DOCSLIB.ORG

LIM Protein JUB Promotes Epithelialmesenchymal Transition in Colorectal Cancer

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
LIM Protein JUB Promotes Epithelialmesenchymal Transition in Colorectal Cancer LIM protein JUB promotes epithelial–mesenchymal transition in colorectal cancer Xing-Hua Liang,1,9 Guang-Xian Zhang,2,9 Yue-bin Zeng,3,9 Hai-Feng Yang,4 Wen-Hong Li,5 Qi-Long Liu,5 Yue-liang Tang,5 Wen-guang He,5 Yan-Nian Huang,5 Lei Zhang,6 Li-Na Yu7,8 and Xian-Cheng Zeng5,6 1Department of Gastroenterology, Zengcheng People’s Hospital (BoJi-Affiliated Hospital of Sun Yat-Sen University), Zengcheng; 2School of Basic Medical Sciences, Guangzhou University of Chinese Medicine, Guangzhou; 3Department of Infectious Diseases, Zengcheng People’s Hospital (BoJi-Affiliated Hospital of Sun Yat-Sen University), Zengcheng; 4Department of Pathology, The Second Affiliated Hospital of Guangzhou University of Chinese Medicine (Guangdong Provincial Hospital of TCM), Guangzhou; 5Department of General Surgery, Zengcheng People’s Hospital (BoJi-Affiliated Hospital of Sun Yat- Sen University), Zengcheng; 6Department of Clinical Laboratory Zengcheng People’s Hospital (BoJi-Affiliated Hospital of Sun Yat-Sen University), Zengcheng; 7Department of Pathology, Nanfang Hospital, Southern Medical University, Guangzhou; 8Department of Pathology, School of Basic Medical Sciences, Southern Medical University, Guangzhou, China Key words Metastasis is the leading cause of cancer-related death in almost all types of can- Colorectal cancer, epithelial–mesenchymal transition, JUB, cers, including colorectal cancer (CRC). Metastasis is a complex, multistep, LIM protein, Snail dynamic biological event, and epithelial–mesenchymal transition (EMT) is a criti- Correspondence cal process during the cascade. Ajuba family proteins are LIM domain-containing Xian-Cheng Zeng, Department of General Surgery, Zen- proteins and are reported to be transcription repressors regulating different gcheng People’s Hospital (BoJi-Affiliated Hospital of Sun kinds of physiological processes. However, the expression and pathological roles Yat-Sen University), Zengcheng 511300, China. of Ajuba family proteins in tumors, especial in tumor metastasis, remain poorly Tel: 86-20-32855003; Fax: 86-20-62287040; studied. Here, we found that JUB, but not the other Ajuba family proteins, was E-mail: [email protected] highly upregulated in clinical specimens and CRC cell lines. Ectopic expression of Li-Na Yu, Department of Pathology, School of Basic Medi- JUB induced EMT and enhanced motility and invasiveness in CRC, and vice versa. cal Sciences, Southern Medical University, Guangzhou Mechanistic study revealed that JUB induces EMT via Snail and JUB is also 510515, China. required for Snail-induced EMT. The expression of JUB shows an inverse correla- Tel: 86-20-62789371; tion with E-cadherin expression in clinical specimens. Taken together, these find- E-mail: [email protected] ings revealed that the LIM protein JUB serves as a tumor-promoting gene in CRC 9These authors contributed equally to this work. by promoting EMT, a critical process of metastasis. Thus, the LIM protein JUB may provide a novel target for therapy of metastatic CRC. Funding Information Natural Science Foundation of China (81001111). Natural Science Foundation of Guangdong (S2011040003696). Zengcheng People’s Hospital Scholarship for Excellent Scientists (2013-YX-001). Received February 6, 2014; Revised March 17, 2014; Accepted March 24, 2014 Cancer Sci 105 (2014) 660–666 doi: 10.1111/cas.12404 etastasis accounts for approximately 90% of cancer- morphology, high motility and invasiveness. Downregulation M associated deaths.(1) An estimated 1.2 million cases of of E-cadherin is a hallmark of EMT. Control of transcription colorectal cancer (CRC) were recorded worldwide in 2008. of the E-cadherin gene is the main mechanism accounting for Approximately 35% of patients present with stage-IV meta- downregulation of this protein.(7) Several transcription factors static disease when diagnosed with primary disease, and 20– have been reported to repress expression of E-cadherin: Snail, 50% of subjects with stage-II or- stage-III disease will progress Slug, Twist and S1P,(8–10) among which Snail was the first to be to stage-IV disease.