Role of Polymorphisms in MTHFR and MTHFD1 Genes in the Outcome of Childhood Acute Lymphoblastic Leukemia

Role of polymorphisms in MTHFR and MTHFD1 genes in the outcome of childhood acute lymphoblastic leukemia

M Krajinovic1,2 ABSTRACT ´ 1 The central role of 5,10-methylenetetrahydrofolate reductase (MTHFR) and E Lemieux-Blanchard methylenetetrahydrofolate dehydrogenase (MTHFD1) in folate metabolism 1 S Chiasson renders polymorphisms in genes encoding these enzymes potential M Primeau1 modulators of therapeutic response to antifolate chemotherapeutics. The I Costea1 analysis of 201 children treated with methotrexate for childhood acute 1,2 lymphoblastic leukemia (ALL) showed that patients with either the MTHFR A Moghrabi T677A1298 haplotype or MTHFD1 A1958 variant had a lower probability of 1Centre de Recherche, Hoˆpital Sainte-Justine; event-free survival (EFS) in univariate analysis (hazard ratio (HR) ¼ 2.2, 95% Centre Hospitalier Universitaire Me`re-Enfant, confidence interval (CI), 1.0–4.7 and 2.8, 95% CI, 1.1–7.3, respectively). Coˆte Ste-Catherine, Montreál, Canada; Multivariate analysis supported only the role of the MTHFR variant (HR ¼ 2.2, 2 De´partement de Pe´diatrie, Universite´ de 95% CI, 0.9–5.6). However, the association of both genes with ALL outcome Montreál, Que´bec, Canada appears to be more obvious in the presence of another event-predisposing Correspondence: variant belonging to the same path of drug action. The combined effect of a thymidylate synthase (TS) triple repeat associated with increased TS levels, M Krajinovic, Centre de recherche, Hoˆpital with either the MTHFR T677A1298 haplotype or MTHFD1 A1958 allele, Sainte-Justine, 3175 Coˆte Ste-Catherine, resulted in a highly significant reduction of EFS (multivariate HR ¼ 9.0, 95% Montreál, Que´bec, Canada H3T 1C5. Tel: þ 1 514 345 4931x6259; CI, 1.9–42.8 and 8.9, 95% CI, 1.8–44.6, respectively). These results reveal Fax: þ 1 514 345 4731 the role of gene–gene interactions within a folate pathway, and how they can E-mail: [email protected] correlate with relapse probabilities in ALL patients. The Pharmacogenomics Journal (2004) 4, 66–72. doi:10.1038/sj.tpj.6500224 Published online 2 December 2003

Keywords: folate metabolism; MTHFR; MTHFD1; polymorphism; ALL; outcome

INTRODUCTION The 5,10-methylenetetrahydrofolate reductase (MTHFR) catalyzes the conversion of 5,10-methylenetetrahydrofolate (5,10-methylene-THF) into 5-methyltetrahydrofolate (5-methyl-THF), a major circulating form of folate that provides a methyl group for homocysteine methylation.1,2 5,10-Methylene-THF and its derivates, such as 10-formyl tetrahydrofolate (10-formyl-THF), are essential cofactors for thymidylate and de novo purine synthesis, and are provided by the action of the trifunctional enzyme, methylenetetrahydrofolate dehydrogenase/ methenyltetrahydrofolate cyclohydrolase/formyltetrahydrofolate synthetase (MTHFD1).1–3 Since MTHFR and MTHFD1 are key players in folate metabolism, the Received: 05 June 2003 differences in their activity due to their respective gene variants could not only Revised: 23 September 2003 2 Accepted: 02 October 2003 modify susceptibility to different diseases but might also modulate therapeutic Published online 2 December 2003 response to antifolate chemotherapeutic agents. One such agent is methotrexate MTHFR and MTHFD1 polymorphisms and childhood ALL outcome M Krajinovic et al 67

