DOCSLIB.ORG

Molecular Phylogeny of the Crab Genus Brachynotus (Brachyura

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Molecular Phylogeny of the Crab Genus Brachynotus (Brachyura 18860 k - J H\clrubiologia 4 49: 41-46.2001. 41 W P J.P.M. PiiuUt, A.A.V. Flores & C.H.J.M. Fransen teils). Advances iii Decapod Crustacean Research. ¡Q 2001 Kluwer Academic Publishers. Printed in the Netherlands. Molecular phylogeny of the crab genusBrachynotus (Brachyura: Varunidae) based on the 16S rRNA gene Christoph D. Schubart1, José A. Cuesta2 & Antonio Rodriguez2 1 Department o f Biological Sciences, National University o f Singapore, 10 Kent Ridge Crescent, Singapore 119260, Republic o f Singapore Presen! address: Biologie I, Universität Regensburg, 93040 Regensburg, Germany 2Instituto de Ciencias Marinas de Andalucía (CS1C). Polígono de Rio San Pedro s/n, Apartado Oficial, Puerto Real ! 1510, Cádiz, Spain i- Key words: phylogeny, systematics, 16S rRNA, Crustacea, Decapoda, Britdiynoj/ts S' A b stract Vlaams Instituut voor Flanders Marine Institute Tlie crab genus Brachynotus de Haan, 1833 is restricted to the intertidal and shallow subtidal of the Mediterranean and northeastern Atlantic. It is presently recognized to consist of four species, of which three {B. fo resti, B. gem m ellari and B. sexdentatus) are endemic to the Mediterranean. The fourth species, B. atlanticus, is found along the Atlantic coasts of northern Africa and southern Europe, but also extends into the western Mediterranean. This high level of endemism suggests that spéciation within Brachynotus is strongly correlated with the geography and geology of the Mediterranean Sea. A molecular phylogeny based on the mitochondrial large subunit (16S) rRNA gene indicates that the four species of Brachynotus form a monophyletic group within Atlantic Varunidae. The DNA sequence data also show that the genus Brachynotus can be subdivided into two species groups, one comprising B. atlanticus and B. foresti, and the other one B. gem m ellari and B. sexdentatus. W hile B. atlanticus and B. fo resti are clearly genetically distinct, B. gemmellari and B. sexdentatus are identical in the studied region of the 16S rRNA gene, suggesting a recent separation or continuing gene flow. Introduction The geographical confinement of its species, makes Brachynotus a very interesting genus for the study of Crabs of the genus Brachynotus de Haan, 1833 are spéciation and biogeography within the Mediterranean restricted to the western Atlantic and Mediterranean, Sea. despite the fact that many species from different parts The ecological distribution of the crabs belonging of the world, which are now classified in Cyrto­ to Brachynotus is typically the intertidal and shal­ grapsus. Hemigrapsus, Leptograpsodes, Tetragrapsus low subtidal zone of rocky or soft bottom shores or Thalassograpsus, had been previously placed in this (d’Udekem d’Acoz, 1999). The resurrection of the genus (see for example Rathbun, 1893; Tesch, 1918; species B. gem m ellari by Froglia & Manning (1978) Tweedie, 1942; Phillips et al., 1984). Today, B ra­ was mainly based on bathymetric and morphometric chynotus consists of four species. B. a tlanticus Forest, differences of this species and B. sexdentatus. O ther­ 1957 is found along the Atlantic coasts of northern wise, these two species have overlapping distributions Africa and southern Europe extending into the west­ and a practically identical morphology. The taxonomic ern Mediterranean (García-Raso, 1984; d’Udekem status o f B. gemmellari is widely accepted, and several d’Acoz, 1999). The other three species, B. fo resti Za- studies on its distribution, ecology and larval stages, riquiey Alvarez, 1968, B. gemmellari (Rizza, 1839) have been published since its recognition (Almaça, and B. sexdentatus (Risso, 1827), are mostly endemic 1985; Stevcic, 1990; Guerao et ah, 1995; Paula, 1996; to the Mediterranean, with occasional findings from Atkinson et ah, 1997; d'Udekem d'Acoz, 1999). the Black Sea, the Suez Canal, and the Gulf of Cádiz The remaining species of Brachynotus are easily (Zariquiey Alvarez, 1968; d’Udekem