Diversity and Management of Sclerotinia Sclerotiorum in Brassica Spp

Diversity and Management of Sclerotinia sclerotiorum in Brassica spp. in Bangladesh

Dissertation

Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in the

Graduate School of The Ohio State University

Md. Mynul Islam, MS

Graduate Program in Plant Pathology

The Ohio State University

2018

Dissertation Committee:

Sally A. Miller, Advisor

Anne Dorrance

Pierce A. Paul

Christopher Taylor

Md. Mynul Islam

2018

Abstract

Sclerotinia sclerotiorum is an important pathogen of many crops including rapeseed- mustard (Brassica spp.). The pathogen has emerged relatively recently in Bangladesh and there is no information available regarding its population structure in mustard-growing regions of the country. A series of experiments were conducted to determine the variability of S. sclerotiorum isolates from different regions of Bangladesh and from Ohio, USA. In 2014, a total of 132 S. sclerotiorum isolates were collected from 11 locations in Bangladesh and Ohio. Morphological characteristics including mycelial radial growth and number and fresh weight of sclerotia were measured. Genetic variability was also assessed by Internal Transcribed Spacer (ITS) rDNA sequencing, microsatellite markers and mycelial compatibility grouping. Overall, isolates from

Bangladesh showed low variability based on morphological and molecular characteristics.

Mycelial radial growth of isolates from one location in Bangladesh was significantly higher than the radial growth of isolates from Ohio. No significant difference was observed in the number of sclerotia produced by isolates from the 11 locations. The weight of sclerotia produced by isolates from Tangail, Mirzapur was smaller than that of isolates from Ohio and from Tangail, Ghatail and Shirajganj, Chalakpara, Bangladesh. No significant variation was observed among isolates from any location based on their ITS rDNA sequences. Based on eight informative microsatellite loci, 91% of the variation was within the isolates and 9% was due to location, indicating low divergence among the populations from the 11 locations. Principle Component Analysis (PCA) separated Ohio isolates from isolates from nine locations in Bangladesh; however, isolates from

Jamalpur were in the same PCA quartile as isolates from Ohio. Twenty-seven microsatellite haplotypes were identified from 118 isolates from 11 locations, and one haplotype (haplotype 1)

ii was predominant in ten locations in Bangladesh. The Ohio population contained two isolates with two separate haplotypes (haplotype 25 and haplotype 26). Thirty-four mycelial compatibility groups (MCGs) were identified among 80 S. sclerotiorum isolates; those from

Ohio formed four groups while the remaining 30 groups were from Bangladesh. Fifty-one isolates from ten Bangladesh populations were in haplotype 1, which shared 14 MCGs. On the other hand, four MCGs contained more than one haplotype. Based on morphological and genetic characters, the S. sclerotiorum populations from Bangladesh and from Ohio were different, however, populations from Bangladesh had low variability.

Fungicide application is the primary tactic widely used to manage white mold in mustard and other crops. However, no information is available on sensitivity of S. sclerotiorum to fungicides in Bangladesh. Sensitivity of S. sclerotiorum to iprodione, propiconazole, fluazinam and penthiopyrad was determined using isolates collected from 11 locations in Bangladesh and

Ohio, USA in 2014. Sensitivity was assessed using discriminatory doses and concentrations and

50% mycelial inhibition (EC50) values were determined. Compared with the EC50 of the fungicides to S. sclerotiorum from the published literature, none of the tested S. sclerotiorum isolates were resistant to iprodione, propiconazole, fluazinam or penthiopyrad. However, some isolates of S. sclerotiorum exhibited reduced sensitivity to propiconazole. The EC50 values obtained in the first experiment ranged from 0.18 - 0.50 ppm, 0.12 - 0.78 ppm, 0.0019 - 0.0044 ppm and 0.012 - 0.429 ppm for iprodione, propiconazole, fluazinam and penthiopyrad, respectively. In the second experiment, EC50 values ranged from 0.16 - 0.36 ppm, 0.02 - 0.93 ppm, 0.0024 - 0.0050 ppm and 0.08 - 0.83 ppm for iprodione, propiconazole, fluazinam and penthiopyrad respectively. Relative toxicity index (RTI) values, using iprodione as the standard, were 103.2 and 67.6 (experiments 1 and 2, respectively) for fluazinam, and 6.0 and 1.6

iii

(experiments 1 and 2, respectively) for penthiopyrad. Propiconazole was similar to iprodione in toxicity to S. sclerotiorum. Fluazinam and penthiopyrad are not registered in Bangladesh.

Iprodione and propiconazole are registered for other diseases, but not resigtered for white mold management in mustard, therefore the EC50 values of fluazinam and pethiopyrad determined in this study can be considered baseline sensitivity levels for future efforts to monitor development of resistance to these fungicides in S. sclerotiorum in Bangladesh.

Development of rapeseed-mustard varieties partially or fully resistant to S. sclerotiorum would enhance the disease management toolbox and reduce or eliminate the need for fungicides to control this disease. Fourteen varieties and one breeding line developed by the Bangladesh

Agricultural Research Institute (BARI) were screened to determine their reactions to S. sclerotiorum. Twenty S. sclerotiorum isolates were pre-evaluated for virulence and a highly virulent isolate was selected. Isolate SCS1 caused large lesions 24 h after inoculation in a detached leaf assay. This isolate was used in cotyledon and petiole inoculation assays. In screening with cotyledon inoculation, the smallest lesions were observed in BARI Sharisa 14.

There were no significant differences among the varieties/line in percentage of infected cotyledons. In petiole inoculation screening, variation in the reactions of the rapeseed-mustard varieties/line to S. sclerotiorum was insignificant, except for breeding line SS 75 in both experiments. This line showed significantly higher resistance to S. sclerotiorum than BARI

Sharisa 10 in first experiment and Tori 7 in the second experiment. Although the results obtained using two inoculation methods were inconsistent, both BARI Sharisa 14 and SS 75 may prove to be useful as sources of resistance to S. sclerotiorum upon more extensive evaluation.

Integrated management is the most durable management strategy. Two experiments were conducted at Rangpur and Jamalpur to evaluate different treatments separately and in

iv combination to control white mold disease of mustard. The fungal biocontrol agent Trichoderma harzianum isolate BHT-N1 (ThBHT-N1) and five fungicides in different groups (carbendazim, thiophanate-methyl, propiconazole, iprodione and azoxystrobin + difenoconazole) were tested separately and in combination with ThBHT-N1 in natural field conditions. In Burirhut, Rangpur, the incidence of white mold disease was low. However, azoxystrobin + difenoconazole-treated plots had significantly lower disease incidence and higher yield than non-treated control plots. In

Jamalpur, white mold was not observed, but Alternaria blight was recorded. All fungicide treatments and ThBHT-N1 significantly reduced disease severity compared to the non-treated control, but azoxystrobin + difenoconazole and iprodione treatments were more effective than the other treatments.

Information generated from this study will enhance our understanding of population structure of S. sclerotiorum in Bangladesh, its diversity and sensitivity to fungicides and sources of resistance to S. sclerotiorum. This information will be helpful for increasing production and ultimately will contribute to food security of Bangladesh, a developing country.

Dedication

In memory of my parents

Acknowledgements

I would like to express my sincere thanks and appreciation to my advisor Dr. Sally Miller for her insightful scholarly guidance, encouragement, partial research funds and many other opportunities provided me for my development as a plant pathologist since the last 4 years.

I am very much grateful to the members of my advisory committee, Dr. Anne Dorrance,

Dr. Pierce Paul and Dr. Christopher Taylor for their cooperation and suggestions to understand many topics related to my research and to improve the quality of my thesis research.

Thanks to all members of the Miller lab, Fulya Baysal-Gurel, Francesca Rotondo, Angela

Nanes, Jhony Mera, Cláudio Vrisman, Anna Testen, Xing Ma, Nagendra Subedi, Ferdous- E-

Elahi, Mafrua Afroz, Loïc Deblais, Ram Khadka, Andres Sanabria, Nick Rehm, Margaret

Moodispaw, and Luis Huezo for their cordial cooperation.

I would like to thank Ken Nanes, Bob James, Lee Wilson, Monica Lewandowski, Pat

Rigby, and Beau Ingle for their help in facilitating research work, processing my trips to USA and continuous coordination with funding agencies. I would like to thank all the students of the

Department of Plant Pathology, OSU for their support and friendly cooperation. Also thanks to

Dr. Tapan Kumar Dey for his valuable suggestions on the design and set up of field experiments in Bangladesh.

I am grateful to my funding agencies, USAID mission Bangladesh, Borlaug Higher

Education for Agricultural Research and Development (BHEARD) team in Michigan State

University, and Bangladesh Agricultural Research Institute (BARI). Without their support, it would be impossible to complete the program.

Finally I would like thank my family members for their cooperation and help during the time of my dissertation.

vii

Vita

2003 BSc in Agriculture, Khulna University, Bangladesh 2005 MS in Plant Pathology 2005 to present Research Scientist, Plant Pathology Division, Bangladesh Agricultural Research Institute, Gazipur, Bangladesh 2013 USDA Borlaug Fellow at The Ohio State University 2013 to present Graduate Student, Department of Plant Pathology, The Ohio State University, USA

Publications

Islam, M. M. and Bhuiyan, M. K. A. 2006. Integrated management of foot and root rot of tuberose(Polianthes tuberosa) caused by Sclerotium rolfsii. Bangladesh Journal of Plant Pathology 22:49-54.

Karim, Z., Akanda, A. M., Hossain, M. S., Islam, M. M. and Rahman, M.M.E. 2006. Effect of polythene mulch on the management of Tomato Purple Vein Virus. Bangladesh Journal of Plant Pathology 22:79-84.

Rahman, M.M.E., Muyeed, M.A., Ali, M.S., Ali, M.E., Islam, M,M. 2007. Control of seed-borne mico-flora with botanicals. Bangladesh Journal of Crop. Science 18:129-133.

Karim, Z., Bakr, M. A., Hossain, M. S. and Islam, M. M. 2008. Effect of some selected insecticides and botanicals against tomato yellow leaf curl virus in the tomato field through vector management. Bangladesh Journal of Plant Pathology 24:79-84.

Karim, Z., Bakr, M. A., Hossain, M.S., Rahman, M. M. E., Islam, M. M. and Miah, M. A.M. 2010. Post harvest losses of vegetables in relation to pathogen: A case study in Gazipur district. Bangladesh Journal of Plant Pathology 25:41-46.

R. Islam, K. Jahan, M. Mynul Islam, R Momtaz and M. S. Hossain. 2011. Screening botanicals against Alternaria blight of cauliflower seed crop. Bangladesh Journal of Plant Pathology 27:27- 32.

F. E. Elahi, M. Mynul Islam, M. R. Humauan, B. Akter, K. M. Khalequzzaman and T. K. Dey. 2011. First report on club root disease (Plasmodiophora brassicae) on mustard in Bangladesh. Bangladesh Journal of Plant Pathology 27:71-72.

Hossain, M. D., M.M.E. Rahman, M. M. Islam and M. Z. Rahman. 2008. White rot, a new disease of mustard in Bangladesh. Bangladesh Journal of Plant Pathology 24:83-84. viii

Karim, Z., Hossain, M. S., Islam, M.M. 2010. Screening of mungbean lines against Mungbean Yellow Mosaic Virus (MYMV) under field condition. Bangladesh Journal of Plant Pathology 26:79-80.

MME Rahman, T. K. Dey, and M. Mynul Islam. 2011. Anthracnose (Colletotrichum gloeosporiodes) a new disease if jujube (Ziziphus mauritiana) in Bangladesh. Bangladesh Journal of Plant Pathology 27:67-67.

A. L. Testen, D. P. Mamiro, T. Meulia, N. Subedi, M. Islam, F. Baysal-Gurel, and S. A. Miller 2014. First report of leek yellow stripe virus in garlic in Ohio. Plant Disease 98:574-574

Field of Study

Major Field: Plant Pathology

Table of Contents Abstract ...... ii Dedication ...... vi Acknowledgements ...... vii Vita ...... viii List of Tables ...... xi List of Figures ...... xiv Chapter 1: Introduction ...... 1 Introduction ...... 1 References ...... 14 Chapter 2: Morphological and genetic diversity within Sclerotinia sclerotiorum in Bangladesh 25 Introduction ...... 26 Materials and Methods ...... 29 Results ...... 33 Discussion ...... 35 Acknowledgements ...... 38 References ...... 38 Chapter 3: Sensitivity of Sclerotinia sclerotiorum isolates from Bangladesh to selected fungicides ...... 60 Introduction ...... 61 Materials and Methods ...... 63 Results ...... 66 Discussion ...... 68 Acknowledgements ...... 70 References ...... 70 Chapter 4: Resistance of oilseed mustard varieties/lines to Sclerotinia sclerotiorum ...... 95 Introduction ...... 96 Materials and Methods ...... 98 Results ...... 102 Discussion ...... 104 References ...... 105 Chapter 5: Integrated management of white mold of mustard ...... 121 Introduction ...... 121 Materials and Methods ...... 125 Results ...... 127 Discussion ...... 128 References ...... 129 Bibliography ...... 135

List of Tables

Table 2. 1. Origin, population designation and host of Sclerotinia sclerotiorum isolates collected in 2014 from Bangladesh and Ohio, USA and used in SSR marker analysis ...... 43

Table 2. 2Primers used in simple sequence repeat (SSR) analysis of Sclerotinia sclerotiorum isolates from Bangladesh and Ohio, USA ...... 46

Table 2. 3. Morphological characteristics (mycelial colony diameter, number of sclerotia and weight of sclerotia) of 130 isolates of Sclerotinia sclerotiorum, grouped by location of origin .. 47

Table 2. 4. Genetic diversity of Sclerotinia sclerotiorum isolates from mustard from ten locations in Bangladesh and from soybean, cabbage and pepper in Ohio, USA...... 48

Table 2. 5. Analysis of molecular variance (AMOVA) among 118 Sclerotinia sclerotiorum isolates from ten locations in Bangladesh and one in Ohio, USA based on eight simple sequence repeat (SSR) markers ...... 49

Table 2. 6. Mycelial compatibility grouping of 80 Sclerotinia sclerotiorum isolates from 11 locations (Populations 1 - 11). Mycelial compatibility groups (MCGs) were identified by visual observation of all possible interactions among 80 isolates...... 50

Table 2. 7. Relationship between mycelial compatibility group (MCG) and haplotype at eight microsatellite loci for isolates of Sclerotinia sclerotiorum collected from ten locations in Bangladesh and one in Ohio, USA ...... 51

Table 2. 1. Origin, population designation and host of Sclerotinia sclerotiorum isolates collected in 2014 from Bangladesh and Ohio, USA and used in SSR marker analysis ...... 43

Table 2. 2Primers used in simple sequence repeat (SSR) analysis of Sclerotinia sclerotiorum isolates from Bangladesh and Ohio, USA ...... 46

Table 2. 3. Morphological characteristics (mycelial colony diameter, number of sclerotia and weight of sclerotia) of 130 isolates of Sclerotinia sclerotiorum, grouped by location of origin .. 47

Table 2. 4. Genetic diversity of Sclerotinia sclerotiorum isolates from mustard from ten locations in Bangladesh and from soybean, cabbage and pepper in Ohio, USA...... 48

Table 3. 1. Levene’s test for equal variance for EC50 values in two experiments (1 and 2) with four fungicides. The number of isolates was equal in the two experiments...... 75

Table 3. 2. Mean EC50 values and relative toxicity index (RTI) for iprodione, propiconazole, fluazinam and penthiopyrad against Sclerotinia sclerotiorum...... 76

Table 3. 3. Analysis of variance for iprodione EC50 values for 124 isolates of Sclerotinia sclerotiorum...... 77

Table 3. 4. Analysis of variance for propiconazole EC50 values for 124 isolates of Sclerotinia sclerotiorum...... 78

Table 3. 5. Analysis of variance for fluazinam EC50 values for 51 isolates of Sclerotinia sclerotiorum...... 79

Table 3. 6. Analysis of variance for penthiopyrad EC50 values for 51 isolates of Sclerotinia sclerotiorum...... 80

Table 3. 7Mean EC50 values and relative toxicity index (RTI) of fluazinam, penthiopyrad, propiconazole and iprodione for Sclerotinia sclerotiorum isolates collected from 11 locations of Bangladesh and Ohio, USA...... 81

Table 4. 1. Sclerotinia sclerotiorum isolates used in virulence evaluation on oilseed mustard. Isolates were collected from oilseed mustard from ten locations in Bangladesh and from pepper in Ohio, USA ...... 109

Table 4. 2. Rapeseed-mustard (Brassica spp.) varieties and breeding line screened for resistance to Sclerotinia sclerotiorum. All rapeseed-mustard varieties and the breeding line (SS-75) were obtained from the Oilseed Research Center, Bangladesh Agricultural Research Institute, Gazipur, Bangladesh...... 110

Table 4. 3. Lesion length and width on leaves of mustard variety BARI Sharisha 16 after inoculation with Sclerotinia sclerotiorum isolates. Detached leaves were inoculated with a 3-day- old, 6 mm diameter mycelial plug...... 111

Table 4. 4. Response of 14 BARI-released oilseed mustard varieties and one breeding line to Sclerotinia sclerotiorum. Cotyledons were inoculated with a suspension of hyphal fragments (104 fragments/ml)...... 112

xii

Table 4. 5. Area under the disease progress curves (AUDPC) for 14 BARI-released mustard varieties and one breeding line inoculated with Sclerotinia sclerotiorum isolate SCS1 using the petiole inoculation method...... 113

Table 5. 1. Development of white mold disease of oilseed mustard cv. BARI Sharisa 14 in Burirhut, Rangpur, Bangladesh, 2016. Trichoderma harzianum isolate BHT-N1 (Th BHT-N1) and five different fungicides were applied separately and in combination...... 133

Table 5. 2. Effect of fungicides alone and in combination with Trichoderma harzianum BHT-N1 on Alternaria blight of mustard cv. BARI Sharisa 14 in Jamalpur, Bangladesh, 2016...... 134

xiii

List of Figures

Figure 2. 1. Three districts in Bangladesh from which Sclerotinia sclerotiorum isolates were collected from mustard plants in 2014...... 54

Figure 2. 2. Culture and sclerotial morphology of Sclerotinia sclerotiorum isolates. The image was taken after 7 days of culture...... 55

Figure 2. 3. Frequency of haplotypes within 11 populations of Sclerotinia sclerotiorum isolates from ten locations in Bangladesh (Populations 1-10) and one from Ohio, USA (Population 11)...... 56

Figure 2. 4. Principle component analysis (PCA) of genetic diversity of Sclerotinia sclerotiorum populations from mustard plants in Bangladesh (Pop1 – Pop10) and cabbage, pepper and soybean plants in Ohio, USA (Pop 11). PCA was calculated based on Eigen values of first two principle components. Among the isolates from Bangladesh, populations 1, 3, 4, 5 and 6 were from Tangail, population 2 was from Jamalpur, and populations 7, 8, 9 and 10 were from Shirajgonj...... 57

Figure 2. 5. Mycelial compatibility grouping among isolates of Sclerotinia sclerotiorum after 10 days of culture. (A) Compatible reaction; (B) incompatible reaction with superficial mycelial growth at the interaction zone; (C) incompatible reaction with a dark brown line at the interaction zone; and (D) incompatible reaction with a light brown line at the interaction zone. 58

Figure 2. 6. Frequency of mycelial compatibility groups (MCGs) of Sclerotinia sclerotiorum isolates from ten locations in Bangladesh (Populations 1-10) and one in Ohio, USA (Population 11)...... 59

Figure 3. 1. Frequency distribution of iprodione EC50 values for 124 isolates of Sclerotinia sclerotiorum collected from 11 locations in Bangladesh and Ohio, USA. Individual EC50 values were grouped in class intervals of 0.05 ppm (Experiment 1)...... 83

Figure 3. 2Frequency distribution of iprodione EC50 values for 124 isolates of Sclerotinia sclerotiorum collected from 11 locations in Bangladesh and Ohio, USA. Individual EC50 values were grouped in class intervals of 0.03 ppm (Experiment 2)...... 84

Figure 3. 3. Mycelial growth of Sclerotinia sclerotiorum isolate SST15 from Bangladesh on potato dextrose agar medium amended with different concentrations of iprodione: 0 (control), 0.0001, 0.001, 0.01, 0.1, 0.3, 1.0, and 10.0 ppm (Experiment 1)...... 85

Figure 3. 4. Frequency distribution of propiconazole EC50 values for 124 isolates of Sclerotinia sclerotiorum collected from 11 locations in Bangladesh and Ohio, USA. Individual EC50 values were grouped in class intervals of 0.09 ppm (Experiment 1)...... 86

xiv

Figure 3. 5. Frequency distribution of propiconazole EC50 values for 124 isolates of Sclerotinia sclerotiorum collected from 11 locations in Bangladesh and Ohio, USA. Individual EC50 values were grouped in class intervals of 0.13 ppm (Experiment 2)...... 87

Figure 3. 6. Mycelial growth of Sclerotinia sclerotiorum isolate SDT28 from Bangladesh on potato dextrose agar medium amended with different concentrations of iprodione: 0 (control), 0.001, 0.01, 0.1, 0.1, 0.3, 1.0, 10.0 and 100.0 ppm (Experiment 1)...... 88

Figure 3. 7. Frequency distribution of fluazinam EC50 values for 51 isolates of Sclerotinia sclerotiorum collected from 11 locations in Bangladesh and Ohio, USA. Individual EC50 values were grouped in class intervals of 0.0004 ppm (Experiment 1)...... 89

Figure 3. 8. Frequency distribution of fluazinam EC50 values for 51 isolates of Sclerotinia sclerotiorum collected from 11 locations in Bangladesh and Ohio, USA. Individual EC50 values were grouped in class intervals of 0.0004 ppm (Experiment 2)...... 90

Figure 3. 9. Mycelial growth of Sclerotinia sclerotiorum isolate SAS1 from Bangladesh on potato dextrose agar medium amended with different concentrations of fluazinam: 0 (control), 0.0001, 0.001, 0.003, 0.01, and 0.1 ppm (Experiment 2)...... 91

Figure 3. 10. Frequency distribution of penthiopyrad EC50 values for 51 isolates of Sclerotinia sclerotiorum collected from 11 locations in Bangladesh and Ohio, USA. Individual EC50 values were grouped in class intervals of 0.07 ppm (Experiment 1)...... 92

Figure 3. 11. Frequency distribution of penthiopyrad EC50 values for 51 isolates of Sclerotinia sclerotiorum collected from 11 locations in Bangladesh and Ohio, USA. Individual EC50 values were grouped in class intervals of 0.13 ppm (Experiment 2)...... 93

Figure 3. 12. Mycelial growth of Sclerotinia sclerotiorum isolate SDS2 from Bangladesh on potato dextrose agar medium amended with different concentrations of penthiopyrad: 0 (control), 0.001, 0.01, 0.03, 0.1, 1.0 and 3.0 ppm (Experiment 2)...... 94

Figure 4. 1. Inoculation of rapeseed-mustard ‘BARI Sharisa 16’ leaves with isolates of Sclerotinia sclerotiorum in a detached leaf assay (A) Leaf lesions caused by isolates of S. sclerotiorum. (B) Leaf lesion caused by S. sclerotiorum isolate SCS1. (C) Control leaf inoculated with plug of PDA medium alone...... 114

Figure 4. 2. Screening of rapeseed-mustard varieties against Sclerotinia sclerotiorum isolate SCS1 by cotyledon inoculation. (A) Seedlings grown in potting mix. (B) Inoculation of cotyledons with a hyphal suspension (104 hyphal fragments/ml water) of S. sclerotiorum. (C) Water soaked and necrotic lesions on cotyledons 48 hr after inoculation...... 115

Figure 4. 3. Screening of 14 BARI released rapeseed-mustard varieties/line for resistance to Sclerotinia sclerotiorum isolate SCS1 by petiole inoculation (A) Plants grown in sterilized soil in plastic cones. (B) Response 8 days after inoculation...... 116

Figure 4. 4. Disease progress curves for 14 rapeseed-mustard varieties inoculated with Sclerotinia sclerotiorum isolate SCS1 by petiole inoculation in Experiment 1. Disease progress curves were developed based on disease severity, using a 0 -4 scale where 0 = no symptoms; 1 = small lesion at junction of petiole and stem, no water soaking and no wilt; 2 = small water soaked lesion and no wilt; 3 = expanded, sunken water soaked lesion and no wilt; 4 = expanded, sunken, water-soaked lesion resulting in irreversible wilt...... 117

Figure 4. 5. Disease progress curves for 14 rapeseed-mustard varieties inoculated with Sclerotinia sclerotiorum isolate SCS1 by petiole inoculation in Experiment 2. Disease progress curves were developed based on disease severity, using a 0 -4 scale where 0 = no symptoms; 1 = small lesion at junction of petiole and stem, no water soaking and no wilt; 2 = small water soaked lesion and no wilt; 3 = expanded, sunken water soaked lesion and no wilt; 4 = expanded, sunken, water-soaked lesion resulting in irreversible wilt...... 118

Figure 4. 6. Boxplot of the area under the disease progress curves (AUDPC) for for 13 rapeseed- mustard varieties and one breeding line inoculated with Sclerotinia sclerotiorum isolate SCS1 by petiole inoculation (Experiment 1). AUDPC was calculated based on disease severity, using a 0 -4 scale where 0 = no symptoms; 1 = small lesion at junction of petiole and stem, no water soaking and no wilt; 2 = small water soaked lesion and no wilt; 3 = expanded, sunken water soaked lesion and no wilt; 4 = expanded, sunken, water-soaked lesion resulting in irreversible wilt...... 119

Figure 4. 7. Boxplot of the area under the disease progress curves (AUDPC) for 13 rapeseed- mustard varieties and one breeding line inoculated with Sclerotinia sclerotiorum isolate SCS1 by petiole inoculation (Experiment 2). AUDPC was calculated based on disease severity, using a 0 -4 scale where 0 = no symptoms; 1 = small lesion at junction of petiole and stem, no water soaking and no wilt; 2 = small water soaked lesion and no wilt; 3 = expanded, sunken water soaked lesion and no wilt; 4 = expanded, sunken, water-soaked lesion resulting in irreversible wilt...... 120

xvi

Chapter 1

Introduction

Taxonomic history of Sclerotinia sclerotiorum. Sclerotinia sclerotiorum (Lib.) de Bary, a plant pathogenic fungus in the family Sclerotiniaceae, order Helotiales and phylum Ascomycota, has a long taxonomic history. Fungi in the family Sclerotiniaceae produce asci from brownish apothecia that arise from sclerotial stroma (Holst-Jensen et al. 1997; Whetzel 1945). Sclerotinia sclerotiorum was first described in 1837 as Peziza sclerotiorum (Libert 1837). Later its binomial nomenclature was changed to Sclerotinia libertania Fuckel in honor of Libert (Fuckel 1870;

Purdy 1979). Wakefield (1924) showed that this nomenclature conflicted with principles of the

International Code of Botanical Nomenclature, one of which was that species transferred from one genus to another must retain the original species name unless it is in use. At that time

Sclerotinia sclerotiorum was not in use. Wakefield also reported incorrectly that the combination

S. sclerotiorum was first used by G. E. Massee in 1895 and cited it as S. sclerotiorum (Lib.)

Massee. However, Purdy (1979) reported that de Bary used the name S. sclerotiorum in 1884 and, therefore, the correct name and authority of the fungus should be Sclerotinia sclerotiorum

(Lib.) de Bary.

Symptoms of disease caused by Sclerotinia. Sclerotinia sclerotiorum is a necrotrophic pathogen with a wide host range, causing symptoms that vary from host to host. In general, at the initial stage, water soaked lesions developed on leaves, expand rapidly downward and enter into 1 the stem through the petiole. When they enter into the stem, water soaked lesions develop at the junction of the stem and petiole. These lesions gradually become necrotic and produce masses of white mycelium. This sign of white mycelium is one of the most important characteristics of S. sclerotiorum infection. As the infection progresses, it damages the vascular tissue and finally the plant wilts. Large, often irregularly-shaped black sclerotia, which are melanized resting structures, are produced inside and outside stems, fruit and other tissues (Bolton 2006).

Sclerotinia sclerotiorum disease cycle on canola. Sclerotinia sclerotiorum can produce a large number of sclerotia that are resistant to environmental and/or biological degradation, and can therefore survive for long time in soil and other substrates. For this reason, sclerotia have a significant role in the disease cycle. Sclerotia can germinate either carpogenically or myceliogenically depending on environmental conditions (Bolton 2006). When sclerotia germinate myceliogenically, they produce hyphae and can attack host tissue directly at ground level tissue (Bardin and Huang 2001; Le Tourneau 1979). Apothecia and ascospores are formed from sclerotia by sexual reproduction and ascospores can travel long distances through air.