(2,3) Mortality has declined by approxi- discovered. Snail has been reported to be a major transcription mately 1.8% per year for stage-IV disease(3) but the prognosis repressor of E-cadherin, frequently upregulated in breast can- of metastatic CRC remains extremely poor (overall survival at cer,(8,11) esophageal squamous cell carcinoma(12) and CRC.(13) 5 years <10%).(4) Metastasis remains the most poorly under- The LIM protein Ajuba family contains three members, stood component of the pathogenesis of cancer. JUB, WTIP and LIMD1, and is characterized by a unique N- Epithelial–mesenchymal transition (EMT) is known to be terminal region, the preLIM region, and three tandem C-termi- fundamental for embryonic development, wound healing and nal LIM domains.(14–16) This family of proteins function as fibrosis, but also for tumor invasion and metastasis.(5,6) EMT scaffolds and have been reported to modulate many events in is the initial process of tumor metastasis. Cells undergoing cells, such as cell proliferation and tissue size,(17,18) DNA EMT usually acquire a mesenchymal phenotype, spindle-like damage response,(19) meiotic maturation of oocytes(14) and Cancer Sci | June 2014 | vol. 105 | no. 6 | 660–666 © 2014 The Authors. Cancer Science published by Wiley Publishing Asia Pty Ltd on behalf of Japanese Cancer Association. This is an open access article under the terms of the Creative Commons Attribution-NonCommercial License, which permits use, distribution and reproduction in any medium, provided the original work is properly cited and is not used for commercial purposes. Original Article www.wileyonlinelibrary.com/journal/cas Liang et al. embryonal cell proliferation and differentiation.(20) However, and quantified using an ABI Prism 7500 Sequence Detection the pathological roles of Ajuba family proteins in diseases System (Applied Biosystems, Lab India, Haryana, India), with remain unexplored. Langer et al.(21) find that LIM protein SYBR Green I dye (Molecular Probes, Invitrogen). b-actin was Ajuba family proteins interact with the SNAG domain of the used as an internal control. Expression data were normalized to Snail family. They use Xenopus neural crest as a model of b-actin, and calculated as 2(-[(Ct of gene) À (Ct of beta-actin)]),where in vivo Snail-induced EMT and demonstrate that Ajuba LIM Ct represents the threshold cycle for each transcript. The primers proteins contribute to neural crest development as Snail ⁄ Slug for qRT-PCR were: corepressors and are required for in vivo Snail ⁄ Slug func- tion.(21) Thus, we propose that Ajuba family proteins may also JUB-Fwd AGAGGCCAGGGAGGACTACT regulate EMT in cancer and promote metastasis. JUB-Rev GAGCAGCAAACAAAGCACTG In the present study, surprisingly, we find that the LIM pro- WTIP-Fwd TGTGGGCTTGGCATCTACG tein JUB, but not the other two members of the Ajuba family, WTIP-Rev TGCTGGAACCCGGAGTACAG WTIP and LIMD1, was highly upregulated in CRC specimens LIMD1-Fwd TCACCCGAAGGCTGATTACT and cell lines. Ectopic overexpression of JUB induces EMT LIMD1-Rev AGGTGAAGCATGTGTCATGG and promotes migration and invasion in CRC cells. Silencing b-actin-Fwd GCACAGAGCCTCGCCTT of JUB impairs EMT and inhibits migration and invasion in b-actin-Rve CCTTGCACATGCCGGAG CRC cells. Further mechanistic study revealed that JUB pro- moting EMT depends on Snail, and JUB is also required for Snail to induce EMT, which is consistent with previous reports Clinical tissue specimens and ethics statement. Tissue speci- that JUB serves as a corepressor of Snail. The present study mens were freshly collected from Zengcheng People’s Hospital uncovered an important role of the LIM protein JUB in the (BoJi-Affiliated Hospital of Sun Yat-Sen University), so that pathological progress of tumorigenesis in CRC. Hereafter, JUB patients could be histopathologically and clinically diagnosed. could be a novel therapy target for metastatic CRC. All samples were obtained with prior written informed consents from the patients and approval from the Institutional Research Materials and Methods Ethics Committees of Zengcheng People’s Hospital (BoJi-Affil- iated Hospital of Sun Yat-Sen University) ethics Committee. Plasmids and antibodies. For overexpression of JUB, human Transwell assays. A total of 4 9 104 of each the indicated JUB (538aa) was amplified by PCR from cDNA of SW620 cells were suspended in 200 lL basic 1640 medium and cells and subcloned into a pSin-EF2-puro retroviral vector seeded into the upper trans-well cell culture chambers (BD (Addgene). For depletion of JUB, two human shRNA Biosciences) coated with Matrigel (for invasion assay) or with- sequences were cloned into the pSuper-retro-puro vector to out Matrigel (for migration assay). The lower chamber was generate pSuper-retro-JUB-RNAi(s). The target sequences loaded with 500 lL of 1640 medium with 10% FBS. After were: RNAi#1, GGACCGGGATTATCACTTT, and RNAi#2, incubation for 48 h at 37°Cin5%CO2, cells were fixed with CCAAGTATACTGTGTCACC, as previously reported.