Wollschlager Thesis

Nematocysts of the Invasive Species Cordylophora caspia

THESIS

Presented in Partial Fulfillment of the Requirements for the Degree Master of Science in the Graduate School of The Ohio State University

Jennifer Wollschlager, B.S.

Graduate Program in Evolution, Ecology and Organismal Biology

The Ohio State University

2011

Master's Examination Committee:

Meg Daly, Advisor

John Freudenstein

Norman Johnson

Jennifer Wollschlager

2011

Abstract

Although there is significant genetic diversity within the hydroid Cordylophora caspia, the species has not been formally split into genetically defined distinct species.

This is due in part to the physiological and morphological plasticity of C. caspia : all morphological characters used to distinguish species in Cordylophora are phenotypically plastic in this species and unreliable for classification. One potential source of characters not yet explored in C. caspia are nematocysts. Nematocysts have been widely used in taxonomy of Cnidaria, and in some cases, have a strong functional component and so may be subject to or correspond with ecotype. Elucidating the cnidom of lineages of C. caspia will help determine whether or not nematocysts are good indicators for different genetic lineages of this group, and whether nematocysts are functionally differentiated in populations from different habitats. A one-way ANOVA was used to determine if means between populations differed for euryteles or desmonemes, the two types of nematocysts found in C. caspia. Means between populations differed for euryteles (p<0.001) and desmonemes (p<0.001), although no correlation could be found between clade or salinity.

This indicates that nematocysts within C. caspia are not phenotypically plastic or taxonomically informative. Nematocysts may be correlated to another environmental factor, such as prey type, size, and abundance in the location of each population. These morphological characters may still aid in distinguishing more distantly related species such as Cordylophora japonica. Further study of reproductive compatibility and ii morphometric features (e.g., branching pattern, hydrocaulus length) may provide some means of separating lineages in this cosmopolitan invasive species.

iii

Acknowledgments

Thanks are due to Meg Daly, Paul Larson, Anthony D’Orazio, and Jennifer Yi for collection aid, Abby Reft for Scanning Electron Micrographs and collection aid, Nadine

Folino-Rorem for providing animals, Meg Daly, Norman Johnson, and John Freudenstein for input on my thesis, and The Ohio State University.

Vita

May 2008…………………………..B.S. Marine Science, Biology Track, Eckerd College

2008 to present……………………..Graduate Teaching Associate, Department of

Evolution, Ecology, and Organismal Biology, The

Ohio State University

Fields of Study

Major Field: Evolution, Ecology and Organismal Biology

Table of Contents

Abstract ...... ii

Acknowledgments...... ivv

Vita ...... v

List of Tables ...... viii

List of Figures ...... ix

Introduction ...... 1

Diversity and Systematics of Cordylophora caspia ...... 7

A Potential Solution for this Species Complex ...... 12

Methods...... 18

Sample Collection ...... 18

Nematocyst Measurement ...... 18

DNA Extraction, Amplification, and Sequencing ...... 20

Statistical Analysis of Nematocyst Sizes ...... 21

Results ...... 23

Discussion ...... 38

References ...... 43

vii

List of Tables

Table 1. Amplification primers ...... 21

Table 2. P-values from a one-way ANOVA testing between polyp averages ...... 24

Table 3. Summary of statistical groups...... 30

Table 4. Summary of eurytele data ...... 31

Table 5. Summary of desmoneme data ...... 37

viii

List of Figures

Figure 1. Sketch of a Cordylophora colony...... 2

Figure 2. Phylogenetic tree based on mtDNA ...... 5

Figure 3. Global distribution of Cordylophora lineages ...... 6

Figure 4. Scanning electron microscope image of a discharged eurytele capsule ...... 15

Figure 5. Scanning electron microscope image of a discharged desmoneme capsule ..... 16

Figure 6. Stained euryteles and desmonemes ...... 17

Figure 7. Normal quantile plot of residuals of euryteles ...... 26

Figure 8. Boxplot of eurytele lengths by polyp and population ...... 27

Figure 9. Boxplot of eurytele lengths by population ...... 28

Figure 10. Boxplot of eurytele lengths by groups ...... 29

Table 11. Normal quantile plot of residuals of desmonemes ...... 33

Table 12. Boxplot of desmoneme lengths by polyp and population...... 34

Table 13. Boxplot of desmoneme lengths by population ...... 35

Table 14. Boxplot of desmoneme lengths by groups ...... 36

Introduction

The Ponto-Caspian invasive hydrozoan Cordylophora caspia is one of only a handful of cnidarians that live in fresh rather than marine waters (Janowski et al. 2008). It can tolerate a range of salinities, from brackish (~ 15 ‰) to freshwater, giving it a wide range of suitable habitat (reviewed in Roos 1979; Folino 2000). In a laboratory setting, C. caspia can survive at salinities as high as 30 ‰ (Kinne 1958). It is a clonal organism that also reproduces sexually, allowing it to be able to spread over substrate rapidly and spread planulae to new substrate locations. It grows by adding more hydranths to hydrocauli, the upright branches, or by extending the attached stolon (hydrorhiza) for more hydrocauli (Fig. 1) (Kinne 1958; Fulton 1962; Jormalainen et al. 1994).

Gonophores, the reproductive structures, branch from the hydranths (Fig. 1) (Jormalainen et al. 1994). Cordylophora caspi a is often associated with zebra mussels ( Dreissena polymorpha ), another Ponto-Caspian invasive species, and, like D. polymorpha , it is also biofouling, causing industrial and ecological problems (Folino 2000; Musko et al. 2008).

The spread of C. caspia is difficult to control because colonies are able to “die back” to structures called menonts, in which the tissue shrinks back into the stolon (Fig. 1).

Menonts are ecologically resilient and allow a colony to survive stressful and changing environments, because a colony can regenerate from a menont when environmental

1 conditions are right (Roos 1979; Folino 2000). This diversity of growth and reproductive mechanisms and its broad salinity tolerance enhance the capacity of C. caspia to invade.

Figure 1. A. Part of a Cordylophora colony with gastrozooids, female gonophores, and epiphauna. Scale is 5 mm. Camera lucida drawing (Roos 1979). B. A drawing of the anatomy of an upright stalk and hydrorhiza of Cordylophora (Folino 2000 re-drawn from Marcum and Dichl 1978). C. Menonts in hydrorhiza and base of hydrocaulus. Scale is 1 mm. Camera lucida drawing (Roos 1979).

Although its success as an invader comes largely from being clonal and phenotypically plastic (Roman and Darling 2007), there is also evidence for multiple invasions of C. caspia into different localities throughout the world (Folino-Rorem et al.

2009). Multiple invasions greatly increase genetic diversity of the invader species in the new habitat, and thus are thought to increase invasion success (Roman and Darling

2007). Multiple invasions can even increase the genetic diversity of an invasive

2 population to higher than that of native populations (Roman and Darling 2007).

Cordylophora caspia is inferred to invade through ballast water and aquarium release

(DAISIE 2006). Ballast water introductions are expected to have high potential for multiple introductions (MacIsaac et al. 2002) and multiple ballast water introductions have been shown to increase genetic variation (Stepien et al. 2005). In contrast, aquarium release is less likely to lead to multiple introductions (Facon et al. 2003). In either case, invasion by C. caspia may have profound effects on the ecosystems: invaded communities may restructure, with decreases in the diversity and abundance of bryozoans and ciliates and increases in the numbers of barnacles, amphipods, and polychaetes (Ruiz et al. 1999; Folino 2000).