Sclerotinia sclerotiorum is homothallic and genetic recombination is rare (Aldrich-Wolfe et al.

2015). Hyphae are hyaline, septate, branched and multinucleate. Though they do not produce asexual conidia, microconidia were reportedly produced on hyphae or apothecial hymenia (Kohn

1979), but their role is still unknown (Bolton 2006).

Sclerotia germinate under favorable environmental conditions. Temperature has a major role in sclerotial germination. They cannot germinate below 10°C but can germinate partially at

15°C (Jones and Gray 1973). Apothecia are formed after conditioning of sclerotia, which depends on soil temperature (Huang and Kozub 1989) and moisture (Morrall 1977). The origin

2 of S. sclerotiorum affects germination of sclerotia (Huang and Kozub 1991). Sclerotia originating from cool (10°C) climate regions germinate more rapidly than isolates originating from higher temperature (25-30° C) areas. Isolates from tropical regions may not require a cool period to prepare for apothecia formation. Water potential of 100 kPa for 1-2 weeks at a temperature of 10-25° C is essential for apothecia formation (Clarkson et al. 2004).

Dense plant canopies maintain high humidity within the plant microclimate, which promotes apothecia formation. One or more apothecia may form from a single sclerotium. Small thin strips are formed from sclerotia and hymenial layer develop on the strip. The hymenial layer contains rows of asci, each of which contains a cylindrical sac. Each sac contains hyaline, ellipsoid bi-nucleate ascospores (6 × 9-14µm) (Kohn 1979). Ascospores can discharge at a rate of 1600 spores/h for 10 days in favorable conditions (Clarkson et al. 2003). Ascospores are coated with a sticky mucilage that helps in adhesion to host tissue. Ascospores can survive up to

2 weeks under suitable environmental conditions (low relative humidity and low ultraviolet light)

(Clarkson et al. 2003).

Ascospores that have landed on host tissue need an exogenous nutrient source and a film of water for germination. Flowering of Brassica spp. is considered an important host factor in disease epidemiology. When senescing infected flowers fall on leaves or stems, they provide nutrients to ascospores for germination (Inglis and Boland 1990; Tukington and Morrall 1993).

After host colonization, the mycelia form sclerotia if there is shortage of nutrients and sclerotia remain inside stems or drop to the soil for overwintering.

Population Biology. Sclerotinia sclerotiorum exhinits a clonal mode of reproduction (Cubeta

1997; Kohli and Kohn 1998; Kohli et al. 1995) with some evidence of outcrossing (Atallah et al.

2004; Kohli and Kohn 1998; Sexton and Howlett 2004). Studies have shown that S. sclerotiorum isolates from Australia and from some temperate regions have both clonal and outcrossing reproduction (Atallah et al. 2004, Sexton and Howlett 2004), whereas isolates from Canadian oilseed rape did not show any sexual recombination and a small number of clones were isolated from across 2000 km over 4 years (Anderson and Kohn 1995; Kohli et al. 1992). S. sclerotiorum has a haploid somatic phase. Clonality is maintained by asexual reproduction through sclerotia formation or by sexual reproduction through self-fertilization (Kohn 1995). However, there are some exceptions in which intra-clonal variation was observed due to mutation (Carbone and

Kohn 2001; Carnone et al. 1999).

Molecular and biochemical aspects of pathogenicity. As a necrotrophic pathogen, S. sclerotiorum produces a number of hydrolytic enzymes and metabolites that can act as toxins

(Kars and van kan 2004; Thomma 2003; Toth et al. 2003). Cell wall-degrading enzymes

(CWDE) and oxalic acid have significant effects on pathogenesis of S. sclerotiorum. S. sclerotiorum secretes pectinases (Alghisi and Favaron 1995) to degrade pectin, an important component of plant cell walls and middle lamellae. Pectin hydrolysis weakens the cell wall to facilitate penetration and colonization by hyphae. Moreover, fungi use pectin as a carbon source for growth and development.

Oxalic acid has been recovered from diseased plant tissue (Ferrar and Walker 1993;

Godoy et al. 1990), and the amount of oxalic acid is strongly correlated with disease severity

(Bateman and Beer 1965; Magro et al. 1984). S. sclerotiorum secretes oxalic acid and thereby develops water soaked lesions before fungal hyphae invade the cell (Lumsden and Dow 1973; Tu

1985).

Importance of S. sclerotiorum. Sclerotinia sclerotiorum is cosmopolitan necrotrophic plant pathogen. More than 50 different names have been used to refer to diseases caused by S. sclerotiorum (Purdy 1979) such as cottony rot, watery rot, watery soft rot, stem rot, crown rot, blossom blight and the commonly used name white mold. The fungus infects more than 400 species of plants (Boland and Hall 1994). It poses a threat to dicot crops such as sunflower, soybean, oilseeds, chickpea, peanut, lentil and vegetables as well as monocots like onion and tulip (Boland and Hall 1994). Annual losses from S. sclerotiorum in the United States, for example, have exceeded $200 million. In 1999, a Sclerotinia head rot epidemic on sunflowers in the United States resulted in crop losses estimated at $100 million (Anon. 2005).

The pathogen can survive in different types of climatic conditions from tropical to temperate. In 2006, white mold was first observed in the northern part of Bangladesh in an oilseed mustard (Brassica spp.) field (Hossain et al. 2008). Mustard is an important oilseed crop in Bangladesh. According to the Bangladesh Bureau of Statistics, about 0.29 million hectare land were under mustard cultivation during 2013-2014, producing about 0.29 million tonnes yield

(BBS 2015). It is also a cash crop, supplying a major part of edible oil for human consumption as well as byproducts used as a source of fodder. At present, white mold disease has become the most important problem for the production of mustard in Bangladesh (Kamal et al. 2015). Due to extensive import of seeds from different Sclerotinia-infested regions and rapid climate change, the pathogen has emerged from a rare occurrence to become a pathogen of consequence in

Bangladesh, causing significant losses in oilseed mustard and other crops.

Diversity of S. sclerotiorum. Since S. sclerotiorum was not present or was present at low levels previously in Bangladesh, there is very little information regarding the isolates of S. sclerotiorum

5 causing disease in the region. Due to its wide host range, global distribution and chance of recombination and mutation, it is essential to study pathogen variability to develop effective management strategies and new resistant crop varieties. Different molecular tools such as amplified fragment length polymorphism (Cubeta et al. 1997), random amplified fragment length polymorphism (Yli-Mattila et al. 2010), micro satellite marker (Meinhardt et al. 2002) and sequence based polymorphism (Li et al. 2009) analyses have been used to explore the genetic diversity of S. sclerotiorum. Further, mycelial compatibility grouping (MCG) is another important technique that has been used as an indirect method for assessment of genetic variability of fungal isolates (Leslie 1993). Mycelial compatibility is an important marker to identify field populations and facilitates exchange of genetic materials of fungi, esspecially those that have limited impacts of sexual reproduction on the disease cycle (Kohn et al. 1991; Leslie

1993). Isolates of a MCG restrict exchange of cytoplasm, genetic materials and extra- chromosomal elements from the isolates of other MCGs (Caten 1972). Incompatible isolates form separate and distinct gene pools, which may different in ecological, physiological and pathological traits.

Sensitivity of S. sclerotiorum to fungicides. White mold disease of mustard is difficult to control and there are no known highly resistant mustard varieties available to farmers in

Bangladesh. Application of fungicides is the major means of management of white mold of mustard (Wang et al. 2014). The fungicide carbendazim, a benzimidazole, was one of the most common fungicides used against white mold of Brassica oilseed crops during 1980s and 1990s in different areas of the world. As a result, high levels of resistance to carbendazim have been reported in those areas since late 1990 (Pan 1998; Shi et al. 1999; Zhang et al. 2003; Qi et al.

2006; Kuang et al. 2011). Iprodione and procymidone have also been used to control of S. sclerotiorum in the last few decades. However, a low level of resistance to these fungicides has been reported in many countries (Ma et al. 2009; Zhou et al. 2014a, b).

Fluazinam is a dinitroaniline fungicide (FRAC code 29) used as a preventive contact fungicide. Fluazinam interrupts mitochondrial oxidative phosphorylation and thus stops synthesis of ATP (adenosine triphosphate, which is essential for cellular energy) without affecting the respiratory chain and ATP synthase (Vitoratos 2014). Fluazinam is a highly effective fungicide with broad-spectrum activity, but has little curative or systemic activity. However, it has good persistence and rain fastness on plants. As it is a protectant fungicide, it must be applied prior to disease onset for best results (Butzler et al. 1998). Efficacy of fluazinam has been reported against Sclerotinia blight in peanut caused by S. minor, lettuce drop caused by S. sclerotiorum or

S. minor, and potato late blight caused by Phytophthora infestans (Anema and Bouwman 1992;

Lemay et al. 2002; Matheron and Porchas 2004; Smith et al. 2008).

Penthiopyrad (FRAC code 07) is a recently developed fungicide in the carboxamide group. Fungicides in this group function as succinate dehydrogenase inhibitors (SDHI), limiting fungal growth by interfering with energy production in the mitochondrial electron transport system (Yanase et al. 2007). Penthiopyrad was registered in the USA to control many pathogens including S. sclerotiorum in 2012 (Grichar and Woodward 2016).

Dicaroximide fungicides (FRAC code 02) were developed beytween 1960s and 1970s and used against different fungi of ascomycetes including Botrytis spp., Sclerotinia spp,

Bipolaris spp. etc. (Tanaka and Izumitsu 2010). Though they are widely used fungicides, their mode of action and resistance mechanism is not clearly understood. Pappas and Fisher (1979) from a biochemical study reported that dicarboximides had little influence on respiration, or

7 biosynthesis sterol, nuclic acids, sterol, protein or chitin. But its application accelerates swelling hyphae and burst the hyphae tips (Eichhorn and Lorenz 1978). Yoshida and Yukimoto (1993) reported that dicarboximide fungicides interfere with fungal membranes but thet had no effect on ion leakage or water permeability. As an effective fungicide and used by developed countries for long time, dicarboximide fungicides iprodione and dimethachlon have been used in Asian countries including Bangladesh to control many foliar diseases including white mold disease of mustard. Though these fungicides and new in Bangladesh, resistance of this fungicides reported from many contrived who are using for long time (Tanaka and Izumitsu 2010).

The sterol demethylation-inhibiting (DMI) fungicide propiconazole (FRAC code 03) has been used to control dollar spot caused by S. homoeocarpa in the United States since 1979

(Golembiewski et al. 1995). This fungicide provides a broad spectrum of activities. DMI fungicides can be used at low concentration and long application intervals as they are systemic in nature (Ktiller and Scheinpflug 1987). This class of fungicide restricts ergosterol biosynthesis by demethylation of C-14 methyl sterols. Ergosterol is essential for formation of cell membrane of fungi. Propiconazole is one of the important DMI fungicides shown to be effective against S. sclerotiorum in laboratory evaluations (Dalili et al. 2015; Li et al. 2015). Propiconazole was very effective against fungi like Monilinia fruticola and Sclerotinia homoeocarpa in USA for up to 15 years after its introduction (Schnabel and Brysin 2004; Golembiewski et al. 1995). However, during 2001 and 2003 in peach orchards in South Carolina, a serious epidemic of brown rot of peach was recorded. It was assumed that the outbreak was due to reduced sensitivity in M. fruticola to propiconazole (Schnabel et al. 2004).

Resistance of mustard varieties to S. sclerotiorum. The Brassicaceae family contains a large number of crops including oilseed rape (Brassica napus and B. rapa, B. campestris) (Salisbury and Barbetti 2011), oilseed mustard including Indian mustard (B. juncia), Ethiopian mustard, and brown mustard (B. nigra) (Chauhan et al. 2006; Salisbury and Barbetti 2011). Oilseed mustard is also an important oil crop in Bangladesh. There are many biotic and abiotic factors that reduce mustard yield. About 14 diseases have been recorded in mustard in Bangladesh (Ahmed 1986).

White mold disease is a major problem for mustard (Brassica napus) production worldwide. In

China, yield losses ranging from 10 to 80% have been recorded. In Australia an average yield loss of 24% has been observed (Oilcrop Research Institute, Chinese Academy of Science 1975; www.australianoilseed.com). But actual yield loss of mustard by white mold disease has not been investigated yet in Bangladesh, although it is considered a main threat for mustard production.

Currently some cultural practices and chemical pesticides are in use in mustard growing regions to control white mold. But extensive use of pesticides is not environmentally safe and economically viable (Del Rio et al. 2007). Selection and development of resistant mustard variety is essential for management of white mold disease (Mei et al. 2012). Earlier, it was difficult to develop a resistant mustard variety against S. sclerotiorum due to lack of its host septicity, however recent works on mustard host resistance successfully located resistant genes against S. sclerotiorum at stem rot stage (Li et al. 2006, 2007, 2009b; Garg 2010). In oilseed rape, partial resistance loci and genes were identified (Zhang et al. 2011a; Zhao et al. 2006).

Field tests of S. sclerotiorum resistance in B. napus have been conducted, but no source of complete resistance was identified (Zhou et al. 1994). However, Sun (1995) reported a number of resistant and susceptible spring type canola accessions using inoculation techniques.

Screening techniques are important to identify resistant host species. As S. sclerotiorum has a wide host range, it is difficult to get a complete host resistance. Moreover, specificity of S. sclerotiorum strains to different hosts has not been precisely investigated (Saharan and Mehta

2008). Therefore, screening for partial resistance is important for any breeding program (Garg et al. 2010b; Li et al. 2006). There are many screening methods; stem inoculation at mature stage with sterile tooth-picks (Zhao et al. 2003), detached leaf inoculation at seedling stage (Zhao et al.

2003), cut stem inoculation (Mei et al. 2011), stem inoculation with mycelial plug at 50% flowering stage (Buchwaldt et al. 2005), cotyledon inoculation with mycelial suspension (Garg et al. 2008), petiole inoculation with mycelial plug (Zhao et al. 2004) are used in the cruciferous S. sclerotiorum pathosystem to screen mustard lines/varieties.

Integrated management of S. sclerotiorum in mustard. Rapeseed-mustard (Brassica spp.) is an important oilseed crop in Bangladesh. It belongs to the genus Brassica in the family

Cruciferae. There are three species in Brassica (B. napus, B. campestris and B. juncia) that contribute to oilseed production. However, in the Indian subcontinent and Bangladesh most of the varieties originated from B. campestris and B. napus. The average yield content in rapeseed- mustard is about 40-45% oil and 20-25% protein.

Rapeseed-mustard is the second edible oil after soybean in Bangladesh. But considering the areas and production, it is the number one among the oilseed crops (soybean, sunflower, sesame etc.). In 2014-2015 the total area under mustard cultivation was 0.32 million hectares and production was 0.35 million tons (BBS 2015). The area under oilseed cultivation is decreasing in

Bangladesh; however, the area under rapeseed-mustard cultivation is increasing day by day

(Miah et al. 2014). The increasing trend of rapeseed-mustard production is due to local demand

10 and the government’s support for increasing production. There is little scope of expansion of land for rapeseed-mustard and other oilseed production in Bangladesh. Therefore it is necessary to increase production by adoption of good management practices. Among the constraints to mustard production, diseases and pests are the major problem. A number of diseases affect mustard in the field. The most important are Alternaria blight (Alternaria brassicae), powdery mildew (Erysiphe cruciferarum) and white mold or Sclerotinia rot (Sclerotinia sclerotiorum).

Sclerotinia sclerotiorum is the most devastating disease of rapeseed-mustard in Bangladesh.

Sclerotinia is present in all rapeseed and mustard growing regions and is considered economically damaging (Kharbanda and Tewari 1996). The symptoms caused by S. sclerotiorum are the formation of bleached lesions on main stem, branches and pods. At a later stage the plants wilt and hard, black sclerotia are observed in the stem (Khangura and Beard 2015). It survives in soil with its resting structure sclerotia for several years (Coley-Smith and Cooks 1971), which makes it difficult to control. To control S. sclerotiorum, either ascospores or sclerotia have to be targeted with different management strategies.

Currently cultural practices and application of fungicides are the only methods used to control S. sclerotiorum in rapeseed-mustard (Bardin and Huang 2001; Murray and Brennan

2012). Fungicides of different classes are effective against S. sclerotiorum including anilinopyrimidines (Benigni and Bompeix 2010), benzimidazoles (Attanayake et al. 2011), dicarboxamide (Matheron and Matejka 1989), demethylation inhibitors (DMIs) (Li et al. 2015), quinone outside inhibitors (QoIs, known as strobilurins) (Muller et al. 2002, Xu et al. 2014) and succinate dehydrogenase inhibitors (SDHIs) (Stammler et al. 2007). Different fungicides such as azoxystrobin, boscalid, thiophanate-methyl, iprodione, propiconazole and vinclozolin are moderately effective by restricting germination of ascospores (Bradley et al. 2006). Ascospores

11 are released for up to two weeks; as a result multiple application of foliar fungicides are necessary to control the disease (Bradley et al. 2006; Mueller et al. 2002). The pathogen can be controlled indirectly by reducing the number of sclerotia in soil or by destroying sclerotia because apothecia and ascospores are produced from sclerotia.

There are several disease management strategies that can reduce or destroy the primary source of inoculum (sclerotia). Crop rotation with non-host crops restricts accumulation of screrotia in soil. However, one to two years of rotation is not effective as sclerotia can survive up to eight years (Coley-Smith and Cooks 1971). Soil fumigation is another method, but is generally considered damaging to the environment (Budge and Whipps 1991).

Different fungal and bacterial biocontrol agents (BCA) have been used to suppress S. sclerotiorum in cropping systems such as lettuce (Budge and Whipps 1991; Chitrampalam et al.

2008), soybean (del Rio et al. 2002), and dry bean (Huang et al. 2000). A number of BCA, including Coniothyrium minitans (Contans WG), Streptomyces lydicus (Actinovate AG),

Trichoderma harzianam T-22 (PlantShield HC), and Bacillus subtilis (Serenade MAX) were applied in soil to control Sclerotinia stem rot of soybean and among them C. minitans was very effective (Zeng et al. 2012).

Integration of different management strategies enhances the activity of BCAs (Budge and

Whipps 2001). Integrated use of BCAs with fungicides in foliar (Budge and Whipps 1991; Elad

1994; Elad et al. 1993; Harman et al. 1996; Sundheim and Amundsen 1982), soil and seed

(Adams and Wong 1991; Conway et al. 1997; Cubeta and Echandi 1991; Inuto et al. 1995) and postharvest (Chand-Goyal and Spotts 1996; Dorby et al. 1998; Suger and Spotts 1999) disease management have been used. In most of the studies, combined application of biocontrol agents and fungicides were more effective in controlling pathogens than individual components. Some

12 studies showed that integration of BCAs helps to reduce the application of fungicides either by combination of lower dose application simultaneously with application of biocontrol agents

(Chand-Goyal and Spotts 1996; Conway et al. 1997; Droby et al. 1998) or by using alternative treatments of biocontrol agents and fungicides (Elad et al. 1993; Harman et al. 1996; Sundheim and Amundsen 1983). This approach helps insure a durable and environmentally friendly disease control strategy.

To address the present status of the disease, improve available management strategies and develop guidelines for future research on white mold disease of mustard in Bangladesh, a series of experiments were conducted with the following objectives:

i) to determine the morphological and genetic variability of S. sclerotiorum

isolates from Bangladesh and compare these features to isolates from Ohio;

ii) to determine the baseline sensitivity of S. sclerotiorum populations from

Bangladesh to fungicides (fluazinam and penthiopyrad) not yet introduced in

Bangladesh, and to determine the level of resistance among Bangadesh S.

sclerotiorum isolates to commonly used fungicides iprodione and

propiconazole;

iii) to evaluate the degree of resistance of Bangladesh Agricultural Research

Institute (BARI)- released rapeseed mustard varieties and lines to S.

sclerotiorum; and

iv) to develop tactics that may be used in an integrated system for the management

of white mold of mustard in Bangladesh.

References

Abreu, M. J., and Souza, E. A. 2015. Investigation of Sclerotinia sclerotiorum strains variability in Brazil. Genetics and Molecular Research 14:6879-6896.

Adams, P. B., and Wong, J. L. 1991. The effect of chemical pesticides on the infection of sclerotia of Sclerotinia minor by the biocontrol agent Sporidesmium sclerotivorum. Phytopathology 81:1340-1343.

Ahmadi, M. R., Javan-Nik- Khan, M., Aghajani, M., and Ghobakhloo, M. 2012. Morphological variability among Sclerotinia sclerotiorum populations associated with stem rot of important crops and weeds. World Applied Sciences Journal 20:1561-1564.

Ahmed, A. U. 1986. Recommendation on the methods of disease management of crops in Bangladesh. Plant Pathology Division, Bangladesh Agricultural Research Institute pp.11-13.

Aldrich-Wolfe, L., Travers, S., and Nelson Jr, B. D. 2015. Genetic variation of Sclerotinia sclerotiorum from multiple crops in the north central United States. PloS one 10:e0139188.

Alghisi, P., and Favaron, F. 1995. Pectin-degrading enzymes and plant-parasite interactions. European Journal of Plant Pathology 101:365-375.

Anderson, J. B., and Kohn, L. M. 1995. Clonality in soilborne, plant-pathogenic fungi. Annual Review of Phytopathology 33:369-391.

Anema, P. E., and Bouwman, J. J. 1992. Fluazinam a novel fungicide for use against Phytophthora infestans in potatoes. In: Proceedings/Brighton Crop Protection Conference, Pests and Diseases. pp. 663–668.

Anonymous 2005. Sclerotinia initiative brochure, Fargo, ND: United States Department of Agriculture, www.whitemoldresearch.com

Atallah, Z. K., Larget, B., Chen, X., and Johnson, D. A. 2004. High genetic diversity, phenotypic uniformity, and evidence of outcrossing in Sclerotinia sclerotiorum in the Columbia Basin of Washington State. Phytopathology 94:737-742.

Attanayake, R. N., del Río-Mendoza, L., Chen, W., and Jiang, D. 2011. Genetic diversity and population differentiation of Sclerotinia sclerotiorum collected from canola in China and in USA. Phytopathology101:S10-1.

Bardin, S. D., and Huang, H. C. 2001. Research on biology and control of Sclerotinia diseases in Canada. Canadian Journal of Plant Pathology 23:88-98.

Bateman, D. F. 1964. An induced mechanism of tissue resistance to polygalacturonase in Rhizoctonia-infected hypocotyls of bean. Phytopathology 54:438-445. 14

Bangladesh Bureau of Statistics. 2015. Statistical Year Book of Bangladesh, Dhaka. Bangladesh Bureau of Statistics p40.

Benigni, M., and Bompeix, G. 2010. Chemical and biological control of Sclerotinia sclerotiorum in wilt of chicory culture. Pest Management Science 66:1332-1336.

Boland, G. J., and Hall, R. 1994. Index of plant hosts of Sclerotinia sclerotiorum. Canadian Journal of Plant Pathology16:93-108.

Bolton, M. D., Thomma, B. P., and Nelson, B. D. 2006. Sclerotinia sclerotiorum (Lib.) de Bary: biology and molecular traits of a cosmopolitan pathogen. Molecular Plant Pathology 7:1-16.

Bradley, C. A., Lamey, H. A., Endres, G. J., Henson, R. A., Hanson, B. K., McKay, K. R., and Porter, P. M. 2006. Efficacy of fungicides for control of Sclerotinia stem rot of canola. Plant Disease 90:1129-1134.

Buchwaldt, L., Li, R., Hegedus, D. D., and Rimmer, S. R. 2005. Pathogenesis of Sclerotinia sclerotiorum in relation to screening for resistance. Page 22 in: 13th international Sclerotinia workshop. Proceeding of the workshop held at Monterey, California, USA, 12-16 June 2005. 22

Budge, S. P., and Whipps, J. 1991. Glasshouse trials of Coniothyrium minitans and Trichoderma species for the biological control of Sclerotinia sclerotiorum in celery and lettuce. Plant Pathology 40:59-66.

Budge, S. P., and Whipps, J. M. 2001. Potential for integrated control of Sclerotinia sclerotiorum in glasshouse lettuce using Coniothyrium minitans and reduced fungicide application. Phytopathology 91:221-227.

Butzler, T. M., Bailey, J. E., and Beute, M. K. 1998. Integrated management of Sclerotinia blight in peanut: utilizing canopy morphology, mechanical pruning, and fungicide timing. Plant Disease 82:1312–1318.

Carbone, I., and Kohn, L. M. 2001. Multilocus nested haplotype networks extended with DNA fingerprints show common origin and fine‐scale, ongoing genetic divergence in a wild microbial metapopulation. Molecular Ecology 10:2409-2422.

Carbone, I., Anderson, J. B., and Kohn, L. M. 1999. Patterns of descent in clonal lineages and their multilocus fingerprints are resolved with combined gene genealogies. Evolution 53:11-21.

Caten, C. E. 1972. Vegetative compatibility and cytoplasmic infection in fungi. Journal of General Microbiology 72:221-229.

Chand-Goyal, T., and Spotts, R. A. 1996. Postharvest biological control of blue mold of apple and brown rot of sweet cherry by natural saprophytic yeasts alone or in combination with low doses of fungicides. Biological Control 6:253-259.

Chitrampalam, P., Figuli, P. J., Matheron, M. E., Subbarao, K. V., and Pryor, B. M. 2008. Biocontrol of lettuce drop caused by Sclerotinia sclerotiorum and S. minor in desert agroecosystems. Plant Disease 92:1625-1634.

Clarkson, J. P., Coventry, E., Kitchen, J., Carter, H. E., and Whipps, J. M. 2013. Population structure of Sclerotinia sclerotiorum in crop and wild hosts in the UK. Plant Pathology 62:309- 324.

Clarkson, J. P., Phelps, K., Whipps, J. M., Young, C. S., Smith, J. A., and Watling, M. 2004. Forecasting Sclerotinia disease on lettuce: toward developing a prediction model for carpogenic germination of sclerotia. Phytopathology 94:268-279.

Clarkson, J. P., Staveley, J., Phelps, K., Young, C. S., and Whipps, J. M. 2003. Ascospore release and survival in Sclerotinia sclerotiorum. Mycological Research 107:213-222.

Coley-Smith, J. R., and Cooke, R. C. 1971. Survival and germination of fungal sclerotia. Annual Review of Phytopathology 9:65-92.

Conway, K. E., Maness, N. E., and Motes, J. E. 1997. Integration of biological and chemical controls for Rhizoctonia aerial blight and root rot of rosemary. Plant Disease 81:795-798.

Cubeta, M. A., and Echandi, E. 1991. Biological control of Rhizoctonia and Pythium damping- off of cucumber: an integrated approach. Biological Control 1:227-236.

Cubeta, M. A., Cody, B. R., Kohli, Y., and Kohn, L. M. 1997. Clonality in Sclerotinia sclerotiorum on infected cabbage in eastern North Carolina. Phytopathology 87:1000-1004.

Dalili, A., Bakhtiari, S., Barari, H., and Aldaghi, M. 2015. Effect of some fungicides against the growth inhibition of Sclerotinia sclerotiorum mycelial compatibility groups. Journal of Plant Protection Research 55:354-361.

Del Río, L. E., Bradley, C. A., Henson, R. A., Endres, G. J., Hanson, B. K., McKay, K., and Lamey, H. A. 2007. Impact of Sclerotinia stem rot on yield of canola. Plant Disease 91:191-194.

Droby, S., Cohen, L., Daus, A., Weiss, B., Horev, B., Chalutz, E., and Shachnai, A. 1998. Commercial testing of Aspire: a yeast preparation for the biological control of postharvest decay of citrus. Biological Control 12:97-101.

Dunn, A. R., Kikkert, J. R. and Pethybridge, S. J. 2017. Genotypic characteristics in populations of Sclerotinia sclerotiorum from New York State, USA. Annals of Applied Biology 170:219- 228.

Eichhorn, K. W. and Lorenz, D. H. 1978. Untersuchungen uber die Wirkung von Vinclozolin gegenuber Botrytis cinerea in vitro. Zeitschrift fur Pflanzenkrankheiten und Pflanzenschutz. Journal of plant disease and protection.

Elad, Y. 1994. Biological control of grape grey mould by Trichoderma harzianum. Crop Protection 13:35-38.

Elad, Y., Zimand, G., Zaqs, Y., Zuriel, S., and Chet, I. 1993. Use of Trichoderma harzianum in combination or alternation with fungicides to control cucumber grey mould (Botrytis cinerea) under commercial greenhouse conditions. Plant Pathology 42:324-332.

