and their phylogenetic relationships with closely related species. Nematology 18: 651-678. UNEP, 2008. In dead water. merging of climate change with pollution, over-harvest, and infestations in the world‟s fishing grounds. UNEP/GRID-Arendal, Arendal, Norway. http://www.grida.no/_res/site/file/publications/InDeadWater_LR.pdf. Uphoff, N. and Kassam, A. 2009. Case study: System of Rice Intensification, in Agricul-tural Technologies for Developing Countries. Final report. Annex 3. European Technology Assessment Group, Karlsruhe, Germany. Uribe, G.E.M., Bert, W., Vierstraete, A.R., De la Peña, E., Moens, M. and Decraemer, W. 2010. Burrowing nematodes from Colombia and their relationship with Radopholus similis populations, R. arabocoffeae and R. duriophilus. Nematology 12 (4): 619-629. Vallino, M., Greppi, D., Novero, M., Bonfante, P. and Lupotto, E. 2009. Rice root colonisation by mycorrhizal and endophytic fungi in aerobic soil. Annals of Applied Biology 154: 195-204.

165

Vallino, M., Fiorilli, V. and Bonfante, P. 2014. Rice flooding negatively impacts root branching and Arbuscular mycorrhizal colonisation, but not fungal viability. Plant, Cell and Environment 37: 557-572. Doi: 10.1111/pce.12177. Van de Mortel, J.E., de Vos, R.C.H., Dekkers, E., Pineda, A., Guillod, L., Bouwmeester, K., van Loon, J.J.A., Dicke, M. and Raaijmakers, J.M. 2012. Metabolic and transcriptomic changes induced in Arabidopsis by the rhizobacterium Pseudomonas fluorescens SS1011. Plant Physiology 160: 21177-2188. van Loon, L.C., Bakker, P. A. H. M. and Pieterse, C.M.J. 1998. Systemic resistance induced by rhizosphere bacteria. Annual Revue of Phytopathology 36: 453-483. van Loon, L.C., Rep, M. and Pieterse, C.M.J. 2006. Significance of inducible defense-related proteins in infected plants. Annual Revue Phytopathology 44: 135-162. van Loon, L.C. 2007. Plant responses to plant growth-promoting rhizobacteria. European Journal of Plant Pathology 119: 243-254. van Wees, S.C.M., van der Ent, S. and Pieterse, C.M.J. 2008. Plant immune responses triggered by beneficial microbes. Current Opinion in Plant Biology 11: 443-448. Varma, A., Verma, S., Sudha, Sahay, N., Bütehorn, B. and Franken, P. 1999. Piriformospora indica, a cultivable plant-prowth-promoting root endphyte. Applied and Environmental Microbiology 65 (6): 2741-2744. Varma, A., Sree, K.S., Arora, M., Bajaj, R., Prasad, R. and Kharkwal, A.C. 2014. Functions of novel symbiotic fungus-Piriformospora indica. Proceedings of the Indian National Science Academy 80 (2): 429-441. Veloso, J. and Díaz, J. 2012. Fusarium oxysporum Fo47 confers protection to pepper plants against Verticillium dahliae and Phytophthora capsici, and induces the expression of defence genes. Plant Pathology 61: 281-288. Veloso, J., Alabouvette, C., Olivain, C., Flors, V., Pastor, V., García, T. and Díaz, J. 2015. Mode of action of the protective strain Fo47 in controlling Verticillium wilt of pepper. Plant Pathology 65: 997-1007. Doi: 10.1111/ppa.12477. Verhagen, B.W.M., Glazebrook, J., Zhu, T., Chang, H.-S., Van Loon, L.C, and Pieterse, C.M.J. 2004. The transcriptome of rhizobacteria-induced systemic resistance in Arabidopsis. Molecular Plant-Microbe Interactions 17: 895-908. Verma, S., Varma, A., Rexer, K.-H., Hassel, A., Kost, G., Sarbhoy, A., Bisen, P., Bütehorn, B. and Franken, P. 1998. Piriformospora indica, gen. et sp. nov., a new root-colonizing fungus. Mycologia 90 (5): 896-903. Vos, C.M, Claerhout, S., Mkandawire, R., Panis, B., De Waele, D. and Elsen, A. 2012a. Arbuscular mycorrhizal fungi reduce root-knot nematode penetration through altered root exudation of their host. Plant and Soil 354: 335-345. Vos, C.M., Tesfahun, A.N., Panis, B., De Waele, D. and Elsen, A. 2012b. Arbuscular mycorrhizal fungi induce systemic resistance in tomato against the sedentary nematode Meloidogyne incognita and the migratory nematode Pratylenchus penetrans. Applied Soil Ecology 61: 1-6. Vos, C.M., Schouteden, N., van Tuinen, D., Chatagnier, O., Elsen, A., De Waele, D., Panis, B. and Gianinazzi-Pearson, V. 2013. Mycorrhiza-induced resistance against the root-knot nematode Meloidogyne incognita involves priming of defense gene responses in tomato. Soil Biology and Biochemistry 60: 45-54. Vu, T., Hauschild, R. and Sikora, R.A. 2006. Fusarium oxysporum endophytes induced systemic resistance against Radopholus similis on banana. Nematology 8 (6): 847-852.