(MTX), which, besides 6-mercaptopurine, is considered as a Table 1 Frequency of MTHFR and MTHFD1 genotypes in ALL key component in the treatment of childhood acute children with and without event lymphoblastic leukemia (ALL). Two common polymorphisms, a C677 to T transition Event, N (%) Nonevent, N (%) causing an alanine to valine substitution at codon 222 C677T A1298C (Ala222Val)4 and an A1298 to C transversion causing a glutamic acid to alanine replacement at codon 429 MTHFR genotypes CC AA 2 (5.7) 33 (19.9) (Glu429Ala),5,6 have been described in the MTHFR gene. CTAA 12 (34.3) 40 (24.1) Both variants have an impact on enzyme function: 677T TTAA 5 (14.3) 16 (9.6) affecting the catalytic and 1298C the regulatory MTHFR CC AC 7 (20.0) 33 (19.9) 4,5 domain. Reduced enzymatic activity has been observed in CT AC 9 (25.7) 35 (21.1) TT677 or CC1298 homozygotes, and to a lesser extent in CC CC 0 (0) 9 (5.4) heterozygous individuals.4,6,7 The role of MTHFR variants in a number of disorders, involving disturbances in folate T677A1298 + 26 (74.3) 91 (54.8) metabolism, such as neural tube defects (NTDs),8 vascular T677A1298 À 9 (25.7) 75 (45.2) disease9,10 and cancer susceptibility, is well documented.11,12 Recently, the potential role of these polymorphisms MTHD1 genotypes G1958A GG 5 (14.3) 58 (34.3) in response to MTX treatment has been addressed in several 13–16 GA 24 (68.6) 84 (49.7) studies. Higher in vitro MTX sensitivity of a patient’s AA 6 (17.1) 27 (16.0) lymphoblasts with the TT677 genotype has been shown.13 Likewise, among adult acute lymphoblastic leukemia (ALL) The risk of event (HR) for MTHFR T677A1298 haplotype individuals vs noncarriers and chronic myelogenic leukemia (CML) patients receiving is 2.2, 95% CI ¼ 1.1–4.7, P ¼ 0.04, and HR for MTHFD1 1958A carriers vs GG homozygotes is 2.8 95% CI ¼ 1.1–7.3, P ¼ 0.03. MTX, higher drug toxicity was observed in TT677 homozygotes as compared to individuals with other MTHFR genotypes.14,15 enced an event. Individuals with this haplotype (essentially The G to A substitution at position 1958 of the MTHFD1 corresponding to T677 carriers) were at a higher risk of event gene, causing an alanine to glycine substitution at codon compared to other MTHFR genotype groups (hazard ratio 653 located within the 10-formyl-THF synthetase enzyme (HR) ¼ 2.2, 95% confidence interval (CI), 1.0–4.7, P ¼ 0.04). domain, has recently been reported.17 The role of an Within our sample, the observed association did not seem to MTHFD1 A1958 variant in NTD susceptibility suggested be dependent on the presence or absence of the MTHFR the possibility of its functional impact.18 1298 variant (ie it was not exclusively due to either the Since MTHFR and MTHFD1 polymorphisms might affect C677C1298 or C677A1298 haplotypes). Similarly, Kaplan– MTX sensitivity through their impact on 5-methyl-THF and Meier EFS estimates showed that T677A1298A individuals 5,10-methylene-THF levels, we assessed here the association had a lower probability of 5-year post-treatment EFS of these polymorphisms with event- and disease-free compared to other genotype groups (P ¼ 0.03, Figure 1a). survival (EFS and DFS), overall survival (OS), as well as with Likewise, the MTHFD1 A1958 variant was associated with an the frequency of weeks with MTX dose reduction or increased risk of event (HR ¼ 2.8, 95% CI, 1.1–7.3 P ¼ 0.03), withdrawal in children who received this drug for the and hence a lower probability of EFS (P ¼ 0.02, Figure 1b). treatment of ALL. Given that MTX polyglutamates directly The inclusion of previously analyzed genotypes that corre- inhibit folate-dependent enzymes,19,20 along with the fact lated with ALL outcome (see Materials and methods section) that thymidylate synthase (TS) requires for its activity 5,10- in the multivariate model did not affect the results for the methylene-THF,11,21,22 it is possible that increased levels of MTHFR T677A1298 haplotype or MTHFD1 A1958 variant this cofactor, produced by altered MTHFR and/or MTHFD1 (respective HRs are 2.1, 95% CI, 1.0–8.4 and 2.5, 95% CI, action, might facilitate thymidylate synthesis thus interfer- 1.0–6.4). When patients and disease characteristics (see ing with MTX action. This would be particularly obvious in Materials and methods section) were entered together with ALL patients with increased TS levels, such as for those that MTHFR or MTHFD1 genotype in the Cox regression model, are homozygous for a triple repeat (3R) of the 50UTR TS HR estimates for MTHFR T677A1298 did not change the polymorphism.23 Homozygous TS 3R ALL patients have output values of the test (HR ¼ 2.2, 95% CI, 0.9–5.6), previously been shown to have an increased risk of event.24 although due to the reduced power, the level of significance Therefore, we also assessed the association of MTHFR and was lost (P ¼ 0.1). In contrast, risk of event associated with MTHFD1 polymorphisms with ALL outcome in the context the MTHFD1 A1958 allele was reduced in a multivariate of TS 3R homozygosity. analysis (HR ¼ 1.7, 95% CI, 0.9–4.4, P ¼ 0.3), suggesting that the MTHFD1 variant does not independently affect the probability of event in patients with ALL. Further analysis of RESULTS DFS (n ¼ 30) showed a similar multivariate HR, as in EFS The analysis of MTHFR genotypes (Table 1) showed that analysis for both the MTHFR T677A1298 haplotype individuals bearing the T677A1298 haplotype were found at (HR ¼ 3.3, 95% CI, 1.1–9.9, P ¼ 0.03) and MTHFD1 A1958 a higher frequency in the group of children who experi- variant (HR ¼ 1.6, 95% CI, 0.8–5.8, P ¼ 0.4), whereas no

