
LIM protein JUB promotes epithelial–mesenchymal transition in colorectal cancer Xing-Hua Liang,1,9 Guang-Xian Zhang,2,9 Yue-bin Zeng,3,9 Hai-Feng Yang,4 Wen-Hong Li,5 Qi-Long Liu,5 Yue-liang Tang,5 Wen-guang He,5 Yan-Nian Huang,5 Lei Zhang,6 Li-Na Yu7,8 and Xian-Cheng Zeng5,6 1Department of Gastroenterology, Zengcheng People’s Hospital (BoJi-Affiliated Hospital of Sun Yat-Sen University), Zengcheng; 2School of Basic Medical Sciences, Guangzhou University of Chinese Medicine, Guangzhou; 3Department of Infectious Diseases, Zengcheng People’s Hospital (BoJi-Affiliated Hospital of Sun Yat-Sen University), Zengcheng; 4Department of Pathology, The Second Affiliated Hospital of Guangzhou University of Chinese Medicine (Guangdong Provincial Hospital of TCM), Guangzhou; 5Department of General Surgery, Zengcheng People’s Hospital (BoJi-Affiliated Hospital of Sun Yat- Sen University), Zengcheng; 6Department of Clinical Laboratory Zengcheng People’s Hospital (BoJi-Affiliated Hospital of Sun Yat-Sen University), Zengcheng; 7Department of Pathology, Nanfang Hospital, Southern Medical University, Guangzhou; 8Department of Pathology, School of Basic Medical Sciences, Southern Medical University, Guangzhou, China Key words Metastasis is the leading cause of cancer-related death in almost all types of can- Colorectal cancer, epithelial–mesenchymal transition, JUB, cers, including colorectal cancer (CRC). Metastasis is a complex, multistep, LIM protein, Snail dynamic biological event, and epithelial–mesenchymal transition (EMT) is a criti- Correspondence cal process during the cascade. Ajuba family proteins are LIM domain-containing Xian-Cheng Zeng, Department of General Surgery, Zen- proteins and are reported to be transcription repressors regulating different gcheng People’s Hospital (BoJi-Affiliated Hospital of Sun kinds of physiological processes. However, the expression and pathological roles Yat-Sen University), Zengcheng 511300, China. of Ajuba family proteins in tumors, especial in tumor metastasis, remain poorly Tel: 86-20-32855003; Fax: 86-20-62287040; studied. Here, we found that JUB, but not the other Ajuba family proteins, was E-mail: [email protected] highly upregulated in clinical specimens and CRC cell lines. Ectopic expression of Li-Na Yu, Department of Pathology, School of Basic Medi- JUB induced EMT and enhanced motility and invasiveness in CRC, and vice versa. cal Sciences, Southern Medical University, Guangzhou Mechanistic study revealed that JUB induces EMT via Snail and JUB is also 510515, China. required for Snail-induced EMT. The expression of JUB shows an inverse correla- Tel: 86-20-62789371; tion with E-cadherin expression in clinical specimens. Taken together, these find- E-mail: [email protected] ings revealed that the LIM protein JUB serves as a tumor-promoting gene in CRC 9These authors contributed equally to this work. by promoting EMT, a critical process of metastasis. Thus, the LIM protein JUB may provide a novel target for therapy of metastatic CRC. Funding Information Natural Science Foundation of China (81001111). Natural Science Foundation of Guangdong (S2011040003696). Zengcheng People’s Hospital Scholarship for Excellent Scientists (2013-YX-001). Received February 6, 2014; Revised March 17, 2014; Accepted March 24, 2014 Cancer Sci 105 (2014) 660–666 doi: 10.1111/cas.12404 etastasis accounts for approximately 90% of cancer- morphology, high motility and invasiveness. Downregulation M associated deaths.(1) An estimated 1.2 million cases of of E-cadherin is a hallmark of EMT. Control of transcription colorectal cancer (CRC) were recorded worldwide in 2008. of the E-cadherin gene is the main mechanism accounting for Approximately 35% of patients present with stage-IV meta- downregulation of this protein.(7) Several transcription factors static disease when diagnosed with primary disease, and 20– have been reported to repress expression of E-cadherin: Snail, 50% of subjects with stage-II or- stage-III disease will progress Slug, Twist and S1P,(8–10) among which Snail was the first to be to stage-IV disease.(2,3) Mortality has declined by approxi- discovered. Snail has been reported to be a major transcription mately 1.8% per year for stage-IV disease(3) but the prognosis repressor of E-cadherin, frequently upregulated in breast can- of metastatic CRC remains extremely poor (overall survival at cer,(8,11) esophageal squamous cell carcinoma(12) and CRC.(13) 5 years <10%).(4) Metastasis remains the most poorly under- The LIM protein Ajuba family contains three members, stood component of the pathogenesis of cancer. JUB, WTIP and LIMD1, and is characterized by a unique N- Epithelial–mesenchymal transition (EMT) is known to be terminal region, the preLIM region, and three tandem C-termi- fundamental for embryonic development, wound healing and nal LIM domains.