Excoffier, L., and Lischer, H. E. L. 2010. Arlequin suite ver 3.5: A new series of programs to perform population genetics analyses under Linux and Windows. Molecular Ecology Resources 10:564-567.

Ferrar, P. H., and Walker, J. R. L. 1993. o-Diphenol oxidase inhibition—an additional role for oxalic acid in the phytopathogenic arsenal of Sclerotinia sclerotiorum and Sclerotium rolfsii. Physiological and Molecular Plant Pathology 43:415-422.

Fuckel, L. 1870. Symbolic mycologicae. Beitrage zur Kenntniss der Rheinischen Pilze. Jhrb. Nassauischen Vercins Naturk 23:1-459.

Garg, H., Atri, C., Sandhu, P. S., Kaur, B., Renton, M., Banga, S. K., and Banga, S. S. 2010. High level of resistance to Sclerotinia sclerotiorum in introgression lines derived from hybridization between wild crucifers and the crop Brassica species B. napus and B. juncea. Field Crops Research 117:51-58.

Garg, H., Sivasithamparam, K., Banga, S. S., and Barbetti, M. J. 2008. Cotyledon assay as a rapid and reliable method of screening for resistance against Sclerotinia sclerotiorum in Brassica napus genotypes. Australasian Plant Pathology 37:106-111.

Godoy, G., Steadman, J. R., Dickman, M. B., and Dam, R. 1990. Use of mutants to demonstrate the role of oxalic acid in pathogenicity of Sclerotinia sclerotiorum on Phaseolus vulgaris. Physiological and Molecular Plant Pathology 37:179-191.

Golembiewski, R. C., Vargas, J. M., Jones, A. L., and Detweiler, A. R. 1995. Detection of demethylation inhibitior (DMI) resistance in Sclerotinia homoeocarpa populations. Plant Disease 79:491-493.

Grichar, W. J., and Woodward, J. E. 2016. Fungicides and application timing for control of early leafspot, southern blight, and Sclerotinia Blight of peanut. International Journal of Agronomy 2016.

Hambleton, S., Walker, C., and Kohn, L. M. 2002. Clonal lineages of Sclerotinia sclerotiorum previously known from other crops predominate in 1999-2000 samples from Ontario and Quebec soybean. Canadian Journal of Plant Pathology 24:309-315.

Harman, G. E., Latorre, B., Agosin, E., San Martin, R., Riegel, D. G., Nielsen, P. A., and Pearson, R. C. 1996. Biological and integrated control of Botrytis bunch rot of grape using Trichoderma spp. Biological Control 7:259-266.

Holst-Jensen, A., Kohn, L. M., and Schumacher, T. 1997. Nuclear rDNA phylogeny of the Sclerotiniaceae. Mycologia 1:885-899.

Hossain, M. D., Rahman, M. M. E., Islam, M. M., and Rahman, M. Z. 2008. White rot, a new disease of mustard in Bangladesh. Bangladesh Journal Plant Pathology 24:81-82.

Huang, H. C., and Kozub, G. C. 1989. A simple method for production of apothecia from sclerotia of Sclerotinia sclerotiorum. Plant Protection Bulletin, Taiwan 31:333-345.

Huang, H. C., and Kozub, G. C. 1991. Temperature requirements for carpogenic germination of sclerotia of Sclerotinia sclerotiorum isolates of different geographic origin. Botanical Bulletin of Academia Sinica 32:279-286.

Huang, H. C., Bremer, E., Hynes, R. K., and Erickson, R. S. 2000. Foliar application of fungal biocontrol agents for the control of white mold of dry bean caused by Sclerotinia sclerotiorum. Biological Control 18:270-276.

Inglis, G. D., and Boland, G. J. 1990. The microflora of bean and rapeseed petals and the influence of the microflora of bean petals on white mold. Canadian Journal of Plant Pathology 12:129-134.

Jones, D., and Gray, E. G. 1973. Factors affecting germination of sclerotia of Sclerotinia sclerotiorum from peas. Transactions of the British Mycological Society 60:495IN8-500.

Júnior, C. L., Gomes, E. V., Júnior, M. L., Nasser, L. C. B., and Petrofeza, S. 2011. Genetic diversity and mycelial compatibility groups of the plant-pathogenic fungus Sclerotinia sclerotiorum in Brazil. Genetics and Molecular Research 10:868-877.

Kamal, M., Alam, M., Savocchia, S., Lindbeck, K., and Ash, G. 2015. Prevalence of sclerotinia stem rot of mustard in northern Bangladesh. Int. J. BioRes 19:13-19.

Kars, I., and van Kan, J. A. 2007. Extracellular enzymes and metabolites involved in pathogenesis of Botrytis. In Botrytis: Biology, pathology and control pp. 99-118. Springer Netherlands.

Khangura, R., and Beard, C. 2015. Managing sclerotinia stem rot in canola. Department of Agriculture and Food. Australian Government, cited at https:// www.agric.wa.gov.au/canola/managing-sclerotinia-stem-rot-canola. Accessed 9 September 2015.

Kharbanda, P. D., and Tewari, J. P. 1996. Integrated management of canola diseases using cultural methods. Canadian Journal of Plant Pathology 18:168-175.

Kohli, Y., and Kohn, L. M. 1998. Random association among alleles in clonal populations of Sclerotinia sclerotiorum. Fungal Genetics and Biology 23:139-149.

Kohli, Y., Brunner, L. J., Yoell, H., Milgroom, M. G., Anderson, J. B., Morrall, R. A. A., and Kohn, L. M. 1995. Clonal dispersal and spatial mixing in populations of the plant pathogenic fungus, Sclerotinia sclerotiorum. Molecular Ecology 4:69-77.

Kohli, Y., Morrall, R. A. A., Anderson, J. B., and Kohn, L. M. 1992. Local and trans-Canadian clonal distribution of Sclerotinia sclerotiorum on canola. Phytopathology 82:875-880.

Kohn, L. M. 1979. A monographic revision of the genus Sclerotinia. Mycotaxon 9:365-444.

Ktiller, W., and Scheinpflug, H. 1987. Fungal resistance to sterol biosynthesis inhibitors: a new challenge. Plant Disease 71:12.

Kuang, J., Hou, Y. P., Wang, J. X., and Zhou, M. G. 2011. Sensitivity of Sclerotinia sclerotiorum to fludioxonil: in vitro determination of baseline sensitivity and resistance risk. Crop Protection 30:876-882.

Kuang, J., Wang, J. X., and Zhou, M. G. 2011b Monitoring carbendazim and dimethachlon resistance of Sclerotinia sclerotiorum obtained from the blight stems of rape in Jiangsu Province. Chinese Agricultural Science Bulletin 27:285–291.

Le Tourneau, D. 1979. Morphology, cytology, and physiology of Sclerotinia species in culture. Phytopathology 69:887-890.

Lemay, A. V., Bailey, J. E., and Shew, B. B. 2002. Resistance of peanut to Sclerotinia blight and the effect of acibenzolar-S-methyl and fluazinam on disease incidence. Plant Disease 86:1315-1317.

Leslie, J. F. 1993. Fungal vegetative compatibility. Annual Review of Phytopathology 31:127- 150.

Li, C. X., Li, H., Sivasithamparam, K., Fu, T. D., Li, Y. C., Liu, S. Y., and Barbetti, M. J. 2006. Expression of field resistance under Western Australian conditions to Sclerotinia sclerotiorum in Chinese and Australian Brassica napus and Brassica juncea germplasm and its relation with stem diameter. Australian Journal of Agricultural Research 57:1131-1135.

Li, C. X., Liu, S. Y., Sivasithamparam, K., and Barbetti, M. J. 2009. New sources of resistance to Sclerotinia stem rot caused by Sclerotinia sclerotiorum in Chinese and Australian Brassica napus and B. juncea germplasm screened under Western Australian conditions. Australasian Plant Pathology 38:149-152.

Li, J. L., Liu, X. Y., Di, Y. L., Liang, H. J., and Zhu, F. X. 2015. Baseline sensitivity and control efficacy of DMI fungicide epoxiconazole against Sclerotinia sclerotiorum. European Journal of Plant Pathology 141:237-246.

Li, Z., Wang, Y., Chen, Y., Zhang, J., and Fernando, W. D. 2009. Genetic diversity and differentiation of Sclerotinia sclerotiorum populations in sunflower. Phytoparasitica 37:77-85.

Li, C. X., Li, H., Siddique, A. B., Sivasithamparam, K., Salisbury, P., Banga, S. S., Chattopadhya, C., Humar, A., Singh, R., Singh, D., Agnihotri, A., Liu, S. Y., Li, Y. C., Tu, J., Fy, T. D., Wang, Y. F., and Barbetti, M. J. 2007. The importance of the type and time of inoculation and assessment in the determination of resistance in Brassia napus and B. juncea to Sclerotinia sclerotiorum. Australian Journal of Agricultural Research 58:1198-1203.

Libert, M. A. 1837. Plante crytogamicae arduennae (Exsiccati) no. 326. Published by the author. Lumsden, R. D., and Dow, R. L. 1973. Histopathology of Sclerotinia sclerotiorum infection of bean. Phytopathology.

Ma, H. X., Feng, X. J., Chen, Y., Chen, C. J., and Zhou, M. G. 2009. Occurrence and characterization of dimethachlon insensitivity in Sclerotinia sclerotiorum in Jiangsu Province of China. Plant Disease 93:36–42.

Magro, P., Marciano, P., and Di Lenna, P. 1984. Oxalic acid production and its role in pathogenesis of Sclerotinia sclerotiorum. FEMS Microbiology Letters 24:9-12.

Malvárez, G., Carbone, I., Grünwald, N. J., Subbarao, K. V., Schafer, M., and Kohn, L. M. 2007. New populations of Sclerotinia sclerotiorum from lettuce in California and peas and lentils in Washington. Phytopathology 97: 470-483.

Mandal, A. K., and Sunil, C. D. 2012. Genetic diversity analysis of Sclerotinia sclerotiorum causing stem rot in chickpea using RAPD, ITS-RFLP, ITS sequencing and mycelial compatibility grouping. World Journal of Microbiology and Biotechnology 28:849-1855.

Matheron, M. E. and Matejka, J. C. 1989. In vitro and field comparison of six new fungicides with iprodione and vinclozolin for control of leaf drop of lettuce caused by Sclerotinia sclerotiorum. Plant Disease 73:27-730.

Matheron, M. E., and Porchas, M. 2004. Activity of boscalid, fenhexamid, fluazinam, fludioxonil, and vinclozolin on growth of Sclerotinia minor and S. sclerotiorum and development of lettuce drop. Plant Disease 88:665–668.

Mei, J., Qian, L., Disi, J. O., Yang, X., Li, Q., Li, J., Frauen, M., Cai, D., and Qian, W. 2011. Identification of resistant sources against Sclerotinia sclerotiorum in Brassica species with emphasis on B. oleracea. Euphytica 177:393-399.

Mei, J., Wei, D., Disi, J. O., Ding, Y., Liu, Y., and Qian, W. 2012. Screening resistance against Sclerotinia sclerotiorum in Brassica crops with use of detached stem assay under controlled environment. European Journal of Plant Pathology 134:599-604.

Meinhardt, L. W., Wulff, N. A., Bellato, C. M., and Tsai, S. M. 2002. Telomere and microsatellite primers reveal diversity among Sclerotinia sclerotiorum isolates from Brazil. Fitopatologia Brasileira 27:211-215.

Meirmans P.G and Van Tienderen P.H. 2004. Genotype and genodive: two programs for the analysis of genetic diversity of asexual organisms. Mol Ecol Notes 4:792–794.

Miah, M. M., Shiblee, S. M. A., and Rashid, M. A. 2015. Economic Impacts of Oilseed Research and Development in Bangladesh. Bangladesh Dev. Stud. 38:1-31.

Miller, G. L., Stevenson, K. L., and Burpee, L. L. 2002. Sensitivity of Sclerotinia homoeocarpa isolates to propiconazole and impact on control of dollar spot. Plant Disease 86:1240-1246.

Minuto, A., Migheli, Q., and Garibaldi, A. 1995. Evaluation of antagonistic strains of Fusarium spp. in the biological and integrated control of Fusarium wilt of cyclamen. Crop Protection 14:221-226.

Morrall, R. A. A. 1977. A preliminary study of the influence of water potential on sclerotium germination in Sclerotinia sclerotiorum. Canadian Journal of Botany 55:8-11.

Mueller, D. S., Dorrance, A. E., Derksen, R. C., Ozkan, E., Kurle, J. E., Grau, C. R., and Pedersen, W. L. 2002. Efficacy of fungicides on Sclerotinia sclerotiorum and their potential for control of Sclerotinia stem rot on soybean. Plant Disease 86:26-31.

Murray, G and Brennan, J. P. 2012. The current and potential costs from diseases of oilseed crops in Australia, Cited at https://www.grdc.com.au/ Resources/Publications/2012/06/The- Current-and-Potential-Costs-fromDiseases-of-Oilseed-Crops-in-Australia. Accessed 21 July 2015.

Njambere, E. N., Chen, W., Frate, C., Wu, B. M., Temple, S. R., and Muehlbauer, F. J. 2008. Stem and crown rot of chickpea in California caused by Sclerotinia trifoliorum. Plant Disease 92:917-922.

Pappas, A. C., and Fisher, D. J. 1979. A comparison of the mechanisms of action of vinclozolin, procymidone, iprodione and prochloraz against Botrytis cinerea. Pest Management Science 10:239-246.

Pan, Y., Liu, F., and Xu, Z. 2000. The resistance of Sclerotinia sclerotiorum of rape to carbendazim and its management. Jiangsu Agricultural Sciences 3:39-40.

Purdy, L. 1979. Sclerotinia sclerotiorum: history, diseases and symptomatology, host range, geographic distribution, and impact. Phytopathology 69:875-880.

Qi, Y. X., Chen, F. X., Su, X. Y., Ding, K. J., Yu, J., and Jiang, M. S. 2006. Monitoring of carbendazim resistance of Sclerotinia sclerotiorum obtained from the blight stems of rape in Anhui Province. Chinese Agricultural Science Bulletin 22:371–373.

Saharan, G. S., Mehta, N. 2008. Sclerotinia Disease in Crop plants: Biology, Ecology and Disease Management. Springer. ISBN978-1-40208407-2.

Schnabel, G., Bryson, P. K., Bridges, W. C., and Brannen, P. M. 2004. Reduced sensitivity in Monilinia fructicola to propiconazole in Georgia and implications for disease management. Plant Disease 88:1000-1004.

Sexton, A. C., and Howlett, B. J. 2004. Microsatellite markers reveal genetic differentiation among populations of Sclerotinia sclerotiorum from Australian canola fields. Current Genetics 46:357-365.

Shi, Z., Zhou, M., and Ye, Z. 1999. Resistance of Sclerotinia sclerotiorum to carbendazim and dimethachlon. Chinese Journal of Oil Crop Sciences 22:54-57.

Sirjusingh, C., and Kohn, L. M. 2001. Characterization of microsatellites in the fungal plant pathogen, Sclerotinia sclerotiorum. Molecular Ecology Resources 1:267-269.

Smith, D. L., Garrison, M. C., Hollowell, J. E., Isleib, T. G., and Shewa, B. B. 2008. Evaluation of application timing and efficacy of the fungicides fluazinam and boscalid for control of Sclerotinia blight of peanut. Crop Protection 27:823-833.

Stammler, G., Benzinger, G., and Speakman, J. 2007. A rapid and reliable method for monitoring the sensitivity of Sclerotinia sclerotiorum to boscalid. Journal of Phytopathology 155:11-12.

Sugar, D., and Spotts, R. A. 1999. Control of postharvest decay in pear by four laboratory-grown yeasts and two registered biocontrol products. Plant Disease 83:155-158.

Sundheim, L., and Amundsen, T. 1982. Fungicide tolerance in the hyperparasite Ampelomyces quisqualis and integrated control of cucumber powdery mildew. Acta Agriculturae Scandinavica 32:349-355.

Tanaka, C., and Izumitsu, K. 2010. Two-component signaling system in filamentous fungi and the mode of action of dicarboximide and phenylpyrrole fungicides. In Fungicides. InTech.

Thomma, B. P. 2003. Alternaria spp.: from general saprophyte to specific parasite. Molecular Plant Pathology 4:225-236.

Toth, I. K., Bell, K. S., Holeva, M. C., and Birch, P. R. 2003. Soft rot erwiniae: from genes to genomes. Molecular Plant Pathology 4:17-30.

Tu, J. C. 1985. Tolerance of white bean (Phaseolus vulgaris) to white mold (Sclerotinia sclerotiorum) associated with tolerance to oxalic acid. Physiological Plant Pathology 26:111- 117.

Turkington, T. K., and Morrall, R. A. A. 1993. Use of petal infection to forecast Sclerotinia stem rot of canola: the influence of inoculum variation over the flowering period and canopy density. Phytopatology 83:682-689.

Uloth, M., You, M. P., Finnegan, P. M., Banga, S. S., Yi, H., and Barbetti, M. J. 2014. Seedling resistance to Sclerotinia sclerotiorum as expressed across diverse cruciferous species. Plant Disease 98:184-190.

Wakefield, E. M. 1924. On the names Sclerotinia sclerotiorum (Lib.) Massee and S. libertiana Puokel. Phytopathology 14:2.

Wang, Y., Hou, Y. P., Chen, C. J., and Zhou, M. G. 2014. Detection of resistance in Sclerotinia sclerotiorum to carbendazim and dimethachlon in Jiangsu Province of China. Australasian Plant Pathology 43:307-312.

Whetzel, H. H. 1945. A synopsis of the genera and species of the Sclerotiniaceae, a family of stromatic inoperculate discomycetes. Mycologia 37:648-714.

Wu, J., Cai, G., Tu, J., Li, L., Liu, S., Luo, X., and Zhou, Y. 2013. Identification of QTLs for resistance to Sclerotinia stem rot and BnaC. IGMT5. as a candidate gene of the major resistant QTL SRC6 in Brassica napus. PloS one 8:e67740.

Xilin, Z., Xuemei, S., and Gufeng, Z. 2003. Preliminary report on the Monitoring of the resistance of Sclerotinia Libertiana to carbendazim and its integrated management. J. Pesticide Science and Administration 6:009.

Xu, C., Hou, Y., Wang, J., Yang, G., Liang, X., and Zhou, M. 2014. Activity of a novel strobilurin fungicide benzothiostrobin against Sclerotinia sclerotiorum. Pesticide Biochemistry and Physiology 115:32-38.

Yanase, Y., Yoshikawa, Y., Kishi, J., and Katsuta, H. 2007. The history of complex II inhibitors and the discovery of penthiopyrad. Pesticide Chemistry: Crop Protection, Public Health, Environmental Safety 295-303.

Yilou, P., Zhiyuan, W., and Hanzhang, W. 1997. Resistance to carbendazim in Sclerotinia sclerotiorum. Chin J Oil Crop Sci 3:021.

Yli-Mattila, T., Kalko, G., Hannukkala, A., Paavanen-Huhtala, S., and Hakala, K. 2010. Prevalence, species composition, genetic variation and pathogenicity of clover rot (Sclerotinia trifoliorum) and Fusarium spp. in red clover in Finland. European Journal of Plant Pathology 126:13.

Zeng, W., Kirk, W., and Hao, J. 2012. Field management of Sclerotinia stem rot of soybean using biological control agents. Biological Control 60:141-147.

Zhang, Y., Hu, C. X., Zhang, C. G. 2011. Cloning and expression analysis of Rsk in Brassica napus induced by Sclerotinia sclerotiorum. iActa. Physiol. Plant 33:1277-1283.

Zhao, J., and Meng, J. 2003. Genetic analysis of loci associated with partial resistance to Sclerotinia sclerotiorum in rapeseed (Brassica napus L.). Theoretical and Applied Genetics 106:759-764.

Zhao, J., Peltier, A. J., Meng, J., Osborn, T. C., and Grau, C. R. 2004. Evaluation of Sclerotinia stem rot resistance in oilseed Brassica napus using a petiole inoculation technique under greenhouse conditions. Plant Disease 88:1033-1039.

Zhao, J., Udall, J. A., Quijada, P. A., Grau, C. R., Meng, J., and Osborn, T. C. 2006. Quantitative trait loci for resistance to Sclerotinia sclerotiorum and its association with a homeologous non- reciprocal transposition in Brassica napus L. Theoretical and Applied Genetics 112:509-516.

Zhou, B. W., and Luo, Q. 1994. Rapeseed diseases and control. China Commerce and Trade Press, Beijing pp. 346.

Zhou, F., Zhu, F. X., Zhang, X. L., and Zhang, A. S. 2014a. First report of dimethachlon resistance in field isolates of Sclerotinia sclerotiorum on oilseed rape in Shaanxi Province of northwestern China. Plant Disease 98:568.

Zhou, F., Zhang, X. L., Li, J. L., and Zhu, F. X. 2014b. Dimethachlon resistance in Sclerotinia sclerotiorum in China. Plant Disease 98:1221-1226.

Zhou, L. C., Yu, Q., Liu, S. Y., and Zhou, B. W. 1994. Evaluation of Sclerotinia resistance in rapeseed. Chin. Oilseed Crops (Suppl.) 4:69-71.

Chapter 2

Morphological and genetic diversity within Sclerotinia sclerotiorum in Bangladesh

Abstract. Sclerotinia sclerotiorum is an important pathogen of many crops including mustard in

Bangladesh. The pathogen has emerged relatively recently in Bangladesh and there is no information available regarding its population structure in mustard growing regions of the country. The aim of this study was to determine the variability of S. sclerotiorum isolates from different regions of Bangladesh and from Ohio, USA. In 2014, a total of 132 S. sclerotiorum isolates were collected from eleven locations in Bangladesh and Ohio. Morphological characteristics including mycelial radial growth, number and fresh weight of sclerotia from culture were measured. Genetic variability was also assessed by Internal Transcribed Spacer

(ITS) rDNA sequencing, microsatellite markers and mycelial compatibility grouping. Overall, isolates from Bangladesh showed low variability based on morphological and molecular characteristics. Mycelial radial growth of isolates from one location in Bangladesh was significantly higher than the radial growth of isolates from Ohio. No significant difference was observed in the number of sclerotia produced by isolates from the 11 locations. The weight of sclerotia produced by Isolates from Tangail, Mirzapur produced smaller sclerotia than isolates from Ohio and from Tangail, Ghatail and Shirajganj, Chalakpara, Bangladesh. No significant variation was observed among isolates from any location based on their ITS rDNA sequences.

Based on eight informative microsatellite loci, 91% of the variation was among the isolates and

9% was due to location, indicating low divergence among the populations from the 11 locations.

Principle Component Analysis (PCA) separated Ohio isolates from isolates from nine locations in Bangladesh; however, isolates from Jamalpur were in the same PCA quartile with isolates from Ohio. Twenty-seven microsatellite haplotypes were identified among the 118 isolates from

11 locations, and one haplotype (haplotype 1) was predominant in ten locations in Bangladesh.

Among the isolates from Ohio, two were in two separate haplotypes (haplotype 25 and haplotype

26). Thirty-four mycelial compatibility groups (MCGs) were identified among 80 S. sclerotiorum isolates; those from Ohio formed four groups while the remaining 30 groups were from Bangladesh. Fifty-one isolates from ten Bangladesh populations were in haplotype 1, which shared 14 MCGs. On the other hand, four MCGs contained more than one haplotype. Based on morphological and genetic characters, the S. sclerotiorum populations from Bangladesh and from

Ohio were different, however, populations from Bangladesh had low variability.

Introduction

Sclerotinia sclerotiorum (Lib.) de Bary (phylum Ascomycota) is a ubiquitous pathogen of many crops of different families (Kohn 1979). More than 50 names have been used to refer to diseases caused by the pathogen (Purdy 1979) such as cottony rot, watery rot, watery soft rot, stem rot, crown rot, blossom blight and the most widely known, white mold. The fungus infects more than 400 species of plants (Boland and Hall 1994). It poses a threat to dicotyledonous crops such as sunflower, soybean, oilseeds, chickpea, peanut, lentil and vegetables, as well as monocots like onion and tulip (Boland and Hall 1994). In China, 4 to 7 million ha of mustard are damaged annually by S. sclerotiorum (Ni et al. 2014). At present, white mold disease has

26 become a major problem for the production of mustard and other crops in Bangladesh, primarily due to extensive importation of seeds from different Sclerotinia-infested regions and rapid climate change. Since the pathogen was not present or at low levels previously in Bangladesh, there is very little information regarding population structure and variability of isolates causing white mold.

Sclerotinia sclerotiorum is a homothallic fungus that reproduces both asexually and sexually, which results in a clonal population structure (Bolton et al. 2006). In Canada, a single clonal population of S. sclerotiorum from canola was repeatedly isolated over 4 years across

2000 km (Anderson and Kohn 1995). However, recombination and mutation in S. sclerotiorum populations from Canadian soybean fields were reported, which increase genetic diversity and adaptability (Hambleton et al. 2002; Aldrich-Wolfe et al. 2015). Molecular techniques based on amplified fragment length polymorphisms (Cubeta et al. 1997), random amplified fragment length polymorphisms (Yli-Mattila et al. 2010), microsatellite markers (Meinhardt et al. 2002) and sequence-based polymorphisms (Li et al. 2009) have been used to explore genetic diversity within S. sclerotiorum. Simple sequence repeats (SSR), also known as microsatellites, are widely dispersed and distributed in the genome of eukaryotes (Gaggiotti et al. 1999). Analysis of SSR markers is an effective molecular tool for intraspecific population studies of eukaryotic organisms including many plant pathogens (Balloux and Lugon‐Moulin 2002). Microsatellites contain tandemly repeated nucleotide motifs of one to six base pairs long (Capote et al. 2012), and they occur in both coding and non-coding regions (Matsuoka et al. 2002; Toth et al. 2000;

Katti et al. 2001; Ellegren 2004; Sharopova 2008). SSR markers have a high level of polymorphism and their easy detection by PCR amplification has led to their widespread application for identification and population genetics studies of many fungi and other eukaryotes

(Karaoglu et al. 2005). Genetic diversity of many plant pathogenic fungi including Ascochyta rabiei (Bayraktar et al. 2007), Macrophomina phaseolina (Jana et al. 2005), Puccinia graminis

(Admassu et al. 2010) and S. sclerotiorum (Winton et al. 2007) was determined successfully with

SSR markers.

Further, determination of mycelial compatibility groups (MCGs), an indirect assessment of genetic variation in fungi (Leslie 1993), has also been used widely to assess variation among

S. sclerotiorum isolates (Kohn et al. 1990; Earnshaw and Boland 1997; Schafer and Kohn 2006;

Aldrich-Wolf et al. 2015). Mycelial compatibility groups (MCG) are important markers to identify field populations. Mycelial compatibility groups reflect fungal exchange of genetic material, even if there are limited impacts of sexual reproduction on disease cycles (Kohn et al.

1991; Leslie 1993). Isolates within a MCG restrict exchange of cytoplasm, genetic material and extra-chromosomal elements to isolates in other MCGs (Caten 1972). Incompatible isolates belong to separate and distinct gene pools, which may differ in ecological, physiological and pathological traits (Remesal et al. 2012).

While neither current genetic diversity nor incompatibility assessments necessarily provide information regarding pathogen virulence, aggressiveness or fitness, information about population structure and the prevalence of recombination can be utilized to select isolates for breeding programs to develop effective and durable disease resistance. Screening programs used for developing resistant varieties depends on the selection of representative S. sclerotiorum isolates for vast cropping areas (Dunn et al. 2017). As a new emerging pathogen in Bangladesh, morphological and genetic variability of S. sclerotiorum populations have not been thoroughly investigated. The present study was undertaken to assess the diversity of S. sclerotiorum isolates

28 from Bangladesh, with a tropical climate, in comparison with isolates from a temperate climate in Ohio, USA.

Materials and Methods

Recovery and identification of S. sclerotiorum isolates. A total of 124 isolates from

Bangladesh and seven isolates from Ohio (USA) were assessed in this study. Isolates from

Bangladesh were recovered from infected mustard plants in ten fields in three districts (Tangail,

Sirajgonj and Jamalpur) (Figure 2.1). Isolates from each field were considered a population.

Diseased plants were selected at random from each field, and one sclerotium was recovered from each plant and considered a single isolate. Eight isolates from Ohio were recovered from soybean, pepper and cabbage fields. Sclerotia from infected plant parts were washed in 5% sodium hypochlorite for 4 minutes, then 70 % ethanol for 2 minutes, and rinsed twice in sterilized distilled water. After drying, a single sclerotium from each sample was plated on potato dextrose agar (PDA) medium (Hi Media, India). The cultures were incubated at 24°C in the dark.