(22) methanol and stained with 1% crystal violate. Cells presented Human Snail gene was amplified from cDNA and inserted into on the lower surface of the membrane were quantified and the EcoR I and Xho I sites of the pCDNA3.1 vector. For photographed under a microscope. The average number of five silencing of Snail, oligonucleotides were purchased from Ribo- randomly selected microscopic fields was presented. Bio (RiboBio, Guangzhou, Guangdong) and the target 3-D spheroid invasion assay. First, we coated
Load more

Recommended publications
  • Entrez Symbols Name Termid Termdesc 117553 Uba3,Ube1c
    Entrez Symbols Name TermID TermDesc 117553 Uba3,Ube1c ubiquitin-like modifier activating enzyme 3 GO:0016881 acid-amino acid ligase activity 299002 G2e3,RGD1310263 G2/M-phase specific E3 ubiquitin ligase GO:0016881 acid-amino acid ligase activity 303614 RGD1310067,Smurf2 SMAD specific E3 ubiquitin protein ligase 2 GO:0016881 acid-amino acid ligase activity 308669 Herc2 hect domain and RLD 2 GO:0016881 acid-amino acid ligase activity 309331 Uhrf2 ubiquitin-like with PHD and ring finger domains 2 GO:0016881 acid-amino acid ligase activity 316395 Hecw2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 GO:0016881 acid-amino acid ligase activity 361866 Hace1 HECT domain and ankyrin repeat containing, E3 ubiquitin protein ligase 1 GO:0016881 acid-amino acid ligase activity 117029 Ccr5,Ckr5,Cmkbr5 chemokine (C-C motif) receptor 5 GO:0003779 actin binding 117538 Waspip,Wip,Wipf1 WAS/WASL interacting protein family, member 1 GO:0003779 actin binding 117557 TM30nm,Tpm3,Tpm5 tropomyosin 3, gamma GO:0003779 actin binding 24779 MGC93554,Slc4a1 solute carrier family 4 (anion exchanger), member 1 GO:0003779 actin binding 24851 Alpha-tm,Tma2,Tmsa,Tpm1 tropomyosin 1, alpha GO:0003779 actin binding 25132 Myo5b,Myr6 myosin Vb GO:0003779 actin binding 25152 Map1a,Mtap1a microtubule-associated protein 1A GO:0003779 actin binding 25230 Add3 adducin 3 (gamma) GO:0003779 actin binding 25386 AQP-2,Aqp2,MGC156502,aquaporin-2aquaporin 2 (collecting duct) GO:0003779 actin binding 25484 MYR5,Myo1e,Myr3 myosin IE GO:0003779 actin binding 25576 14-3-3e1,MGC93547,Ywhah
    [Show full text]
  • Noelia Díaz Blanco
    Effects of environmental factors on the gonadal transcriptome of European sea bass (Dicentrarchus labrax), juvenile growth and sex ratios Noelia Díaz Blanco Ph.D. thesis 2014 Submitted in partial fulfillment of the requirements for the Ph.D. degree from the Universitat Pompeu Fabra (UPF). This work has been carried out at the Group of Biology of Reproduction (GBR), at the Department of Renewable Marine Resources of the Institute of Marine Sciences (ICM-CSIC). Thesis supervisor: Dr. Francesc Piferrer Professor d’Investigació Institut de Ciències del Mar (ICM-CSIC) i ii A mis padres A Xavi iii iv Acknowledgements This thesis has been made possible by the support of many people who in one way or another, many times unknowingly, gave me the strength to overcome this "long and winding road". First of all, I would like to thank my supervisor, Dr. Francesc Piferrer, for his patience, guidance and wise advice throughout all this Ph.D. experience. But above all, for the trust he placed on me almost seven years ago when he offered me the opportunity to be part of his team. Thanks also for teaching me how to question always everything, for sharing with me your enthusiasm for science and for giving me the opportunity of learning from you by participating in many projects, collaborations and scientific meetings. I am also thankful to my colleagues (former and present Group of Biology of Reproduction members) for your support and encouragement throughout this journey. To the “exGBRs”, thanks for helping me with my first steps into this world. Working as an undergrad with you Dr.