www.nature.com/tpj MTHFR and MTHFD1 polymorphisms and childhood ALL outcome M Krajinovic et al 68

and 8.9, 95% CI, 1.8–44.6, P ¼ 0.007), or when applying a correction for multiple testing. The results did not change if DFS was analyzed instead of EFS, whereas no association was found between combined genotypes and OS (data not shown). No correlation between combined genotypes and MTX dosage, or frequency of weeks with MTX dose reduction or withdrawal was observed. And finally, no interaction between the MTHFR and MTHFD1 genotypes was seen (data not shown).

DISCUSSION MTHFR plays a key role in folate metabolism by channeling one-carbon units between nucleotide synthesis and methylation reactions.2 Reduced 50methyl-THF levels may decrease homocysteine methylation to methionine, resulting in hyperhomocysteinemia and DNA hypomethylation.25 On the other hand, reduced levels of 5,10-methylene-THF, required for thymidylate synthesis, could lead to uracil misincorporation into DNA, increasing the frequency of chromosome damage,25,26 the effect that facilitates the Figure 1 Kaplan–Meier estimates of EFS for ALL patients in the function of MTHFR and MTHFD1 genotypes. EFS curves for patients action of certain chemotherapeutics, including that of who are positive or negative for (a) MTHFR T677A1298 haplotype; MTX. In addition to MTHFR, maintenance of the folate (b) MTHFD1 A1958 variant; (c) both MTHFR T677A1298 haplotype pool is provided by MTHFD1, which plays an important role and TS 3R repeat; and (d) both MTHFD1 A1958 variant and TS 3R in the generation of the 5,10-methylene-THF and 10-formyl- repeat. The genotype and the number of patients in each curve, THF required for de novo purine and thymidylate synthesis.3 numbers of individuals with an event (in the parenthesis), as well as Since the effect of MTX depends upon intracellular THF the P-value, estimated by log-rank test for the survival differences depletion,27 it is quite possible that alterations in the between the patients groups, are indicated on the plot. reduced folate pools, influenced by MTHFR and MTHFD1 polymorphisms, may affect MTX sensitivity. Indeed, several recent studies found that variant MTHFR 677T correlates with MTX toxicity. Using lymphoblasts originating from ALL patients who suffered MTX-related toxicity, Taub et al13 association was found between either of the polymorphisms found that those with the TT genotype exhibited greater in and OS (n ¼ 19, respective multivariate HRs are 2.0, 95% CI, vitro MTX sensitivity when compared to patients with other 0.5–7.4, P ¼ 0.3 and 1.9, 95%, CI 0.4–9.0, P ¼ 0.4). genotypes.13 MTX toxicity recorded during the mainte- We did not observe a significant difference between nance phase of adult ALL treatment was significantly individuals with or without the T677A1298 haplotype or increased in TT677 patients, in whom myelosuppression MTHFD1 A1958 allele with regard to missed weeks of MTX and liver toxicity seemed particularly pronounced.14 A due to drug toxicity, or average drug dose received weekly. similar effect of the MTHFR polymorphisms was also These parameters remained constant when only homozy- observed for other diseases treated by MTX. For example, gous individuals were taken into account (ie MTHFR TT677, MTHFR TT677 patients with CML who received MTX for the MTHFR CC1298 or MTHFD1 AA), and compared to prevention of a graft-versus-host disease, experienced higher individuals without these genotypes. toxicity, as documented by increased oral mucositis and Following the hypothesis that the conservation of 5,10- delayed platelet recovery.15 Increased MTX toxicity was also methylene-THF, via altered MTHFR or MTHFD1 activity, noted in ovarian cancer patients with the TT677 genotype,28 would facilitate thymidylate synthesis, particularly in and in patients with rheumatoid arthritis who were carriers individuals with the 3R3R genotype of the TS gene, we of the T677A1298 haplotype.16 MTX-associated effects studied the association of combined TS and MTHFR, or observed in these studies were suggested to arise due to MTHFD1 event-predisposing genotypes. Individuals with low 5-methyl-THF levels associated with the T677 variant. both TS 3R3R and MTHFR T677A1298 or TS 3R3R and In our study, we did not observe any association between MTHFD1 A1958 genotypes had a remarkably lower prob- MTHFR or MTHFD1 polymorphisms and MTX toxicity in ability of 5-year post-treatment EFS, compared to subjects childhood ALL patients, at least not to the extent that it with no event-predisposing genotypes (54 vs 93%, would lead to MTX withdrawal or dose reduction. Further P ¼ 0.0001 and 45 vs 95%, P ¼ 0.0002, respectively, Figure analyses beyond the MTX dose are needed to confirm this 1c and d). Significant association is retained during Cox’s observation. In contrast, we observed an association be- regression analysis in the presence of other prognostic tween the MTHFR1 T677A1298 haplotype and risk or relapse factors (respective HRs are 9.0, 95% CI, 1.9–42.8, P ¼ 0.006 (ie an association of the MTHFR variant with both EFS and