Folino-Rorem et al. (2009) identified four distinct lineages of C. caspia within two larger groups: one of these contains only samples from brackish waters and the other contains both freshwater and brackish samples (Fig. 2). The sub-class Hydroidolina, to which C. caspia belongs is composed of mostly marine taxa and freshwater tolerance is interpreted to be a recent innovation in Cordylophora (Jankowski et al. 2008) Thus, ability to inhabit freshwater may represent a recent adaptation since it is likely that inhabiting brackish water is basal. Furthermore, the Ponto-Caspian region, where C. caspia originated, is dominated by large, brackish water lakes. Only one sub-clade is location-specific: a brackish lineage represented only by samples from the Pacific coast of the United States (Fig. 3). One sub-clade is habitat specific: within the brackish- freshwater group is a small cluster of exclusively freshwater samples, with a sister clade containing both freshwater and brackish samples (Fig. 2). In several cases, more than one

3 lineage was found in a single location (Fig. 3). With different genetic lineages in the same locations, introductions must be frequent, with repeated secondary invasions of disturbed habitats. The genetic pattern suggests that the invasion history of this species is complex.

Figure 2. Single most parsimonious tree based on mtDNA haplotype data from Folino- Rorem et al. (2009). Nodal support is indicated as percent of 1,000 bootstrap replicates. Collection site salinities are indicated with shaded boxes.

Figure 3. Global distribution of Cordylophora lineages from Folino-Rorem et al. (2009). Sample IDs and shades indicate lineages correspond to Fig. 2. Pie charts were scaled to reflect sample size. The Great Lakes region is shown as an inset for clarity of presentation.

Diversity and Systematics of Cordylophora caspia

Many invasive species belong to groups for which taxonomy and identification are problematic, hindering their control and identification. Although there is significant genetic diversity within C. caspia, the species has not been formally split. Complicating this situation is the physiological and morphological plasticity of C. caspia : members of the same genetic lineage may assume different morphologies in brackish and fresh water, and may form physiological races (Folino 2000).

The genus Cordylophora currently has seven valid species. Five species of

Cordylophora are found in specific localities. Cordylophora annulata occurs in Bermuda

(Calder 1988), Cordylophora pusilla occurs off the coast of Spain and is specifically found on Posidonia and other sea grasses (Boreo 1987), Cordylophora inkermanica occurs in the Black Sea (Marfenin 1983), and Cordylophora japonica and Cordylophora mashikoi are both found in Japan (Itô 1951; Itô 1952). Cordylophora japonica and C. mashikoi are distinguished by distinct annulations on the hydrocaulus on the latter species

(Itô 1952) and from widespread species of Cordylophora by distinct colony structure as well as structure and number of gonophores (Fig. 1) (Itô 1951; Itô 1952). Cordylophora caspia and Cordylophora lacustris are both widespread and are distinguished by morphological characters such as colony height, gonophore size, number of tentacles, and absence or presence of annulations on the perisarc of the stalk (Fig 1) (reviewed in Folino

2000). Annulations on the perisarc of the stalk are not consistently reported in the literature for C. caspia or C. lacustris (reviewed in Folino 2000). All of the characters used to distinguish between these two species are demonstrably phenotypically plastic

7 and thus unreliable for classification. Due to this inconsistency, many taxonomists consider C. caspia and C. lacustris to be conspecific (McClung et al. 1978; Roos 1979;

Smith 1989; Cohen et al. 1998). The synonymy of these species was justified by co- occurrence geographically and the absence of clear morphological distinction due to phenotypic plasticity. Other Cordylophora species, such as the two Japanese species, may also need further investigation due to their classification based on plastic morphological characters.

The criteria for recognizing species are not uniformly agreed upon, varying across lineages with respect to the kinds of features that are considered important and varying across researchers with respect to the formal criterion used to justify or recognize distinct species. A morphological species concept was used in the past to describe species of

Cordylophora, but with phenotypic plasticity and geographic co-occurrence genetic evidence may be of more use in determining species. Genetic evidence can clarify or complicate the distinction between species. For example, Dawson and Jacobs (2001) showed genetic separation among populations of Aurelia , whose status as distinct species had been debated because of morphological simplicity. In contrast, genetic evidence may distinguish between morphologically indistinguishable units; the recognition of these cryptic species is usually contingent on geographic, ecological, or other evidence

(reviewed in Bickford et al. 2007). Many cryptic species are organisms which have very few morphological characters to differentiate them (reviewed in Bickford et al. 2007). In the case of C. caspia , a morphological species concept recognizes fewer units than would a genetic or phylogenetic species concept. The genetic data can readily be interpreted

8 with reference to a phylogenetic species concept, where the least inclusive taxon in phylogenetic classification is referred to as a species (Mishler and Theriot 2000; Wheeler and Platnick 2000). How the least inclusive taxon is determined can differ. One method groups the least inclusive taxon by apomorphies, or derived states, and therefore monophyly is required (Mishler and Theriot 2000). A different approach does not require apomorphies, since ancestral species may contain characters that derived species also carry (Wheeler and Platnick 2000). In this case taxa can be paraphyletic; not all derived species may carry these characters and so monophyly is not required (Wheeler and

Platnick 2000). The problem with either implementation of the phylogenetic species concept is determining what the least inclusive taxon is among several populations on a phylogenetic tree.

An alternative perspective on species delimitation is implied in the process of

DNA-barcoding, which uses the degree of genetic divergence between samples for some standard DNA marker to characterize potential species. Two markers are widely used for barcoding metazoans: the mitochondrial genes Cytochrome Oxidase subunit I (COI) and

16S rDNA. Well-defined species of Hydrozoa show degrees of divergence in COI characteristic of other Metazoa: within metazoan species divergence is typically less than

3%, and between metazoan species is typically between 10-25% (Herbert et al 2003).

Divergence for 16S in hydrozoans is also typical of invertebrates (Huang et al. 2008).

Moura et al. (2007) found that 16S was useful for resolving cryptic species and determining species from previously thought single, widely spread species in

Hydrozoans. Ortman et al. (2010) found that COI was useful for assigning species of

Medusozoans when populations were phenotypically plastic and that COI has significant distances between congeneric species even when there is high intra-specific variation.

COI is also useful for uncovering cryptic species (Dawson and Martin 2001; Dawson and

Jacobs 2001).

Folino-Rorem et al. (2009) found divergence between the two major clades (as minimum p-distance) of 12.35% for COI and 6.04% for 16S. Divergence within clade 1 is 7.83% for COI and 3.51% for 16S; within clade 2 divergence is 9.57% for COI and

3.31% for 16S. These values are consistent with others within hydrozoans and typical metazoan rates, suggesting different cryptic species. Therefore, it is possible that minor lineages also deserve species status. Older classification of this genus does show the possibility of multiple species, but they are all based on morphological characters that are problematic and so previous taxonomy and identification may not be correct (reviewed in

Folino 2000).

Morphology is not invariant among populations of C. caspia , although the pattern of variation is difficult to interpret because some attributes seem to correspond to habitat .