    [Show full text]
  • WMC-79, a Potent Agent Against Colon Cancers, Induces Apoptosis Through a P53-Dependent Pathway
    1617 WMC-79, a potent agent against colon cancers, induces apoptosis through a p53-dependent pathway Teresa Kosakowska-Cholody,1 Introduction 1 2 W. Marek Cholody, Anne Monks, The bisimidazoacridones are bifunctional antitumor Barbara A. Woynarowska,3 agents with strong selectivity against colon cancers (1, 2). and Christopher J. Michejda1 Recent studies of the effect of bisimidazoacridones on sensitive colon tumors cells revealed that these com- 1 Molecular Aspects of Drug Design, Structural Biophysics pounds act as cytostatic agents that completely arrest cell Laboratory, Center for Cancer Research; 2Screening Technologies Branch, Laboratory of Functional Genomics, Science Applications growth at G1 and G2-M check points but do not trigger International Corporation, National Cancer Institute at Frederick, cell death even at high concentrations (10 Amol/L; ref. 3). Frederick, Maryland; and 3Department of Radiation Oncology, The chemical structure of bisimidazoacridones is symmet- University of Texas Health Science Center, San Antonio, Texas rical in that it consists of two imidazoacridone moieties held together by linkers of various lengths and rigidities. Abstract We recently reported on the synthesis of unsymmetrical variants of the original bisimidazoacridones (4). WMC-79 WMC-79 is a synthetic agent with potent activity (Fig. 1), a compound consisting of an imidazoacridone against colon and hematopoietic tumors. In vitro, the moiety linked to a 3-nitronaphthalimide moiety via agent is most potent against colon cancer cells that 1,4-bispropenopiperazine linker, was found to be a potent carry the wild-type p53 tumor suppressor gene (HCT- but selective cytotoxic agent in a variety of tumor cell f 116 and RKO cells: GI50 <1 nmol/L, LC50 40 nmol/L).
    [Show full text]
  • Upregulated Genes in Colorectal Cancer Compared with Paired Normal Mucosa
    [Supplemental Table 1] Upregulated genes in colorectal cancer compared with paired normal mucosa Genes Description Probe p value Fold IL8 interleukin 8 202859_x_at 2.2E-06 85.8 MMP1 matrix metallopeptidase 1 204475_at 4.5E-06 48.1 MMP3 matrix metallopeptidase 3 205828_at 0.000269 46.1 FOXQ1 forkhead box Q1 227475_at 1E-07 27.6 CTHRC1 collagen triple helix repeat containing 1 225681_at p < 1e-07 26.2 CXCL6 chemokine (C-X-C motif) ligand 6 206336_at 6.23E-05 24.8 MMP10 matrix metallopeptidase 10 (stromelysin 2) 205680_at 0.000808 24.8 SRPX2 sushi-repeat-containing protein, X-linked 2 205499_at 4E-07 22.8 CDNA FLJ14388 fis, clone HEMBA1002716 229802_at 4.5E-06 22.6 MRNA full length insert cDNA clone EUROIMAGE 1913076 226237_at 4.93E-05 20.9 KIAA1199 KIAA1199 212942_s_at 0.000824 20.7 CLDN1 Claudin 1 222549_at 1E-07 20.6 CXCL1 chemokine (C-X-C motif) ligand 1 204470_at 1E-07 19.9 LY6G6D lymphocyte antigen 6 complex, locus G6D 207457_s_at 5.38E-05 17.9 