A 5-mm plug from the edge of a mycelial colony was transferred to 10% water agar medium and incubated for three days at 24°C. Hyphal tips from 3-day-old cultures were transferred aseptically to PDA. Hyphal tip cultures were preserved at 4°C. Ten - to - twenty sclerotia from each isolate from hyphal tip cultures on PDA medium were collected and stored in a labeled sterile 2ml eppendorf tube in 4°C refrigerator. Several tubes for each isolates were maintained.

Sclerotia were shipped to The Ohio State University – OARDC under USDA Animal Plant

Health Inspection Service (APHIS) permit no. P526P-14-00187.

Morphological variation of S. sclerotiorum isolates. Variation in mycelial growth, and number and weight of sclerotia on PDA medium was assessed for 122 isolates of S. sclerotiorum collected in Bangladesh and eight isolates from Ohio. A single sclerotium from a pure culture of each isolate was placed on PDA medium in a 90 cm petri plate. Cultures were incubated under a

12 h/12 h light/dark photoperiod at 24±1°C on a laboratory bench. Three replications per isolate were arranged in a randomized complete block design (RCBD). Colony diameter was measured after 3 days of culture of sclerotium, and the number and fresh weight of newly formed sclerotia were determined 14 days later. The experiment was conducted twice in Biosafety Containment

Lab 2, Selby Hall, Wooster campus, OARDC, OSU.

Confirmation of isolate identity

DNA extraction. Two agar disks from 3-day-old actively growing cultures of each isolate were transferred to a 250 ml conical flask containing 150 ml Difco™ potato dextrose broth (PDB).

The flasks were incubated at 24°C on a shaker at 120 rpm for 72 hours. Mycelial mats were harvested by filtering through two layers of sterilized cheesecloth, dried and maintained at -

20°C. One gram of harvested mycelia were added to a 1.5 ml sterile Eppendorf tube. The tube with mycelia was dipped into liquid nitrogen and the flash-frozen mycelia were ground with a sterilized plastic pestle to a fine powder. DNA was extracted using a Wizard Genomic DNA

Purification Kit (Promega Corporation, Madison WI, USA) following the manufacturer’s instructions. The DNA of each isolate was quantified using a NanoDrop spectrophotometer

(ThermoFisher Scientific, NY, USA).

PCR and ITS sequencing. DNA of 109 isolates was amplified with primers ITS1 and ITS4 as

30 described by White et al. (1990). The amplification was conducted in a 25 µl PCR reaction mixture containing 12.5 µl 2× PCR master mix (Promega Green Master Mix, 2×, Promega

Corporation, Madison WI, USA), 1.25 µl of each primer (ITS1 and ITS4, [10 µM]), 1 µl template DNA and 9 µl nuclease-free deionized water. The template concentration for each reaction was 10 ng of genomic DNA. The PCR assay was performed using a PTC-100 thermal cycler (MJ Research Inc., Waltham MA, USA) with the following parameters: 1 min denaturation at 94°C was followed by 30 cycles of 15 s at 94°C, 15 s at 55°C and 30 s at 72°C, and a final extension step of 7 min at 72°C. Amplified DNA products were separated on a 1.5% agarose gel in Tris TAPS EDTA (TTE) buffer. Amplicons were separated for 60 minutes at

100V. A 1-kb plus ladder (Promega Corporation, Madison WI) was used to estimate the size of

DNA amplicons. Gels were stained with dye, GelRed (1x, Biotium Inc, Fremont CA, USA) and visualized under UV light. The amplified PCR products were cleaned using Wizard@SV gel and

PCR Cleanup kits (Promega, USA) following the manufacturer’s instructions. Purified DNA of each isolate was sequenced at the Molecular and Cellular Imaging Center (MCIC), The Ohio

State University, OARDC, Wooster, Ohio, USA. Sequence data were edited using the software

Chromas lite. Multiple sequence alignments were made using MEGA version 6.0. The nucleotide sequences were compared with published sequences in the National Center for

Biotechnology Information (NCBI) website using BLAST. A phylogenetic tree was constructed with 16 reference isolates (published in refereed journal articles) from the NCBI database and

ITS sequence data of 109 isolates with phylogenetic software MEGA 6.0 using the Neighbor-

Joining method with 1000 bootstrap value.

Simple sequence repeat (SSR) marker analysis. A total of 118 isolates from 11 locations were

31 screened using SSR marker analysis to determine genetic diversity (Table 2.1). DNA was extracted as described above. A subset of eight SSR markers (Table 2.2) was selected from the original set developed by Sirjusingh and Kohn (2001). A preliminary screening was carried out using sixteen S. sclerotiorum isolates to evaluate the degree of polymorphism among the isolates.

Polymerase chain reactions were performed using a BioRad S1000 Touch thermal cycler

(California, USA). Reactions were carried out in a final volume of 25 µl containing: 12.5 µl of

Master Mix [0.6 units of Taq DNA polymerase, 1× supplied reaction buffer (pH 8.5), 200 µM of each deoxyribonucleotide, and 1.5 mM MgCl2] (Promega Corporation, Madison WI), and 0.6

µM of each primer. The template concentration for each reaction was 10 ng of genomic DNA.

PCR conditions were set as follow: initial denaturation step at 95°C for 8 min, followed by 35 cycles of denaturation at 95°C; primer annealing at 55-60°C (Table 2.3); and extension at 72°C for

45 s, with a final extension step at 72°C for 10 min. PCR products were separated on a 3% (wt/vol) agarose gel in 1× TAE buffer and visualized under UV light after staining in GelRed solution.

Fragment size was visually calculated based on comparison with a 1Kb ladder plus.

Mycelial compatibility grouping of S. sclerotiorum isolates. Eighty isolates of S. sclerotiorum from ten locations in Bangladesh and one in the USA (Ohio) were used in this study (Table 2.4).

A 6-mm mycelial plug from 1 cm inside of the growing edge of a 3-day-old culture of each isolate was cultured on PDA medium amended with McCormick’s red food color (75µl/L)

(Amazon.com). Two sets of isolates were placed 3 mm apart in 9 cm petri plates. Pairing was done in all possible combinations of the 80 isolates. The plates were incubated in the dark at

24±2°C on a laboratory bench. Mycelial incompatibility was identified by observing a barrier zone (no mycelial growth) at the contact point of two colonies, and aerial mycelia in the

32 interaction zone on the colony surface. A compatible reaction was recognized by formation of a uniform colony with no distinct interaction zone (Kohn et al., 1990). Mycelial compatibility and incompatibility reactions were recorded 10 days after culture initiation.

Data analysis. Analysis of variance (ANOVA) of mycelial colony diameter, and number and weight of sclerotia was conducted with statistical software Minitab 16. Means separations for mycelial growth and weight of sclerotia were conducted by using Tukey’s test. Frequency based genetic diversity (allele frequency) and genetic distance-based analyses were performed using population genetics software GeneAlEx (Peakall and Smouse 2006). Clonal diversity was calculated with the software Genodive v. 2.0 (Aldrich-Wolfe et al. 2015; Excoffier and Lischer

2010; Meirmans and Van Tienderen 2004). For principle component analysis, ten axes were separated based on populations from 11 locations and eight microsatellite loci with software

Genodive v. 2.0 (Meirmans 2004). Eigen values of first two principle components were used to calculate mean values of isolates from each location and plotted against one another using statistical software Minitab 16.0 (Minitab Inc).

Results

Morphological variability of S. sclerotiorum. Mycelial colony diameter, number of sclerotia and fresh weight of sclerotia of isolates collected from ten locations within three districts of

Bangladesh and from Ohio ranged from 76.9 to 83.9 mm, 26.8 to 21.4 and 8.6 to 16 mg, respectively (Table 2.3; Fig 2.2). Mycelial colony diameter and sclerotia weight, but not number of sclerotia, varied significantly between locations. Mycelial colony diameter did not vary significantly among Bangladesh isolates, however the colony diameter of Ohio isolates was

33 significantly lower than that of Shirajgang, Sadar isolates. Sclerotium weight of isolates from nine of ten Bangladesh fields and the Ohio isolates did not differ significantly. Sclerotia produced by the Tangail, Mirzapur isolates were significantly smaller than those produced by isolates from Ohio, Shirajganj, Chalakpara and Tangail, Ghatail.

Confirmation of isolate identity by ITS sequencing. PCR amplification of all isolates with primers ITS1 and ITS4 yielded a DNA fragment of ~550 bp. Sequences shared 95-100% similarity with S. sclerotiorum sequences in the NCBI database. The sequence data were submitted to NCBI GenBank and accession numbers were obtained (Acc No. KY848692 -

KY848799). The lack of variation in sequence data precluded construction of a meaningful phylogenetic tree for the isolates.

SSR marker analysis for determination of genetic diversity among S. sclerotiorum isolates.

A total of 31 SSR marker alleles with an average of 2.53 alleles per locus were detected among the SSR markers (Table 2.4). The effective numbers of alleles per locus ranged from 1.46 – 2.33 with an average of 1.94. Private alleles were observed among isolates in only three locations

(Dhonbari, Jamalpur, Deohata, Tangail and Deshipara, Shirajgong). Low genetic variation (9%) was partitioned among the geographically designated populations, while high variation (91%) was observed within populations by AMOVA (Table 2.5). Twenty-seven microsatellite haplotypes were identified among the 118 isolates. Haplotype 1 was observed in all ten populations from Bangladesh, and contained 83 isolates. Twenty haplotypes contained one isolate each. Seven haplotypes contained more than one isolate (Figure 2.3). Haplotypes 25, 26, and 27 contained only isolates from Ohio. Principle component analysis indicated that isolates

34 from Pop 11 (Ohio) were genetically divergent from those from nine locations in Bangladesh.

Isolates from Population 2 (Jamalpur, Bangladesh) were in the same quartile as isolates from

Ohio (Figure 2.4). Isolates from Populations 3, 6 and 8 were in the second quartile, isolates from

Populations 9 and 10 were in the third quartile and isolates from Populations 1, 4, 5 and 7 clustered in the forth quartile.

Mycelial compatibility grouping. Among the 80 S. sclerotiorum isolates tested from 11 populations, 26 were incompatible with all other isolates tested but were self-compatible; 54 isolates were compatible with at least one other isolate, forming eight compatibility groups

(Table 2.6). All of the isolates were self-compatible. Mycelial compatibility group 3 contained the largest number of isolates, with 24 from eight different populations (Figure 2.6). Two isolates (SS2 and JSS1) from USA formed a single MCG (MCG1) (Table 2.7).

Fourteen MCGs (9, 11-13, 17, 19, 20, 22, 23, 26, 27, 31, 33, 34) were associated with unique haplotypes (Table 2.7). Haplotype 1 was predominant and present in all 10 populations from Bangladesh. Haplotypes 25 and 26 were observed in Population 11 (Ohio, USA). All but one of the 20 isolates in MCG 3 were haplotype 1, as were all isolates in MCGs 5-8. Fifty-one haplotype 1 isolates belonged to 14 MCGs. More than one haplotype was found in MCG1

(haplotypes 25 and 26), MCG2 (haplotypes 3 and 8), MCG3 (haplotype 1, 6 and 25) and MCG4

(haplotypes 1, 17 and 22).

Discussion

Morphological characteristics can serve and indicators of variability in many fungi.

Variation in morphology was observed among isolates of S. sclerotiorum collected from 35 different locations and hosts (artimisia, cabbage, lettuce, rapeseed, soybean, sunflower and tobacco) in Iran (Ahmadi et al. 2012). Mycelial colony diameter of isolates from cabbage, pepper and soybean from Ohio was significantly less than the diameter of colonies from mustard recovered from one location, Shirajgang-Sadar, in Bangladesh. However, there was no significant difference in colony diameter among S. sclerotiorum isolates from the ten locations in

Bangladesh. There were no differences among isolates from different locations based on number of sclerotia per culture plate, which ranged from 21.4 to 26.8. In common bean, Abreu and Ouza

(2015) observed on average 10.3 to 26.7 sclerotia per S. sclerotiorum culture. Weight of sclerotia was similar among isolates from Bangladesh and Ohio, with the exception of isolates from one field in Bangladesh that produced smaller sclerotia. The lowest linear mycelial growth was observed for isolates from Ohio while the highest sclerotium weight was observed in isolates from same location. Ahmadi et al. (2012) also observed a negative correlation among the mycelial radial growth and size of sclerotia (coefficient -0.317).

All of the 109 isolates for which ITS rDNA was sequenced were confirmed as S. sclerotiorum, but there was insufficient variation among sequences of this genomic DNA region to be informative regarding population structure. Other workers have reported low genetic variability of Indian isolates of S. sclerotiorum (Najambere et al., 2008; Mandal et al., 2012) using ITS rDNA sequencing.

Microsatellite markers are DNA sequences with high genetic mutation rates and can therefore be informative in assessing genetic variability. Eight microsatellite loci suggested by

Sirjusing and Kohn (2001) were used in this study. Analysis of molecular variance (AMOVA) showed that 91% of the variation in allele frequency was among the isolates within a population and only 9% of the variation was between populations, including diverse geographic regions of

Bangladesh and Ohio, USA. Some haplotypes were detected in single locations, indicating the rarity of those haplotypes. On the other hand some haplotypes were detected frequently over all locations. Earlier studies showed similar results for S. sclerotiorum (Clarkson et al. 2013; Júnior et al. 2011, Atallah et al. 2004; Sexton and Howlett 2004; Anderson and Kohn 1995). Isolates from Australia and temperate regions of North America had diverse populations through outcrossing and clonal reproduction (Sexton and Howlett 2004) whereas no sexual recombination was observed among isolates from Canadian oilseed fields, and only a single clone was isolated repeatedly across 2000 km over a period of four years (Anderson and Kohn

1995; Kohli et al. 1992).

From the 80 isolates from 11 locations, 34 MCGs were identified. Among the MCGs,

41.2% (14 out of 34) were haplotype 1 and 12 MCGs contained only haplotype 1 isolates.

Haplotype 1 isolates were present in all 10 locations in Bangladesh, but not in population 11 from Ohio. This could indicate a lack of relationship between S. sclerotiorum populations from the two regions, although the small sample size from Ohio precludes definitive conclusions. In principle component analysis, isolates from Ohio clustered with isolates from one location

(Jamalpur) in Bangladesh, but separately from isolates from other locations. In addition, isolates from Ohio were members of four MSGs, none of which were present in Bangladesh.

In general, there should be a linkage between MCG and haplotype, but we found that 14

MCGs were a single haplotype, haplotype 1. These results do not support a linkage between

MCGs and microsatellite haplotypes that may result from sexual reproduction. Similar results were reported by others (Atallah et al 2004; Malvarex et al 2007) who concluded that mycelial compatibility in S. sclerotiorum is not fully understood and is not always associated with DNA fingerprints. On the other hand, 11.8% of the MCGs (MCG 1- 4) each contained more than one

37 haplotype, indicating that some populations may be evolving gradually. According to Hambleton et al. (2002), multiple haplotypes in one MCG, indicate that new genotypes are evolving through mutation or genetic recombination.

This study explored morphological and genetic variability of S. sclerotiorum collected from 11 locations in Bangladesh and Ohio. To understand the population structure and diversity of S. sclerotiorum of Bangladesh more clearly, more samples will have to be collected for further study with additional SSR markers. In this study, the isolate collection was limited to a relatively small number of rapeseed-mustard growing areas. The number of isolates from Ohio was also lower than needed for stringent comparisons. Inclusion of additional isolates would result in a more informative study than was possible here.

Acknowledgements

This research was supported by the United States Agency for International Development, as part of the Feed the Future initiative, under the CGIAR Fund, award number BFS-G-11-

00002, and the predecessor fund the Food Security and Crisis Mitigation II grant, award number

EEM-G-00-04-00013, and by state and federal funds appropriated to the Ohio Agricultural

Research and Development Center (OARDC), The Ohio State University.

References

Abreu, M. J., and Souza, E. A. 2015. Investigation of Sclerotinia sclerotiorum strains variability in Brazil. Genetics and Molecular Research 14:6879-6896.

Admassu, B., Friedt, W., and Ordon, F. 2010. Genetic characterization of Puccinia graminis f. sp. tritici populations from Ethiopia by SSRs. Journal of Phytopathology 158:806-812.

Ahmadi, M. R., Javan-Nik- Khan, M., Aghajani, M and Ghobakhloo, M. 2012. Morphological variability among Sclerotinia sclerotiorum populations associated with stem rot of important crops and weeds. World Applied Sciences Journal 20:1561-1564.

Aldrich-Wolfe, L., Travers, S., and Nelson Jr, B. D. 2015. Genetic variation of Sclerotinia sclerotiorum from multiple crops in the north central United States. PLoS One 10:e0139188.

Anderson, J. B., and Kohn, L. M. 1995. Clonality in soilborne, plant-pathogenic fungi. Annual Review of Phytopathology 33:369-391.

Balloux, F., and Lugon‐Moulin, N. 2002. The estimation of population differentiation with microsatellite markers. Molecular Ecology 11:155-165.

Bayraktar, H., Dolar, F. S., and Tör, M. 2007. Determination of genetic diversity within Ascochyta rabiei (Pass.) Labr., the cause of Ascochyta blight of chickpea in Turkey. Journal of Plant Pathology 89:341-347.

Boland, G. J., and Hall, R. 1994. Index of plant hosts of Sclerotinia-Sclerotiorum. Canadian Journal of Plant Pathology-Revue Canadienne De Phytopathologie 16:93-108.

Bolton, M., D., Bart, P. H. J., Thomma, and Nelson, B. D. 2006. Sclerotinia sclerotiorum (Lib.) de Bary: biology and molecular traits of a cosmopolitan pathogen. Molecular Plant Pathology 7:1-16.

Capote, N., Pastrana, A. M., Aguado, A., and Sánchez-Torres, P. 2012. Molecular tools for detection of plant pathogenic fungi and fungicide resistance. Pages 151-202 in: Plant Pathology. C. J. Cumagun, eds. InTech, available from http://www.intechopen.com/books/plantpathology/ molecular-tools-for-detection-of-plant-pathogenic-fungi-and-fungicide-resistance.

Caten CE, 1972. Vegetative compatibility and cytoplasmic infection in fungi. Journal of General Microbiology 72:221-9.

Clarkson, J. P., Coventry, E., Kitchen, J., Carter, H. E., and Whipps, J. M. 2013. Population structure of Sclerotinia sclerotiorum in crop and wild hosts in the UK. Plant Pathology 62:309- 324.

Cubeta, M. A., Cody, B. R., Kohli, Y., and Kohn, L. M. 1997. Clonality in Sclerotinia sclerotiorum on infected cabbage in eastern North Carolina. Phytopathology 87:1000-1004.

Dunn, A. R., J. R. Kikkert, and S. J. Pethybridge. 2017. Genotypic characteristics in populations of Sclerotinia sclerotiorum from New York State, USA. Annals of Applied Biology 170:219- 228.

Earnshaw, D., and Boland, G. J. 1997. Mycelial compatibility groups in Sclerotium cepivorum. Plant Pathology 46:229-238.

Ellegren, H. 2004. Microsatellites: simple sequences with complex evolution. Nature Reviews. Genetics 5:435.

Excoffier, L., and Lischer, H. E. L. 2010. Arlequin suite ver 3.5: A new series of programs to perform population genetics analyses under Linux and Windows. Mol. Ecol. Resour. 10:564- 567.

Gaggiotti, O. E., Lange, O., Rassmann, K., and Gliddon, C. 1999. A comparison of two indirect methods for estimating average levels of gene flow using microsatellite data. Molecular Ecology 8:1513-1520.

Jana, T., Sharma, T. R., and Singh, N. K. 2005. SSR-based detection of genetic variability in the charcoal root rot pathogen Macrophomina phaseolina. Mycological Research 109:81-86.

Karaoglu, H., Lee, C. M. Y., and Meyer, W. 2004. Survey of simple sequence repeats in completed fungal genomes. Molecular Biology and Evolution 22:639-649.

Katti, M. V., Ranjekar, P. K., and Gupta, V. S. 2001. Differential distribution of simple sequence repeats in eukaryotic genome sequences. Molecular Biology and Evolution 18:1161-1167.

Kohli, Y., Morrall, R. A. A., Anderson, J. B., and Kohn, L. M. 1992. Local and trans-Canadian clonal distribution of Sclerotinia sclerotiorum on canola. Phytopathology 82:875-880.

Kohn, L. M., Carbone, I., and Anderson, J. B. 1990. Mycelial interactions in Sclerotinia sclerotiorum. Experimental Mycology 14:255-267.

Kohn, L. M., Stasovski, E., Carbone, I., Royer, J., and Anderson, J. B. 1991. Mycelial incompatibility and molecular markers identify genetic variability in field populations of Sclerotinia sclerotiorum. Phytopathology 81:480-485.

Leslie, J. F. 1993. Fungal vegetative compatibility. Annual Review of Phytopathology 31:127- 150.

Li, Z., Wang, Y., Chen, Y., Zhang, J., and Fernando, W. D. 2009. Genetic diversity and differentiation of Sclerotinia sclerotiorum populations in sunflower. Phytoparasitica 37:77-85. 40

Matsuoka, Y., Mitchell, S. E., Kresovich, S., Goodman, M., and Doebley, J. 2002. Microsatellites in Zea–variability, patterns of mutations, and use for evolutionary studies. Theoretical and Applied Genetics 104:436-450.

Meirmans P.G., and Van Tienderen, P.H. 2004. Genotype and genodive: two programs for the analysis of genetic diversity of asexual organisms. Mol. Ecol. Notes 4:792–794.

Ni, Y., Guo, Y. J., Wang, J., Xia, R. E., Wang, X. Q., Ash, G., and Li, J. N. 2014. Responses of physiological indexes and leaf epicuticular waxes of Brassica napus to Sclerotinia sclerotiorum infection. Plant Pathology 63:174-184.

Njambere, E. N., Chen, W., Frate, C., Wu, B. M., Temple, S. R., and Muehlbauer, F. J. 2008. Stem and crown rot of chickpea in California caused by Sclerotinia trifoliorum. Plant Disease 92:917-922.

Peakall, R. O. D. and Smouse, P. E. 2006. GENALEX 6: genetic analysis in Excel. Population genetic software for teaching and research. Molecular Ecology Resources 6:288-295.

Purdy, L. H. 1979. Sclerotinia sclerotiorum: history, disease and symtomatology, host range, geographic distribution and impact. Phytoathology 69:875-80.

Remesal, E., Jordán‐Ramírez, R., Jiménez‐Díaz, R. M., and Navas‐Cortés, J. A. 2012. Mycelial compatibility groups and pathogenic diversity in Sclerotium rolfsii populations from sugar beet crops in Mediterranean‐type climate regions. Plant Pathology 61:739-753.

Schafer, M. R., and Kohn, L. M. 2006. An optimized method for mycelial compatibility testing in Sclerotinia sclerotiorum. Mycologia 98:593-597.

Sexton, A. C., and Howlett, B. J. 2004. Microsatellite markers reveal genetic differentiation among populations of Sclerotinia sclerotiorum from Australian canola fields. Current Genetics 46:357-365.

Sharopova, N. 2008. Plant simple sequence repeats: distribution, variation, and effects on gene expression. Genome 51:79-90.

Sirjusingh, C., and Kohn, L. M. 2001. Characterization of microsatellites in the fungal plant pathogen, Sclerotinia sclerotiorum. Molecular Ecology Resources 1:267-269.

Tóth, G., Gáspári, Z., and Jurka, J. 2000. Microsatellites in different eukaryotic genomes: survey and analysis. Genome Research 10:967-981.

White, T. J., Bruns, T., Lee, S. J. W. T., and Taylor, J. L. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR protocols: A Guide to Methods and Applications 18:315-322.

Winton, L. M., Krohn, A. L., and Leiner, R. H. 2007. Microsatellite markers for Sclerotinia subarctica nom. prov., a new vegetable pathogen of the High North. Molecular Ecology Resources 7:1077-1079.

Table 2. 1. Origin, population designation and host of Sclerotinia sclerotiorum isolates collected in 2014 from Bangladesh and Ohio, USA and used in SSR marker analysis. .

Isolate Origin Population Host SKMT4 Kunis, Mirzapur, Tangail 1 Mustard SKMT5 Kunis, Mirzapur, Tangail 1 Mustard SKMT6 Kunis, Mirzapur, Tangail 1 Mustard SKMT7 Kunis, Mirzapur, Tangail 1 Mustard SKMT10 Kunis, Mirzapur, Tangail 1 Mustard SKMT13 Kunis, Mirzapur, Tangail 1 Mustard SDJ1 Dhanbari, Jamalpur 2 Mustard SDJ5 Dhanbari, Jamalpur 2 Mustard SDJ6 Dhanbari, Jamalpur 2 Mustard SDJ7 Dhanbari, Jamalpur 2 Mustard SDJ10 Dhanbari, Jamalpur 2 Mustard SDJ11 Dhanbari, Jamalpur 2 Mustard SDJ12 Dhanbari, Jamalpur 2 Mustard SDJ13 Dhanbari, Jamalpur 2 Mustard SDJ16 Dhanbari, Jamalpur 2 Mustard SDJ17 Dhanbari, Jamalpur 2 Mustard SDJ19 Dhanbari, Jamalpur 2 Mustard SDJ20 Dhanbari, Jamalpur 2 Mustard SDJ21 Dhanbari, Jamalpur 2 Mustard SDJ22 Dhanbari, Jamalpur 2 Mustard SDJ23 Dhanbari, Jamalpur 2 Mustard SDJ Dhanbari, Jamalpur 2 Mustard STS1 Sadar, Tangail 3 Mustard STS2 Sadar, Tangail 3 Mustard STS3 Sadar, Tangail 3 Mustard STS4 Sadar, Tangail 3 Mustard STS7 Sadar, Tangail 3 Mustard STS8 Sadar, Tangail 3 Mustard STS10 Sadar, Tangail 3 Mustard STS11 Sadar, Tangail 3 Mustard STS12 Sadar, Tangail 3 Mustard STS13 Sadar, Tangail 3 Mustard SGT1 Ghatail, Tangail 4 Mustard SGT2 Ghatail, Tangail 4 Mustard

Isolate Origin Population Host SGT3 Ghatail, Tangail 4 Mustard SGT4 Ghatail, Tangail 4 Mustard SGT5 Ghatail, Tangail 4 Mustard SGT7 Ghatail, Tangail 4 Mustard SST2 Shohagpur, Tangail 5 Mustard SST5 Shohagpur, Tangail 5 Mustard SST6 Shohagpur, Tangail 5 Mustard SST7 Shohagpur, Tangail 5 Mustard SST8 Shohagpur, Tangail 5 Mustard SST9 Shohagpur, Tangail 5 Mustard SST12 Shohagpur, Tangail 5 Mustard SST15 Shohagpur, Tangail 5 Mustard SST16 Shohagpur, Tangail 5 Mustard SDT1 Deohata, Tangail 6 Mustard SDT2 Deohata, Tangail 6 Mustard SDT3 Deohata, Tangail 6 Mustard SDT6 Deohata, Tangail 6 Mustard SDT7 Deohata, Tangail 6 Mustard SDT9 Deohata, Tangail 6 Mustard SDT10 Deohata, Tangail 6 Mustard SDT11 Deohata, Tangail 6 Mustard SDT12 Deohata, Tangail 6 Mustard SDT13 Deohata, Tangail 6 Mustard SDT14 Deohata, Tangail 6 Mustard SDT15 Deohata, Tangail 6 Mustard SDT16 Deohata, Tangail 6 Mustard SDT18 Deohata, Tangail 6 Mustard SDT19 Deohata, Tangail 6 Mustard SDT24 Deohata, Tangail 6 Mustard SDT26 Deohata, Tangail 6 Mustard SDT28 Deohata, Tangail 6 Mustard SDT Deohata, Tangail 6 Mustard SCS1 Chalakpara, Shirajgonj 7 Mustard SCS2 Chalakpara, Shirajgonj 7 Mustard SCS3 Chalakpara, Shirajgonj 7 Mustard SCS4 Chalakpara, Shirajgonj 7 Mustard SCS5 Chalakpara, Shirajgonj 7 Mustard SCS6 Chalakpara, Shirajgonj 7 Mustard SCS7 Chalakpara, Shirajgonj 7 Mustard SCS9 Chalakpara, Shirajgonj 7 Mustard SCS10 Chalakpara, Shirajgonj 7 Mustard SCS11 Chalakpara, Shirajgonj 7 Mustard 44

Isolate Origin Population Host SCS14 Chalakpara, Shirajgonj 7 Mustard SCS15 Chalakpara, Shirajgonj 7 Mustard SCS16 Chalakpara, Shirajgonj 7 Mustard SCS17 Chalakpara, Shirajgonj 7 Mustard SCS18 Chalakpara, Shirajgonj 7 Mustard SCS19 Chalakpara, Shirajgonj 7 Mustard SCS20 Chalakpara, Shirajgonj 7 Mustard SCS22 Chalakpara, Shirajgonj 7 Mustard SAS1 Sadar, Shirajgonj 8 Mustard SAS2 Sadar, Shirajgonj 8 Mustard SAS3 Sadar, Shirajgonj 8 Mustard SAS4 Sadar, Shirajgonj 8 Mustard SAS5 Sadar, Shirajgonj 8 Mustard SAS6 Sadar, Shirajgonj 8 Mustard SAS7 Sadar, Shirajgonj 8 Mustard SAS8 Sadar, Shirajgonj 8 Mustard SAS12 Sadar, Shirajgonj 8 Mustard SAS14 Sadar, Shirajgonj 8 Mustard SAS15 Sadar, Shirajgonj 8 Mustard SAS16 Sadar, Shirajgonj 8 Mustard SAS17 Sadar, Shirajgonj 8 Mustard SAS18 Sadar, Shirajgonj 8 Mustard SAS19 Sadar, Shirajgonj 8 Mustard SBS2 Bashbari, Shirajgonj 9 Mustard SBS4 Bashbari, Shirajgonj 9 Mustard SBS6 Bashbari, Shirajgonj 9 Mustard SBS7 Bashbari, Shirajgonj 9 Mustard SBS8 Bashbari, Shirajgonj 9 Mustard SBS9 Bashbari, Shirajgonj 9 Mustard SDS1 Deshipur, Shirajgonj 10 Mustard SDS2 Deshipur, Shirajgonj 10 Mustard SDS3 Deshipur, Shirajgonj 10 Mustard SDS7 Deshipur, Shirajgonj 10 Mustard SDS8 Deshipur, Shirajgonj 10 Mustard SDS10 Deshipur, Shirajgonj 10 Mustard SS1 Ohio, USA 11 Pepper SS2 Ohio, USA 11 Pepper SS5 Ohio, USA 11 Pepper SS6 Ohio, USA 11 Cabbage SS7 Ohio, USA 11 Cabbage SS8 Ohio, USA 11 Cabbage JSS1 Ohio, USA 11 Soybean 45

Table 2. 2. Primers used in simple sequence repeat (SSR) analysis of Sclerotinia sclerotiorum isolates from Bangladesh and Ohio, USA.