Colonies in brackish water may have hydrocauli that range in height from 20-100 mm, whereas freshwater colonies rarely grow taller than 30 mm in stalk height (Fig. 1)

(reviewed in Folino 2000). Brackish populations generally have more, larger gonozooids and tentacles on hydranths compared to freshwater populations (Fig. 1) (reviewed in

Folino 2000). Another plastic morphological character is rings around the perisarc of the stalk (Fig. 1), which has no correlation to the name C. caspia or C. lacustris (reviewed in

Folino 2000). This plasticity is mirrored in habitat choice. Fyfe (1928) found C. caspia

10 in calm water, whereas Clarke (1878) located C. caspia in high flowing currents. In Lake

Balaton, there were no significant differences with distribution or abundance based on several water quality parameters measured across the lake (Musko et al. 2008). Fulton

(1962) found that C. caspia is insensitive to pH, temperature, light intensity, and oxygen supply. As Folino (2000) points out, it is unclear whether different populations represent geographical isolates, physiological races, or distinct species because of the ecological plasticity, broad range, and physiological tolerance of these animals.

Experimental work by Kinne (1958) explains how a single population may acclimate to diverse habitats. Kinne (1958) gradually acclimated clones from a single population of C. caspia to salinities ranging from freshwater to nearly full strength seawater. At the optimal salinity of 15 ‰, colonies were tallest, and these had more branching and the highest growth rate; the polyps had longer and medium thickness hydranths; more numerous, longer tentacles; a medium cell length and width with a medium nuclei size, and a medium cell number per hydranth. The freshwater treatment resulted in the shortest colonies, and these had no branching and slow growth; the polyps had short and thick hydranths; few, thick tentacles; long and narrow cells with larger nuclei, and the most cells per hydranth. At 30 ‰, colonies were shorter than maximum, and these had branching and very slow growth; the polyps had short and thin hydranths; few, thin tentacles; short and broad cells with the smallest nuclei, and the least number of cells per hydranth. The branching pattern of the colony, its size, the thickness of hydranths, tentacle diameter, shape and number of cells all seem to respond to salinity and so may be poor indicators of species identify in C. caspia.

A Potential Solution for this Species Complex

Although conventional morphological characters do not support the distinction of lineages within C. caspia , novel characters may aid in identifying the different lineages of C. caspia . In addition to supporting the genetic distinctions with independent character evidence, morphological characters could facilitate the application of existing names to genetic clades. One potential source of characters not yet fully explored in Cordylophora are nematocysts. All members of the phylum Cnidaria produce cnidae, the complex cellular secretory structures responsible for the stinging capabilities of jellyfish. There are three kinds of cnidae: spirocysts, ptychocysts, and nematocysts (Mariscal 1974). Of these, only nematocysts are found within all Cnidaria (Östman 2000); these are used in prey capture, defense, and larval settlement, among other things. There are over 30 varieties and subvarieties of nematocysts, and hydrozoans specifically have a high variety of these, including 17 specific nematocysts that are unique to their class (Mariscal 1974).

Nematocyst size and distribution are integral to species identification in the cnidarian class Anthozoa, but have been less frequently used in Medusozoa, the super group that includes classes Hydrozoa, Scyphozoa, and Cubozoa. Although their phylogenetic and taxonomic value is clear at least at higher levels, and has been substantiated in a few medusozoan taxa (Papenfuss 1936; Calder 1971; Calder 1977), in at least some cases, nematocyst complement (cnidom) has a strong functional component (e.g., Rifkin and

Endean 1983; Purcell 1984; Purcell and Mills 1988; Peach and Pitt 2005; Colin and

Costello 2007) and so may be subject to ecophenotypic plasticity.

In my thesis, I investigate whether there are differences in the sizes of nematocysts from different genetic lineages and ecotypes within C. caspia . Because this species shows such high plasticity in physiology, ecology, and gross anatomy across environmental conditions, it may be that the nematocysts also show plasticity in response to environmental conditions. For example, freshwater populations may have different prey than brackish populations and these differences may lead to or be the consequence of differences in nematocysts. Therefore, in genetically similar lineages there may be a difference in nematocysts between populations. Elucidating the cnidom of lineages of C. caspia will aid in determining whether or not nematocysts are good indicators for different genetic lineages of this group, and whether nematocysts are functionally differentiated in this species. Together, these will help to improve knowledge and classification of this group, which will aid in prevention and management of this global, invasive species or species complex. This also provides the first statistical account of nematocyst sizes in Hydrozoans, and the first full account of cnidom in C. caspia.

The kinds and sizes of nematocysts are taxonomically informative in many groups

(reviewed by Fautin 1988; Östman 2000). The cnidom and sizes of nematocysts are essential to most taxonomic descriptions for cnidarians, but there is no consistency of taxonomic descriptions for any groups (Fautin 2009). Furthermore, nematocyst size cannot be solely used to identify species in Anthozoa and zoanthids (Fautin 1988; Seifert

1928) Geographic and taxonomic scope of data may play a role in the cnidom (Fautin

2009). In hydrozoans, nematocysts may be informative taxonomically: species in the

13 genus Obelia may be differentiated by nematocyst morphology, but there are also ecological and morphological differences between the species as well (Östman 1982).

Ecology may affect nematocyst size, condensing nematocyst size range in species with similar niches so that they are not distinguishable by size even though size range is a characteristic of each species (Fautin 2009). Purcell and Mills (1988) studied the prey types captured by each type of nematocyst in certain pelagic hydrozoa and found strong correlations between nematocyst type and prey types. Desmonemes were associated with the capture of hard bodied prey, such as many crustaceans; these nematocysts adhere to surfaces rather than penetrate, which may prove more effective for hard-bodied prey items. Euryteles, a penetrant, were associated with other crustacean prey species and with soft bodied prey species. Furthermore, Purcell (1984) found that when copepod prey size increases the size and quantity of nematocysts also increases.

Acuña et al. (2003) found high variability in sizes of nematocysts within species of actiniarian sea anemone and suggested that one reason may be nematocysts at different developmental stages. In Hydra , nematocyst size increases proximally to distally along the column (Bode and Flick 1976, Bode et al. 1983). As many nematocysts are fired each day they must be replaced constantly, suggesting nematocysts occur at different stages of growth (reviewed in Fautin 2009). Therefore, measuring a number of nematocysts per specimen is essential.

Cordylophora caspia has two nematocysts types, euryteles (Fig 4) and desmonemes (Fig 5). Euryteles are a penetrant type of nematocyst with a thread that has a well-defined shaft of unequal diameter that is dilated distally (Fig 4) (Mariscal 1974).

Desmonemes are a volvent type of nematocyst with a thread that is closed at the tip and a shaft that is not well-defined (Mariscal 1974). The thread forms a corkscrew-like coil when discharged, wrapping around prey (Fig. 5) (Mariscal 1974). Desmonemes are the most numerous nematocyst type within C. caspia (Fig. 6).

Figure 4. Scanning electron micrograph of a discharged eurytele.

Figure 5. Scanning electron micrograph of thread of a discharged desmoneme.

Figure 6. Eurytele and desmoneme nematocysts from Cordylophora caspia stained with Giemsa stain at 1000x magnification. Euryteles are the larger oval nematocysts and desmonemes are the smaller, more circular nematocysts.

Methods

Sample Collection

Fresh and brackish water populations were collected for analysis. Cordylophora caspia samples were collected from Lake Erie off the North side of Gibraltar Island at a depth of 0.5-1.0 m. Other populations of C. caspia were obtained from cultures maintained by Nadine Folino-Rorem. Colonies were maintained at room temperature in the same salinity as they were collected from and fed brine shrimp two to three times a week. Filters were used to ensure adequate water flow. Fresh tissue was used for DNA extractions and measuring nematocysts. Vouchers were deposited at the American

Museum of Natural History.