d’Acoz, 1999). separable on the basis of morphological characters. On 42 43 the other hand, the important question about under­ primers listed in Table 2. PCR products were purified Table t. Localities, dates of collection and genetic database accession numbers of the specimen of Brachynotus (4 species). Hemigrapsus penicillatus. Cyrtograpsus angulatus an d Eriocheir sinensis used for genetic comparisons. Abbreviations of lying phylogenetic relationships among these mostly and sequenced by dideoxy chain termination with S35 museums where animals were deposited as voucher specimens: BMNH: British Museum of Natural History, London: SMF: sympatric species was never resolved. In this study, we radioactive labeling (at the Pennsylvania State Uni­ Senckenbcrg Museum und Forschungsinstitut. Frankfurt a. M.: ULLZ: University of Louisiana at Lafayette Zoological compared a 580 basepair region of the mitochondrial versity) or with the AB1 Prism 310 Genetic Analyzer Collection. Lafayette: USNM: United States National Museum. Smithsonian Institution. Washington DNA (large subunit rRNA) in order to test whether using the AB I BigDye terminator mix (at the Univer­ Brachynotus sexdentatus (Risso. 1827) (EMBL AJ278832) Brachynotus forms a monophyletic group, to help sity of Louisiana at Lafayette). All sequences were Spain: Cadi/.: Puerto de Santa Maria: El Toruno, in aquaculture ponds up to 1.5 m depth: 14. June 1999: coli. A. resolve phylogenetic relationships within the genus, aligned manually using the multisequence editing pro­ Rodriguez; SMF 25794 and to establish the degree of genetic differentiation gram ESEE (Cabot & Beckenbach, 1989). Distance Greece: Gulf of Amvrakikos: Monidi; 'Ü.5 in - 1.5 m deep muddy bottom with sea grasses", 17. July 1993; coli. C. between the closely related B. gem m ellari and B. matrices of sequence divergence were analyzed using d'Udckem d'Acoz; SMF 25795 sexdentatus. Kimura 2-parameter distances and neighbor joining (NJ) (Saitou & Nei, 1987) with the program MEGA Brachynotus gemmellari (Ri/.za, 1839) (EMBL AJ278833) (Kumar et al., 1993). Maximum parsimony (MP) ana­ Italy; Ancona. 3 miles off. 15 m depth; 7. July 1963: coll. Froglia; USNM 172093 M aterial and methods lyses were carried out with PAUP (Swofford. 1993), England: Swansea: Queens Dock. M arch-Junc 1957; coll. E. Naylor; BMNH 1957.11.11.1-6 using the heuristic search method with tree bisection For the molecular phylogenetic analysis of B ra ­ and reconnection branch swapping. Gaps were treated Brachynotus atlanticus Forest, 1957 (EMBL AJ27883I) chynotus and allied crabs, we included representat­ as missing and the tree was rooted by a user-defined Spain: Cádiz: Cabo de Trafalgar: June 1996: coll. J.A. Cuesta; SM F 25706 ives of all the genera of Varunidae occurring in the outgroup. Statistical significance of groups within in­ Atlantic, i.e. four species (six specimens) of B ra ­ ferred trees was evaluated by bootstrapping with 2000 Brachynotus foresti Zariquiey Alvarez. 1968 (EMBL AJ278834) chynotus, as well as Cyrtograpsus affinis, C. an­ replications. Greece: Gulf of Amvrakikos: Agia Triada. 4 July 1993; coli. C. d'Udekem d’Acoz; SMF 25796 gulatus, Chasmagnathus granulatus, Cyclograpsus Hemigrapsus penicillatus (de Haan. 1835) (EMBL AJ278835) integer. Eriocheir sinensis and Hemigrapsus penicil­ France: La Gironde Estuary, Talmont (~ 451 32' N - 0 ' 54' W ); 9 May 1996; coli. P. Noel: SMF 25798 latus (see Table 1). The latter two are East Asian R esu lts species that have been introduced into European wa­ Cyrtograpsus angulatus Dana. 1851 (EMBL AJ278836) ters during this century (Schnakenbeck, 1924; Noël et The complete alignment of the sequenced 16S rRNA Argentina: Mar Chiquita: January 1996: coli. K. Anger; SMF 24546 al., 1997). 16S mtDNA sequences ofChasmagnathus gene region consisted of 580 positions. Of these, 186 granulatus (EMBL accession number AJ250640), were variable and 114 parsimony-informative. Pair­ Eriocheir sinensis 1-L Milne Edwards. 