(14–16) This family of proteins function as fibrosis, but also for tumor invasion and metastasis.(5,6) EMT scaffolds and have been reported to modulate many events in is the initial process of tumor metastasis. Cells undergoing cells, such as cell proliferation and tissue size,(17,18) DNA EMT usually acquire a mesenchymal phenotype, spindle-like damage response,(19) meiotic maturation of oocytes(14) and Cancer Sci | June 2014 | vol. 105 | no. 6 | 660–666 © 2014 The Authors. Cancer Science published by Wiley Publishing Asia Pty Ltd on behalf of Japanese Cancer Association. This is an open access article under the terms of the Creative Commons Attribution-NonCommercial License, which permits use, distribution and reproduction in any medium, provided the original work is properly cited and is not used for commercial purposes. Original Article www.wileyonlinelibrary.com/journal/cas Liang et al. embryonal cell proliferation and differentiation.(20) However, and quantified using an ABI Prism 7500 Sequence Detection the pathological roles of Ajuba family proteins in diseases System (Applied Biosystems, Lab India, Haryana, India), with remain unexplored. Langer et al.(21) find that LIM protein SYBR Green I dye (Molecular Probes, Invitrogen). b-actin was Ajuba family proteins interact with the SNAG domain of the used as an internal control. Expression data were normalized to Snail family. They use Xenopus neural crest as a model of b-actin, and calculated as 2(-[(Ct of gene) À (Ct of beta-actin)]),where in vivo Snail-induced EMT and demonstrate that Ajuba LIM Ct represents the threshold cycle for each transcript. The primers proteins contribute to neural crest development as Snail ⁄ Slug for qRT-PCR were: corepressors and are required for in vivo Snail ⁄ Slug func- tion.(21) Thus, we propose that Ajuba family proteins may also JUB-Fwd AGAGGCCAGGGAGGACTACT regulate EMT in cancer and promote metastasis. JUB-Rev GAGCAGCAAACAAAGCACTG In the present study, surprisingly, we find that the LIM pro- WTIP-Fwd TGTGGGCTTGGCATCTACG tein JUB, but not the other two members of the Ajuba family, WTIP-Rev TGCTGGAACCCGGAGTACAG WTIP and LIMD1, was highly upregulated in CRC specimens LIMD1-Fwd TCACCCGAAGGCTGATTACT and cell lines. Ectopic overexpression of JUB induces EMT LIMD1-Rev AGGTGAAGCATGTGTCATGG and promotes migration and invasion in CRC cells. Silencing b-actin-Fwd GCACAGAGCCTCGCCTT of JUB impairs EMT and inhibits migration and invasion in b-actin-Rve CCTTGCACATGCCGGAG CRC cells. Further mechanistic study revealed that JUB pro- moting EMT depends on Snail, and JUB is also required for Snail to induce EMT, which is consistent with previous reports Clinical tissue specimens and ethics statement. Tissue speci- that JUB serves as a corepressor of Snail. The present study mens were freshly collected from Zengcheng People’s Hospital uncovered an important role of the LIM protein JUB in the (BoJi-Affiliated Hospital of Sun Yat-Sen University), so that pathological progress of tumorigenesis in CRC. Hereafter, JUB patients could be histopathologically and clinically diagnosed. could be a novel therapy target for metastatic CRC. All samples were obtained with prior written informed consents from the patients and approval from the Institutional Research Materials and Methods Ethics Committees of Zengcheng People’s Hospital (BoJi-Affil- iated Hospital of Sun Yat-Sen University) ethics Committee. Plasmids and antibodies. For overexpression of JUB, human Transwell assays. A total of 4 9 104 of each the indicated JUB (538aa) was amplified by PCR from cDNA of SW620 cells were suspended in 200 lL basic 1640 medium and cells and subcloned into a pSin-EF2-puro retroviral vector seeded into the upper trans-well cell culture chambers (BD (Addgene). For depletion of JUB, two human shRNA Biosciences) coated with Matrigel (for invasion assay) or with- sequences were cloned into the pSuper-retro-puro vector to out Matrigel (for migration assay). The lower chamber was generate pSuper-retro-JUB-RNAi(s). The target sequences loaded with 500 lL of 1640 medium with 10% FBS. After were: RNAi#1, GGACCGGGATTATCACTTT, and RNAi#2, incubation for 48 h at 37°Cin5%CO2, cells were fixed with CCAAGTATACTGTGTCACC, as previously reported.(22) methanol and stained with 1% crystal violate. Cells presented Human Snail gene was amplified from cDNA and inserted into on the lower surface of the membrane were quantified and the EcoR I and Xho I sites of the pCDNA3.1 vector. For photographed under a microscope. The average number of five silencing of Snail, oligonucleotides were purchased from Ribo- randomly selected microscopic fields was presented. Bio (RiboBio, Guangzhou, Guangdong) and the target 3-D spheroid invasion assay. First, we coated
Details
-
File Typepdf
-
Upload Time-
-
Content LanguagesEnglish
-
Upload UserAnonymous/Not logged-in
-
File Pages7 Page
-
File Size-