166

Waeyenberge, L., Ryss, A., Moens, M., Pinochet, J. and Vrain, T.C. 2000. Molecular characterisation of 18 Pratylenchus species using rDNA restriction fragment length polymorphism. Nematology 2: 135-142. Wakelin, S.A., Warren, R.A., Harvey, P.R. and Ryder, M.H. 2004. Phosphate solubilization by Penicillium spp. closely associated with wheat roots. Biology of Fertile Soils 40: 36-43. Waller, F., Achatz, B., Baltruschat, H., Fodor, J., Becker, K., Fischer, M., Heier, T., Hückelhoven, R., Neumann, C., von Wettstein, D., Franken, P. and Kogel, K.-H. 2005. The endophytic fungus Piriformospora indica reprograms barley to salt-stress tolerance, disease resistance, and higher yield. Proceeding of Natural Academy of Science of the United State of America 102 (38): 13386-13391. Wambugu, P.W., Mathenge, P.W., Auma, E.O. and van Rheenen, H.A. 2012. Constraints to on- farm maize (Zea mays L.) seed production in western Kenya: plant growth and yield. Agronomy 1-7. Doi:10.5402/2012/153412. Wang, D., Amornsiripanitch, N. and Dong, X. 2006. A genomic approach to identify regulatory nodes in the transcriptional network of systemic acquired resistance in plants. PLoS Pathogens 2 (11): e123. Doi:10.1371/journal.ppat.0020123. Wang, L., Tsuda, K., Sato, M., Cohen, J.D., Katagiri, F. and Glazebrook, J. 2009. Arabidopsis CaM Binding Protein CBP60g contributes to MAMP-Induced SA accumulation and is involved in disease resistance against Pseudomonas syringae. PLoS Pathog 5 (2): e1000301. doi:10.1371/journal.ppat.1000301. Wang, H., Zhuo, K., Ye, W. and Liao, J. 2015. Morphological and molecular charaterisation of Pratylenchus parazeae n. sp. (Nematoda: Pratylenchidae) parasitizing sugarcane in China. European Journal of Plant Pathology 143: 173-191. Waweru, B., Losenge, T., Kahangi, E., Dubois, T. and Coyne, D.L. 2013. Potential biological control of lesion nematodes on banana using Kenyan strains of endophytic Fusarium oxysporum. Nematology 15: 101-107. Waweru, B., Turoop, L., Kahangi, E., Coyne, D. and Dubois, T. 2014. Non-pathogenic Fusarium oxysporum endophytes provide field control of nematodes, improving yield of banana (Musa sp.). Biological Control 74: 82-88. Westfall, C.S., Herrmann, J., Chen, Q., Wang, S. and Jez, J.M. 2010. Modulating plant hormones by enzyme action: the GH3 family of acyl acid amido synthetases. Plant Signal and Behavor 5: 1607-1612. Doi:10.4161/psb.5.12.13941. White, T.J., Bruns, T., Lee, S. and Taylor, J. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR protocols: a guide to methods and applications 18: 315-322. Whitelaw, M.A. 2000. Growth promotion of plants inoculated with phosphate solubilizing fungi. Advances in Agronomy 69: 99-151. Xiao, W., Liu, H., Li, Y., Li, X., Xu, C., Long, M. and Wang, S. 2009. A rice gene of de novo origin negatively regulates pathogen-induced defense response. PLoS One 4: e4603. Xu, G.X., Fan, X.R. and Miller, A.J. 2012. Plant nitrogen assimilation and use efficiency. Annual Review of Plant Biology 63: 153-182. Xu, J., Audenaert, K., Höfte, M. and De Vleesschauwer, D. 2013. Abscisic acid promote susceptibility to the rice leaf blight pathogen Xanthomonas oryzae pv. oryzae by suppressing the salicylic acid-mediated defences. PLoS One 8 (6): e67413. Doi:10.1371/journal.pone.0067413. Xu, X.-H., Su, Z.-Z., Wang, C., Kubicek, C.P., Feng, X.-X., Mao, L.-J., Wang, J.-Y., Chen, C., Lin, F.-C. and Zhang, C.-L. 2014. The rice endophyte Harpophora oryzae genome reveals evolution from a pathogen to a mutualistic endophyte. Scientific Reports 4: 1-9.