Nematocyst Measurement

Fresh and brackish populations were prepared for measurement of nematocysts by removing one randomly chosen polyp from a colony and placing it on a glass slide. For freshwater cultures, excess water was removed and a Giemsa stain was added to the slide.

Excess stain was removed after a minimum of thirty minutes. For brackish populations, excess water was removed and the polyp was rinsed with deionized water to remove excess salts. Giemsa stain was added and the polyp was stained for a minimum of four hours, often staining overnight. Brackish populations do not stain as well and require more time to stain. For both fresh and brackish populations, the polyp was rinsed with

18 acid alcohol to help dissociate tissue and remove all excess stain. The polyp was rinsed with 70% ethanol and excess water and ethanol were removed. Permount and a cover slip were added to the slide and the tissue dissociated further by adding pressure to the cover slip.

To determine the necessary number of nematocysts to accurately represent within- polyp size ranges, 50-75 nematocysts of each type were measured from three polyps from the Woods Hole population. Measurements for each type were group into blocks of ten measurements, starting with the first measurement made for the polyp. The blocks were added to one another in sequence (i.e., first block to second; third to first + second; fourth to first + second + third), and the mean was calculated. The averages calculated for each set (i.e., one block, block 1+2, block 1 +2+3) were compared to determine the minimum number of nematocysts needed per polyp to find a stable and accurate average for that type of nematocyst. For euryteles, mean nematocyst length varied by 0.14 µm or less after 20-30 nematocysts. For desmonemes, mean nematocyst length varied by 0.08 µm or less after 20 nematocysts. The number of polyps needed to accurately estimate the population mean was determined in a similar manner, using blocks of 25 nematocysts because the previous operation indicated that this number of capsules was the minimum required to accurately capture within-polyp variation in size. Twenty five nematocysts of each type were measured from five more polyps from the Woods Hole population and were added to the three polyps already measured. Only the first 25 nematocysts of each type were used for the first three polyps, since the first 25 measured was used for the other five polyps. For euryteles, mean nematocyst length varied by 0.02 µm after eight

19 polyps were measured. In contrast, variation between the first, second, and third polyp was 0.24 µm, showing more variation in the mean with fewer polyps used.

Twenty five of each nematocyst type were measured at 1000X magnification for each polyp. Measurements were taken by starting at a random location on the slide and moving across the slide in a single direction to avoid measuring any nematocyst twice.

Complete dissociation of the polyp allowed for a random starting location within each polyp. Eight polyps were measured in each population. In total, 200 nematocysts of each type were measured from 14 populations, totaling 2800 measurements of each nematocyst, 5600 measurements overall.

DNA Extraction, Amplification, and Sequencing

Two to four polyps were picked from a single colony and DNA was extracted using the Qiagen DNeasy purification of Total DNA protocol. DNA was amplified from the mitochondrial genes COI and 16S and the nuclear gene 28S using the primers in Table 1.

The PCR cycle for COI and 28S began with a denaturing step at 94°C for 5min; followed by 35 cycles of 94°C for 30s, 50°C for 60s, and 72°C for 90s; with a final extension at

72°C for15min (Folino-Rorem et al. 2009). The PCR cycle for 16S began with a denaturing step at 94°C for 5min, followed by 35 cycles of 94°C for 20s, 50°C for 45s, and 68°C for 120s; followed by a final extension at 68°C for 10min (Folino-Rorem et al.

2009). Samples that did not amplify were rerun, using lower or higher annealing temperatures; the final annealing temperatures for both PCR cycles varied between 48°C and 52°C.

Table 1. Primers used to amplify Cordylophora caspia mitochondrial genes COI (Folmer et al. 1994) and 16S (Cunningham and Buss 1993) and nuclear gene 28S (Sogin and Edman 1990).

Gene Forward Reverse COI TCWACNAAYCAYAARGAYATTGG ACYTCNGGRTGNCCRAARARYCA 16S ACGGAATGAACTCAAATCATGT TCGACTGTTTACCAAAAACATA 28S ACCCGCTGAATTTAAGCATA AACCAGCTACTAGRYGGTTCGAT

PCR products were sequenced with the amplification primers in the forward and reverse directions. Sequences were aligned in Sequencher and matched to clades from

Folino-Rorem et al. (2009) using BLAST (Johnson et al. 2008). Once clades were determined for each population, averages were compared to determine if mean nematocyst length correlated by clade.

Statistical Analysis of Nematocyst Sizes

A one-way ANOVA was conducted on each population’s nematocyst measurements to determine if between polyp variation was significant. If means between eight polyps in a population were significantly different, all two hundred measurements of nematocyst length from a population could not be considered independent and could not be pooled. Measurements taken from a single polyp in a colony are likely to be more similar in length than to measurements from a different polyp in the same colony.

Therefore, measurements in a single polyp are likely to correlate and are not independent

21 of each other. Independence within a sample and between samples is one assumption of a one-way ANOVA test. If means between the eight polyps in a single population were significantly different, then the samples are pseudoreplicates and the 25 nematocyst measurements per polyp could be averaged to provide a single mean per polyp for each nematocyst type. This totaled eight means per nematocyst per population. All eight measurements in a population were independent and each population was also independent.

A one-way ANOVA was used to determine if means between populations differed. Normality was determined using a normal quantile plot of residuals because a one-way ANOVA test is not robust to non-normality. Constant variance is also necessary for a one-way ANOVA and was determined by comparing residuals versus fits. For this test to be effective the errors must have a mean zero with constant spread and no patterns, and all of these will support constant variance. Boxplots were used to determine outliers and view variance. A one-way ANOVA test is not robust to numerous outliers. Once it was determined that this test was appropriate for the data, full (all populations separate) and reduced (populations with similar means grouped together) models were examined to determine the best reduced model for each nematocyst type. A reduced model was needed in order to observe which populations had statistically similar mean nematocyst lengths.

Results

Although the overall results are consistent, euryteles and desmonemes in C. caspia differ in the specifics of their statistical properties. Only three populations had nematocysts that did not differ in length between polyps (Table 2). All three were desmonemes, and the corresponding eurytele measurements differed between polyps

(Table 2). This suggests that even though the desmoneme nematocyst lengths are statistically the same throughout the whole population, they are not independent of each other since the eurytele nematocysts are not independent. It is likely this was observed in desmonemes because they are much smaller than most nematocysts and thus show much lower variation and are harder to measure accurately. Pseudoreplication was applied to all populations and all nematocyst types.

Table 2. P-values from a one-way ANOVA testing between polyp averages by nematocyst type in each population.