The Pharmacogenomics Journal MTHFR and MTHFD1 polymorphisms and childhood ALL outcome M Krajinovic et al 69

DFS, but not OS). This observation could be explained by the suggested to limit DNA damage by reducing uracil incor- fact that T677 carriers conserve more 5,10-methylene-THF poration into DNA, thus explaining the protective role of than carriers of other genotype groups, which would slow these variants against leukemia.35 On the other hand, this the incorporation of uracil into DNA, and might therefore might also favor the proliferation of residual malignant reduce MTX efficacy. Individuals with the C677A1298 or clone. C677C1298 haplotypes appeared protected from the event, In conclusion, our study provides further evidence of the suggesting, at least in our study, that the C1298 variant has critical role played by the enzymes of the folate pathways in little influence on ALL outcome. The association of the ALL outcome, possibly through interference with MTX MTHFR C1298 variant with parameters of MTX sensitivity action. The association of the MTHFR T677A1298 haplotype was less frequently studied than that of T677, and so far has and MTHFD1 A1958 allele with reduced EFS and DFS is been assessed only in studies of rheumatoid arthritis, among particularly obvious when combined with other event- which one study showed that patients with the C677C1298 predisposing variants within the same pathway. Keeping in haplotype responded better to the MTX treatment,16 while mind the small sample size of our study, this finding should in another study no influence of any of the MTHFR be replicated in independent and larger patient cohorts. In polymorphisms was observed.29 addition, given the complex mechanism of folate pool With regard to the MTHFD1 polymorphism, its functional maintenance, as well as that of MTX resistance, polygenic role in folate pool maintenance has been suggested: women effects on ALL outcome and MTX sensitivity are expected with the MTHFD1 AA1958 genotype were found to be at an beyond the influence of the two loci shown here. The whole increased risk of having NTD-affected offspring.18 In addi- range of both cytoplasmatic and mitochondrial enzymes tion, the conservation of an arginine residue at the might play a role in the outcome of this disease. For corresponding position of the MTHFD1 gene across numer- example, the enzymes affecting folate catabolism37 or ous species suggests that replacement with glutamine, methylene-THF synthesis might be of importance.38,39 caused by a G to A base substitution, may have functional Similarly, the mitochondrial counterpart of MTHFD1, the consequences.18 Since MTHFD1 arg653gln replacement lies NAD-dependent methylenetetrahydrofolate dehydrogenase, within the 10-formyl-THF synthase domain of MTHFD1, it is can influence 10-formyl-THF generation that in turn possible that a reduction in 10-formyl THF formation could contributes to the cytoplasmatic folate pools.40 shift folate balance towards 5,10-methylene-THF pools In order to analyze the whole range of polymorphisms required for TS synthesis. In addition, genomic imbalance underlying other enzymatic variants within the folate corresponding to the MTHFD1 locus was found in MTX- pathway, as well as their possible gene–gene interactions, resistant T-cell ALL cell lines.30 it is necessary that much larger and more collaborative The association of both gene polymorphisms, and parti- studies be undertaken, if we are to understand the role of cularly that of MTHFD1, appears more obvious when gene polymorphisms in ALL outcome. combined with other variants within the same pathway. The known mechanism of MTX further supports this observation. MTX-induced depletion of folate cofactors MATERIALS AND METHODS such as 10-formyl-THF and 5-10-methylene-THF contributes Study Population to the inhibition of the folate-dependent enzymes of de novo The patients (n ¼ 201) included in this study were children purine and thymidylate synthesis.31 It was suggested that with ALL of French–Canadian origin treated at Sainte- depletion of these factors alone would not be sufficient to Justine Hospital, Montreal, Canada, between 1988 and inhibit folate-dependent enzymes.32,33 Indeed, several stu- 2000, with the multiagent chemotherapeutic protocols dies confirmed that MTX polyglutamates are potent in- DFCI 87-01, 91-01 or 95-01 of the Dana-Farber Cancer hibitors of folate-dependent enzymes,19–21,32 providing Institute.24 The details of the MTX administration are given evidence that inhibition of de novo thymidylate synthesis elsewhere.41 Information concerning the reduction and consists of both substrate depletion and direct enzymatic increase of MTX dose carried out according to the protocols inhibition. It can then be speculated that lower levels of TS was available for 185 patients. Patient samples were and 5,10-methylene-THF would facilitate MTX action while, obtained at diagnosis after informed consent. The Hospital in contrast, high levels would mediate MTX resistance. The Ethical Committee approved the study protocol. The latter would be expected for homozygous TS 3R individuals distribution of prognostic factors at diagnosis (sex, age, with the MTHFR T677A1298 haplotype or possibly MTHFD1 white blood cell (WBC) count, ALL immunophenotype, A1958 variant, thus explaining the highly significant treatment protocol, risk group and DNA index) among reduction in the relapse rate for individuals with those individuals with and without event was as described genotype combinations. previously.41 For analysis, patients were categorized accord- It is also possible that the association observed between ing to relapse risk prediction (boys or girls; age below 1 year, polymorphisms analyzed herein and disease outcome arises 1–10 and above 10; WBC below or above of 50 Â 109;B-orT- due to the their impact on malignancy progression, since cell type; standard, high or very high risk and DNA index both the MTHFR T677 and TS 3R variants were found to above or below 1.16, corresponding to 50 chromosomes).41 influence susceptibility to ALL.34–36 Higher 5,10-methylene- Children who relapsed or had a fatal outcome due to the THF and TS levels associated with these variants were disease were defined to have had an event.