hCG_1815491 hCG1815491 238021_s_at 1.17E-05 13.8 COL12A1 collagen, type XII, alpha 1 225664_at 3E-07 12.9 SULF1 sulfatase 1 212353_at 3E-07 12.6 CXCL2 chemokine (C-X-C motif) ligand 2 209774_x_at 4.13E-05 12.5 WNT5A wingless-type MMTV integration site family, member 5A 213425_at p < 1e-07 11.7 WNT5A wingless-type MMTV integration site family, member 5A 205990_s_at p < 1e-07 11.5 HS6ST2 heparan sulfate 6-O-sulfotransferase 2 230030_at 4.09E-05 11.2 UBD ubiquitin D 205890_s_at 5.69E-05 11 Transcribed locus 238967_at 9.11E-05 10.8 JUB jub, ajuba homolog (Xenopus laevis) 225806_at p < 1e-07 10.6 ANLN anillin, actin binding protein 222608_s_at 3E-07 10.5 SULF1 sulfatase 1 212344_at 4.9E-06 10.5 SLC6A6 solute carrier family 6, member 6 228754_at p < 1e-07 10.4 PHLDA1 pleckstrin homology-like domain, family A, member 1 225842_at 1E-07 10.4 WNT2 wingless-type MMTV integration site family member 2 205648_at 1.4E-06 10.2 PSAT1 phosphoserine aminotransferase 1 223062_s_at 3E-07 10 Fold: fold change between colorectal cancer and paired normal colonic mucosa.
    [Show full text]
  • Src Inhibits the Hippo Tumor Suppressor Pathway Through Tyrosine Phosphorylation
    Author Manuscript Published OnlineFirst on July 28, 2017; DOI: 10.1158/0008-5472.CAN-17-0391 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Src inhibits the Hippo tumor suppressor pathway through tyrosine phosphorylation of Lats1 Yuan Si1, Xinyan Ji1, Xiaolei Cao1, Xiaoming Dai1, Lingyi Xu1, Hongxia Zhao1, Xiaocan Guo1, Huan Yan1, Haitao Zhang1, Chu Zhu1, Qi Zhou1, Mei Tang1, Zongping Xia1, Li Li3, Yu-Sheng Cong3, Sheng Ye1, Tingbo Liang2, Xin-Hua Feng1, Bin Zhao1, 3, * 1Life Sciences Institute and Innovation Center for Cell Signaling Network 2Department of Hepatobiliary and Pancreatic Surgery and the Key Laboratory of Cancer Prevention and Intervention, The Second Affiliated Hospital, School of Medicine Zhejiang University, Hangzhou, Zhejiang 310058, China 3Institute of Aging Research, Hangzhou Normal University, Hangzhou, Zhejiang 311121, China *Correspondence: Bin Zhao, Life Sciences Institute, Zhejiang University, 866 Yuhangtang Road, Hangzhou, Zhejiang, China. Phone: 86-571-88208545; Email: [email protected] Key words: Src, Hippo pathway, Lats1, cell adhesion, tumorigenesis Running title: Lats1 phosphorylation by Src promotes tumorigenesis Financial support: This work was supported by grants to B. Zhao from the National Natural Science Foundation of China General Projects (31471316) and Excellent Yong Scholars Project (31422036), the State Key Development Program for Basic Research of China (2013CB945303), the National Natural Science Foundation of China International Collaboration Project (31661130150), the 111 project (B13026), and the Qianjiang Scholar Plan of Hangzhou, the Thousand Young Talents Plan of China, and the Newton Advanced Fellowship from the Academy of Medical Sciences, UK. And grant from the National Natural Science Foundation of China to S.