167

Yadav, V., Kumar, M., Deep, D.K., Kumar, H., Sharma, R., Tripathi, T., Tuteja, N., Saxena, A.K. and Johri, A.K. 2010. A phosphate transporter from the root endophytic fungus Piriformospora indica plays a role in phosphate transport to the host plant. Journal of Biological Chemistry, 285 (34): 26532-26544. Yadav, B.K. and Tarafdar, J.C. 2011. Penicillium purpurogenum, unique P-mobilizers in arid agro-ecosystems. Arid Land Research and Management 25 (1): 87-99. Yang, Y.N., Qi, M. and Mei, C.S. 2004. Endogenous salicylic acid protects rice plants from oxidative damage caused by aging as well as biotic and abiotic stress. Plant Journal 40: 909-919. Doi:10.1111/j.1365-313X.2004.02267.x. Yang, B., Ma, H.-Y., Wang, X.-M., Jia, Y., Hu, J., Li, X. and Dai, C.-C. 2014a. Improvement of nitrogen accumulation and metabolism in rice (Oryza sativa L.) by the endophyte Phomopsis liquidambari. Plant Physiology and Biochemistry 82: 172-182. Yang, B., Wang, X.-M., Ma, H.-Y., Jia, Y., Li, X. and Dai, C.C., 2014b. Effects of the fungal endophyte Phomopsis liquidambari on nitrogen uptake and metabolism in rice. Plant Growth Regulation 73: 165-179. Yang, B., Wang, X.-M., Ma, H.-Y., Yang, T., Jia, Y., Zhou, J. and Dai, C.-C. 2014c. Fungal endophyte Phomopsis liquidambari affects nitrogen transformation processes and related microorganisms in the rice rhizosphere. Frontier in Microbiology 6: 982. doi: 10.3389/fmicb.2015.00982 Yik, C-P. and Birchfield, W. 1979. Host studies and reactions of rice cultivars to Meloidogyne graminicola. Phytopathology 69: 497-499. Yilmaz, N., Visagie, C.M., Houbraken, J., Frisvad, J.C. and Samson, R.A. 2014. Polyphasic taxonomy of the genus Talaromyces. Studies in Mycology 78: 175-341. Yuan, B., Shen, X., Li, X., Xu, C. and Wang, S. 2007a. Mitogen-activated protein kinase OsMPK6 negatively regulates rice disease resistance to bacterial pathogens. Planta 226: 953-960 Yuan, Z.L., Dai, C.C., Li, X., Tian, L.S. and Wang, X.X., 2007b. Extensive host range of an endophytic fungus affects the growth and physiological functions in rice (Oryza sativa L.). Symbiosis 43: 21-28. Yuan, Y.X., Zhong, S.H., Li, Q., Zhu, Z.R., Lou, Y.G., Wang, L.Y., Wang, J., Wang, M., Li, Q., Yang, D. and He, Z. 2007c. Functional analysis of rice NPR1-like genes reveals that OsNPR1/NH1 is the rice orthologue conferring disease resistance with enhanced herbivore susceptibility. Plant Biotechnology Journal 5: 313-324. Yuan, Z.-L., Lin, F.-C., Zhang, C.-L. and Kubicek, C.P. 2010. A new species of Harpophora (Magnaporthaceae) recovered from healthy wild rice (Oryza granulata) roots, representing a novel member of a beneficial dark septate endophyte. FEMS Microbiology Letters 307: 94-101. Zafar-ul-Hye1, M., Farooq, H.M. and Hussain, M. 2015. Bacteria in combination with fertilizers promote root and shoot growth of maize in saline-sodic soil. Brazilian Journal of Microbiology 46 (1): 97-102. Zakaria, L., Yaakop, A.S., Salleh, B. and Zakaria, M. 2010. Endophytic fungi from paddy. Tropical Life Sciences Research 21 (1): 101-107. Zasada, I. 2005. Factors affecting the suppression of Heterodera glycines by N-Viro Soil. Journal of Nematology 37: 220-225. Zehr, J.P., Jenkins, B.D., Short, S.M. and Steward, G.F. 2003. Nitrogenase gene diversity and microbial community structure: across-system comparison. Environmental Microbiology 5: 539-554.