1853 (EMBL AJ250642) Cyclograpsus integer (AJ250639), Cyrtograpsus af­ wise transition to transversion ratios ranged between U.S.A. California: San Francisco Bay: Byron: Stale Fish facility: 11.11.1996; coll. K. I-lieb; ULLZ 4175 fin is (AJ130801), Eriocheir sinensis (AJ250642), 0.74 (outgroup vs. ingroup) and 6.5 (closely related Hemigrapsus oregonensis (AJ250644), Sesarma re­ species). The MP heuristic search, with transversions ticulatum (Sesarmidae) (AJ 130799) and Tetragrapsus versus transitions weighted 3/1, resulted in two most jo u y i(AJ250647) had been used in a previous study parsimonious Lees. The MP bootstrap analysis (2000 Table 2. Primers used for PCR amplification and se­ from different localities (see Table 1), which rendered to show that the genera Chasmagnathus and C yclo­ replicates) yielded a consensus tree of the length 722 quencing of parls of (lie 16S rRNA gene identical results. grapsus need to be classified within the Varunidae with the following tree-fit values: Cl: 0.665, RI: 0.569, The present results also show significant sup­ l6Sar: 5'- CGCCTGTTTATCAAAAACAT -3' (see Schubart et al., 2000a). Other sequences ob­ RC: 0.378 (Fig. 1). Results obtained by NJ agreed in port for other phylogenetic groupings. The Varunidae I6L2 5'- YGCCTGTTTATCAAAAACAT -3' tained from genetic databases and included in the the tree topology with MP (only considering bootstrap (sensu Schubart et ah, 2000a) is confirmed as a mono­ 16L15: 5'- GACGATAAGACCCTATAAAGCTT -3' present study were Eriocheir japonica (AF105242) values > 509c) and are, therefore, combined in Fig. 1. phyletic family (Fig.l: node ‘VAR’; 99 / 99) (see 1472 5'- AGATAGAAACCAACCTGG -3' and Grapsus grapsus (Grapsidae) (AJ250650). The All phylogenetic analyses suggest that B ra­ also Cuesta & Schubart, 1997; Schubart & Cuesta, 16,Sb/-: 5'- CCGGTCTGAACTCAGATCACGT -3' latter species served as an outgroup for the phylogen­ ch yn o tu sforms a monophyletic group within the other 1998). Congeneric species belonging to two other I 6 H 16: 5'-T T A T C R C C C C A A T A A A A T A -3' etic analyses. New sequences were submitted to the Varunidae tested in this analysis (bootstrap values of varunid genera were grouped together with relatively EMBL genetic database and can be retrieved under the 100 / 100).
Load more

Recommended publications
  • National Monitoring Program for Biodiversity and Non-Indigenous Species in Egypt
    UNITED NATIONS ENVIRONMENT PROGRAM MEDITERRANEAN ACTION PLAN REGIONAL ACTIVITY CENTRE FOR SPECIALLY PROTECTED AREAS National monitoring program for biodiversity and non-indigenous species in Egypt PROF. MOUSTAFA M. FOUDA April 2017 1 Study required and financed by: Regional Activity Centre for Specially Protected Areas Boulevard du Leader Yasser Arafat BP 337 1080 Tunis Cedex – Tunisie Responsible of the study: Mehdi Aissi, EcApMEDII Programme officer In charge of the study: Prof. Moustafa M. Fouda Mr. Mohamed Said Abdelwarith Mr. Mahmoud Fawzy Kamel Ministry of Environment, Egyptian Environmental Affairs Agency (EEAA) With the participation of: Name, qualification and original institution of all the participants in the study (field mission or participation of national institutions) 2 TABLE OF CONTENTS page Acknowledgements 4 Preamble 5 Chapter 1: Introduction 9 Chapter 2: Institutional and regulatory aspects 40 Chapter 3: Scientific Aspects 49 Chapter 4: Development of monitoring program 59 Chapter 5: Existing Monitoring Program in Egypt 91 1. Monitoring program for habitat mapping 103 2. Marine MAMMALS monitoring program 109 3. Marine Turtles Monitoring Program 115 4. Monitoring Program for Seabirds 118 5. Non-Indigenous Species Monitoring Program 123 Chapter 6: Implementation / Operational Plan 131 Selected References 133 Annexes 143 3 AKNOWLEGEMENTS We would like to thank RAC/ SPA and EU for providing financial and technical assistances to prepare this monitoring programme. The preparation of this programme was the result of several contacts and interviews with many stakeholders from Government, research institutions, NGOs and fishermen. The author would like to express thanks to all for their support. In addition; we would like to acknowledge all participants who attended the workshop and represented the following institutions: 1.