Population Locality Population Code Eurytele Desmonemes p-values p-values Cayuga Lake, NY CL 0.007 <0.001 Napa River, CA NR <0.001 0.001 Squamscott River, Exeter, NH E 0.003 0.048 Jackson Landing, Durham, NH J 0.001 <0.001 James River, Jamestown, VA V <0.001 0.001 Sonoma, CA SO <0.001 0.635 Lake Michigan, Chicago, IL FN <0.001 <0.001 DesPlaines River, Joliet, IL DP <0.001 0.652 Seneca Lake, NY SL <0.001 0.020 Illinois River, Henry, IL H <0.001 0.378 LaSalle Lake, Marseilles, IL LS <0.001 0.016 Woods Hole, MA WH2 <0.001 <0.001 Lake Ontario, Rochester, NY LO <0.001 0.001 Lake Erie, Put-in Bay, OH LE <0.001 0.002

Means between populations differed for euryteles (p<0.001). Eurytele lengths were mostly normal with some short tails (Fig. 7). Errors had a mean zero, with constant spread and no patterns. Since the data were mostly normal and had a constant variance, a one-way ANOVA test was appropriate. There were many outliers when looking at boxplots of polyps by populations (Fig. 8). There were outliers in three populations (DP,

E, and SO) when pseudoreplication was applied (Fig. 9). Pseudoreplication removed many of the problematic outliers observed within single polyps which further supported a one-way ANOVA test. Group two of the final reduced model had one outlier (Fig. 10).

Standard deviations were similar once groups were established. The best reduced model used included four groups and was preferred over a more reduced model (p=0.0098) 24

(Table 3). A one-way ANOVA was used to group populations by clade and salinity as well. A model of euryteles grouped by clade was not preferred over a full model in which all the populations had separate means (p<0.001), even though means of clades were statistically different (p=0.014). A model of euryteles grouped by salinity was not preferred over a full model in which all the populations had separate means (p<0.001).

Means between groups of salinity were not statistically different from each other

(p=0.122). For all three final reduced models no correlation could be found between clade, salinity, or variation in regards to population means (Table 4).

1.0

0.5

0.0 26 26 Residuals

-0.5

-1.0 -3 -2 -1 0 1 2 3 Score

Figure 7. Normal quantile plot of residuals of euryteles.

8 27 27

Nematocyst Length (um) Length Nematocyst 7

Polyp 12 345678 12345 678 12345678 12345678 12345678 12345678 123 45678 123456 78 12345678 12345678 12345678 12345678 1234 5678 1234567 8

Population L P E N H J E O S R L O V 2 C D F L L L N S S H W

Figure 8. Eurytele lengths by polyp and population. Interquartile range indicated by box; median indicated by horizontal line within box; range bars; points outliers. 27

9.5

9.0

8.5

28 8.0 Nematocyst Length (um) Length Nematocyst

7.5

7.0 CL DP E FN H J LE LO LS NR SL SO V WH2 Population

Figure 9. Eurytele lengths by population. Interquartile range indicated by box; median indicated by horizontal line within box; range bars; points outliers. 28

9.5

9.0

8.5

8.0 29 Nematocyst Length (um) Length Nematocyst 7.5

7.0 G1 G2 G3 G4 Groups

Figure 10. Eurytele lengths by groups. Interquartile range indicated by box; median indicated by horizontal line within box; range bars; points outliers. 29

Table 3. Populations of Cordylophora caspia grouped by similar means using a one-way ANOVA. This reduced model for euryteles and the new means by group were preferred over a more reduced model (p=0.0098). This reduced model for desmonemes and the new means by group were preferred over a more reduced model (p<0.001).

Nematocyst Euryteles Desmonemes Group 1 2 3 4 1 2 3 4 Mean 8.40 8.08 7.90 7.65 4.74 4.58 4.35 4.14 CL x x NR x x E x x J x x V x x SO x x FN x x DP x x SL x x H x x LS x x WH2 x x LO x x LE x x

Table 4. Eurytele mean length (n=8) for each population with corresponding clade, salinity, group, standard deviation (n=8), mean (n=8) of polyp standard deviations (SD), and the range difference of polyp standard deviations.

Population Clade Salinity Mean Group Standard Mean Difference of Deviation Polyp SD Polyp SD CL 1A fresh 8.44 G1 0.35 0.55 0.17 J 1A fresh 8.15 G2 0.21 0.46 0.26 DP 1A fresh 7.88 G3 0.19 0.40 0.12 H 1A fresh 7.96 G3 0.19 0.41 0.14 FN 1A fresh 7.94 G3 0.26 0.43 0.32 LS 1A fresh 7.69 G4 0.17 0.43 0.18 LE 1A fresh 7.62 G4 0.35 0.74 0.44 LO 1A fresh 7.56 G4 0.27 0.44 0.27 E 1B 8ppt 8.07 G2 0.22 0.60 0.36 V 1B 25ppt 8.07 G2 0.43 0.52 0.24 SL 1B fresh 7.83 G3 0.18 0.44 0.25 WH2 1B 15ppt 7.73 G4 0.29 0.62 0.16 NR 2B 16ppt 8.35 G1 0.41 0.74 0.43 SO 2B 16ppt 8.04 G2 0.25 0.54 0.25

Populations with high variation in mean eurytele length include CL, V, LE, NR, and WH2 (Table 4). Populations with low variation include DP, H, LS, and SL (Table 4).

Populations with high variation in mean standard deviations of polyps include LE and

NR (Table 4). Populations with low variation in mean standard deviations of polyps include DP, H, LS, and WH2 (Table 4). Populations with high difference in standard deviation between polyps include WH2, NR, LE, and E. Populations with low difference in standard deviation between polyps include DP, H, V, LS, FN, LO, and SL. Mean standard deviations of polyps are significantly different from one another according to a one-way ANOVA (p<0.001). 31

Means between populations differed for desmonemes (p<0.001). Desmoneme lengths were normally distributed (Fig. 11). Errors had a mean zero, with constant spread and no patterns. Since the data were normal and had a constant variance, a one-way

ANOVA test was appropriate. There were many outliers when looking at boxplots of polyps by populations (Fig. 12). There were no outliers in populations when pseudoreplication was applied (Fig. 13). Pseudoreplication removed many of all problematic outliers observed within single polyps which further supported a one-way

ANOVA test. Group one of the final reduced model had three outliers (Fig. 14). Standard deviations were similar once groups were established. The best reduced model I used included four groups and was preferred over a more reduced model (p=0.0105) (Table 3).

A one-way ANOVA was used to group populations by clade and salinity as well. A model of desmonemes grouped by clade was not preferred over a full model in which all the populations had separate means (p<0.001). Means between clades were not statistically different from each other (p=0.110). A model of desmonemes grouped by salinity was not preferred over a full model in which all the populations had separate means (p<0.001). Means between groups of salinity were not statistically different from each other (p=0.861). For all three final reduced models no correlation could be found between clade, salinity, or variation in regards to population means (Table 5).

0.75

0.50

0.25

33 33 0.00 Residuals

-0.25

-0.50

-3 -2 -1 0 1 2 3 Score

Figure 11. Normal quantile plot of residuals of desmonemes. 33

6.5

6.0

5.5

5.0

4.5 34

4.0 NematocystLengths (um)

3.5

3.0

Polyp 1 2345678 12345678 12345678 12345678 12345678 12345678 12345678 12345678 12345678 12345678 1234567 8 1234567 8 123456 78 12345 678

Population L P E N H J E O S R L O V 2 C D F L L L N S S H W

Figure 12. Desmoneme lengths by polyp and population. Interquartile range indicated by box; median indicated by horizontal line within box; range bars; points outliers. 34

5.2

5.0

4.8

4.6 35 35 4.4 Nematocyst Length (um) Length Nematocyst 4.2

4.0

CL DP E FN H J LE LO LS NR SL SO V WH2 Population

Figure 13. Desmoneme lengths by population. Interquartile range indicated by box; median indicated by horizontal line within box; range bars; points outliers. 35

5.2

5.0

4.8

4.6

36 4.4 Nematocyst Length (um) Length Nematocyst 4.2

4.0

G1 G2 G3 G4 Groups

Figure 14. Desmoneme lengths by groups. Interquartile range indicated by box; median indicated by horizontal line within box; range bars; points outliers. 36

Table 5. Desmoneme mean length (n=8) for each population with corresponding clade, salinity, group, standard deviation (n=8), mean (n=8) of polyp standard deviations (SD), and the range difference of polyps standard deviations.