www.nature.com/tpj MTHFR and MTHFD1 polymorphisms and childhood ALL outcome M Krajinovic et al 70

Genotyping diagnosis and relapse (range 1–84 and median of 26.5 Polymorphic MTHFR and MTHFD1 sites were screened by months), while in OS analysis (n ¼ 19) it corresponded to the allele-specific oligonucleotide (ASO) hybridization. DNA time between diagnosis and fatal outcome (range 1–84 and segments containing the polymorphic sites were amplified median of 20 months). by PCR using 15 ng of genomic DNA, 0.5 mM of each of the To estimate gene–gene interaction, we performed a primers, 100 mM dNTPs, 10 mM Tris-HCl (pH 8.3), 1.5 mM stratified analysis. For the analysis of survival probabilities MgCl2, 50 mM KCl and 0.5 U of Taq polymerase (Platinum, in the function of two genes, individuals for the double TS InVitroGene) in a total volume of 50 ml for 35 cycles repeat and having the MTHFD GG genotype or a haplotype composed of 30 s at 941C, 30 s at 621C, 51 or 621C (for sites other than MTHFR T677A1298, were defined as having a MTHFR 677, MTHFR 1298 and MTHFD1 1958, respectively), low-risk genotype combination and hence considered as a and 45 s at 721C. The sequence of forward and reverse reference. primer pairs used for the amplification of the regions The correlation between MTHFR and MTHFD1 genotypes encompassing the MTHFR 677, MTHFR 1298 and MTHD1 and MTX dosage (mg/m2/week), and the frequency of weeks 1958 polymorphisms were: tgaaggagaaggtgtctgcgg and agga with reduced or missed doses of MTX, were correlated using cggtgcggtgagagtg, ctttggggagctgaaggacta and cactttgtgaccat Spearman’s rank-correlation test. tccggttt and cactccagtgtttgtccatg and gcatcttgagagccctgac, The analyses were carried out using the SPSS statistical respectively. package (Version 10.0). The resulting PCR products were dot-blotted in duplicate on a nylon membrane and assayed for the presence or absence of one or the other variant by ASO hybridization, as described in Labuda et al.42 ASO probes specific for the DUALITY OF INTEREST MTHFR C677 (gcgggagCcgatttc), MTHFR T677 (gcgggagTc None declared gatttc), MTHFR A1298 (ccagtgaagAaagtg), MTHFR C1298 (ccagtgaagCaagtg), MTHFD1 G1958 (cagaccGgatcgcac) and ACKNOWLEDGEMENTS MTHFD1 A1958 (cagaccAgatcgcac) alleles were designed and We are indebted to all patients and their parents who consented to hybridized at 501C (MTHFR 677 and MTHFD1 1958) or 521C participate in this study. We are grateful to our colleagues Damian Labuda and Daniel Sinnett for discussion and biological material, (MTHFR 1298). Mark Bernstein for facilitating access to clinical data and Alan Lovell for critical reading of the manuscript. MK is a scholar of the Fonds Statistics de la Recherche en Sante´ du Que´bec. EL-B is a recipient of the w2 tests were used to examine the differences in the studentship from the Leukemia Research Funds of Canada. The frequency of MTHFR and MTHFD1 genotypes between Canadian Institutes of Health Research, Leukemia Research Fund of children with and without event or across categories of Canada and Fondation de l’Hoˆpital Sainte-Justine supported this different prognostic factors (sex, age, WBC count, ALL cell study. type, treatment protocol, risk group and DNA index). Crude odd ratios, with 95% CIs, and the levels of significance were ABBREVIATIONS calculated by Fisher’s exact test. Individuals with the MTHFR ALL acute lymphoblastic leukemia T677A1298 haplotype, or MTHFD1 A1958 carriers (repre- CML chronic myelogenic leukemia sented as dichotomous variables), were tested against other DFS disease-free survival MTHFR haplotypes or MTHFD1 genotypes in EFS, DFS and EFS event-free survival 10-formyl-THF 10-formyl tetrahydrofolate OS analysis. Survival differences obtained by Kaplan–Meier 5-methyl-THF 5-methyltetrahydrofolate for patients with different genotype groups were determined 5,10-methylene-THF 5,10-methylenetetrahydrofolate using a log-rank test. The HR (with a 95% CI) of the MTHFR MTHFD1 methylenetetrahydrofolate dehydrogenase and MTHFD1 variants was estimated by Cox’s regression MTHFR 5,10-methylenetetrahydrofolate reductase MTX methotrexate analysis, with and without the enclosure of prognostic NTD neural tube defects factors (ie sex, age, WBC count, ALL cell type, treatment OS overall survival protocol, risk group and DNA index) or other genetic WBC white blood cell variants (TS triple repeat, RFC1 A 80 and CCND1 A870) previously shown to influence the risk of relapse.24,41,43 In EFS analysis, survival time corresponded to the time between diagnoses and event (n ¼ 35), whereas for the REFERENCES censored cases it corresponded to time between diagnosis 1 Shane B. Folylpolyglutamate synthesis and role in the regulation of one- and the end of follow-up (5 years post-treatment) or carbon metabolism. Vitam Horm 1989; 45: 263–335. 2 Schwahn B, Rozen R. Polymorphisms in the methylenetetrahydrofolate February 2002 (for patients receiving therapy or those who reductase gene: clinical consequences. Am J Pharmacogenomics 2001; 1: have entered the follow-up period). In the event group, the 189–201. survival time ranged from 1 to 84 months with a median of 3 Hum DW, Bell AW, Rozen R, MacKenzie RE. Primary structure of a 19 months, and in the nonevent group, it ranged from 12 to human trifunctional enzyme. Isolation of a cDNA encoding methylenetetrahydrofolate dehydrogenase–methenyltetrahydrofolate cyclohydro- 84 months with a median of 60 months. In DFS analysis lase–formyltetrahydrofolate synthetase. J Biol Chem 1988; 263: (n ¼ 30), survival time corresponded to the time between 15946–15950.