    [Show full text]
  • Checklists of Crustacea Decapoda from the Canary and Cape Verde Islands, with an Assessment of Macaronesian and Cape Verde Biogeographic Marine Ecoregions
    Zootaxa 4413 (3): 401–448 ISSN 1175-5326 (print edition) http://www.mapress.com/j/zt/ Article ZOOTAXA Copyright © 2018 Magnolia Press ISSN 1175-5334 (online edition) https://doi.org/10.11646/zootaxa.4413.3.1 http://zoobank.org/urn:lsid:zoobank.org:pub:2DF9255A-7C42-42DA-9F48-2BAA6DCEED7E Checklists of Crustacea Decapoda from the Canary and Cape Verde Islands, with an assessment of Macaronesian and Cape Verde biogeographic marine ecoregions JOSÉ A. GONZÁLEZ University of Las Palmas de Gran Canaria, i-UNAT, Campus de Tafira, 35017 Las Palmas de Gran Canaria, Spain. E-mail: [email protected]. ORCID iD: 0000-0001-8584-6731. Abstract The complete list of Canarian marine decapods (last update by González & Quiles 2003, popular book) currently com- prises 374 species/subspecies, grouped in 198 genera and 82 families; whereas the Cape Verdean marine decapods (now fully listed for the first time) are represented by 343 species/subspecies with 201 genera and 80 families. Due to changing environmental conditions, in the last decades many subtropical/tropical taxa have reached the coasts of the Canary Islands. Comparing the carcinofaunal composition and their biogeographic components between the Canary and Cape Verde ar- chipelagos would aid in: validating the appropriateness in separating both archipelagos into different ecoregions (Spalding et al. 2007), and understanding faunal movements between areas of benthic habitat. The consistency of both ecoregions is here compared and validated by assembling their decapod crustacean checklists, analysing their taxa composition, gath- ering their bathymetric data, and comparing their biogeographic patterns. Four main evidences (i.e. different taxa; diver- gent taxa composition; different composition of biogeographic patterns; different endemicity rates) support that separation, especially in coastal benthic decapods; and these parametres combined would be used as a valuable tool at comparing biotas from oceanic archipelagos.
    [Show full text]
  • Invertebrate Animals (Metazoa: Invertebrata) of the Atanasovsko Lake, Bulgaria
    Historia naturalis bulgarica, 22: 45-71, 2015 Invertebrate Animals (Metazoa: Invertebrata) of the Atanasovsko Lake, Bulgaria Zdravko Hubenov, Lyubomir Kenderov, Ivan Pandourski Abstract: The role of the Atanasovsko Lake for storage and protection of the specific faunistic diversity, characteristic of the hyper-saline lakes of the Bulgarian seaside is presented. The fauna of the lake and surrounding waters is reviewed, the taxonomic diversity and some zoogeographical and ecological features of the invertebrates are analyzed. The lake system includes from freshwater to hyper-saline basins with fast changing environment. A total of 6 types, 10 classes, 35 orders, 82 families and 157 species are known from the Atanasovsko Lake and the surrounding basins. They include 56 species (35.7%) marine and marine-brackish forms and 101 species (64.3%) brackish-freshwater, freshwater and terrestrial forms, connected with water. For the first time, 23 species in this study are established (12 marine, 1 brackish and 10 freshwater). The marine and marine- brackish species have 4 types of ranges – Cosmopolitan, Atlantic-Indian, Atlantic-Pacific and Atlantic. The Atlantic (66.1%) and Cosmopolitan (23.2%) ranges that include 80% of the species, predominate. Most of the fauna (over 60%) has an Atlantic-Mediterranean origin and represents an impoverished Atlantic-Mediterranean fauna. The freshwater-brackish, freshwater and terrestrial forms, connected with water, that have been established from the Atanasovsko Lake, have 2 main types of ranges – species, distributed in the Palaearctic and beyond it and species, distributed only in the Palaearctic. The representatives of the first type (52.4%) predomi- nate. They are related to the typical marine coastal habitats, optimal for the development of certain species.