* Locus/Gen Repeat motif Primer sequence (5-3) T a Size No of Bank (°C) range allele Accession (bp) s number AF377902 (GA)14 TTTGCGTATTATGGTGGGC 55 160-172 4 ATGGCGCAACTCTCAATAGG AF377907 (GTGGT)6 TCTACCCAAGCTTCAGTATTCC 55 284-304 4 GAACTGGTTAATTGTCTCGG AF377908 [(GT)2GAT]3(G CAGACGAATGAGAAGCGAAC 55 245-320 5 T)14GAT(GT)5 TTCAAAACAACGCTCCTGG [GAT(GT)4]3(G AT)3 AF377910 (CA) 12 CACTCGCTTCTCCATCTCC 60 251-271 4 GCTTGATTAGTTGGTTGGCA AF377911 (TTA)9 GCTTGATTAGTTGGTTGGCA 55 345-390 5 TCATAGTGAGTGCATGATGCC AF377918 TACA10 GTTTTCGGTTGTGTGCTGG 60 173-221 7 GCTCGTTCAAGCTCAGCAAG AF377921 (CATA)25 TGCATCTCGATGCTTGAATC 55 491-571 10 CCTGCAGGGAGAAACATCAC AF377925 GTAT)6 and GTAACAAGAGACCAAAATTCG 60 369-391 3 (TACA)5 GTGAACGAGCTGTCATTCCC * T a: annealing temperature

Table 2. 3. Morphological characteristics (mycelial colony diameter, number of sclerotia and weight of sclerotia) of 130 isolates of Sclerotinia sclerotiorum, grouped by location of origin.

Location na Mycelial Number of Sclerotium colony sclerotia weight (mg) diameter (mm) Shirajgang, Deshipara 7 83.9 ab* 25.8 13.5 ab Shirajgang, Sadar 15 83.5 a 25.7 13.7 ab Shirajgang, Basbari 7 82.6 ab 21.4 11.9 ab Jamalpur, Dhonbari 18 82.5 ab 26.8 11.3 ab Tangail, Shohagpur 12 82.5 ab 22.7 13.3 ab Tangail, Deohata 21 82.5 ab 23.5 11.7 ab Tangail, Sadar 10 82.1 ab 23.2 14.1 ab Shirajganj, 20 81.8 ab 25.0 14.2 a Chalakpara Tangail, Ghatail 6 80.8 ab 25.4 15.6 a Tangail, Mirzapur 6 80.6 ab 25.9 8.6 b Ohio, USA 8 76.9 b 24.0 16 a NSb a n: number of isolates from each location b NS: not significant Values significant at p ≤ 0.05 *Mean values designated by the same latter did not differ significantly (Tukey’s test, α = 0.05)

Table 2. 4. Genetic diversity of Sclerotinia sclerotiorum isolates from mustard from ten locations in Bangladesh and from soybean, cabbage and pepper in Ohio, USA.

Population Location Number Number Number of Number Effective Number of of haplotypes of number of of isolates MCGsa alleles genotypesb private allelesc 1 Mirzapur, Tangail 6 3 3 2.37 1.971 0.00 2 Dhanbari, 16 6 3 2.50 1.760 0.12 Jamalpur 3 Tangail, Sadar 10 3 4 2.37 1.907 0.00 4 Ghatail, Tangail 6 2 2 2.00 1.465 0.00 5 Shohagpur, 9 8 4 3.00 2.330 0.00 Tangail 6 Deohata, Tangail 19 7 5 3.12 1.959 0.25 7 Chalakpara, 18 8 7 3.00 2.250 0.00 Shirajgonj 8 Sadar, Shirajgonj 15 5 3 2.62 2.088 0.00 9 Bashbari, 6 4 2 2.25 1.839 0.00 Shirajgonj 10 Deshipur, 6 3 3 2.37 2.032 0.12 Shirajgonj 11 Ohio, USA 7 4 3 2.25 1.785 0.00 Average 4.73 3.55 2.53 1.944 0.04 aMycelial compatibility groups b Effective number of genotypes calculated using GeneAlex c Alleles only found in a single population

Source of variation d.f. Sum of squares Variance Percentage of P value components variation Among populations 10 37.489 0.181 9 0.001 Within populations 107 198.011 1.851 91 Total 117 235.500 2.031 100

Mycelial Isolates compatibility group (MCG) 1 SS2, JSS1 2 STS7, SKMT10 3 SCS1, SCS7, SCS11, SCS17, SCS22, SDS3, SDS10, SGT1, SGT2, SGT3, SHS1, STS1, STS4, STS12, SDJ, SDJ10, SDJ11, SDJ13, SDJ15, SAS6, SAS16, SBS9, SDT12, SST7 4 SAS1, SAS4, SAS14, SDJ1, SBS7, SCS4, SDT11 5 SST8, SBS2 6 SDT2, SDT16, SDT19, SDT24, SAS18, SDJ6 7 SST6, SST15, SDJ5, SDJ12, SDJ21, SDT3, SDT10, SCS16, SCS21, 8 SKMT13, SKMT 7 9 SKMT5 10 SDS8 11 SCS3 12 SGT4 13 SBS6 14 SAS2 15 SST9 16 SAS3 17 SST2 18 SCS18 19 SCS6 20 SST5 21 SS7 22 SDS2 23 SCS2 24 SDT18 25 SST16 26 SST12 27 SCS5 28 STS13 29 SDJ19 30 SS3 31 SS8 32 SDJ20 33 SDT15 34 SDT6

Table 2.7. Relationship between mycelial compatibility group (MCG) and haplotype at eight microsatellite loci for isolates of Sclerotinia sclerotiorum collected from ten locations in Bangladesh and one in Ohio, USA.

Isolates Location Mycelial compatibility group Haplotype SKMT10 Mirzapur, Tangail 2 3 SKMT7 Mirzapur, Tangail 8 1 SKMT13 Mirzapur, Tangail 8 1 SKMT5 Mirzapur, Tangail 9 2 SKMT4 Mirzapur, Tangail ND1 1 SKMT6 Mirzapur, Tangail ND1 1 SDJ10 Dhanbari, Jamalpur 3 1 SDJ11 Dhanbari, Jamalpur 3 1 SDJ13 Dhanbari, Jamalpur 3 1 SDJ Dhanbari, Jamalpur 3 1 SDJ1 Dhanbari, Jamalpur 4 1 SDJ6 Dhanbari, Jamalpur 6 1 SDJ5 Dhanbari, Jamalpur 7 1 SDJ12 Dhanbari, Jamalpur 7 1 SDJ21 Dhanbari, Jamalpur 7 1 SDJ19 Dhanbari, Jamalpur 29 1 SDJ20 Dhanbari, Jamalpur 32 1 SDJ17 Dhanbari, Jamalpur ND1 1 SDJ22 Dhanbari, Jamalpur ND1 1 SDJ23 Dhanbari, Jamalpur ND1 1 SDJ7 Dhanbari, Jamalpur ND1 4 SDJ16 Dhanbari, Jamalpur ND1 5 SDJ15 Dhanbari, Jamalpur 3 ND2 STS7 Tangail, Sadar 2 8 STS4 Tangail, Sadar 3 1 STS12 Tangail, Sadar 3 1 STS1 Tangail, Sadar 3 6 STS13 Tangail, Sadar 28 1 STS3 Tangail, Sadar ND1 1 STS8 Tangail, Sadar ND1 1 STS10 Tangail, Sadar ND1 1 STS11 Tangail, Sadar ND1 1 STS2 Tangail, Sadar ND1 7 SGT1 Ghatail, Tangail 3 1 SGT2 Ghatail, Tangail 3 1 SGT3 Ghatail, Tangail 3 1 51

Isolates Location Mycelial compatibility group Haplotype SGT4 Ghatail, Tangail 12 7 SGT5 Ghatail, Tangail ND1 1 SGT7 Ghatail, Tangail ND1 1 SHS1 Ghatail, Tangail 3 ND2 SST7 Shohagpur, Tangail 3 1 SST8 Shohagpur, Tangail 5 1 SST6 Shohagpur, Tangail 7 1 SST15 Shohagpur, Tangail 7 1 SST9 Shohagpur, Tangail 15 1 SST2 Shohagpur, Tangail 17 9 SST5 Shohagpur, Tangail 20 10 SST16 Shohagpur, Tangail 25 1 SST12 Shohagpur, Tangail 26 11 SDT12 Deohata, Tangail 3 1 SDT11 Deohata, Tangail 4 1 SDT2 Deohata, Tangail 6 1 SDT16 Deohata, Tangail 6 1 SDT19 Deohata, Tangail 6 1 SDT24 Deohata, Tangail 6 1 SDT3 Deohata, Tangail 7 1 SDT10 Deohata, Tangail 7 1 SDT18 Deohata, Tangail 24 1 SDT15 Deohata, Tangail 33 14 SDT6 Deohata, Tangail 34 12 SDT1 Deohata, Tangail ND1 1 SDT7 Deohata, Tangail ND1 1 SDT13 Deohata, Tangail ND1 1 SDT26 Deohata, Tangail ND1 1 SDT28 Deohata, Tangail ND1 1 SDT Deohata, Tangail ND1 1 SDT14 Deohata, Tangail ND1 9 SDT9 Deohata, Tangail ND1 13 SCS1 Chalakpara, Shirajgonj 3 1 SCS7 Chalakpara, Shirajgonj 3 1 SCS11 Chalakpara, Shirajgonj 3 1 SCS17 Chalakpara, Shirajgonj 3 1 SCS22 Chalakpara, Shirajgonj 3 1 SCS4 Chalakpara, Shirajgonj 4 17 SCS16 Chalakpara, Shirajgonj 7 1 SCS3 Chalakpara, Shirajgonj 11 16 SCS18 Chalakpara, Shirajgonj 18 20 SCS6 Chalakpara, Shirajgonj 19 19 SCS2 Chalakpara, Shirajgonj 23 15 SCS5 Chalakpara, Shirajgonj 27 18 SCS9 Chalakpara, Shirajgonj ND1 1 52

Isolates Location Mycelial compatibility group Haplotype SCS10 Chalakpara, Shirajgonj ND1 1 SCS14 Chalakpara, Shirajgonj ND1 1 SCS15 Chalakpara, Shirajgonj ND1 1 SCS19 Chalakpara, Shirajgonj ND1 1 SCS20 Chalakpara, Shirajgonj ND1 20 SCS21 Chalakpara, Shirajgonj 7 ND2 SAS6 Sadar, Shirajgong 3 1 SAS16 Sadar, Shirajgong 3 1 SAS1 Sadar, Shirajgong 4 1 SAS4 Sadar, Shirajgong 4 1 SAS14 Sadar, Shirajgong 4 22 SAS18 Sadar, Shirajgong 6 1 SAS2 Sadar, Shirajgong 14 1 SAS3 Sadar, Shirajgong 16 21 SAS5 Sadar, Shirajgong ND1 1 SAS7 Sadar, Shirajgong ND1 1 SAS8 Sadar, Shirajgong ND1 1 SAS12 Sadar, Shirajgong ND1 1 SAS15 Sadar, Shirajgong ND1 1 SAS19 Sadar, Shirajgong ND1 1 SAS17 Sadar, Shirajgong ND1 22 SBS9 Bashbari, Shirajgonj 3 1 SBS7 Bashbari, Shirajgonj 4 1 SBS2 Bashbari, Shirajgonj 5 1 SBS6 Bashbari, Shirajgonj 13 23 SBS4 Bashbari, Shirajgonj ND1 1 SBS8 Bashbari, Shirajgonj ND1 1 SDS3 Deshipur, Shirajgong 3 1 SDS10 Deshipur, Shirajgong 3 25 SDS8 Deshipur, Shirajgong 10 1 SDS2 Deshipur, Shirajgong 22 24 SDS1 Deshipur, Shirajgong ND1 1 SDS7 Deshipur, Shirajgong ND1 1 SS2 Ohio, USA 1 26 JSS1 Ohio, USA 1 25 SS7 Ohio, USA 21 25 SS8 Ohio, USA 31 26 SS1 Ohio, USA ND1 25 SS6 Ohio, USA ND1 25 SS5 Ohio, USA ND1 27 SS3 Ohio, USA 30 ND2 *ND1= Isolates were not included in SSR test; only MCG test was conducted *ND2=Isolates were not included in MCG test; only SSR marker analysis was conducted

Figure 2. 1. Three districts in Bangladesh from which Sclerotinia sclerotiorum isolates were collected from mustard plants in 2014.

Figure 2. 2. Culture and sclerotial morphology of Sclerotinia sclerotiorum isolates. The image was taken after 7 days of culture.

90 Population Population9 80 Population8 Population7 Population6 70 Population5 Population4 Population3 60 Population2 s

e Population11 t a l 50 Population10 o

s Population1 i

f o

40 . o N 30

0 Haplotype 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 1 1 1 1 1 1 1 1 1 1 2 2 2 2 2 2 2 2

Figure 2. 3. Frequency of haplotypes within 11 populations of Sclerotinia sclerotiorum isolates from ten locations in Bangladesh (Populations 1-10) and one from Ohio, USA (Population 11).

2 Population Population1 Population10 Population11 Population2 1 Population3

t Population4 n

e Population5

n Population6 o

p Population7 m Population8 o 0 C

Population9 d n o c e S -1

-2 -2.0 -1.5 -1.0 -0.5 0.0 0.5 1.0 1.5 First Component

Figure 2.4. Principle component analysis (PCA) of genetic diversity of Sclerotinia sclerotiorum populations from mustard plants in Bangladesh (Pop1 – Pop10) and cabbage, pepper and soybean plants in Ohio, USA (Pop 11). PCA was calculated based on Eigen values of first two principle components. Among the isolates from Bangladesh, populations 1, 3, 4, 5 and 6 were from Tangail, population 2 was from Jamalpur, and populations 7, 8, 9 and 10 were from Shirajgonj.

Population Population9 Population8 20 Population7 Population6 Population5 Population4 Population3 s

e Population2

t 15 a

l Population11 o

s Population10 I

f Population1 o

o 10 N

0 MCG 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 1 2 3 4 1 1 1 1 1 1 1 1 1 1 2 2 2 2 2 2 2 2 2 2 3 3 3 3 3

Figure 2. 6. Frequency of mycelial compatibility groups (MCGs) of Sclerotinia sclerotiorum isolates from ten locations in Bangladesh (Populations 1-10) and one in Ohio, USA (Population 11).

Chapter 3

Sensitivity of Sclerotinia sclerotiorum isolates from Bangladesh to selected fungicides

Abstract. Sensitivity of Sclerotinia sclerotiorum to iprodione, propiconazole, fluazinam and penthiopyrad was determined using isolates collected from ten locations in Bangladesh and from

Ohio, USA in 2014. Sensitivity was assessed using discriminatory doses and concentrations and

50% mycelial inhibition (EC50) values were determined. Compared with the EC50 of the fungicides to S. sclerotiorum from the published literature, none of the tested S. sclerotiorum isolates were resistant to iprodione, propiconazole, fluazinam or penthiopyrad. However, some isolates of S. sclerotiorum exhibited reduced sensitivity to propiconazole. The EC50 values obtained in the first experiment ranged from 0.18 – 0.50 ppm, 0.12 - 0.78 ppm, 0.0019 – 0.0044 ppm and 0.012 – 0.429 ppm for iprodione, propiconazole, fluazinam and penthiopyrad, respectively. In the second experiment, EC50 values ranged from 0.16 – 0.36 ppm, 0.02 – 0.93 ppm, 0.0024 – 0.0050 ppm and 0.08 – 0.83 ppm for iprodione, propiconazole, fluazinam and penthiopyrad respectively. Relative toxicity index (RTI) values, using iprodione as the standard, were 103.2 and 67.6 (experiments 1 and 2, respectively) for fluazinam, and 6.0 and 1.6

(experiments 1 and 2, respectively) for penthiopyrad. Propiconazole was similar to iprodione in toxicity to S. sclerotiorum. Fluazinam and penthiopyrad are not registered yet in Bangladesh.

Iprodione and propiconazole are registered for other diseases, but not resigtered yet for white mold management in mustard, therefore the EC50 values of fluazinam and pethiopyrad

60 determined in this study can be considered baseline sensitivity levels for future efforts to monitor development of resistance to these fungicides in S. sclerotiorum in Bangladesh.

Introduction

Sclerotinia sclerotiorum is a cosmopolitan pathogenic fungus that causes disease in more than 400 crops, including mustard (Brassica campestris, B. napus, B. juncia). The fungus was first identified in Bangladesh in 2007 in mustard fields and is considered a severe threat to crop production (Hossain et al. 2008). White mold disease caused by S. sclerotiorum is the main fungal disease of mustard in many countries and can cause large yield losses (Zhuo and Luo

1994; Bardin and Huang 2001; Bolton and Nelson 2006; Kuang et al. 2011a). White mold of mustard is difficult to control and there are no commercially available resistant varieties.

Application of fungicides is the major tactic used to manage the disease in mustard (Wang et al.

2014). The benzimidazoles thiophanate methyl and carbendazim have been used widely in many countries to control white mold of mustard for more than 20 years (Pan et al. 1997).

Carbendazim was one of the most common fungicides used in in mustard during the 1980s and

1990s worldwide. As a result, high levels of resistance to carbendazim have been reported since the late 1990s (Pan 1998; Shi et al. 1999; Zhang et al. 2003; Qi et al 2006; Kuang et al. 2011a).

Iprodione and procymidone have also been used to manage S. sclerotiorum in the last several decades. However, low levels of resistance have been reported (Ma et al. 2009; Zhou et al.

2014a, b). Since last decade, the dicarboximide fungicides iprodione (FRAC code 02) and dimethachlon have been using in Asian countries, including Bangladesh, to control white mold in mustard. However, no information on status of resistance to these or other fungicides in S. sclerotiorum in Bangladesh is available.

The sterol demethylation-inhibiting (DMI) fungicide propiconazole (FRAC code 03) has 61 been used to manage dollar spot caused by Sclerotinia homoeocarpa in the United States since

1979 (Golembiewski et al. 1995). DMI fungicides can be used at low concentration and long application intervals as they are systemic in nature (Ktiller and Scheinpflug 1987). This class fungicide restricts ergosterol biosynthesis by demethylation of C-14 methyl sterols. Ergosterol is essential for formation of cell membrane of fungi. Propiconazole is one of the important DMI fungicides showed effective against S. sclerotiorum in laboratory evaluation (Dalili et al. 2015;

Li et al. 2015). Propiconazole was very effective against different fungi like Monilinia fruticola,

Sclerotinia homoeocarpa in the USA for up to 15 years after its introduction (Schnabel et al.

2004; Golembiewski et al. 1995). However, during 2001 and 2003 serious epidemics of brown rot of peach in orchards in South Carolina were recorded. It was assumed that the outbreak was due to reduced sensitivity in M. fruticola to propiconazole (Schnabel et al. 2004). As this group of fungicides was effective against different fungi, a number of field and laboratory experiments on efficacy and baseline sensitivity to S. sclerotiorum were conducted in China (Li et al. 2015).

Fluazinam is a dinitroaniline fungicide (FRAC code 29) used as a preventive contact fungicide. Fluazinam interrupts mitochondrial oxidative phosphorylation and stops synthesis of adenosine triphosphate (ATP), which is essential for cellular energy, without affecting the respiratory chain and ATP synthase (Vitoratos 2014). Fluazinam is a highly effective fungicide with broad-spectrum activities, but has little curative or systemic activity. However, it has good persistence and rainfastness. As it is a protectant fungicide, it must be applied prior to disease onset for best results (Butzler et al. 1998). Efficacy of fluazinam has been reported against

Sclerotinia blight in peanut caused by S. minor and lettuce drop caused by S. sclerotiorum or S. minor (Anema and Bouwman 1992; Lemay et al. 2002; Matheron and Porchas 2004; Smith et al.

2008). Omega®500F, which contains fluazinam as the active ingredient, is labeled for white

62 mold control for several crops in the USA.

Penthiopyrad (FRAC code 07) is a recently developed fungicide in the carboxamide group. It functions as a succinate dehydrogenase inhibitor (SDHI) and limits fungal growth by interfering with energy production in the mitochondrial electron transport system (Yanase et al.

2007). Penthiopyrad was registered in the USA in 2012 to control many pathogens including S. sclerotiorum (Grichar and Woodward 2016).

Iprodione and propiconazole are currently recommended in Bangladesh to control white mold disease of mustard. However, they are not highly effective in controlling this disease.

There has been no published work on sensitivity of S. sclerotiorum isolates in Bangladesh to these fungicides. Moreover, in anticipation of future access in Bangladesh to more effective fungicides such as penthiopyrad and fluazinam, baseline sensitivities in S. sclerotiorum populations to these fungicides should be determined prior to their introduction to allow monitoring for fungicide resistance development. The objectives of this study were to determine baseline sensitivities to fluazinam and penthiopyrad in S. sclerotiorum populations from three mustard-producing regions of Bangladesh, to assess resistance in these populations to the commonly used fungicides iprodione and propiconazole, and to determine the toxicity to these isolates of propiconazole, fluazinam and penthiopyrad relative to that of iprodione.

Materials and Methods

Collections of Sclerotinia sclerotiorum isolates. A total of 116 isolates of S. sclerotiorum were collected from mustard fields in ten locations in Bangladesh. Eight isolates were collected from vegetable crops and soybeans in Ohio, USA. Isolates were identified and characterized based on their morphology and genetic characters (Chapter 2). One hundred twenty-four isolates were

63 evaluated for sensitivity to iprodione and propiconazole and 51 isolates were tested for sensitivity to fluazinam and penthiopyrad. Sensitivity to iprodione, propiconazole, fluazinam and penthiopyrad was tested in separate experiments and all the experiments conducted twice.

Fungicides. Commercial formulations of four fungicides were tested: Rovral® (iprodione, 41.6% a.i., FMC, USA), Tilt® (propiconazole, 41.8% a.i., Syngenta, USA), Omega®500F (fluazinam,

40% a.i., Syngenta, USA) and Fontelis® (penthiopyrad, 20.4% a.i., DuPont, USA).

Determination of EC50 values of Bangladesh isolates S. sclerotiorum to iprodione, propiconazole, fluazinam and penthiopyrad. Fungicides were dissolved in sterile water to prepare stock solutions. Stock solution of fungicide was added to potato dextrose agar (PDA) medium at different amount to make following final concentrations of active ingredient in PDA medium: Iprodione, 0.0001, 0.001, 0.01, 0.1, 0.3, 1.0, and 10.0 ppm; propiconazol, 0.001, 0.01,

0.1, 0.3, 1.0, 10.0 and 100.0 ppm; fluazinam, 0.00001, 0.0001, 0.001, 0.003, 0.01, 0.1 and 1.0 ppm; and penthiopyrad; 0.0001, 0.001, 0.01, 0.03, 0.1, 1.0 and 3.0 ppm. The effective concentration for 50% inhibition of mycelial growth (EC50) was calculated by comparing the colony diameter after two days of incubation on fungicide-amended medium with the diameter of non-treated control colony (Ma et al. 2009). A 5 mm mycelial plug of a 36-hour-old culture of each isolate was plated on PDA medium in 9 cm-diameter petri plates amended with each concentration of fungicide. Cultures were arranged in a randomized complete block design with three replications. Colony diameter was measured after 48 hours incubation at 24° C temperature in the 12 h/12 h dark/light condition in two perpendicular directions including the original mycelial plug diameter (5 mm), which was subtracted from the recorded diameter. Relative

64 growth of mycelia on each plate was calculated by comparing amended and non-amended control colony diameters for each concentration according to the following formula:

!"#$%&'% !!"#!$ !"#$%& !" !"#$%&%'( !""#$%#% !"#$%! !"#$%&'% !"#$"% !"#$%& !" !"# !"#$%! !"#$ (!" !"#$%&%'()

Determination of Relative Toxicity Index (RTI). RTI of propiconazole, fluazinam and penthiopyrad were calculated from the mean EC50 of S. sclerotiorum isolates to compare the relative effective ness of fungicides. Iprodione was used as reference fungicide. The relative toxicity indices (RTI) (Liang et al. 2015; Sun 1950) for propiconazole, fluazinam and penthiopyrad compared to iprodione were calculated using the following formula:

RTI= !"#$ !"#$ !"#$%& !" !"#$%!$&' !"#$ !"#$ !"#$%& !" !"#!"$ !"#$%&%'(

Statistical Analysis. Each of the data points were checked by scatter plots graphs in Microsoft

Excel 2007. Relative mycelial growth data were plotted against log10 transformed concentrations for each replication. Outlying data points that did not fit a sigmoid curve were not included in the analysis. The EC50 values were calculated by regression analysis of relative mycelial growth against the log10 transformation of each fungicide concentration using statistical software “R

Studio” (Packagae: plyr). Tukey’s multiple comparison test of ANOVA (analysis of variance) was done with Minitab 16.0 (Minitab Inc.) to test significant differences in mean EC50 values among different isolates and locations. Normality of frequency distribution of S. sclerotiorum isolates at different EC50 values were also tested using Statistical software Minitab 16.0.

Test for equal variance (Levene’s test) of EC50 values for the two experiments for each fungicide was conducted. Variation between the two experiments testing iprodione, fluazinam and penthiopyrad was non-significant (P>0.05), however the variation between the two 65 experiments testing propiconazole were significant (P<0.05) (Table 3.1). All the graphs and tables are presented separately for the two experiments for each fungicide.

Results

Sensitivity of S. sclerotiorum to iprodione, propiconazole, fluazinam and penthiopyrad. In the first experiment, iprodione EC50 values for 124 S. sclerotiorum isolates were distributed normally, with a mean of 0.32 ppm and a range of 0.18 - 0.50 ppm (Figure 3.1, Figure 3.3, Table

3.2). EC50 values for the majority (71.8%) of the strains were between 0.28 - 0.37 ppm. In the second experiment, iprodione EC50 values for the 124 S. sclerotiorum isolates ranged from 0.16

– 0.37 ppm, with a mean of 0.23 ppm (Figure 3.2, Table 3.2). EC50 values for 70% of the strains were distributed in three class intervals between 0.19 - 0.27 ppm iprodione. Differences among

S. sclerotiorum isolates in sensitivity to iprodione were significant in both experiments (Table

3.3). In contrary, differences among mean EC50 values of 11 locations were non-significant to iprodione in both experiments (Table 3.7).