Population Clade Salinity Mean Group Standard Mean Difference of Deviation Polyp SD Polyp SD LE 1A fresh 4.74 G1 0.18 0.49 0.19 J 1A fresh 4.58 G2 0.23 0.33 0.22 CL 1A fresh 4.62 G2 0.14 0.40 0.20 DP 1A fresh 4.36 G3 0.05 0.29 0.09 H 1A fresh 4.35 G3 0.06 0.28 0.18 LS 1A fresh 4.35 G3 0.08 0.26 0.09 FN 1A fresh 4.31 G3 0.21 0.32 0.17 LO 1A fresh 4.14 G4 0.12 0.30 0.16 E 1B 8ppt 4.51 G2 0.11 0.38 0.28 V 1B 25ppt 4.31 G3 0.13 0.43 0.33 SL 1B fresh 4.25 G3 0.11 0.31 0.09 WH 1B 15ppt 4.42 G3 0.34 0.45 0.31 NR 2B 16ppt 4.61 G2 0.18 0.46 0.18 SO 2B 16ppt 4.42 G3 0.06 0.36 0.23

Populations with high variation in mean desmoneme length include WH2 and JL

(Table 5). Populations with low variation include DP, H, LS, LE, SL, and SO (Table 5).

Populations with high variation in mean standard deviations of polyps include J, WH2 and E (Table 5). Populations with low variation in mean standard deviations of polyps include DP, LS, SL, and LE (Table 5). Populations with high difference in standard deviation between polyps include CL, E, J, LE, NR, SO, and WH2. Populations with low difference in standard deviation between polyps include DP, H, V, FN, LO, and SL.

Mean of polyp standard deviations are significantly different from one another according to a one-way ANOVA (p<0.001).

Discussion

Mean nematocyst length was statistically different for both euryteles and desmonemes between the examined populations of Cordylophora caspia . Although means differed, the colonies could be sorted into four groups based on the length of the euryteles and four groups based on the length of the desmonemes; the composition of groups differed depending on the type of nematocyst (Table 3).

In some cases (CL, NR, E, J) mean lengths of both euryteles and desmonemes were very large (Table 3). In other cases (LS, LO, WH2) mean lengths of both euryteles and desmonemes were very small (Table 3). Other cases the mean lengths of euryteles and desmonemes did not correlate: for example, LE has the largest mean length for desmonemes and one of the smallest mean lengths for euryteles (Table 3).

No correlation between mean nematocyst length and genetic clade was observed for either euryteles or desmonemes (Table 4 and 5), indicating that for C. caspia , nematocysts are not informative for species or subspecies differentiation. Cordylophora caspia may represent too recent of a divergence for morphological difference to have been fixed. It is also possible that their niche is so similar that stabilizing selective pressures have produced similar sized nematocysts between these species. Even with these explanations, there are some statistical differences of nematocyst lengths between

38 groups of populations and statistical groups are not identical for each nematocyst suggesting that other explanations may pertain.

No correlation between mean nematocyst length and salinity was observed for either euryteles or desmonemes (Table 4 and 5), indicating that nematocysts within C. caspia are not phenotypically plastic in correlation with salinity. A possibility for why there was no correlation to salinity could be a correlation to another environmental factor, suggesting a different stimulus for phenotypic plasticity of this morphological character.

It is possible that prey size is a driving force for the different sizes of these nematocysts.

When copepod prey size increases, the size and quantity of nematocysts also increases

(Purcell 1984). This would also account for different trends between nematocyst types since each nematocyst type is better adapted for capturing different prey types.

Desmonemes adhere to surfaces and so are used to capture hard bodied prey, such as many crustaceans (Purcell and Mills 1988). Euryteles are able to penetrate some prey epithelium and are often associated with crustacean prey species as well as soft bodied prey species (Purcell and Mills 1988). Depending on the prey type, size, and abundance in the location of each population, different environmental pressures would be able to act on the nematocyst types separately.

Although the distributions of lengths for desmonemes and euryteles do not correspond to genetic distinctions among populations of C. caspia , these data may be relevant for distinguishing more distantly related species. Folino-Rorem et al (2009) hypothesized that the Japanese species Cordylophora japonica was different from the four genetic lineages already identified. A comparison of nematocyst lengths supports

39 this contention: the mean length of euryteles reported from this species was 10-10.2 µm; desmonemes have a mean length of 4.9-5.0 µm (Itô 1951). The largest mean length I found for euryteles in a colony of C. caspia is 8.44 µm, and the largest mean length I found for desmonemes is 4.74 µm. Thus, the populations with the largest mean capsule size in C. caspia had smaller nematocysts than are reported for C. japonica . This is even more significant, considering the maximum difference between the mean lengths of eurytele groups was 0.32 µm. The difference between the largest C. caspia eurytele mean length and the smallest C. japonica eurytele mean length is 1.56 µm, which is nearly 5 times the difference between the groups of C. caspia studied here. Similarly, the maximum difference between the mean lengths of desmoneme groups was 0.16 µm. The difference between the largest C. caspia desmoneme mean length and the smallest C. japonica desmoneme mean length is 0.16. Another species from Japan, C. mashikoi, has euryteles of mean length 9.1-9.3 µm and desmonemes of mean length 4.3-4.4 µm (Itô

1952). The mean length for desmonemes are similar between C. caspia and C. mashikoi , but the mean length of euryteles are quite different, still exceeding the maximum distance of 0.32 µm between groups of C. caspia by about twice the distance.

Not all Cnidarian taxa are distinguishable by nematocysts and the diagnostic value seems to differ between taxa. In scyphozoans, nematocyst size and morphology was found to be uninformative in distinguishing congeneric species in at least one case

(Jensch and Hofmann 1997). Gravier-Bonnet (1987) used nematocysts to try to separate specimens of thecate hydroids and was able to separate several species from two closely related genera in a geographically restricted area on nematocysts alone, although cnidom

40 differences seem to be most useful at a family level. More studies on genus level cnidoms need to be done before it is clear if nematocyst size is a useful character in hydrozoans.

Some other potential problems with using nematocysts for taxonomy are that environment and size of the organism can affect the size of nematocysts (reviewed in

Fautin 2009 and discussed above). For Anthozoa, nematocysts of the same type in the same tissue often differ in length (Dunn 1981). Gravier-Bonnet (1987) also noted in thecate hydroids that size, location, and abundance may have variation due to many types of stimuli and therefore shape and type may be more useful. Shape and type tend to vary less among closely related organisms, which may be problematic for distinguishing genus and species level taxa. Gravier-Bonnet (1987) also suggests that with comparative studies, only the largest nematocysts should be used since they produce easier and more precise data than small nematocysts. Both types of nematocysts in C. caspia are smaller than many of the nematocysts used, including nematocysts from Halecium and

Zygophylax , suggesting that C. caspia nematocysts are too small to be accurately or consistently measured and so their value as taxonomic features may be compromised.