    [Show full text]
  • Molecular Targeting and Enhancing Anticancer Efficacy of Oncolytic HSV-1 to Midkine Expressing Tumors
    University of Cincinnati Date: 12/20/2010 I, Arturo R Maldonado , hereby submit this original work as part of the requirements for the degree of Doctor of Philosophy in Developmental Biology. It is entitled: Molecular Targeting and Enhancing Anticancer Efficacy of Oncolytic HSV-1 to Midkine Expressing Tumors Student's name: Arturo R Maldonado This work and its defense approved by: Committee chair: Jeffrey Whitsett Committee member: Timothy Crombleholme, MD Committee member: Dan Wiginton, PhD Committee member: Rhonda Cardin, PhD Committee member: Tim Cripe 1297 Last Printed:1/11/2011 Document Of Defense Form Molecular Targeting and Enhancing Anticancer Efficacy of Oncolytic HSV-1 to Midkine Expressing Tumors A dissertation submitted to the Graduate School of the University of Cincinnati College of Medicine in partial fulfillment of the requirements for the degree of DOCTORATE OF PHILOSOPHY (PH.D.) in the Division of Molecular & Developmental Biology 2010 By Arturo Rafael Maldonado B.A., University of Miami, Coral Gables, Florida June 1993 M.D., New Jersey Medical School, Newark, New Jersey June 1999 Committee Chair: Jeffrey A. Whitsett, M.D. Advisor: Timothy M. Crombleholme, M.D. Timothy P. Cripe, M.D. Ph.D. Dan Wiginton, Ph.D. Rhonda D. Cardin, Ph.D. ABSTRACT Since 1999, cancer has surpassed heart disease as the number one cause of death in the US for people under the age of 85. Malignant Peripheral Nerve Sheath Tumor (MPNST), a common malignancy in patients with Neurofibromatosis, and colorectal cancer are midkine- producing tumors with high mortality rates. In vitro and preclinical xenograft models of MPNST were utilized in this dissertation to study the role of midkine (MDK), a tumor-specific gene over- expressed in these tumors and to test the efficacy of a MDK-transcriptionally targeted oncolytic HSV-1 (oHSV).
    [Show full text]
  • UC San Diego Electronic Theses and Dissertations
    UC San Diego UC San Diego Electronic Theses and Dissertations Title Cardiac Stretch-Induced Transcriptomic Changes are Axis-Dependent Permalink https://escholarship.org/uc/item/7m04f0b0 Author Buchholz, Kyle Stephen Publication Date 2016 Peer reviewed|Thesis/dissertation eScholarship.org Powered by the California Digital Library University of California UNIVERSITY OF CALIFORNIA, SAN DIEGO Cardiac Stretch-Induced Transcriptomic Changes are Axis-Dependent A dissertation submitted in partial satisfaction of the requirements for the degree Doctor of Philosophy in Bioengineering by Kyle Stephen Buchholz Committee in Charge: Professor Jeffrey Omens, Chair Professor Andrew McCulloch, Co-Chair Professor Ju Chen Professor Karen Christman Professor Robert Ross Professor Alexander Zambon 2016 Copyright Kyle Stephen Buchholz, 2016 All rights reserved Signature Page The Dissertation of Kyle Stephen Buchholz is approved and it is acceptable in quality and form for publication on microfilm and electronically: Co-Chair Chair University of California, San Diego 2016 iii Dedication To my beautiful wife, Rhia. iv Table of Contents Signature Page ................................................................................................................... iii Dedication .......................................................................................................................... iv Table of Contents ................................................................................................................ v List of Figures ...................................................................................................................
    [Show full text]
  • The Adherens Junction Interactome and the Role of Vinculin in Cytoskeletal Integration at the Cardiomyocyte ICD
    Title P age The Adherens Junction Interactome and the Role of Vinculin in Cytoskeletal Integration at the Cardiomyocyte ICD by Chelsea DeAnn Merkel B.S., Eastern University, 2013 Submitted to the Graduate Faculty of the School of Medicine in partial fulfillment of the requirements for the degree of Doctor of Philosophy University of Pittsburgh 2019 Committee M emb er ship P ag e UNIVERSITY OF PITTSBURGH SCHOOL OF MEDICINE This dissertation was presented by Chelsea DeAnn Merkel It was defended on June 21, 2019 and approved by Ora A. Weisz, Professor, Dept. of Medicine, Renal-Electrolyte Division; Department of Cell Biology Bernhard Kühn, Associate Professor, Department of Pediatrics Simon C. Watkins, Distinguished Professor, Department of Cell Biology Gerald R. Hammond, Assistant Professor, Department of Cell Biology Dissertation Director: Adam V. Kwiatkowski, Assistant Professor, Department of Cell Biology ii Copyright © by Chelsea DeAnn Merkel 2019 iii Ab stract The Adherens Junction Interactome and the Role of Vinculin in Cytoskeletal Integration at the Cardiomyocyte ICD Chelsea DeAnn Merkel, PhD University of Pittsburgh, 2019 The primary function of the heart is to contract and pump oxygenated blood throughout the body. Coordinated contraction between individual cardiomyocytes requires mechanical and electrical coupling through a specialized adhesive structure called the intercalated disc (ICD). The ICD joins cardiomyocytes and is comprised of adherens junctions (AJ), desmosomes, and gap junctions. The core of the AJ is the cadherin-catenin complex and it links the myofibrils of neighboring cells. Much work has been performed in epithelial cells to study the role of force in regulating complex formation and ligand recruitment.