In the first experiment, propiconazole EC50 values for 124 S. sclerotiorum isolates were also normally distributed, with a mean of 0.32 ppm and a range of 0.12 - 0.78 ppm (Figure 3.4,

Figure 3.6, Table 3.2). EC50 values for the majority (58%) of the strains were between 0.30 - 0.38 ppm. In the second experiment, iprodione EC50 values for 124 S. sclerotiorum isolates ranged from 0.02 - 0.93 ppm with a mean 0.27 ppm (Figure 3.5, Table 3.2). EC50 values for 95% of strains were distributed in four class intervals between 0.02- 0.53 ppm. A similar trend was observed for sensitivity to propiconazole. Differences among S. sclerotiorum isolates in sensitivity to propiconazole were significant in both experiments (Table 3.4). In the first experiment, differences among mean EC50 values of 11 locations were significant, however, in 66 the second experiment the mean EC50 values of 11 locations were non-significant (Table 3.7).

The mean EC50 values of fluazinam for 51 S. sclerotiorum of the first experiment were

0.0031 with a range of 0.0019 - 0.0044 ppm (Figure 3.7, Table 3.2). EC50 for the majority

(35.3%) of the strains were between 0.0031 – 0.0034 ppm. In the second experiment, fluazinam

EC50 values for 51 S. sclerotiorum isolates ranged from 0.0024 – 0.0050 ppm with a mean of

0.0034 ppm (Figure 3.8, Figure 3.9, Table 3.2). About 72% of the strains were distributed in three class intervals between 0.0028 – 0.0039 ppm fluazinam. Differences among S. sclerotiorum isolates in sensitivity to fluazinam were significant in both experiments (Table 3.5). The differences among mean EC50 values of 11 locations were non-significant in the first experiment, but significant in second experiment (Table 3.7).

Finally, in the first experiment, penthiopyrad mean EC50 values for 51 S. sclerotiorum isolates were 0.0528 ppm with a range of 0.012 – 0.429 ppm. Distribution of penthiopyrad EC50 values for 51 S. sclerotiorum isolates were unimodal and 91% of the strains were between 0.012

– 0. 082 ppm (Figure 3.10, Table 3.2). In the second experiment, penthiopyrad EC50 values for

51 isolates of S. sclerotiorum isolates ranged from 0.08 - 0.85 ppm, with a mean of 0.14 ppm

(Figure 3.11, Figure 3.12, Table 3.2). EC50 values for 90% of the isolates were distributed in two class intervals between 0.01 - 0. 27 ppm penthiopyrad. Differences among S. sclerotiorum isolates in sensitivity to penthiopyrad were significant in both experiments (Table 3.6).

Differences among mean EC50 values of 11 locations were non-significant to penthiopyrad in both experiments (Table 3.7)

Relative toxicity index (RTI) of tested fungicides. In the first experiment, toxicities of propiconazole, fluazinam and penthiopyrad relative to iprodione (RTI) were 1.0, 103.2 and 6.0

67 respectively (Table 3.2). Similar results were observed in the second experiment where RTIs of propiconazole, fluazinam and penthiopyrad were 0.8, 67.6 and 1.6 respectively. Considering the locations, sensitivity of S. sclerotiorum isolates based on RTI, isolates from Ohio showed less sensitivity to fluazinam (RTI = 74.53), penthiopyrad (RTI = 1.68) and propiconazole (RTI =

0.55) in the first experiments (Table 3.7). However, in the second experiments isolates from four locations of Bangladesh (Bashbari, Shirajgang; Deohata, tangail; Ghatail, Tangail and Sadar,

Shirajgang) showed less sensitivity than Ohio isolates to fluazinam. Similarly, isolates from

Chalakpara, Shirajgang showed less sensitivity than Ohio isolates to penthiopyrad. In case of propiconazole, isolates from Ohio showed less sensitivity than isolates from Bangladesh (Table

3.7).

Discussion

In Bangladesh, research on baseline sensitivity of new fungicides to major fungal pathogens, and monitoring of fungicide resistance system has not been well established. As a result, no information is available on baseline sensitivity of major pathogens including S. sclerotiorum. It is also essential to determine baseline sensitivity of a target pathogen to a new fungicide for future decision-making on disease management strategies.

The dicarbaximide fungicide iprodione and DMI fungicide propiconazole have been used for a long time in Bangladesh to control many foliar diseases. Until February 2016, iprodione and propiconazole had not been labeled for S. sclerotiorum (Bangladesh Crop Protection

Association 2016). However, growers in different areas are using these two fungicides against S. sclerotiorum in consultation with the pesticide dealers. As a result there is a chance of exposing

S. sclorotiorum isolates from Bangladesh to iprodione and propiconazole and preclude determination of baseline sensitivity. The average EC50 values of iprodione and propiconazole

68 were compared with the results of published literature. Liu et al. (2009) evaluated 161 S. sclerotiorum isolates to test sensitivity to iprodione and the average EC50 values ranged from

0.117 – 0.634 ppm. This range of EC50 of S. sclerotiorum was recorded as sensitive to iprodione.

Considering these values (0.117-0.634 ppm) as baseline, no isolates of S. sclerotiorum from

Bangladesh were found resistant to iprodione. Miller et al. (2002) tested more than 400 isolates of S. homoeocarpa against propiconazole and identified some isolates with reduced sensitivity with EC50 values of 0.026 ppm. Comparing the EC50 values in the article published by Miller et al. (2000), all of the isolates from Bangladesh demonstrated reduced sensitivity to propiconazole.

Fluazinam and penthiopyrad have not been registered for any plant pathogens in

Bangladesh (Bangladesh Crop Protection Association 2016). The generated information on mean

EC50 values for isolates from Bangladesh to these two fungicides could be used as baseline sensitivity data. Liang et al. (2015) tested 150 isolates of S. sclerotiorum collected from different locations in China to determine baseline sensitivity to fluazinam. The EC50 values of these 150 isolates ranged from 0.0004 – 0.0056 ppm. Isolates from Bangladesh (N=49) gave a similar range of EC50 values (first experiment: 0.0018 – 0.0040 ppm; second experiment: 0.0026 –

0.0050 ppm). These EC50 values can be used to define the baseline sensitivity of S. sclerotiorum to fluazinam in Bangladesh. The EC50 values of penthiopyrad ranged from 0.0118 – 0.4293 ppm

(first experiment) and 0.0828 – 2.2678 ppm (second experiment). The values from the second experiment were higher than expected for unexposed S. sclerotiorum, which may be the result of experimental error. Therefore, the experiment must be repeated in order to confirm the results.

Results from relative toxicity indices (Table 3.2 and 3.7) indicated that fluazinam was about 103.22 times and penthiopyrad was about 6.0 times more effective against S. sclerotiorum than iprodione. Similarly, in the second experiment fluazinam was 67.6 times and penthiopyrad

69 was 1.6 times more effective against S. sclerotiorum isolates collected from Bangladesh and

Ohio. On the other hand, in the both experiments, propiconazole was almost equally (first experiment) or less (second experiment) effective than iprodione against S. sclerotiorum isolates from all 11 locations. Based on EC50 and RTI values, fluazinam was highly effective in suppressing growth of all isolates of S. sclerotiorum from Bangladesh and Ohio. In the field, fluazinam @ 187.5 g a.i. ha-1 controlled Sclerotinia stem rot of rapeseed over 70%, which was more effective than boscalid (Wang et al. 2009; Wang et al. 2016). From our results, it is evident that the average EC50 values of fluazinam are lower than iprodione, propiconazole and penthiopyrad (Table 3.2, 3.7). A similar observation was reported by Liu et al. (2009) and Kuang et al. (2011). From this study it might be concluded that fluazinam could be used as a new fungicide against S. sclerotiorum in Bangladesh.

Acknowledgements

This research was supported by the United States Agency for International Development, as part of the Feed the Future initiative, under the CGIAR Fund, award number BFS-G-11-

00002, and the predecessor fund the Food Security and Crisis Mitigation II grant, award number

EEM-G-00-04-00013, and by state and federal funds appropriated to the Ohio Agricultural

Research and Development Center (OARDC), The Ohio State University.

References

Bardin, S. D., and Huang, H. C. 2001. Research on biology and control of Sclerotinia diseases in Canada. Canadian Journal of Plant Pathology 23: 88-98.

Bolton, M. D., Thomma, B. P., and Nelson, B. D. 2006. Sclerotinia sclerotiorum (Lib.) de Bary: biology and molecular traits of a cosmopolitan pathogen. Molecular Plant Pathology 7:1-16.

Eichhorn, K. W., and Lorenz, D. H. 1978. Untersuchungen uber die Wirkung von Vinclozolin gegenuber Botrytis cinerea in vitro. Zeitschrift fur Pflanzenkrankheiten und Pflanzenschutz. Journal of Plant Disease and Protection.

Golembiewski, R. C., Vargas, J. M., Jones, A. L., and Detweiler, A. R. 1995. Detection of demethylation inhibitior (DMI) resistance in Sclerotinia homoeocarpa populations. Plant Disease 79:491-493.

Grichar, W. J., and Woodward, J. E. 2016. Fungicides and application timing for control of early leafspot, southern blight, and sclerotinia blight of peanut. International Journal of Agronomy, Article ID:1848723.

Hossain, M. D., Rahman, M. M. E., Islam, M. M., and Rahman, M. Z. 2008. White rot, a new disease of mustard in Bangladesh. Bangladesh Journal of Plant Pathology 24:81-82.

Ktiller, W., and Scheinpflug, H. 1987. Fungal resistance to sterol biosynthesis inhibitors: a new challenge. Plant Disease 71:12.

Kuang, J., Wang, J. X., and Zhou, M. G. 2011a. Monitoring carbendazim and dimethachlon resistance of Sclerotinia sclerotiorum obtained from the blight stems of rape in Jiangsu Province. Chinese Agricultural Science Bulletin 27:285-291.

Kuang, J., Hou, Y. P., Wang, J. X., and Zhou, M. G. 2011b. Sensitivity of Sclerotinia sclerotiorum to fludioxonil: in vitro determination of baseline sensitivity and resistance risk. Crop Protection 30:876-882.

Lemay, A. V., Bailey, J. E., and Shew, B. B. 2002. Resistance of peanut to Sclerotinia blight and the effect of acibenzolar-S-methyl and fluazinam on disease incidence. Plant Disease 86:1315-1317.

Liang, H. J., Di, Y. L., Li, J. L., and Zhu, F. X. 2015. Baseline sensitivity and control efficacy of fluazinam against Sclerotinia sclerotiorum. European Journal of Plant Pathology 142:691- 699.

List of agricultural, bio and public health pesticides in Bangladesh. 2016. Bangladesh crop protection association. Plant protection wing, department of agricultural extension, Khamarbari, Dhaka-1215. pp 39-40.

Liu, X., Yin, Y., Yan, L., Michailides, T. J., and Ma, Z. 2009. Sensitivity to iprodione and boscalid of Sclerotinia sclerotiorum isolates collected from rapeseed in China. Pesticide Biochemistry and Physiology 95:106-112.

Miller, G. L., Stevenson, K. L., and Burpee, L. L. 2002. Sensitivity of Sclerotinia homoeocarpa isolates to propiconazole and impact on control of dollar spot. Plant Disease 86:1240-1246.

Pappas, A. C., and Fisher, D. J. 1979. A comparison of the mechanisms of action of vinclozolin, procymidone, iprodione and prochloraz against Botrytis cinerea. Pest Management Science 10:239-246.

Pan, Y. L., Wang, Z. Y., and Wu, H. Z. 1997. Resistance to carbendazim and stability of the resistance in Sclerotinia sclerotiorum. Chinese Journal of Jiangsu Agricultural Science 13:32-35.

Pan, Y.L., 1998. The resistance of Sclerotinia sclerotiorum of rape to carbendazim and its management. Jiangsu Agric. Sci. 14:159e163.

Pan, Y., Liu, F., and Xu, Z. 2000. The resistance of Sclerotinia sclerotiorum of rape to carbendazim and its management. Jiangsu Agricultural Sciences 3:39-40.

Qi, Y. X., Chen, F. X., Su, X. Y., Ding, K. J., Yu, J., and Jiang, M. S. 2006. Monitoring on carbendazim resistance of Sclerotinia sclerotiorum obtained from the blight stems of rape in Anhui Province. Chinese Agricultural Science Bulletin 22:371-373.

Schumacher, M. M., Enderlin, C. S., and Selitrennikoff, C. P. 1997. The osmotic-1 locus of Neurospora crassa encodes a putative histidine kinase similar to osmosensors of bacteria and yeast. Current Microbiology 34:340-347.

Shi, Z., Zhou, M., and Ye, Z. 1999. Resistance of Sclerotinia sclerotiorum to carbendazim and dimethachlon. Chinese Journal of Oil Crop Sciences 22:54-57.

Sun, Y. P. 1950. Toxicity Index-an improved Method of comparing the relative 378 Toxicity of Insecticides. Journal of Economic Entomology 43:1.

Vitoratos, A. G. 2014. Mode of action and genetic analysis of resistance to fluazinam in Ustilago maydis. Journal of Phytopathology 162:737-746.

Wang, J. X., Ma, H. X., Chen, Y., Zhu, X. F., Yu, W. Y., Tang, Z. H., and Zhou, M. G. 2009. Sensitivity of Sclerotinia sclerotiorum from oilseed crops to boscalid in Jiangsu Province of China. Crop Protection 28:882-886.

Wang, Y., Duan, Y. B., and Zhou, M. G. 2016. Baseline sensitivity and efficacy of fluazinam in controlling Sclerotinia stem rot of rapeseed. European Journal of Plant Pathology 144:337-343.

Xilin, Z., Xuemei, S., and Gufeng, Z. 2003. Preliminary Report on the Monitoring of the Resistance of Sclerotinia Libertiana to Carbendazim and its Integrated Management [J]. Pesticide Science and Administration 6:009.

Yilou, P., Zhiyuan, W., and Hanzhang, W. 1997. Resistance to carbendazim in Sclerotinia sclerotiorum. Journal of Oil Crop Sciences 3:021.

Zhang, X.L., Sun, X.M., Zhang, G.F., Yi, H.J., and Qiang, Y., 2003. Preliminary report on the monitoring of the resistance of Sclerotinia sclerotiorum to carbendazim and its integrated management. Chin. J. Pestic. Sci. Adm. 24:18e22.

Zhou, B. W., and Luo, Q. 1994. Rapeseed diseases and control. China Commerce and Trade Press, Beijing pp. 346.

Zhou, F., Zhang, X. L., Li, J. L., and Zhu, F. X. 2014b. Dimethachlon resistance in Sclerotinia sclerotiorum in China. Plant Disease 98:1221-1226.

Table 3. 1. Levene’s test for equal variance for EC50 values in two experiments (1 and 2) with four fungicides. The number of isolates was equal in the two experiments.

Fungicide Levene’s test statistic P-value Significance Iprodione 0.96 0.329 NS Propiconazole 9.50 0.002 ** Fluazinam 2.46 0.120 NS Penthiopyrad 3.33 0.071 NS NS: Non-significant **Significant at p<0.05

Table 3. 2. Mean EC50 values and relative toxicity index (RTI) for iprodione, propiconazole, fluazinam and penthiopyrad against Sclerotinia sclerotiorum.

a b Experiment Fungicides Mean EC50 (ppm) Mean EC50 (ppm) RelativeToxicity Index (RTI) c Experiment 1 Iprodione 0.3251 0.3200 - Propiconazole 0.3362 0.3200 1.0 Fluazinam 0.0030 0.0031 103.2 Penthiopyrad 0.0470 0.0530 6.0 Experiment 2 Iprodione 0.2334 0.2300 - Propiconazole 0.2683 0.2784 0.8 Fluazinam 0.0034 0.0034 67.6 Penthiopyrad 0.2520 0.1400 1.6 a Mean EC50 values for iprodione and propiconazole were calculated from data for 118 isolates of ten locations of Bangladesh; mean EC50 values for fluazinam and penthiopyrad were calculated from data for 49 isolates of ten locations Bangladesh b Mean EC50 values for iprodione and propiconazole were calculated from data for 124 isolates of 11 locations of Bangladesh and Ohio; mean EC50 values for fluazinam and penthiopyrad were calculated from data for 51 isolates of 11 locations of Bangladesh and Ohio c Iprodione was used as the standard reference fungicide. Mean EC50 data from 11 locations of Bangladesh and Ohio, USA were used to calculate RTI.

Table 3. 3. Analysis of variance for iprodione EC50 values for 124 isolates of Sclerotinia sclerotiorum.

Experiment Source DF Seq. SS Adj. SS Adj. MS F P 1 Isolate 123 0.928333 0.928333 0.007547 3.47 0.000 Error 241 0.524699 0.524699 0.002177 Total 364 1.453031 2 Isolate 123 0.637416 0.637416 0.005182 3.97 0.000 Error 246 0.320749 0.320749 0.001304 Total 369 0.958165

Table 3. 4. Analysis of variance for propiconazole EC50 values for 124 isolates of Sclerotinia sclerotiorum.

Experiment Source DF Seq. SS Adj. SS Adj. MS F P 1 Isolate 123 3.609007 3.609007 0.029342 11.52 0.000 Error 246 0.626697 0.626697 0.002548 Total 369 4.235703 2 Isolate 123 5.34596 5.34596 0.04346 4.27 0.000 Error 235 2.39116 2.39116 0.01018 Total 358 7.73713

Table 3. 5. Analysis of variance for fluazinam EC50 values for 51 isolates of Sclerotinia sclerotiorum.

Experiment Source DF Seq SS Adj SS Adj MS F P 1 Isolate 50 0.0000532 0.0000532 0.0000011 8.15 0.000 Error 101 0.0000132 0.0000132 0.0000001 Total 151 0.0000663 2 Isolate 50 0.0000378 0.0000378 0.0000008 2.62 0.000 Error 102 0.0000294 0.0000294 0.0000003 Total 152 0.0000672

Table 3. 6. Analysis of variance for penthiopyrad EC50 values for 51 isolates of Sclerotinia sclerotiorum.

Experiment Source DF Seq. SS Adj. SS Adj. MS F P 1 Isolate 50 1.725233 1.725233 0.034505 120.01 0.000 Error 101 0.029040 0.029040 0.000288 Total 151 1.754273 2 Isolate 46 1.617382 1.617382 0.035160 38.96 0.000 Error 94 0.084832 0.084832 0.035160 Total 140 1.702213

Table 3. 7. Mean EC50 values and relative toxicity indices (RTI) of fluazinam, penthiopyrad, propiconazole and iprodione for Sclerotinia sclerotiorum isolates collected from 10 locations in Bangladesh and in Ohio, USA.

Fungicide Experiment Location Mean EC50 Mean RTI Fluazinam 1 Bashbari, Shirajgang 0.0034 86.11 Chalakpa, Shirajgang 0.0030 109.36 Deohata, Tangail 0.0031 101.86 Deshipara, Shirajgang 0.0028 127.52 Dhanbari, Jamalpur 0.0029 110.74 Ghatail, Tangail 0.0030 115.05 Mirzapur, Tangail 0.0033 107.79 Sadar, Shirajgang 0.0030 104.54 Shohagpur, Tangail 0.0028 120.24 Tangail, Sadar 0.0030 105.98 Ohio, US 0.0040 74.53 P-value 0.5506 (NS)* - 2 Bashbari, Shirajgang 0.0038 abx 57.98 Chalakpa, Shirajgang 0.0034 b 68.71 Deohata, Tangail 0.0040 a 59.23 Deshipara, Shirajgang 0.0031 b 81.48 Dhanbari, Jamalpur 0.0033 b 71.45 Ghatail, Tangail 0.0038 ab 61.14 Mirzapur, Tangail 0.0032 b 73.67 Sadar, Shirajgang 0.0036 ab 62.31 Shohagpur, Tangail 0.0032 b 72.98 Tangail, Sadar 0.0031 b 71.99 Ohio, US 0.0035 ab 64.15 P-value 0.0492 - Penthiopyrad 1 Bashbari, Shirajgang 0.018 16.65 Chalakpa, Shirajgang 0.120 2.75 Deohata, Tangail 0.017 18.52 Deshipara, Shirajgang 0.134 2.67 Dhanbari, Jamalpur 0.017 18.79 Ghatail, Tangail 0.079 4.35 Mirzapur, Tangail 0.020 18.07 Sadar, Shirajgang 0.016 20.05 Shohagpur, Tangail 0.018 18.87 Tangail, Sadar 0.019 16.58 Ohio, US 0.180 1.68 P-value 0.3067 (NS) - 2 Bashbari, Shirajgang 0.115 1.93 Chalakpa, Shirajgang 0.565 0.42 Deohata, Tangail 0.133 1.78 Deshipara, Shirajgang 0.528 0.48 Dhanbari, Jamalpur 0.126 1.86 Ghatail, Tangail 0.436 0.53 Mirzapur, Tangail 0.104 2.29 Sadar, Shirajgang 0.127 1.79 Shohagpur, Tangail 0.114 2.04 Tangail, Sadar 0.133 1.70 Ohio, US 0.484 0.47 P-value 0.4759 (NS) - 81

Fungicide Experiment Location Mean EC50 Mean RTI Propiconazole 1 Bashbari, Shirajgang 0.374 b 0.79 Chalakpa, Shirajgang 0.290 c 1.14 Deohata, Tangail 0.342 bc 0.93 Deshipara, Shirajgang 0.305 bc 1.17 Dhanbari, Jamalpur 0.364 b 0.88 Ghatail, Tangail 0.337 bc 1.02 Mirzapur, Tangail 0.383 b 0.93 Sadar, Shirajgang 0.314 bc 1.01 Shohagpur, Tangail 0.355 bc 0.96 Tangail, Sadar 0.342 bc 0.93 Ohio, US 0.552 a 0.55 P-value <0.0001 - 2 Bashbari, Shirajgang 0.255 0.87 Chalakpa, Shirajgang 0.238 0.98 Deohata, Tangail 0.284 0.84 Deshipara, Shirajgang 0.287 0.89 Dhanbari, Jamalpur 0.280 0.84 Ghatail, Tangail 0.297 0.78 Mirzapur, Tangail 0.244 0.98 Sadar, Shirajgang 0.320 0.71 Shohagpur, Tangail 0.319 0.73 Tangail, Sadar 0.272 0.83 Ohio, US 0.361 0.63 P-value 0.841 (NS) - Iprodione 1 Bashbari, Shirajgang 0.297 - Chalakpa, Shirajgang 0.331 - Deohata, Tangail 0.318 - Deshipara, Shirajgang 0.357 - Dhanbari, Jamalpur 0.321 - Ghatail, Tangail 0.342 - Mirzapur, Tangail 0.357 - Sadar, Shirajgang 0.318 - Shohagpur, Tangail 0.339 - Tangail, Sadar 0.317 - Ohio, US 0.301 - P-value 0.5065 (NS) - 2 Bashbari, Shirajgang 0.223 - Chalakpa, Shirajgang 0.235 - Deohata, Tangail 0.238 - Deshipara, Shirajgang 0.256 - Dhanbari, Jamalpur 0.234 - Ghatail, Tangail 0.232 - Mirzapur, Tangail 0.239 - Sadar, Shirajgang 0.226 - Shohagpur, Tangail 0.233 - Tangail, Sadar 0.226 - Ohio, US 0.227 - P-value 0.994(NS) - *NS =Non-significant (α = 0.05) x The same letter in the column indicates that mean EC50 of different population was not significantly different (α = 0.05) 82

25 Isolate 20

0 >0.18 0.018-0.22 0.23-0.27 0.28-0.32 0.33-0.37 0.38-0.42 0.43-0.47 0.48-0.51 <0.51 EC50 range (ppm)

20 Isolate 15

0 >0.16 0.16-0.18 0.19-0.21 0.22-0.24 0.25-0.27 0.28-0.30 0.31-0.33 0.34-0.37 <0.37 EC50 range (ppm)

Figure 3. 2. Frequency distribution of iprodione EC50 values for 124 isolates of Sclerotinia sclerotiorum collected from 11 locations in Bangladesh and Ohio, USA. Individual EC50 values were grouped in class intervals of 0.03 ppm (Experiment 2).

Control 0.01 0.0001 0.001 ppm ppm

10 .0 1.0 0.3 0.1

Figure 3.3. Mycelial growth of Sclerotinia sclerotiorum isolate SST15 from Bangladesh on potato dextrose agar medium amended with different concentrations of iprodione: 0 (control), 0.0001, 0.001, 0.01, 0.1, 0.3, 1.0, and 10.0 ppm (Experiment 1).

40 Isolate 30

0 >0.12 0.12-0.20 0.21-0.29 0.30-0.38 0.39-0.47 0.48-0.56 0.57-0.65 0.66-0.78 <0.78 EC50 range (ppm)

Figure 3. 4. Frequency distribution of propiconazole EC50 values for 124 isolates of Sclerotinia sclerotiorum collected from 10 locations in Bangladesh and from Ohio, USA. Individual EC50 values were grouped in class intervals of 0.09 ppm (Experiment 1).

30 Isolate

0 >0.02 0.02-0.14 0.15-0.27 0.28-0.40 0.41-0.53 0.54-0.66 0.67-0.79 0.80-0.93 <0.93 EC50 range (ppm)

Figure 3. 5. Frequency distribution of propiconazole EC50 values for 124 isolates of Sclerotinia sclerotiorum collected from 10 locations in Bangladesh and from Ohio, USA. Individual EC50 values were grouped in class intervals of 0.13 ppm (Experiment 2).

Control 0.001 0.01 0.1

0.3 1.0 10.0 100 .0

20 18 16 14 12 10

Isolate 8 6 4 2 0

EC50 range (ppm)

Figure 3. 7. Frequency distribution of fluazinam EC50 values for 51 isolates of Sclerotinia sclerotiorum collected from 10 locations in Bangladesh and from Ohio, USA. Individual EC50 values were grouped in class intervals of 0.0004 ppm (Experiment 1).

18 16 14 12 10

Isolate 8 6 4 2 0

EC50 range (ppm)

Figure 3. 8. Frequency distribution of fluazinam EC50 values for 51 isolates of Sclerotinia sclerotiorum collected from 10 locations in Bangladesh and from Ohio, USA. Individual EC50 values were grouped in class intervals of 0.0004 ppm (Experiment 2).

0.1 0.01 0.003

0.001 0.0001 Control

25 Isolate 20

0 >0.012 0.012-0.082 0.083-0.151 0.152-0.221 0.222-0.290 0.291-0.360 0.361-0.429 <0.429 EC50 range (ppm)

Figure 3.10. Frequency distribution of penthiopyrad EC50 values for 51 isolates of Sclerotinia sclerotiorum collected from 10 locations in Bangladesh and from Ohio, USA. Individual EC50 values were grouped in class intervals of 0.07 ppm (Experiment 1).

20 Iisolates 15

0 >0.01 0.01-0.14 0.15-0.27 0.28-0.39 0.40-0.52 0.53-0.65 0.66-0.85 <0.85 EC50 range (ppm)

Figure 3. 11. Frequency distribution of penthiopyrad EC50 values for 51 isolates of Sclerotinia sclerotiorum collected from 10 locations in Bangladesh and from Ohio, USA. Individual EC50 values were grouped in class intervals of 0.13 ppm (Experiment 2).

3.0 1.0 0.1

0.03 0.01 0.001 Control

Chapter 4

Resistance of oilseed mustard varieties/lines to Sclerotinia sclerotiorum

Abstract. Sclerotinia sclerotiorum, the causal agent of white mold disease, is a major threat to many food crops worldwide, including oilseed mustard. Fungicide application is the primary tactic widely used to manage this disease in mustard and other crops. Development of mustard varieties partially or fully resistant to S. sclerotiorum would enhance the disease management toolbox and reduce or eliminate the need for fungicides to control this disease. Fourteen mustard varieties and one breeding line developed by the Bangladesh Agricultural Research Institute

(BARI) were screened to determine their reactions to S. sclerotiorum. Twenty S. sclerotiorum isolates were pre-evaluated for virulence and a highly virulent isolate was selected. Isolate SCS1 caused the largest lesions 24 h after inoculation among all isolates in a detached leaf assay. This isolate was used in cotyledon and petiole inoculation assays. In screening with cotyledon inoculation, the smallest lesions were observed in BARI Sharisa 14. There were no significant differences among the varieties/line in percentage of infected cotyledons. In petiole inoculation screening, variation in the reactions of the rapeseed-mustard varieties/line to S. sclerotiorum was insignificant, except for breeding line SS 75 in the both experiments. This line showed significantly higher resistance to S. sclerotiorum than BARI Sharisa 10 in the first experiment and Tori 7 in the second experiemnt. Although the results obtained using two inoculation methods were inconsistent, both BARI Sharisa 14 and SS 75 may prove to be useful as sources of resistance to S. sclerotiorum upon more extensive evaluation.