168

Zhang, Y., Crous, P.W., Schoch, C.L. and Hyde, K.D. 2012. Pleosporales. Fungal Diversity 53: 1-221. Doi 10.1007/s13225-011-0117-x. Zhijun, Z. 1998. The Middle Yangtze region in China is one place where rice was domesticated: phytolith evidence from the Diaotonghuan Cave, Northern Jiangxi. Antiquity 72: 885-897. Zimmerli, L., Métraux, J.-P. and Mauch-Mani, B. 2001. β-Aminobutyric acid-induced protection of Arabidopsis against the necrotrophic fungus Botrytis cinerea. Plant Physiology 126: 517- 523. Zipfel, C., Kunze, G., Chinchilla, D., Caniard, A., Jones, J.D.G., Boller, T. and Fellix, G. 2006. Perception of the bacterial PAMP EF-Tu by the receptor EFR restricts Agrobacterium- mediated transformation. Cell 125: 749-760. Zunke, U. 1990. Observation on the invasion and endoparasitic behaviour of the root lesion nematodes Pratylenchus penetrans. Journal of Nematology 22 (3): 309-322.

169

170

Curriculum vitae

Personal data

Name: Pili Njira Njira

Nationality: Kenyan.

Place and date of birth: Kwale, November 20th 1983.

Gender and marital status: Male, married.

Address:

Moi University, Dept. of Botany

P.O Box 3900-30100, Eldoret, Kenya

Phone: +254-791-711-637

E-mail: [email protected] or [email protected] Education and training

2011-2016: PhD training in Applied Biological Sciences, Ghent University.

Dissertation: Possibilities of endophytic fungi from Kenya for growth promotion of rice (Oryza sativa L) and defense against nematodes.

Promotors: Promoter: Prof. Dr. Godelieve Gheysen, Prof. Dr. Richard Kiprono Mibey and Prof. Dr. ir. Monica Höfte.

2007-2009: Master of Science in Nematology, Ghent University, Belgium (Distinction).

Master dissertation: The role of salicylate and jasmonic acid in defence responses against Meloidogyne graminicola and Hirschmanniella oryzae

Promoters: Prof. Dr. Godelieve Gheysen and Dr. ir. Tina Kyndt.

2002-2006: Bachelor of Science in Horticulture, Moi University, Kenya (First Class Honours). Experience abroad

June 2014-June 2015: Long term mobility to Bonn University, Germany Scientific Output

Publication in International Journals

Pili, N.N., França, S.C., Kyndt, T., Makumba, B.A., Skilton, R., Höfte, M., Mibey, R.K., Gheysen, G. 2016a. Analysis of fungal endophytes associated with rice roots from irrigated and upland ecosystems in Kenya. Plant Soil 405: 371-380. Doi 10.1007/s11104-015-2590-6.

Pili, N.N., Kyndt, T., Janssen, T., Couvreur, M., Bert, W., Mibey, R.K and Gheysen, G. 2016b. First report of Pratylenchus zeae on upland rice from Kwale County, Kenya. Plant disease 100 (5) 1022-1022: Doi.org/10.1094/PDIS-07-15-0743-PDN.

171

Participation in international conferences

Pili, N.N., Kyndt, T., França, S.C., Höfte, M., Mibey, R.K., W. Bert, T. Janssen, Godelieve, G. 2014. Analysis of endophytic fungi and plant-parasitic nematodes from irrigated and upland rice ecosystems in Kenya. Proceedings for the 6th International Congress of Nematology, 4-9 May, 2014, Cape Sun, Cape Town, South Africa, pp 112. Oral presentation.

Pili, N.N., Mibey, R.K., Kyndt, T., França, S.C., Höfte, M., Godelieve, G. 2013. Diversity of endophytic fungi from irrigated and upland rice ecosystems in Kenya. Proceedings for the conference on “Endophytes for Plant Protection: The State of Art”, 27-29 May, 2013, Humboldt University, Berlin, Germany, pp 677. Poster presentation.

Pili, N.N., Mibey, R.K., Kyndt, T., França, S.C., Höfte, M., Godelieve, G. 2013. Diversity of endophytic fungi from irrigated and upland rice ecosystems in Kenya. Proceedings for the conference 65th International Symposium on Crop Protection”, 21st May, 2013, Ghent University, Ghent, Belgium, pp 8779. Poster presentation.

Nahar, K., Kyndt, T., Nsengimana, J., de Bruyne, I., Bauters, L., Pili, N.N., Gheysen, G. 2009. Rice defence to plant-parasitic nematodes. COST 872 meeting (exploiting genomics to understand plant-parasitic nematode interactions). Proceedings of the third annual meeting, Toledo Spain 25-28 May 2009, pp 47. Poster presentation. Supervision of master student

James, Kisaakye (2013-2014). Talaromyces sp. as a potential bio-control agent against Pratylenchus zeae infection of rice (Oryza sativa L.). Promotor: Prof. Dr. Godelieve Gheysen

172