The Pharmacogenomics Journal MTHFR and MTHFD1 polymorphisms and childhood ALL outcome M Krajinovic et al 71

4 Frosst P, Blom HJ, Milos R, Goyette P, Sheppard CA, Matthews RG et al. 22 Sakamoto S, Niina M, Takaku F. Thymidylate synthetase activity in bone A candidate genetic risk factor for vascular disease: a common mutation marrow cells in pernicious anemia. Blood 1975; 46: 699–704. in methylenetetrahydrofolate reductase. Nat Genet 1995; 10: 111–113. 23 Horie N, Aiba H, Oguro K, Hojo H, Takeishi K. Functional analysis and 5 Weisberg I, Tran P, Christensen B, Sibani S, Rozen R. A second genetic DNA polymorphism of the tandemly repeated sequences in the 50- polymorphism in methylenetetrahydrofolate reductase (MTHFR) asso- terminal regulatory region of the human gene for thymidylate synthase. ciated with decreased enzyme activity. Mol Genet Metab 1998; 64: Cell Struct Funct 1995; 20: 191–197. 169–172. 24 Krajinovic M, Costea I, Chiasson S. Polymorphism of the thymidylate 6 van der Put NM, Gabreels F, Stevens EM, Smeitink JA, Trijbels FJ, Eskes synthase gene and outcome of acute lymphoblastic leukaemia. Lancet TK et al. A second common mutation in the methylenetetrahydrofolate 2002; 359: 1033–1034. reductase gene: an additional risk factor for neural-tube defects? Am J 25 Kim YI. Folate and cancer prevention: a new medical application of Hum Genet 1998; 62: 1044–1051. folate beyond hyperhomocysteinemia and neural tube defects. Nutr Rev 7 Weisberg IS, Jacques PF, Selhub J, Bostom AG, Chen Z, Curtis Ellison R et 1999; 57: 314–321. al. The 1298A–4C polymorphism in methylenetetrahydrofolate re- 26 Blount BC, Mack MM, Wehr CM, MacGregor JT, Hiatt RA, Wang G et al. ductase (MTHFR): in vitro expression and association with homocys- Folate deficiency causes uracil misincorporation into human DNA and teine. Atherosclerosis 2001; 156: 409–415. chromosome breakage: implications for cancer and neuronal damage. 8 van der Put NM, Steegers-Theunissen RP, Frosst P, Trijbels FJ, Eskes TK, Proc Natl Acad Sci USA 1997; 94: 3290–3295. van den Heuvel LP et al. Mutated methylenetetrahydrofolate reductase 27 Messmann RA, Allegra CJ. Antifolates. In: Chabner BA, Longo DL (ed) as a risk factor for spina bifida. Lancet 1995; 346: 1070–1071. Cancer, Chemotherapy and Biotherapy (Principles and Practice). Lippin- 9 Engbersen AM, Franken DG, Boers GH, Stevens EM, Trijbels FJ, Blom HJ. cott, Williams & Wilkins: Philadelphia 2001. Thermolabile 5,10-methylenetetrahydrofolate reductase as a cause of 28 Toffoli G, Russo A, Innocenti F, Corona G, Tumolo S, Sartor F et al. Effect mild hyperhomocysteinemia. Am J Hum Genet 1995; 56: 142–150. of methylenetetrahydrofolate reductase 677C–4T polymorphism on 10 Kluijtmans LA, van den Heuvel LP, Boers GH, Frosst P, Stevens EM, van toxicity and homocysteine plasma level after chronic methotrexate Oost BA et al. Molecular genetic analysis in mild hyperhomocysteine- treatment of ovarian cancer patients. Int J Cancer 2003; 103: 294–299. mia: a common mutation in the methylenetetrahydrofolate reductase 29 Kumagai K, Hiyama K, Oyama T, Maeda H, Kohno N. Polymorphisms in gene is a genetic risk