Introduction

The family Brassicaceae contains a large number of oilseed crops including oilseed rape

(Brassica napus, B. rapa, B. campestris) (Salisbury and Barbetti 2011), oilseed mustard, including Indian mustard (B. juncia), and Ethiopian and brown mustard (B. nigra) (Chauhan et al. 2006; Salisbury and Barbetti, 2011). Bangladesh Agricultural Research Institute (BARI) has released 14 rapeseed-mustard varieities and one advanced breeding line (Table 4.2). As all of these originated from rapeseed (B. napus) and mustard (B. juncia, B. campestris), they are commonly called rapeseed-mustard or simply mustard. Rapeseed-mustard (B. napus, B. campestris, B. juncia) is an important oil crop in Bangladesh. The production area under cultivation in Bangladesh is approx. 0.32 million hectares and the total production is approx.

0.35 million metric tons (BBS 2015). There are many biotic and abiotic factors that reduce mustard yield. At least 14 diseases have been recorded in mustard in Bangladesh (Ahmed 1986).

White mold caused by Sclerotinia sclerotiorum was first recorded on mustard in Bangladesh in

2007. This disease is now a major problem in mustard production worldwide. In China, yield losses ranged from 10 to 80%; in Australia the average yield loss was reported to be 24%

(Oilcrop research Institute, Chinese Academy of Science, 1975; www.australianoilseed.com).

However actual yield loss of mustard due to white mold disease in Bangladesh has not been investigated, although it is considered a main threat for mustard production (personal communication, Oilseed Research Center, BARI, Gazipur, Bangladesh).

Currently cultural practices and fungicides are being used in mustard growing regions to control white mold (Del Rio et al. 2007). In Bangladesh, most farmers utilize mustard varieties developed by the BARI, however, the degree of resistance in these varieties to white mold is unknown. Both monogenic and polygenic resistance to S. sclerotiorum has been reported (Abawi

96 et al. 1978; Baswana et al. 1999). In soybean, three quantitative trait loci (QTL) associated with resistance to S. sclerotiorum were mapped (Kim and Diers 2000). Selection, development and utilization of white mold-resistant mustard varieties is essential for integrated management of this disease (Mei et al. 2012). It has been difficult to develop mustard varieties resistant to S. sclerotiorum due to lack of a sufficient number of durable resistant genes in the mustard host, however resistance in mustard to S. sclerotiorum has been identified at the stem rot stage in the past decade (Li et al. 2006, 2007, 2009b; Garg et al. 2010). In oilseed rape, partial resistance loci were identified (Zhang et al. 2011a; Zhao et al. 2006).

As there is no rapeseed-mustard that is immune to S. sclerotiorum and the number of genes involved in Sclerotinia resistance is unknown, it has been difficult to develop highly resistant breeding lines (Zhao and Meng 2003). Moreover, specificity of S. sclerotiorum strains to different hosts has not been precisely investigated (Saharan and Mehta 2008). Therefore, screening efforts have been focused on identifying and incorporating partial resistance to S. sclerotiorum in Brassica species (Garg et al. 2010; Li et. 2006). Numerous screening methods have been utilized under greenhouse, growth chamber or field conditions, and inoculation methods also vary. Inoculation methods include stem inoculation of mature plants with toothpicks cultured with the fungus on PDA medium for 48 h (Zhao et al. 2003), detached leaf inoculation at the seedling stage with mycelia on agar plugs (Zhao et al. 2003), cut stem inoculation with mycelia on agar plug (Mei et al. 2011), stem inoculation with mycelial plugs at the 50% flowering stage (Buchwaldt et al. 2005), cotyledon inoculation with a mycelial suspension (Garg et al. 2008), and petiole inoculation with a mycelial plug (Zhao et al. 2004).

Field tests of S. sclerotiorum resistance in B. napus have been conducted, but sources of complete resistance were not identified (Zhou et al. 1994). Evaluation of resistance in the field is

97 appropriate, however, inconsistent results have been reported from field experiments. Fluctuating weather and field conditions influence the response of the host (Li et al. 2009). For this reason, screening in controlled conditions is widely used and accepted. Moreover, different methods used in the field and under controlled conditions showed both consistent and inconsistent results

(Uloth et al. 2009).

The objective of this study was to assess the level of resistance to S. sclerotiorum in

BARI-released rapeseed-mustard varieties and breeding lines. The hypothesis was that BARI- released rapeseed-mustard varieties and lines exhibit resistance to S. sclerotiorum. To test the hypothesis, a series of experiments were conducted. The information generated from these experiments will be useful to farmers in Bangladesh seeking resistant or partially resistant varieties to include in integrated white mold management programs, and will assist breeders in developing white mold resistant mustard varieties.

Materials and Methods

Collection of S. sclerotiorum isolates. A total of 132 S. sclerotiorum isolates were recovered from mustard from nine locations in Bangladesh and from peppers in Ohio, USA (Chapter 2).

Each isolate was recovered from a single sclerotium of a single infected plant, hyphal tip cultures were prepared and haplotypes were identified (Chapter 2). The relative aggressiveness against mustard of two isolates selected at random from each of the nine Bangladesh locations

(haplotypes 1, 7, 9, 22), as well as the two from Ohio (haplotypes 25, 26) was evaluated (Table

4.1). All isolates were stored as sclerotia at -20°C. Isolates were sub-cultured on potato dextrose agar (PDA) medium and incubated at 24°C for 3 days prior to use.

Rapeseed-mustard varieties and breeding line. Fourteen BARI-released rapeseed-mustard varieties and one BARI breeding line were provided by the Oilseed Research Center, BARI,

Gazipur (Table 4.2).

Evaluation of aggressiveness of S. sclerotiorum isolates. The aggressiveness of 20 isolates of

S. sclerotiorum was assessed using a detached leaf assay (Wu et al. 2013) with BARI Sharisha

16. Twenty seeds of BARI Sharisa 16 were sown in four plastic pots containing steam-sterilized soil and maintained in a Biosafety Level 2 (BSL-2) greenhouse on the campus of The Ohio State

University, Ohio Agricultural Research and Development Center (OSU-OARDC) for 6 weeks.

Plants were watered daily. Four leaves per isolate of S. sclerotiorum were collected and placed on a sterile damp paper towel in a sterile petri dish. A 3-day-old mycelial plug (5 mm) from each isolate was placed on each of the four leaves. Petri dishes were placed in a plastic box (70 cm ×

40 cm × 20 cm) containing sterile damp paper towels. The plastic boxes containing the inoculated leaves were incubated on a bench top in BSL-2 laboratory on the campus of OSU-

OARDC at 24 ± 2°C day and 20 ± 2°C night temperature with 14 h/10 h light/dark conditions.

The experiment was conducted following RCB design with four replications where each replication had one inoculated leaf. Lesion length and width 24 h and 48 h after inoculation were measured and lesion area was calculated.

Cotyledon inoculation of mustard varieties and breeding line. Sclerotinia sclerotiorum isolate SCS1 was selected based on results of the aggressiveness evaluation to screen rapeseed- mustard varieties/line. Seeds of each variety or breeding line were sown into 52 × 28 × 8 cm, 32- cell trays containing potting mix (Fafard® Super-fine Germinating Mix, Sungro Horticulture,

Agawam, MA). Five seeds were sown in each cell and after germination seedlings were thinned to two seedlings per cell. Each tray contained seven or eight varieties/line and a group of two trays together contained 15 varieties. Seedlings were maintained in an OSU-OARDC BSL-2 greenhouse for 10 days at 18 ± 2°C day and 14 ± 2°C night temperature. Plants were watered daily. Six seedlings were inoculated per variety per replication.

Inoculum production and cotyledon inoculation were conducted as described by Uloth et al. (2014). S. sclerotiorum isolate SCS1 was grown on PDA medium for 3 days at 24 ± 2°C in the dark on a bench in an OSU-OARDC BSL-2 laboratory. Five 5-mm agar plugs were cut from the actively growing border of a colony and transferred to a 250 ml Erlenmeyer flask containing

100 ml of potato dextrose broth (PDB) medium. Flasks were incubated on a shaker at 150 rpm for 3 days at 20 ± 1°C. Mycelia were harvested and washed with sterilized water, then macerated in a blender with sterile water for 3 minutes. The macerated mycelial suspension was filtered through two layers of sterilized cheesecloth and the concentration was adjusted to 104 hyphal fragments/ml using a hematocytometer.

Cotyledon inoculation was conducted 10 days after mustard seeds were sown. A 10 µl droplet of hyphal fragment suspension of S. sclerotiorum SCS1 was applied on each cotyledon using a micropipette. Two cotyledons from each plant were inoculated. Two plants of each variety/line were mock-inoculated with sterile water and served as controls. Each tray was placed in a 70 cm × 40 cm × 20 cm plastic storage box. To maintain high humidity, a damp paper towel was placed on the bottom of the box. The boxes were covered with a plastic lid and incubated in an OSU-OARDC BSL-2 containment greenhouse at 24°C day/20° C night on a 16 h/ 8 h light/dark cycle. Symptoms (hypersensitive, necrotic and water-soaked lesions) were evaluated

48 h after inoculation. Incidence of symptomatic leaves and lesion length and width 24 h and 48

100 h after inoculation were measured and lesion area was calculated. The experiment was established as a randomized complete block design (RCBD) with three replications.

Petiole inoculation of mustard varieties and breeding line. Three seeds each of 14 rapeseed- mustard varieties and one breeding line were sown in 30 cm long x 8 cm diameter plastic cones.

Seedlings were thinned to a single seedling per cone for inoculation. Pure cultures of S. sclerotiorum SCS1 were grown on PDA medium for 3 days at 24 ± 2°C in the dark on a bench in an OSU-OARDC BSL-2 laboratory and used for inoculation following the method described by

Zhao et al. (2004). Mycelial plugs were taken from the growing margin of the culture using the wide end of a 1000 µl sterile pipette tip. Leaf petioles from 4-week-old seedlings were cut 2.5 cm from the main stem with a sharp razor blade and the leaves were discarded. The tapered end of each inoculum-filled pipette tip was held and the petiole was guided through the agar plug within the pipette tip until the petiole end touched the mycelial layer of the plug. The inoculated plants were maintained in an OSU-OARDC BSL-2 growth chamber at 24 ± 2°C day and 20 ± 2°C night temperature under 16 h /8 h light/dark conditions. Five plants were inoculated per variety per replication. The experiment was conducted twice following RCB design with four replications. Two plants of each variety/line were mock-inoculated with a PDA plug (without pathogen) and served as control.

Disease severity was recorded each day beginning 2 days after inoculation until the plant wilted, using a lesion phenotype index. A plant was considered wilted when tissues of the apical meristem were limp or the leaves were flaccid. A lesion phenotype (LP) index was used to classify phenotypes for all inoculated plants. Lesion phenotypes were categorized according to a

0-4 scale, where 0 = no symptoms; 1 = small lesion at junction of petiole and stem, no water-

101 soaking and no wilt; 2 = small water-soaked lesion and no wilt; 3 = expanded, sunken water- soaked lesion and no wilt; 4 = expanded, sunken, water-soaked lesion resulting in irreversible wilt. The Area Under Disease Progress Curve (AUDPC) was calculated using the formula:

(��!��!�) ([ ]) (�� − �� − 1), where �� is the rating at each evaluation time and (ti-ti-1) is the number � of days between evaluations.

Statistical analysis. Fisher’s least significant difference test at P < 0.05 was used to compare mean aggressiveness of 20 isolates of S. sclerotiorum, and to compare seedling resistance (by cotyledon inoculation) of 14 rapeseed-mustard varieties and one breeding line. Levene’s test for equal variance for experiments on screening with petiole inoculation was conducted. Analysis of variance (ANOVA) was conducted using statistical software Minitab 16.0 (Minitab Inc.). A pairwise comparison of AUDPC values of 15 rapeseed-mustard varieties/line (by petiole inoculation test) was made using Turkey’s test at 95% confidence interval. Microsoft Office

Excel 2011 was used to generate graphs on disease progress curves.

Results

Aggressiveness of S. sclerotiorum isolates. Significant differences (P<0.05) in lesion length and area on mustard leaves 24 h and 48 h after inoculation were observed among the 20 isolates

(Figure 4.1, Table 4.3). Leaves inoculated with isolate SCS1 developed large lesions (306.2 mm2) within 24 h after inoculation. The lesion area was larger than observed for all isolates except SDJ12 (290.0 mm2) and SGT1 (260.6 mm2). At 48 h after inoculation, the lesion on leaves inoculated with isolate SGT1 was significantly larger (1512.4 mm2) than lesions caused by 12 isolates (range 478.0 mm2 - 1273.0 mm2) but similar to lesions caused by seven isolates

102

(range 1304.7 mm2 - 1391.2 mm2). Based on lesion size and time of initiation of the infection process, isolate SCS1 was selected for screening mustard varieties/line.

Cotyledon inoculation of mustard varieties and breeding line. Necrotic and water soaked lesions were observed 48 h after inoculation of cotyledons with hyphal fragments of S. sclerotiorum (Figure 4.2). No lesions were observed on controls in which cotyledons were inoculated with sterile water. There were no significant differences among varieties/breeding line in disease incidence (percentage of symptomatic cotyledons) (P = 0.33) (Table 4.4). However, lesion length and area differed significantly among the mustard varieties/breeding line. BARI

Sharisa 14 had significantly smaller lesions (0.11 mm length and 0.13 mm2 area) than observed on nine varieties and breeding line SS 75. Lesion area on BARI Sharisa 14 was statistically similar to the lesion area on BARI Sharisa 10, BARI Sharisa 15, BARI Sharisa 16 and BARI

Sharisa 17 (range 0.23 mm2 – 54 mm2). The largest lesions were observed on Kaliaya (1.45 mm2) and BARI Sharisa 13 (1.21 mm2).

Petiole inoculation of mustard varieties and breeding line. Most of the mustard varieties started developing water soaked lesions on the main stem 1 day after inoculation with a mycelial plug of S. sclerotiorum on the cut petiole. With time, enlarged sunken lesions were observed and most plants wilted within 8 days after inoculation (Figures 4.3, 4.4 and 4.5). There were significant differences between the two experiments (P=0.017). In both of the experiments, disease progress over the course of the experiment (AUDPC) varied significantly among mustard varieties/breeding line (Table 4.5). Rapeseed-mustard line SS 75 had significantly lower AUDPC than BARI Sharisa 10 in the first experiment and than Tori 7 in the second experiment. The

103

AUDPC of the remaining rapeseed-mustard lines in both experiments did not differ significantly from each other (Table 4.5, Figure 4.6).

Discussion

At present, no information is available on the resistance or susceptibility of BARI- released oilseed mustard varieties to white mold disease. These experiments were conducted to determine the relative resistance or susceptibility of BARI-released mustard varieties and one

BARI breeding line to an aggressive isolate of S. sclerotiorum. S. sclerotiorum isolate SCS1 was selected based on consistent production of large lesions in a detached leaf inoculation assay. This method is widely used for screening Brassica spp. against S. sclerotiorum (Zhang et al. 2009).

Reactions of plants to pathogens differ at the different plant growth stages. We tested the mustard varieties and breeding line at the seedling stage by cotyledon inoculation and at the vegetative stage by petiole inoculation. There was a large degree of variability in each assay and differences between assays were observed. The least susceptible varieties were BARI Sharisa 14,

BARI Sharisa 10, BARI Sharisa 15, BARI Sharisa 16 and BARI Sharisa 17 in cotyledon inoculation assay.

In the petiole inoculation assay, the numerically lowest AUDPC was observed in breeding line SS 75, although the AUDPC for this line was not separated statistically from

AUDPC values for 12 of the 13 BARI varieties tested. Disease progress curves for both of the experiments indicated separation between breeding line SS 75 and BARI varieties in terms of disease severity and only between SS 75 and the most susceptible variety BARI Sharisa 10 and

Tori 7 in first experiment and seconf experiment respectively. A similar trend was observed in experiment 2, in which SS 75 and BARI Sharisa 14 exhibited the numerically lowest AUDPC

104 values. Within 8 days after inoculation, plants in all of the rapeseed-mustard varieties had wilted except in line SS 75 and BARI Sharisa 14. While the lesions produced by S. sclerotiorum isolate

SCS1 on SS 75 in the cotyledon assay were larger than those observed on BARI Sharisa 14, they were statistically similar in size (area) to lesions on BARI Sharisa 10, BARI Sharisa 15, BARI

Sharisa 16 and BARI Sharisa 17.

Zhao et al. (2004) reported that the susceptible mustard line used in their study wilted within 3 days after petiole inoculation with S. sclerotiorum. In our study, inoculated plants of two varieties, BARI Sharisa 7 and 10, wilted within 4 days after petiole inoculation. Plants from

BARI Sharisa 14 and breeding line SS 75 developed lesions in both petiole inoculation experiments, but did not wilt during the course of the experiment. BARI Sharisa 14 and line SS

75 could be considered potential sources of partial resistance to S. sclerotiorum, although additional evaluations in controlled and field environments are needed. Future studies should include characterization of partial resistance (Li et al. 1999, 2006, 2009; Zhao 2004) and investigations into the mechanisms of resistance in this material. As BARI Sharisa 14 is already released, it should be used as part of an integrated white mold disease management program in areas where this disease is a problem. This may improve the outcomes when fungicides are applied to manage white mold (Bailey et al. 2000; Budge and Whipps 2001) and potentially reduce the number of applications needed.

References

Abawi, G. S., Provvidenti, R., Crosier, D. C., and Hunter, J. E. 1978. Inheritance of resistance to white mold disease in Phaseolus coccineus. Journal of Heredity 69:200-202.

Ahmed, A. U. 1986. Recommendation on the methods of disease management of crops in Bangladesh. Plant Pathology Division, BARI, pp11-13.

105

Anonymous. 2005. Krishi Diary. AIS, Department of Agricultural Extension, Bangladesh. MOA. Dhaka.

Bailey, K. L., Johnston, A. M., Kutcher, H. R., Gossen, B. D., and Morrall, R. A. A. 2000. Managing crop losses from foliar diseases with fungicides, rotation, and tillage in the Saskatchewan Parkland. Canadian Journal of Plant Science 80:169-175.

Baswana, K. S., Rastogi, K. B., and Sharma, P. P. 1991. Inheritance of stalk rot resistance in cauliflower (Brassica oleracea var. Botrytis L.). Euphytica 57:93-96.

Bangladesh Bureau of Statistics. 2015. Statistical Year Book of Bangladesh, Dhaka. Bangladesh Bureau of Statistics p. 40.

Del Río, L. E., Bradley, C. A., Henson, R. A., Endres, G. J., Hanson, B. K., McKay, K., and Lamey, H. A. 2007. Impact of Sclerotinia stem rot on yield of canola. Plant Disease 91:191-194.

Kim, H. S., and Diers, B. W. 2000. Inheritance of partial resistance to Sclerotinia stem rot in soybean. Crop Science 40:55-61.

Li, Y., Chen, J., Bennett, R., Kiddle, G., Wallsgrove, R., Huang, Y. J., and He, Y. H. 1999. Breeding, inheritance, and biochemical studies on Brassica napus cv. Zhougyou 821: tolerance to Sclerotinia sclerotiorum (stem rot). Page 61 in: Proceedings of the 10th International Rapeseed Congress. Canberra, Australia. (Eds N Wratten, PA Salisbury).

106

Mei, J., Qian, L., Disi, J. O., Yang, X., Li, Q., Li, J., and Qian, W. 2011. Identification of resistance sources against Sclerotinia sclerotiorum in Brassica species with emphasis on B. oleracea. Euphytica 177:393-399.

Saharan, G. S., and Mehta, N. 2008. Sclerotinia disease in crop plants: Biology, ecology and disease management. Springer. ISBN978-1-40208407-2.

Sun, C. 1995. Comparison of methods for evaluating oilseed cultivars for resistance to Sclerotinia sclerotiorum in Brassica napus L. Acta Agriculture Shanghai 11:17–22.

Wu, J., Cai, G., Tu, J., Li, L., Liu, S., Luo, X., ... and Zhou, Y. 2013. Identification of QTLs for resistance to Sclerotinia stem rot and BnaC. IGMT5. a as a candidate gene of the major resistant QTL SRC6 in Brassica napus. PloS one 8:e67740.

Zhang, L., Fu, Y., Xie, J., Jiang, D., Li, G., and Yi, X. 2009. A novel virus that infecting hypovirulent strain XG36-1 of plant fungal pathogen Sclerotinia sclerotiorum. Virology Journal 6:96.

Zhang, Y., Hu, C. X., and Zhang, C. G. 2011. Cloning and expression analysis of Rsk in Brassica napus induced by Sclerotinia sclerotiorum. Acta Physiol Plant 33:1277-1283.

107

Zhao, J., and Meng, J. 2003. Genetic analysis of loci associated with partial resistance to Sclerotinia sclerotiorum in rapeseed (Brassica napus L.). Theoretical and Applied Genetics 106:759-764.

Zhou, L. C., Yu, Q., Liu, S. Y., and Zhou, B. W. 1994. Evaluation of Sclerotinia resistance in rapeseed. Chin. Oilseed Crops (Suppl.) 4:69-71.

108

Table 4. 1. Sclerotinia sclerotiorum isolates used in virulence evaluation on rapeseed-mustard. Isolates were collected from rapeseed-mustard from ten locations in Bangladesh and from pepper in Ohio, USA.

Isolate Location Haplotypea SKMT4 Mirzapur, Tangail 1 SKMT13 Mirzapur, Tangail 1 SDJ1 Dhanbari, Jamalpur 1 SDJ12 Dhanbari, Jamalpur 1 STS2 Tangail Sadar 7 STS3 Tangail Sadar 1 SGT1 Ghatail, Tangail 1 SGT5 Ghatail, Tangail 1 SST2 Shohagpur, Tangail 9 SST7 Shohagpur, Tangail 1 SDT2 Deohata, Tangail 1 SDT16 Deohata, Tangail 1 SCS1 Chgalakpara, Sirajgonj 1 SCS21 Chgalakpara, Sirajgonj - SAS1 Sadar, Sirajgonj 1 SAS17 Sadar, Sirajgonj 22 SBS2 Bashbari, Shirajgonj 1 SBS9 Bashbari, Shirajgonj 1 SS1 Ohio, USA 25 SS2 Ohio, USA 26 aHaplotypes of S. sclerotiorum were identified based on ten locations from which isolates were collected (Chapter 2).

109

Variety/ linee Type BARI Sharisha 6 B. campestris BARI Sharisha 7 B. campestris BARI Sharisha 8 B. napus BARI Sharisha 9 B. campestris BARI Sharisha 10 B. campestris BARI Sharisha 11 B. juncia BARI Sharisha 12 B. campestris BARI Sharisha 13 B. napus BARI Sharisha 14 B. campestris BARI Sharisha 15 B. campestris BARI Sharisha 16 B. campestris BARI Sharisha 17 B. juncia Tori 7 B. campestris SS -75 B. campestris Kalyaniya B. campestris

110

Table 4. 3. Lesion length and area on leaves of rapeseed-mustard variety BARI Sharisha 16 after inoculation with Sclerotinia sclerotiorum isolates. Detached leaves were inoculated with a 3-day-old, 6 mm diameter mycelial plug.

Isolates 24 Hours 48 Hours Lesion length Lesion area (mm2) Lesion length Lesion area (mm2) (mm)a (mm) SAS 1 15.0 160.8 46.9 1273.9 SAS 17 6.7 42.5 40.2 892.2 SBS 2 17.0 11.2 50.3 1391.2 SBS 9 12.5 112.6 46.6 1222.5 SCS 1 21.2 306.2 47.6 1264.9 SCS 21 11.7 101.8 43.8 1073.6 SDJ 1 14.7 148.2 47.4 1315.4 SDJ 12 20.8 290.0 49.6 1304.7 SDT 16 17.6 245.3 45.2 1165.2 SDT 2 16.3 188.7 49.8 1371.1 SGT 1 19.5 260.6 52.2 1512.4 SGT 5 11.4 88.2 42.4 1022.4 SKMT 13 17.7 215.8 46.6 1338.4 SKMT 4 11.7 104.9 40.6 978.1 SS 1 16.0 185.9 43.7 1174.9 SS 2 12.5 120.4 43.0 1096.9 SST 2 6.1 31.8 26.4 478.0 SST 7 15.0 165.2 47.8 1315.0 STS2 4.4 21.9 33.7 674.3 STS3 18.0 226.7 48.7 1318.6 LSD* (p <0.05) 2.5 49.7 5.7 224.67 *LSD= Least significant difference for comparing individual isolates at P = 0.05. a Mean values are an averages of length of area for 12 leaves

111

Table 4. 4. Responses of 14 BARI-released rapeseed-mustard varieties and one breeding line to Sclerotinia sclerotiorum isolate SCS1. Cotyledons were inoculated with a suspension of hyphal fragments (104 fragments/ml).

Variety/line Infected cotyledons (%)b Lesion length (mm) Lesion area c (mm2) BARI Sharisa 6 11.11 0.30a 0.75 BARI Sharisa 7 21.53 0.39 0.78 BARI Sharisa 8 30.56 0.47 0.74 BARI Sharisa 9 27.08 0.48 0.92 BARI Sharisa 10 11.11 0.21 0.23 BARI Sharisa 11 30.56 0.39 0.60 BARI Sharisa 12 31.94 0.59 0.81 BARI Sharisa 13 38.89 0.61 1.21 BARI Sharisa 14 11.11 0.11 0.13 BARI Sharisa 15 15.28 0.34 0.54 BARI Sharisa 16 20.83 0.22 0.26 BARI Sharisa 17 20.14 0.22 0.25 Tori 7 25.00 0.43 0.71 Kaliaya 40.28 0.76 1.45 SS 75 27.08 0.38 0.61 LSD NS 0.18 0.45 (P =0.001) aMeans separation was calculated using Fisher’s least significant difference test. *LSD= Least significant difference for comparing individual varieties/lines response at P = 0.05. b Based on number of inoculated per replicate (12). c Calculated from the average lesion length x width.

112

Table 4. 5. Area under the disease progress curves (AUDPC) for 14 BARI-released rapeseed-mustard varieties and one breeding line inoculated with Sclerotinia sclerotiorum isolate SCS1 using the petiole inoculation method.

Variety/line *AUDPC (Experiment 1) AUDPC (Experiment 2) BARI Sharisa 10 10.0 a 7.7 ab BARI Sharisa 7 9.3 ab 6.7 ab BARI Sharisa 9 7.8 ab 5.4 ab BARI Sharisa 12 7.6 ab 7.3 ab BARI Sharisa 11 7.5 ab 7.3 ab BARI Sharisa 6 6.9 ab 7.2 ab Tori 7 6.7 ab 7.9 a BARI Sharisa 13 6.5 ab 4.7 ab BARI Sharisa 8 5.6 ab 5.4 ab BARI Sharisa 15 5.4 ab 5.2 ab BARI Sharisa 17 5.2 ab 7.5 ab BARI Sharisa 14 5.0 ab 5.1 ab BARI Sharisa 16 4.6 ab 6.7 ab SS 75 4.0 b 3.7 b P = 0.05 = 0.023 *Calculated based on disease severity on a scale of 0-4, where 0 = no symptoms, no lesions, no water-soaking, and no wilt; 1 = small lesion at junction of petiole and stem, no water-soaking and no wilt; 2 = small water-soaked lesion and no wilt; 3 = expanded, sunken water-soaked lesion and no wilt; 4 = expanded, sunken, water-soaked lesion resulting in irreversible wilt. Data were taken from 2 days of inoculation to 8 days after inoculation. Means that do not share a letter are significantly different at P = 0.05.