There is a need to resolve the minimum number of animals and capsules required for this kind of research (Fautin 1988; Ardelean and Fautin 2003). There is no clear consensus on presentation of statistics or on comparisons done between samples (Fautin

1988; Williams 1996; Williams 1998; Williams 2000; Acuña et al.2003). Replicating published results has been an issue as well (Fautin 1988). Other problems include normality of capsule lengths. Acuña et al. (2003) had many distributions that were non- normal whereas Williams (1996; 1998; 2000) found their distributions to be normal.

Neither analysis used the same procedure for measuring nematocyst lengths. Both concluded that nematocysts should not be used to distinguish species even if it is an important character and that overlapping ranges of nematocyst lengths does not mean the specimen is a conspecific.

Nematocysts cannot be used as a clear morphological indicator of genetic lineage for C. caspia . Although populations vary in the mean lengths of both desmonemes and euryteles, the differences do not correlate with lineage. However, differences fail to correlate with ecotype, suggesting that ecophenotypic plasticity has only a minor impact on nematocyst length in this species. Further study of reproductive compatibility and morphometric features (e.g., branching pattern, hydrocaulus length) may provide some means of separating lineages in this cosmopolitan invasive species.

References

Acuña FH, Excoffon AC, Zamponi MO, Ricci L. 2003. Importance of nematocysts in taxonomy of acontiarian sea anenomes (Cnidaria, Actiniaria): a statistical comparative study. Zool. Anz. 242: 75-81.

Ardelean A, Fautin DG. 2003. Variability in nematocysts from a single individual of the sea anemone Actinodendron arboreum (Cnidaria: Anthozoa: Actiniaria). Coelenterate Biol. 178 (3): 189-197.

Bickford D, Lohman DJ, Sodhi NS, Ng PKL, Meier R, Winker K, Ingram KK, Das I. 2007. Cryptic species as a window on diversity and conservation. TRENDS in Ecol. and Evol. 22 (3): 148-155.

Bode HR, Flick KM. 1976. Distribution and dynamics of nematocyte populations in Hydra attenuate. J. Cell. Sci. 21 (1): 15-34.

Bode H, Smith GS, Bode PM. 1983. Measurement of the number of nematoblasts, nematocytes, and nematocysts. In: Lenhoff HM, eds. Hydra: Research Methods . New York and London: Plenum Press, 169-182.

Boreo F. 1987. Evolutionary implications of habitat selection in the hydroids of Posidonia oceanica meadows. In: Bouillion J, Boreo F, Cicogna F, Cornelius PFS, eds. Modern Trends in the Systematics, Ecology, and Evolution of Hydroids and Hydromedusae . Oxford: Clarendon Press, 251-256.

Calder DR. 1971. Nematocysts of polyps of Aurelia , Chrysaora, and Cyanea , and their utility in identification. Transactions of the Amer. Micro. Soc. 90 (3): 269-274.

Calder DR. 1977. Nematocysts of the ephyra stages of Aurelia, Chrysaora, Cyanea, and Rhopilema (Cnidaria, Scyphozoa). Transactions of the Amer. Micro. Soc. 96 (1): 13-19.

Calder DR. 1988. Shallow-water hydroids of Bermuda: the Athecate. Royal Ontario Museum Pub. In Life Sci. Toronto Canada: University of Toronto Press, 5-15.

Clarke SF. 1878. A new locality for Cordylophora . The Amer. Naturalist . 12 (4): 232- 234.

Cohen A, Mills C, Berry H, Wonham M, Bingham B, Bookheim B, Calton J, Chapman J, Cordell J, Harris L, Klinger I, Kohn A, Lambert C, Lambert G, Li K, Secord D, Toft J. 43

1998. A rapid assessment survey of non-indigenous species in the shallow waters of Puget Sound. Report of the Puget Sound Expedition. September 8-16, 1998. p36

Colin SP, Costello JH. 2007. Functional characteristics of nematocysts found on the scyphomedusa Cyanea capillata . J. Exp. Mar. Biol. Ecol . 351: 114-120.

Cunningham CW, Buss LW. 1993. Molecular evidence for multiple episodes of paedomorphosis in the family Hydractiniidae. Biochem. Syst. Ecol. 21: 57-69.

DAISIE. 2006. Cordylophora caspia . Delivering Alien Invasive Species Inventories for Europe. Olenin S, eds. Web Publication < http://www.europe- aliens.org/speciesFactsheet.do?speciesId=50150>, Date of access October 14 th 2008.

Dawson MN, Jacobs DK. 2001. Molecular evidence for cryptic species of Aurelia aurita (Cnidaria, Scyphozoa). Biol. Bull. 200: 92-96.

Dawson MN, Martin LE. 2001. Geographic variation and ecological adaptation in Aurelia (Scyphozoa, Semaeostomeae): some implications from molecular phylogenetics. Hydrobiol. 451: 259-273.

Dunn DF. 1981. The clownfish sea anemones: Stichodactylidae (Coelenterata: Actiniaria) and other sea anemones symbiotic with pomacentrid fishes. Transactions of the Amer. Phil. Soc. 71: 1-115.

Facon B, Pointier JP, Glaubrecht M, Poux C, Jarne P, David P. 2003. A molecular phylogeography approach to biological invasions of the New World by parthenogenetic Thiarid snails. Mol. Ecol. 12: 3027-3039.

Fautin DG. 1988. Importance of Nematocysts to Actinian Taxonomy. In: Hessinger DA, Lenhoff HM, eds. The Biology of Nematocysts . San Diego: Academic Press, 487-500.

Fautin DG. 2009. Structural diversity, systematics, and evolution of cnidae. Toxicon . 54: 1054-1064.

Folino NC. 2000. The freshwater expansion and classification of the colonial hydroid Cordylophora (Phylum Cnidaria, Class Hydrozoa). Marine Bioinvasions: Proceedings of the First National Conference, January 24-27, 1999 . 139-144.

Folino-Rorem NC, Darling JA, D’Ausilio CA. 2009. Genetic analysis reveals multiple cryptic invasive species of the hydrozoan genus Cordylophora . Biol. Invasions . 11 (8): 1869-1882.

Folmer O, Black M, Hoeh W, Lutz R, Vrijenhoek R. 1994. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Mol. Mar. Biol. Biotechnol. 3 (5): 294-299.

Fulton C. 1962. Environmental factors influencing the growth of Cordylophora . J. Exp. Zool. 151: 61-78.

Fyfe ML. 1928. A new fresh-water hydroid from Otago, Cordylophora lacustris Allman var. otagoensis n subsp. Trans. N.Z. Inst . 59 (4): 813-823.

Gravier-Bonnet N. 1987. Nematocysts as taxonomic discriminators in thecate hydroids. In: Bouillon J, Boero F, Cicogna F and Cornelius P, eds. Modern trends in the systematic, ecology, and evolution of hydroids and hydromedusae. Oxford: Clarendon Press, 43-55.

Hebert PDN, Ratnasingham S, DeWaard JR. 2003. Barcoding animal life: cytochrome c oxidase subunit 1 divergences among closely related species. Proc. R. Soc. Long. B 270: S96-S99.

Huang D, Meier R, Todd PA, Chou LM. 2008. Slow mitochondrial COI sequence evolution at the base of the metazoan tree and its implications for DNA barcoding. J. Mol. Evol. 66: 167-174.