    [Show full text]
  • Gene Section Review
    Atlas of Genetics and Cytogenetics in Oncology and Haematology OPEN ACCESS JOURNAL AT INIST-CNRS Gene Section Review LATS2 (LATS, large tumor suppressor, homolog 2 (Drosophila)) Damjan Glava č, Mojca Stražišar Department of Molecular genetics, Institute of Pathology, Faculty of Medicine, University of Ljubljana, Ljubljana, Slovenia (DG, MS) Published in Atlas Database: January 2010 Online updated version : http://AtlasGeneticsOncology.org/Genes/LATS2ID41128ch13q12.html DOI: 10.4267/2042/44874 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2010 Atlas of Genetics and Cytogenetics in Oncology and Haematology Identity DNA/RNA Other names: KPM; FLJ13161; EC 2.7.11.1 Type: functioning gene, 8 exons. HGNC (Hugo): LATS2 Description Location: 13q12.11 Yabuta et al. (2000) mapped the human LATS2 gene to Local order: Chromosome 13; orientation: negative. 13q11-q12 (FISH); gene with protein product. UBA: ubiquitin-associated domain, PK: protein kinase domain, AGC: AGC-C terminal domain, Nu-B: NB-nucleotide binding domain. Filled blocks: coding exons, white blocks: non-coding exons, line: intron region, Ex: exon, In: intron, bp: base pair, kb: kilobase. Atlas Genet Cytogenet Oncol Haematol. 2010; 14(10) 979 LATS2 (LATS, large tumor suppressor, homolog 2 (Drosophila)) Glava č D, Stražišar M UBA: ubiquitin-associated domain, STK: serin/threonin kinase domain, AGC: AGC- C terminal domain, Ab: ATP-binding domain, AA: amino acid, P-Ser: phosphorylated serine, P-Thr: phosphorylated threonine, ATP-b: ATP binding site, Pa: proton acceptor. Gene encodes a serine/threonine protein kinase Localisation belonging to the LATS tumor suppressor family. Cytoplasm, nucleus, spindle pole, centrosome; co- Pseudogene localizes with STK6 at the centrosomes during Not known; paralogs according to Ensembl: LATS1, interphase, early pro-phase and cytokinesis.
    [Show full text]
  • Mechanisms of Hippo Pathway Regulation
    Downloaded from genesdev.cshlp.org on September 30, 2021 - Published by Cold Spring Harbor Laboratory Press REVIEW Mechanisms of Hippo pathway regulation Zhipeng Meng, Toshiro Moroishi, and Kun-Liang Guan Department of Pharmacology, Moores Cancer Center, University of California at San Diego, La Jolla, California 92093, USA The Hippo pathway was initially identified in Drosophila 1/2 (LATS1/2; homologs of Drosophila Warts [Wts]) (Fig. melanogaster screens for tissue growth two decades ago 1A). The physiological output of this kinase cascade is and has been a subject extensively studied in both Droso- to restrict the activities of two transcriptional coactiva- phila and mammals in the last several years. The core of tors, Yes-associated protein (YAP) and transcriptional co- the Hippo pathway consists of a kinase cascade, transcrip- activator with PDZ-binding motif (TAZ; two homologs tion coactivators, and DNA-binding partners. Recent of Drosophila Yorkie [Yki]). When YAP and TAZ are ac- studies have expanded the Hippo pathway as a complex tive, they translocate into the nucleus to bind the TEAD signaling network with >30 components. This pathway transcription factor family (homologs of Drosophila Scal- is regulated by intrinsic cell machineries, such as cell– loped [Sd]) and induce expression of a wide range of genes cell contact, cell polarity, and actin cytoskeleton, as that are involved in cell proliferation, survival, and well as a wide range of signals, including cellular energy migration. status, mechanical cues, and hormonal signals that act Mechanistically, the Hippo kinase cascade can be initi- through G-protein-coupled receptors. The major func- ated by TAO kinases (TAOK1/2/3), which phosphorylate tions of the Hippo pathway have been defined to restrict the activation loop of MST1/2 (Thr183 for MST1 and tissue growth in adults and modulate cell proliferation, Thr180 for MST2; hereafter, all residues refer to human differentiation, and migration in developing organs.