113

B C

114

B C

115

116

4.5

BARI Sharisa 6 3.5 BARI Sharisa 7 BARI Sharisa 8 3 BARI Sharisa 9 BARI Sharisa 10 2.5 BARI Sharisa 11 BARI Sharisa 12 2 BARI Sharisa 13 Disease severity BARI Sharisa 14 1.5 BARI Sharisa 15 BARI Sharisa 16 1 BARI Sharisa 17

0.5 Tori 7 SS 75

0 1 2 3 4 5 6 7 8 9 Day after inoculation

117

4.5

0 1 2 3 4 5 6 7 8 9 Day after inoculation

118

C 8 P D U

A 6

0 1 2 3 4 5 6 7 6 7 8 9 5 7 1 1 1 1 1 1 1 1 a a a a 7 ri a a a a a a a a s s s s S o s s s s s s s s ri ri ri ri ri ri ri ri ri ri ri ri a a a a S T a a a a a a a a h h h h h h h h h h h h S S S S S S S S S S S S I I I I I I I I I I I I R R R R R R R R R R R R A A A A A A A A A A A A B B B B B B B B B B B B Variety

Figure 4. 6. Boxplot of the area under the disease progress curves (AUDPC) for for 13 rapeseed-mustard varieties and one breeding line inoculated with Sclerotinia sclerotiorum isolate SCS1 by petiole inoculation (Experiment 1). AUDPC was calculated based on disease severity, using a 0 -4 scale where 0 = no symptoms; 1 = small lesion at junction of petiole and stem, no water soaking and no wilt; 2 = small water soaked lesion and no wilt; 3 = expanded, sunken water soaked lesion and no wilt; 4 = expanded, sunken, water-soaked lesion resulting in irreversible wilt.

119

6 C P D U

A 4

Figure 4. 7. Boxplot of the area under the disease progress curves (AUDPC) for 13 rapeseed-mustard varieties and one breeding line inoculated with Sclerotinia sclerotiorum isolate SCS1 by petiole inoculation (Experiment 2). AUDPC was calculated based on disease severity, using a 0 -4 scale where 0 = no symptoms; 1 = small lesion at junction of petiole and stem, no water soaking and no wilt; 2 = small water soaked lesion and no wilt; 3 = expanded, sunken water soaked lesion and no wilt; 4 = expanded, sunken, water-soaked lesion resulting in irreversible wilt.

120

Chapter 5

Integrated management of white mold of mustard

Abstract. Two experiments were set at Rangpur and Jamalpur, Bangladesh to evaluate different treatments separately and in combination to control white mold disease of mustard. The fungal biocontrol agent Trichoderma harzianum isolate BHT-N1 (ThBHT-N1) and five fungicides in different groups (carbendazim, thiophanate-methyl, propiconazole, iprodione and azoxystrobin + difenoconazole) were tested separately and in combination with ThBHT-N1 in natural field conditions. In Burirhut, Rangpur, the incidence of white mold disease was low.

However, azoxystrobin + difenoconazole-treated plots had significantly lower disease incidence and higher yield than non-treated control plots. In Jamalpur, white mold was not observed, but

Alternaria blight was recorded. All fungicide treatments and ThBHT-N1 significantly reduced disease severity compared to the non-treated control, but azoxystrobin + difenoconazole and iprodione treatments were significantly more effective than the other treatments.

Introduction

Mustard is an important oilseed crop in Bangladesh. Cultivated mustard types are members of the genus Brassica, family Cruciferae. Three species, namely B. napus, B. campestris and B. juncia, have contributed to oilseed production. However, in the Indian subcontinent and Bangladesh most of the mustard varieties originated from B. campestris and B. napus. The average yield content of mustard is 40-45% oil and 20-25% protein.

121

Mustard is the second most consumed edible oil after soybean in Bangladesh, but is number one in cultivated area and production tonnage among all oilseed crops (soybean, sunflower, sesame etc.) (BBS 2015). In 2014-2015 the total area under mustard cultivation was

0.80 million acres and production was 0.35 million metric tons (BBS 2015). The area under general oilseed cultivation is decreasing in Bangladesh, however the area under mustard cultivation is increasing (Miah et al. 2014). This trend is due to local demand as well as the

Bangladesh government’s support for increased supply. There is little scope for continued expansion of the cultivated area of mustard and other oilseed crops in Bangladesh. Therefore it is necessary to increase production by implementation of good management practices. Diseases and pests are among the most important constraints to mustard production. A number of diseases affect mustard under field conditions. The most important are Alternaria blight (Alternaria brassicae), powdery mildew (Erysiphe cruciferarum) and white mold, also called Sclerotinia rot

(Sclerotinia sclerotiorum). White mold is the most economically damaging disease of mustard in

Bangladesh, and occurs in all rapeseed- and mustard-growing regions (Kharbanda and Tewari

1996). The initial symptom caused by S. sclerotiorum is the formation of bleached lesions on the main stem, branches and pods. At later stages, the plants wilt and hard, black sclerotia develop in the tissue (Khangura and Beard 2015). Sclerotia survive in soil for several years (Coley-Smith and Cooks 1971), which contributes to the difficulty in controlling the disease. Sclerotinia sclerotiorum produces ascospores, which are dispersed in air, and both ascospores and sclerotia should be targeted for effective management.

Currently cultural practices and fungicides are used to control S. sclerotiorum in mustard

(Bardin and Huang 2001; Murray and Brennan 2012). Fungicides of different classes are effective against S. sclerotiorum including anilinopyrimidines (Benigni and Bompeix 2010),

122 benzimidazoles (Attanayake et al. 2011), dicarboxamides (Matheron and Matejka 1989), demethylation inhibitors (DMIs) (Li et al. 2015), quinone outside inhibitors (QoIs, known as strobilurins) (Muller et al. 2002; Xu et al. 2014) and succinate dehydrogenase inhibitors (SDHIs)

(Stammler et al. 2007). Different fungicides such as azoxystrobin, boscalid, thiophanate-methyl, iprodione, propiconazole and vinclozolin are moderately effective, by restricting growth of ascospores (Bradley et al. 2006). Ascospores are released for up to two weeks during the cropping season (Bolton 2006); as a result, multiple foliar applications of fungicides are necessary to control the disease (Bradley et al. 2006; Mueller et al. 2002). The pathogen can be controlled indirectly by reducing the number of sclerotia in soil because apothecia and ascospores are produced from sclerotia.

There are several disease management strategies that can either reduce or destroy the primary source of inoculum (sclerotia). Crop rotation with non-host crops restricts accumulation of screrotia in soil. However, one to two years of rotation is not effective as sclerotia can survive up to eight years (Coley-Smith and Cooks 1971). Further, S. sclerotiorum has a wide host range and non-host crops are limited (Bolton 2006). Soil fumigation is another method that can be used to reduce sclerotia in soil, but this method is rarely used in developing regions (Maloy 2005).

Fungal and bacterial biological control agents (BCA) have been used to control S. sclerotiorum in cropping systems such as lettuce (Budge and Whipps 1991; Chitrampalam et al.

2008), soybean (del Rio et al. 2002) and dry bean (Huang et al. 2000). A number of BCA, including Coniothyrium minitans (Contans WG), Streptomyces lydicus (Actinovate AG),

Trichoderma harzianam T-22 (PlantShield HC), and Bacillus subtilis (Serenade MAX), were applied in soil to control Sclerotinia stem rot of soybean, and among them C. minitans was very effective (Zeng et al. 2012). T. harzianum effectively controlled S. sclerotiorum in inoculated

123 squash and eggplant seedlings by parasitism and production of antibiotics (Abdullah et al. 2008).

In Bangladesh, few studies on field application of biocontrol agents to control plant diseases have been reported. T. harzianum strain BHT-N1 has been applied in pot and microplots studies to control soil borne diseases of cabbage and significantly reduced seedling mortality (Annual

Research Report 2015). This native strain of T. harzianum could be effective against S. sclerotiorum.

Integration of different management strategies enhances the efficacy of BCA (Budge and

Whipps 2001). Biocontrol agents have been combined with fungicides for foliar (Budge and

Whipps 1991; Elad 1994; Elad et al. 1993; Harman et al. 1996; Sundheim and Amundsen 1982), soil and seed (Adams and Wong 1991; Conway et al. 1997; Cubeta and Echandi 1991; Inuto et al. 1995), and postharvest (Chand-Goyal and Spotts 1996; Dorby et al. 1998; Suger and Spotts

1999) disease management. In most of the studies, combined application of biocontrol agents and fungicides was more effective in controlling pathogens than individual components. Some studies showed that integration helped to reduce fungicide use, either by applying a lower dose of fungicide along with a BCA (Chand-Goyal and Spotts; Conway et al. 1997 and Droby et al.

1998), or alternating fungicides with BCAs (Elad et al. 1993; Harman et al. 1996; Sundheim and

Amundsen 1983). This approach may contribute to a durable and environmentally friendly disease control strategy. Such integrated approaches have not been developed in Bangladesh, where mustard farmers rely on a few fungicides such as propiconazole and iprodione to control white mold, with only partial success. The present study was undertaken to develop an integrated strategy for the management of white mold of mustard in Bangladesh.

124

Materials and Methods

Land preparation. Two field trials were conducted in November 2016 in research plots in the

Regional Agricultural Research Station (RARS), Jamalpur, Bangladesh and a research farm in

Bhrirhut, Rangpur, Bangladesh. Both of the locations had previous histories of white mold disease of mustard and the experiments were conducted under natural disease pressure. The experimental soil was sandy loam. The cultivar BARI Sharisa 14 was selected for the field trials because it is widely grown and well fitted for the cropping pattern (rice- mustard - rice) typically followed in Bangladesh. Seeds were sown on November 20 and November 28 at RARS,

Jamalpur and Burirhut, Rangpur respectively. Seeds were sown (@ 6kg/ha) with 25 cm row-to- row distance in 2m × 1m plots where the plot-to-plot distance was 0.5m. Fertilizers (urea @ 200 kg/ha, TSP@ 150kg/ha and MP@70kg/ha) were applied two times. Half of the doses were at the time of final land preparation and remaining half at the time of flower initiation. Watering, weeding and mulching were done when necessary. The experimental design was a Randomized

Complete Block Design (RCBD) with four replications.

Soil treatment with Trichoderma harzianum (BCA). Trichoderma harzianum isolate BHT-N1

(ThBHT-N1) was obtained from the Plant Pathology Section, Horticultural Research Center,

Bangladesh Agricultural Research Institute (BARI), Gazipur, Bangladesh. Dried rice bran and partially ground wheat, maize and blackgram were purchased from local markets and mixed manually at a ratio of 1:2:1:2 as an inoculum carrier. The mixture of inoculum carrier was moistened with water, and 800 g was added to a glass bottle (2000 ml), the top of which was covered with two layers of aluminum foil, and autoclaved twice in immediate succession at

121°C for 20 min at 1.5 psi. Bottles of autoclaved carrier were inoculated aseptically inside a

125 laminar air flow hood with 40, 6 mm mycelial plugs of 3-day-old ThBHT-N1 grown on potato dextrose agar (PDA) medium, and incubated on a laboratory bench at 26±1°C room temperature in 14 h/10 h light/dark for 20 days. The carrier plus inoculum were mixed by shaking the bottles by hand approximately every 5 days. T. harzianum BHT-Nl inoculum in the carrier was incorporated into soil in the field to 6-8 cm depth 7 days before seed sowing at a rate of 1kg inoculum/2 m2 plot. The inoculum was mixed with the soil manually. After mixing the inoculum, soil was irrigated manually with water from a small tank with a sprinkler to promote establishment of inoculum in the soil.

Application of fungicides and Trichoderma harzianum BHT-N1. The fungicides carbendazim

(Autostin 50 WDG) @ 2g/kg seed, thiophanate-methyl (Sunphanate70 WP) @ 1g/L, propiconazole (Tilt 250 EC) @ 0.5ml/L, iprodione (Rovral 50 WP) @ 2g/L, and azoxstrobin

20% + difenoconazole 12.5 % (Amistar Top) @ 1ml/L were applied separately and in combination with ThBHT-N1. Carbendazim was applied as a seed treatment @ 2g/kg seed before sowing. Other fungicides were sprayed on plants three times at 7 days intervals beginning on December 24, 2016 in Jamalpur and on January 12, 2017 in Burirhut, Rangpur. At that time about 20% of mustard flowers were in bloom. White mold incidence was assessed based on visual observation of white cottony mycelia on leaves, flowers, petioles or stems or based on disease symptoms and/or signs on the plant (lesions on the main stem, wilted plants with black sclerotia). One hundred plants were selected randomly from each experimental plot in January

28, 2017 and February 7, 2017 in Jamalpur and Burirhut, Rangpur respectively. The number of white mold-infected plants was counted. Alternaria leaf spot developed in plots in Jamalpur and disease severity was evaluated on a 0-5 scale, in which 0 = leaves free from leaf spot, 1 = 0.1-

126

6.0 % leaves or pod diseased, 2 = 6.1 – 12.0% leaves or pods diseased, 3 = 12.1 – 25.0 % leaves or pods diseased, 4 = 25.1 – 50.0% leaves or pods diseased, and 5 = 50.1 – 100.0% leaves or pods diseased. Yield (g/plot) was determined from each replicate treatment after harvest.

Data analysis. The percent disease index (PDI) for Alternaria blight for each plot was calculated according to the following formula: PDI= !"# !" !"" !"#$%&' × !"" Differences in !"#$% !".!" !"#$%&'()!*# × !"#$!%! !"#$%& !"#$% white mold incidence, Alternaria blight severity and yield were determined by analysis of variance (ANOVA) with a general linear model using statistical software Minitab 16.0 (Minitab

Inc). White mold incidence data were square root-transformed prior to analysis. Treatment means were compared using Tukey’s multiple comparison test.

Results

In Burirhut, Rangpur white mold incidence was low but significant differences were observed between plots treated with propiconazole or azoxystrobin + difenoconazole along with soil application with ThBHT-N1 and non-treated plots (P = 0.052) and yield (P = 0.069) (Table

5.1). Plots treated with a soil application of ThBHT-N1 in combination with foliar applications of propiconazole or azoxystrobin + propiconazole had significantly lower white mold disease incidence than non-treated control plots. However, neither BHT-N1 nor propiconazole or azoxystrobin + difenoconazole treatments alone reduced white mold incidence compared to the control. None of the remaining treatments were effective against white mold alone or in combination with ThBHT-N1. A similar trend was observed in the effects of treatments on yield.

Significantly higher yield was recorded from the plots treated with BHT-N1 in combination with

127 propiconazole + azoxystrobin than in the control plot. No other treatments singly or in combination with BHT-N1 significantly increased mustard yield compared to the control.

In Jamalpur, white mold was not observed in any of the mustard field plots. However,

Alternaria pressure was high, and disease severity reached a PDI of 62.0 in the non-treated control. The percent disease index values for Alternaria blight differed significantly (P < 0.001) between treated and non-treated control plots (Table 5.2). Alternaria blight severity was significantly lower in all treated plots than in the non-treated control plots. The most effective treatments were foliar applications of iprodione or propiconazole + azoxystrobin. Combining any of the fungicide treatments with ThBHT-1 did not improve their efficacy against Alternaria blight.

Discussion

White mold was absent or in low incidence in the two naturally infested field sites utilized in 2016/2017. The weather varies from year to year in Bangladesh during the mustard growing season and white mold does not always build to epidemic status under natural inoculum conditions. However, it was possible to differentiate fungicide and biocontrol treatment effects on disease incidence and yield in Burirhut, Rangpur. Under relatively low disease pressure, synergism was observed between the biocontrol agent ThBHT-N1 applied as a soil treatment and two foliar fungicide treatments, propiconazole and propiconazole + azoxystrobin. These results indicate that T. harzianum BHT-N1 is compatible with these two fungicides and the combined effect of biocontrol agent and the fungicides can reduce disease and, in the case of ThBHT-N1 soil application followed by foliar sprays of propiconazole + azoxystrobin, increase yield. Budge and Whipps (2001) also reported that integration of fungicides increased the efficacy of

128 biocontrol agents. Additional field trials are needed to confirm these results, particularly under higher disease pressure than observed in this experiment.

While there was no white mold disease in Jamalpur, we observed plants up to harvest and found that some treatments were very effective against Alternaria blight. Interestingly, propiconazole + azoxystrobin was one of two most effective treatments, the other being iprodione. Iprodiones is used extensively to control Alternaria blight in Bangladesh. As a result, the probability of fungicide resistance developing in Alternaria populations to iprodione is high.

Propiconazole along with azoxystrobin can serve as an equally effective alternative that can be used in alternation with iprodione to manage fungicide resistance. It is not clear from the results of this experiment if azoxystrobin contributes significantly to lowering Alternaria blight incidence, since the PDI values for propiconazole alone (Tilt) and propiconazole + azoxystrobin

(Amistar Top) were statistically similar. Additional experiments should be conducted to fully evaluate the efficacy of these products against Alternaria blight.

Results with the biocontrol agent T. hamatum BHT-N1 were promising for both white mold and Alternaria blight management. While synergism was only observed with fungicides in reduction of white mold incidence, BHT-N1 alone reduced Alternaria blight significantly compared to the non-treated control. Additional studies should be conducted to determine the mode(s) of action of this biocontrol agent against both pathogens, and to optimize product formulation and delivery.

References

Abdullah, M. T., Ali, N. Y., and Suleman, P. 2008. Biological control of Sclerotinia sclerotiorum (Lib.) de Bary with Trichoderma harzianum and Bacillus amyloliquefaciens. Crop Protection 27:1354-1359.

129

Annual Research Report 2014-2015. Horticultural Research Center, Bangladesh Agricultural Research Institute (BARI), Gazipur, Bangladesh p164.

Bardin, S. D., and Huang, H. C. 2001. Research on biology and control of Sclerotinia diseases in Canada. Canadian Journal of Plant Pathology 23:88-98.

Bangladesh Bureau of Statistics. 2015. Statistical Year Book of Bangladesh, Bhaka. Bangladesh Bureau of Statistics.

Benigni, M., and Bompeix, G. 2010. Chemical and biological control of Sclerotinia sclerotiorum in witl of chicory culture. Pest Management Science 66:1332-1336.

Bolton, M. D., Bart, P. H. J., Thomma, B. P., and Nelson, B. D. 2006. Sclerotinia sclerotiorum (Lib.) de Bary: biology and molecular traits of a cosmopolitan pathogen. Molecular Plant Pathology 7:1-16.

130

Coley-Smith, J. R., and Cooke, R. C. 1971. Survival and germination of fungal sclerotia. Annual Review of Phytopathology 9:65-92.

Conway, K. E., Maness, N. E., and Motes, J. E. 1997. Integration of biological and chemical controls for Rhizoctonia aerial blight and root rot of rosemary. Plant Disease 81:795-798.

Cubeta, M. A., and Echandi, E. 1991. Biological control of Rhizoctonia and Pythium damping- off of cucumber: an integrated approach. Biological Control 1:227-236.

Del Río, L. E., Bradley, C. A., Henson, R. A., Endres, G. J., Hanson, B. K., McKay, K., and Lamey, H. A. 2007. Impact of Sclerotinia stem rot on yield of canola. Plant Disease 91:191-194.

Elad, Y. 1994. Biological control of grape grey mould by Trichoderma harzianum. Crop Protection 13:35-38.

Harman, G. E., Latorre, B., Agosin, E., San Martin, R., Riegel, D. G., Nielsen, P. A. and Pearson, R. C. 1996. Biological and integrated control of Botrytis bunch rot of grape using Trichoderma spp. Biological Control 7:259-266.

Khangura R, Beard C, 2015. Managing sclerotinia stem rot in canola. Department of Agriculture and Food. Australian Government, cited at https:// www.agric.wa.gov.au/canola/managing- sclerotinia-stem-rot-canola. Accessed 9 September 2015.

Kharbanda, P. D., and Tewari, J. P. 1996. Integrated management of canola diseases using cultural methods. Canadian Journal of Plant Pathology 18:168-175.

Maloy, O. C. 2005. Plant disease management. The plant health instructor, American Phytopathological Society 10.

131

Matheron, M. E., and Matejka, J. C. 1989. In vitro and field comparison of six new fungicides with iprodione and vinclozolin for control of leaf drop of lettuce caused by Sclerotinia sclerotiorum. Plant Disease 73:727-730.

Miah, M. A. M., Rashid, M. A., and Shiblee, S. A. M. 2014. Assessment of socioeconomic impacts of oilseed research and development in Bangladesh. Final report submitted to the Agricultural Economics and Rural Sociology, BARC, Farmgate, Dhaka.

Miah, M. M., Shiblee, S. M. A., and Rashid, M. A. 2015. Economic impacts of oilseed research and development in Bangladesh. Bangladesh Development Studies 38:1-31.

Minuto, A., Migheli, Q., and Garibaldi, A. 1995. Evaluation of antagonistic strains of Fusarium spp. in the biological and integrated control of Fusarium wilt of cyclamen. Crop Protection 14:221-226.

Murray, G., Brennan, J. P. 2012. The current and potential costs from diseases of oilseed crops in Australia, cited at https://www.grdc.com.au/ Resources/Publications/2012/06/The-Current-and- Potential-Costs-fromDiseases-of-Oilseed-Crops-in-Australia. Accessed 21 July 2015.

Stammler, G., Benzinger, G., and Speakman, J. 2007. A rapid and reliable method for monitoring the sensitivity of Sclerotinia sclerotiorum to boscalid. Journal of Phytopathology 155:746-748.

Sugar, D., and Spotts, R. A. 1999. Control of postharvest decay in pear by four laboratory-grown yeasts and two registered biocontrol products. Plant Disease 83:155-158.

Sundheim, L., and Amundsen, T. 1982. Fungicide tolerance in the hyperparasite Ampelomyces quisqualis and integrated control of cucumber powdery mildew. Acta Agriculturae Scandinavica 32:349-355.

Zeng, W., Kirk, W., and Hao, J. 2012. Field management of Sclerotinia stem rot of soybean using biological control agents. Biological Control 60:141-147.

132

Table 5. 1. Development of white mold disease in rapeseed mustard cv. BARI Sharisa 14 in Burirhut, Rangpur, Bangladesh, 2016. Trichoderma harzianum isolate BHT-N1 (ThBHT-N1) and five different fungicides were applied separately and in combination.

Treatment and rate White mold Yield (g/plot) incidence (%)a Carbendazim seed treatment (Autostin 50 WDG @ 2g/kg) 9.7 abb 156.2 bc (3.0)d Thiophanate-methyl foliar application (Sunphanate 70 WP @ 9.7 ab 215.2 ab 1g/L) (3.1) Propiconazole foliar spray (Tilt 250 EC @ 0.5ml/L) 7.5 ab 254.5 ab (2.7) Iprodione foliar spray (Rovral 50 WP @ 2 g/L) 7.5 ab 224.2 ab (2.7) Azoxystrobin + difenoconazole foliar spray (Amister Top 325 7.5 ab 231.0 ab SC @ 1ml/L) (2.7) Soil application of Th BHT-N1@ 1kg/2 m2 plot 11.5 ab 184.7 ab (3.4) Carbendazim seed treatment (Autostin 50 WDG @ 2g/kg + 9.7 ab 168.7 ab soil application of Th BHT-N1@ 1kg/2 m2 plot) (3.0) Thiophanate-methyl foliar spray (Sunphanate 70 WP @ 1g/L+ 10.7 ab 199.7 ab soil application of Th BHT-N1@ 1kg/2 m2 plot) (3.2) Propiconazole foliar spray (Tilt 250 EC @ 0.5ml/L + soil 5.7 b 253.7 ab application of Th BHT-N1@ 1kg/2 m2 plot) (2.4) Iprodione foliar spray (Rovral 50 WP @ 2 g/L + soil 9.7 ab 187.0 ab application of Th BHT-N1@ 1kg/2 m2 plot) (3.1) Azoxystrobin + difenoconazole foliar spray (Amistar Top 325 5.7 b 288.2 a SC @ 1ml/L + soil application of Th BHT-N1@ 1kg/2 (2.4) m2 plot) Non-treated control 13.0 a 153.0 b (3.6) P value 0.052 0.069 a Percent white mold data = (Number of infected plants × 100)/Number of total plants counted in a plot b Tukey’s multiple comparison test at α = 0.10 c Tukey’s multiple comparison test at α = 0.15 d Data within parenthesis are square root transformed values

133

Table 5. 2. Effect of fungicides alone and in combination with Trichoderma harzianum BHT-N1 on Alternaria blight of mustard cv. BARI Sharisa 14 in Jamalpur, Bangladesh, 2016.

Treatment and rate Plant Disease Indexa Carbendazim seed treatment (Autostin 50 WDG @ 2g/kg) 32.0 bc

Thiophanate-methyl foliar application (Sunphanate 70 WP @ 1g/L) 23.0 cde

Propiconazole foliar spray (Tilt 250 EC @ 0.5ml/L) 24.5 cde

Iprodione foliar spray (Rovral 50 WP @ 2 g/L) 16.0 e

Azoxystrobin + difenoconazole foliar spray (Amistar Top 325 SC @ 1ml/L) 15.0 e

Soil application of Th BHT-N1@ 1kg/2 m2 plot 31.5 bcd

Carbendazim seed treatment (Autostin 50 WDG @ 2g/kg + soil application of Th 40.5 b BHT-N1@ 1kg/2 m2 plot)

Thiophanate-methyl foliar spray (Sunphanate 70 WP @ 1g/L+ soil application of 31.0 bcd Th BHT-N1@ 1kg/2 m2 plot)

Propiconazole foliar spray (Tilt 250 EC @ 0.5ml/L + soil application of Th BHT- 24.0 cde N1@ 1kg/2 m2 plot)

Iprodione foliar spray (Rovral 50 WP @ 2 g/L + soil application of Th BHT-N1@ 18.5 de 1kg/2 m2 plot)

Azoxystrobin + difenoconazole foliar spray (Amister Top 325 SC @ 1ml/L + soil 16.5 e application of Th BHT-N1@ 1kg/2 m2 plot)

Non-treated control 62.0 a P= 0.001 Disease severity was recorded on 0-5 scale, where 0 = leaves free from leaf spot, 1 = 0.1- 6.0 % leaves or pod are diseased, 2 = 6.1 – 12.0% leaves or pod are diseased, 3 = 12.1 – 25.0 % leaves or pod are diseased, 4 = 25.1 – 50.0% leaves or pod are diseased, and 5 = 50.1 – 100.0% leaves or pod are diseased. aPDI (percent disease index) was calculated form disease data following the formula PDI= !"# !" !"" !"#$%&' × !"" !"#$% !".!" !"#$%&'()!*# × !"#$!%! !"#$%& !"#$%

134

Bibliography

Abreu, M. J., and E. A. Souza. 2015. Investigation of Sclerotinia sclerotiorum strains variability in Brazil. Genetics and Molecular Research 14:6879-6896.

Ahmed, A. U. 1986. Recommendation on the methods of disease management of crops in Bangladesh. Plant Pathology Division, Bangladesh Agricultural Research Institute pp.11-13.

Aldrich-Wolfe, L., Travers, S., and Nelson Jr, B. D. 2015. Genetic variation of Sclerotinia sclerotiorum from multiple crops in the north central United States. PloS one 10:e0139188.

Alghisi, P., and Favaron, F. 1995. Pectin-degrading enzymes and plant-parasite interactions. European Journal of Plant Pathology 101:365-375.

Anderson, J. B., and Kohn, L. M. 1995. Clonality in soilborne, plant-pathogenic fungi. Annual Review of Phytopathology 33:369-391.

Anonymous. 2005. Sclerotinia initiative brochure, Fargo, ND: United States Department of Agriculture, cited at www.whitemoldresearch.com.

Bangladesh Bureau of Statistics. 2015. Statistical Year Book of Bangladesh, Bhaka. Bangladesh Bureau of Statistics p 40. 135

Bardin, S. D., and Huang, H. C. 2001. Research on biology and control of Sclerotinia diseases in Canada. Canadian Journal of Plant Pathology 23:88-98.

Bateman, D. F. 1964. An induced mechanism of tissue resistance to polygalacturonase in Rhizoctonia-infected hypocotyls of bean. Phytopathology 54:438-445.

Benigni, M., and Bompeix, G. 2010. Chemical and biological control of Sclerotinia sclerotiorum in wilt of chicory culture. Pest Management Science 66:1332-1336.

Boland, G. J., and Hall, R. 1994. Index of plant hosts of Sclerotinia sclerotiorum. Canadian Journal of Plant Pathology 16:93-108.

Bolton, M., D., Bart, P. H. J., Thomma, and Nelson, B. D. 2006. Sclerotinia sclerotiorum (Lib.) de Bary: biology and molecular traits of a cosmopolitan pathogen. Molecular Plant Pathology 7:1-16.

Carbone, I., Anderson, J. B., and Kohn, L. M. 1999. Patterns of descent in clonal lineages and their multilocus fingerprints are resolved with combined gene genealogies. Evolution 53:11-21.

Caten, C. E. 1972. Vegetative compatibility and cytoplasmic infection in fungi. Journal of General Microbiology 72:221-229.

136