Itô T. 1951. A new athecate hydroid, Cordylophora japonica n. sp., from Japan. Memoirs of the Ehime University . Section II, 1 (2): 81-86.

Itô T. 1952. A new species of athecate hydroid Cordylophora from Japan. A special publication of the Japan Sea Regional Fisheries Research Laboratory . Nakao, Japan, 55- 57.

Janowski T, Collins AG, Campbell R. 2008. Global diversity of inland water cnidarians. Hydrobiologia . 595: 35-40.

Jensch F, Hofmann DK. 1997. The cnidoms of Cassiopea Andromeda Forskal, 1775, and Cassiopea xamachana Bigelow, 1882 (Cnidaria: Scyphozoa). In: den Hartog JC, van Ofwegen LP, van der Spoel S, eds. Coelenterate Biology. Leiden: Nationaal Natuurhistorisch Museum: 279-285.

Johnson M, Zaretskaya I, Raytselis Y, Merezhuk Y, McGinnis S, Madden TL. 2008. NCBI BLAST: a better web interface. Nucleic Acids Research. 36: W5-W9

Jormalainen V, Honkanen T, Vuorisalo T, Laihonen P. 1994. Growth and reproduction of an estuarine population of colonial hydroid Cordylophora caspia (Pallas) in the northern Baltic Sea. Helgolander Meeresunters. 48: 407-418.

Kinne O. 1958. Adaptation to salinity variations- some facts and problems. In: Prosser CL, eds. Physiological Adaptation . Washington DC: American Physiological Society, 92-106.

MacIsaac HJ, Robbins TC, Lewis MA. 2002. Modeling ships ballast water as invasion threats to the Great Lakes. Can. J. Fish. Aquat. Sci. 59 (7): 1245-1256.

Marcum BA, Dichl FA. 1978. Anchoring cells (desmocytes) in the hydrozoan polyp Cordylophora . Tissue and Cell . 10 (1): 113-124.

Marfenin NN. 1983. A new species of the genus Cordylophora (Hydrozoa, Clavidae) from the Black Sea. Zool. J. 62 (11): 1732-1734.

Mariscal RN. 1974. Nematocysts. In: Muscatine L, Lenhoff HM, eds. Coelenterate Biology . New York: Academic Press, 129-178.

McClung GD, Davis JR, Commander D, Pettitt J, Cover EC. 1978. First records of Cordylophora lacustris Allman, 1871 (Hydroida: Clavidae) from Texas. The Southwestern Naturalist . 28 (1). 112-113.

Mishler BD, Theriot EC. 2000. The phylogenetic species concept ( sensu Mishler and Theriot): monophyly, apomorphy, and phylogenetics species concepts. In: Wheeler QD, Meier R, eds. Species concepts and phylogenetic theory . New York: Columbia University Press, 44-54.

Moura CJ, Harris DJ, Cunha MR, Rogers AD. 2008. DNA barcoding reveals cryptic diversity in marine hydroids (Cnidaria, Hydrozoa) from coastal and deep-sea environments. Zool. Scr. 31: 93–108.

Musko IB, Bence M, Balogh CS. 2008. Occurrence of a new ponto-caspian invasive species, Cordylophora caspia (Pallas 1771) (Hydrozoa: Clavidae) in Lake Balaton (Hungary). Acta Zool. Academiae Scientiarum Hungaricae . 54 (2): 169-179.

Ortman BD, Bucklin A, Pagés F, Youngbluth M. 2010. DNA barcoding of the Medusozoa. Deep-Sea Res. II. In press.

Östman C. 1982. Nematocysts and Taxonomy in Laomedea, Gonothyraea and Obelia (Hydrozoa, Campanulariidae). Zool. Scripta . 11 (4). 227-241.

Östman C. 2000. A guideline to nematocyst nomenclature and classification, and some notes on the systematic value of nematocysts. Sci. Mar. 64: 31-46.

Papenfuss EJ. 1936. The utility of the nematocysts in the classification of certain Scyphomedusae. Lunds Univ. Arsslar. (Ard.2) 31(11): 1-26. 46

Peach MB, Pitt KA. 2005. Morphology of the nematocysts of the medusae of two scyphozoans, Catostylus mosaicus and Phyllorhiza punctata (Rhizostomeae): implications for capture of prey. Invert. Biol. 124 (2): 98-108.

Purcell JE. 1984. The functions of nematocysts in prey capture by epipelagic siphonophores (Coelenterate, Hydrozoa). Biol. Bull. 166: 310-327.

Purcell JE, Mills CE. 1988. The correlation of nematocyst types to diets in pelagic Hydrozoa. In: Hessinger DA, Lenhoff HM, eds. The Biology of Nematocysts . San Diego: Academic Press, 463-485.

Rifkin J, Endean R. 1983. The structure and function of the nematocysts of Chironex fleckeri Southcott, 1956. Cell Tissue Res . 233: 563-577.

Roman J, Darling JA. 2007. Paradox lost: genetic diversity and the success of aquatic invasions. Trends in Ecol. And Evol. 22 (9): Published online July 27 th 2007.

Roos PJ. 1979. Two-stage life cycle of a Cordylophora population in the Netherlands. Hydrobiologia . 62 (3): 231-239.

Ruiz GM, Fofonoff P, Hines AH, Grosholz ED. 1999. Non-indigenous species as stressors in estuarine and marine communities: Assessing invasion impacts and interactions. Limnol. Oceanogr . 44 (3, 2): 950-972.

Seifert R. 1928. Die Nessel kapseln der Zoantharien und ihre differentialdiagnostische bedeutung. Zoologische Jahrbucher Abteilung fur Systematik . Okologie und Geographie der Tiere. 55: 419-500 .

Smith DG. 1989. Keys to the freshwater macroinvertebrates of Massachusetts (No. 4): Benthic colonial phyla, including the Cnidaria, Entoprocta, and Ectoprocta. The commonwealth of Massachusetts Technical Services Branch, Division of Water Pollution Control, Westborough, Massachusetts.

Sogin ML, Edman JC. 1990. Amplification of ribosomal RNA genes for molecular evolution studies. In: Innes MA, Gelfand DH, Sninsky JJ, White TJ, eds. PCR protocols: a guide to methods and applications. San Diego: Academic Press, 307-314.

Stepien CA, Brown JE, Neilson ME, Tumeo MA. 2005. Genetic diversity of invasive species in the Great Lakes versus their Eurasian source populations: Insights for risk analysis. Risk Anal. 25 (4): 1043-1060.

Wheeler QD, Platnick NI. 2000. The phylogenetic species concept ( sensu Wheeler and Platnick). In: Wheeler QD, Meier R, eds. Species concepts and phylogenetic theory . New York: Columbia University Press, 55-69.

Williams RB. 1996. Measurements of cnidae from sea anenomes (Cnidaria: Actiniaria): statistical parameters and taxonomic relevance. Sci. Mar. 60 (2-3): 339-351.

Williams RB. 1998. Measurements of cnidae from sea anenomes (Cnidaria: Actiniaria), II: further studies of differences amongst sample means and their taxonomic relevance. Sci. Mar. 60 (4): 361-372.

Williams RB. 2000. Measurements of cnidae from sea anenomes (Cnidaria: Actiniaria), III: ranges and other measures of statistical dispersion, their interrelations and taxonomic relevance. Sci Mar. 64 (1): 49-68