factor for cardiovascular disease. Am J Hum Genet the thymidylate synthase and methylenetetrahydrofolate reductase 1996; 58: 35–41. genes and sensitivity to the low-dose methotrexate therapy in patients 11 Robien K, Ulrich CM. 5,10-Methylenetetrahydrofolate reductase poly- with rheumatoid arthritis. Int J Mol Med 2003; 11: 593–600. morphisms and leukemia risk: a HuGE minireview. Am J Epidemiol 2003; 30 Efferth T, Verdorfer I, Miyachi H, Sauerbrey A, Drexler HG, Chitambar 157: 571–582. CR et al. Genomic imbalances in drug-resistant T-cell acute lympho- 12 de Jong MM, Nolte IM, te Meerman GJ, van der Graaf WT, de Vries EG, blastic CEM leukemia cell lines. Blood Cells Mol Dis 2002; 29: 1–13. Sijmons RH et al. Low-penetrance genes and their involvement in 31 Jolivet J, Cowan KH, Curt GA, Clendeninn NJ, Chabner BA. The colorectal cancer susceptibility. Cancer Epidemiol Biomarkers Prev 2002; pharmacology and clinical use of methotrexate. N Engl J Med 1983; 11: 1332–1352. 309: 1094–1104. 13 Taub JW, Matherly LH, Ravindranath Y, Kaspers GJ, Rots MG, Zantwijk 32 Matherly LH, Barlowe CK, Goldman ID. Antifolate polyglutamylation CH. Polymorphisms in methylenetetrahydrofolate reductase and and competitive drug displacement at dihydrofolate reductase as methotrexate sensitivity in childhood acute lymphoblastic leukemia. important elements in leucovorin rescue in L1210 cells. Cancer Res Leukemia 2002; 16: 764–765. 1986; 46: 588–593. 14 Chiusolo P, Reddiconto G, Casorelli I, Laurenti L, Sora F, Mele L et al. 33 Bunni M, Doig MT, Donato H, Kesavan V, Priest DG. Role of Preponderance of methylenetetrahydrofolate reductase C677T homo- methylenetetrahydrofolate depletion in methotrexate-mediated intra- zygosity among leukemia patients intolerant to methotrexate. Ann cellular thymidylate synthesis inhibition in cultured L1210 cells. Cancer Oncol 2002; 13: 1915–1918. Res 1988; 48: 3398–3404. 15 Ulrich CM, Yasui Y, Storb R, Schubert MM, Wagner JL, Bigler J et al. 34 Skibola CF, Smith MT, Kane E, Roman E, Rollinson S, Cartwright RA et al. Pharmacogenetics of methotrexate: toxicity among marrow transplan- Polymorphisms in the methylenetetrahydrofolate reductase gene are tation patients varies with the methylenetetrahydrofolate reductase associated with susceptibility to acute leukemia in adults. Proc Natl Acad C677T polymorphism. Blood 2001; 98: 231–234. Sci USA 1999; 96: 12810–12815. 16 Urano W, Taniguchi A, Yamanaka H, Tanaka E, Nakajima H, Matsuda Y 35 Skibola CF, Smith MT, Hubbard A, Shane B, Roberts AC, Law GR et al. et al. Polymorphisms in the methylenetetrahydrofolate reductase gene Polymorphisms in the thymidylate synthase and serine hydroxymethyl- were associated with both the efficacy and the toxicity of methotrexate transferase genes and risk of adult acute lymphocytic leukemia. Blood used for the treatment of rheumatoid arthritis, as evidenced by single 2002; 99: 3786–3791. locus and haplotype analyses. Pharmacogenetics 2002; 12: 183–190. 