    [Show full text]
  • DNA Methylation and Chromatin Dynamics During Postnatal Cardiac Development and Maturation Using in Vitro and in Vivo Model Systems
    DNA methylation and chromatin dynamics during postnatal cardiomyocyte maturation Ms Sim Choon Boon B.Eng, M.Sc (Genetics) A thesis submitted for the degree of Doctor of Philosophy at The University of Queensland in 2017 School of Biomedical Sciences. Abstract Background: The neonatal mammalian heart has a transient capacity for regeneration, which is lost shortly after birth. A series of critical developmental transitions including a switch from hyperplastic to hypertrophic growth occur during this postnatal regenerative window, preparing the heart for the increased contractile demands of postnatal life. Postnatal cardiomyocyte maturation and loss of regenerative capacity are associated with expression alterations of thousands of genes embedded within tightly controlled transcriptional networks, which remain poorly understood. Interestingly, although mitogenic stimulation of neonatal cardiomyocytes results in proliferation, the same stimuli induce hypertrophy in adult cardiomyocytes by activating different transcriptional pathways, indicating that cardiomyocyte maturation may result from epigenetic modifications during development. Notably, DNA methylation and chromatin compaction are both important epigenetic modifications associated with a decrease in transcription factor (TF) accessibility to DNA. However, the role of both DNA methylation and chromatin compaction during postnatal cardiac maturation remain largely unknown. Hypothesis: Postnatal changes in DNA methylation and chromatin compaction silence transcriptional networks required
    [Show full text]
  • Gene Expression for HIV-Associated Dementia and HIV Encephalitis in Microdissected Neurons 1: Preliminary Analysis
    Neurobehavioral HIV Medicine Dovepress open access to scientific and medical research Open Access Full Text Article ORIGINAL RESEARCH Gene expression for HIV-associated dementia and HIV encephalitis in microdissected neurons 1: preliminary analysis Paul Shapshak1,2 Abstract: We analyzed gene expression in neurons from 16 cases divided into four groups, ie, Robert Duncan3 human immunodeficiency virus (HIV)-associated dementia (HAD)/HIV encephalitis (HAD/ E Margarita Duran4 HIVE), HAD alone, HIVE alone, and HIV positive alone. We produced the neurons using laser Fabiana Farinetti5 capture microdissection from cryopreserved basal ganglia (specifically globus pallidus). Gene Alireza Minagar6 expression in pooled neurons from each case was analyzed on GE CodeLink Microarray chips Deborah Commins7,8 with 55,000 gene fragments per chip. One-way analysis of variance showed significant changes in expression of 197 genes among the four groups (P , 0.005). The three groups, ie, HAD/HIVE, Hector Rodriguez9 HAD alone, and HIVE alone, were compared with the HIV-positive group using Fisher’s least Francesco Chiappelli10 significant difference test, and associated gene expression changes were assigned to each of the Pandajarasamme For personal use only. three comparisons. Identified genes were associated with 159 functional categories and many 11,12 Kangueane of the genes had more than one function. The functional groups included adhesion, amyloid, 8,13 Andrew J Levine apoptosis, channel complex, cell cycle, chaperone, chromatin, cytokine, cytoskeleton, metabolism, Elyse Singer8,13 mitochondria, multinetwork detection protein, sensory perception, receptor, ribosome, noncoding Charurut Somboonwit1,14 miRNA, signaling, synapse, transcription factor, homeobox, transport, multidrug resistance, and John T Sinnott1,14 ubiquitin cycle. Several genes were associated with other neurodegenerative and developmental 1Division of Infectious Disease and International diseases, including Alzheimer’s disease, Huntington’s disease, and diGeorge syndrome.
    [Show full text]