36 Wiemels JL, Smith RN, Taylor GM, Eden OB, Alexander FE, Greaves MF. 17 Hol FA, van der Put NM, Geurds MP, Heil SG, Trijbels FJ, Hamel BC et al. Methylenetetrahydrofolate reductase (MTHFR) polymorphisms and risk Molecular genetic analysis of the gene encoding the trifunctional of molecularly defined subtypes of childhood acute leukemia. Proc Natl enzyme MTHFD (methylenetetrahydrofolate-dehydrogenase, methe- Acad Sci USA 2001; 98: 4004–4009. nyltetrahydrofolate-cyclohydrolase, formyltetrahydrofolate synthetase) 37 Anguera MC, Suh JR, Ghandour H, Nasrallah IM, Selhub J, Stover PJ. in patients with neural tube defects. Clin Genet 1998; 53: 119–125. Methenyltetrahydrofolate synthetase regulates folate turnover and 18 Brody LC, Conley M, Cox C, Kirke PN, McKeever MP, Mills JL et al. A accumulation. J Biol Chem 2003; 278: 29856–29862. polymorphism, R653Q, in the trifunctional enzyme methylenetetrahy- 38 Herbig K, Chiang EP, Lee LR, Hills J, Shane B, Stover PJ. Cytoplasmic drofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase/for- serine hydroxymethyltransferase mediates competition between folate- myltetrahydrofolate synthetase is a maternal genetic risk factor for dependent deoxyribonucleotide and S-adenosylmethionine biosynth- neural tube defects: report of the Birth Defects Research Group. Am J eses. J Biol Chem 2002; 277: 38381–38389. Hum Genet 2002; 71: 1207–1215. 39 Stover PJ, Chen LH, Suh JR, Stover DM, Keyomarsi K, Shane B. 19 Allegra CJ, Chabner BA, Drake JC, Lutz R, Rodbard D, Jolivet J. Enhanced Molecular cloning, characterization, and regulation of the human inhibition of thymidylate synthase by methotrexate polyglutamates. mitochondrial serine hydroxymethyltransferase gene. J Biol Chem 1997; J Biol Chem 1985; 260: 9720–9726. 272: 1842–1848. 20 Baram J, Chabner BA, Drake JC, Fitzhugh AL, Sholar PW, Allegra CJ. 40 Di Pietro E, Sirois J, Tremblay ML, MacKenzie RE. Mitochondrial NAD- Identification and biochemical properties of 10-formyldihydrofolate, a dependent methylenetetrahydrofolate dehydrogenase-methenyltetra- novel folate found in methotrexate-treated cells. J Biol Chem 1988; 263: hydrofolate cyclohydrolase is essential for embryonic development. Mol 7105–7111. Cell Biol 2002; 22: 4158–4166. 21 Chu E, Drake JC, Boarman D, Baram J, Allegra CJ. Mechanism of 41 Laverdiere C, Chiasson S, Costea I, Moghrabi A, Krajinovic M. thymidylate synthase inhibition by methotrexate in human neoplastic Polymorphism G80A in the reduced folate carrier gene and its cell lines and normal human myeloid progenitor cells. J Biol Chem 1990; relationship to methotrexate plasma levels and outcome of childhood 265: 8470–8478. acute lymphoblastic leukemia. Blood 2002; 100: 3832–3834.

www.nature.com/tpj MTHFR and MTHFD1 polymorphisms and childhood ALL outcome M Krajinovic et al 72

42 Labuda D, Krajinovic M, Richer C, Skoll A, Sinnett H, Yotova V et al. 43 Costea I, Moghrabi A, Krajinovic M. The influence of cyclin D1 (CCND1) Rapid detection of CYP1A1, CYP2D6, and NAT variants by multiplex 870A4G polymorphism and CCND1-thymidylate synthase (TS) gene– polymerase chain reaction and allele-specific oligonucleotide assay. gene interaction on the outcome of childhood ALL. Pharmacogenetics Anal Biochem 1999; 275: 84–92. 2003; 13: 577–580.

The Pharmacogenomics Journal