    [Show full text]
  • Illustrated Keys for the Identi¢Cation of the Pleocyemata (Crustacea: Decapoda) Zoeal Stages, from the Coastal Region of South-Western Europe
    J. Mar. Biol. Ass. U.K. (2004), 84, 205^227 Printed in the United Kingdom Illustrated keys for the identi¢cation of the Pleocyemata (Crustacea: Decapoda) zoeal stages, from the coastal region of south-western Europe Antonina dos Santos*P and Juan Ignacio Gonza¤ lez-GordilloO *Instituto de Investigac° a‹ o das Pescas e do Mar, Avenida de Brasilia s/n, 1449-006 Lisbon, Portugal. OCentro Andaluz de Ciencia y Tecnolog|¤a Marinas, Universidad de Ca¤ diz, Campus de Puerto Real, 11510öPuerto Real (Ca¤ diz), Spain. PCorresponding author, e-mail: [email protected] The identi¢cation keys of the zoeal stages of Pleocyemata decapod larvae from the coastal region of south-western Europe, based on both new and previously published descriptions and illustrations, are provided. The keys cover 127 taxa, most of them identi¢ed to genus and species level. These keys were mainly constructed upon external morphological characters, which are easy to observe under a stereo- microscope. Moreover, the presentation of detailed ¢gures allows a non-specialist to make identi¢cations more easily. INTRODUCTION nearby areas as a complement document when identifying larval stages. Identi¢cation of decapod larvae from plankton samples The order Decapoda comprises two suborders, the is not easy, principally because there are great morpholo- Dendrobranchiata and the Pleocyemata (Martin & Davis, gical changes between developmental phases, although less 2001). A key for the identi¢cation of Dendrobranchiata pronounced between larval stages. Moreover, larval larvae covering the same area of this study has been descriptions of many species are still unsuitable or even presented by dos Santos & Lindley (2001).
    [Show full text]
  • Decapoda, Brachyura
    APLICACIÓN DE TÉCNICAS MORFOLÓGICAS Y MOLECULARES EN LA IDENTIFICACIÓN DE LA MEGALOPA de Decápodos Braquiuros de la Península Ibérica bérica I enínsula P raquiuros de la raquiuros B ecápodos D de APLICACIÓN DE TÉCNICAS MORFOLÓGICAS Y MOLECULARES EN LA IDENTIFICACIÓN DE LA MEGALOPA LA DE IDENTIFICACIÓN EN LA Y MOLECULARES MORFOLÓGICAS TÉCNICAS DE APLICACIÓN Herrero - MEGALOPA “big eyes” Leach 1793 Elena Marco Elena Marco-Herrero Programa de Doctorado en Biodiversidad y Biología Evolutiva Rd. 99/2011 Tesis Doctoral, Valencia 2015 Programa de Doctorado en Biodiversidad y Biología Evolutiva Rd. 99/2011 APLICACIÓN DE TÉCNICAS MORFOLÓGICAS Y MOLECULARES EN LA IDENTIFICACIÓN DE LA MEGALOPA DE DECÁPODOS BRAQUIUROS DE LA PENÍNSULA IBÉRICA TESIS DOCTORAL Elena Marco-Herrero Valencia, septiembre 2015 Directores José Antonio Cuesta Mariscal / Ferran Palero Pastor Tutor Álvaro Peña Cantero Als naninets AGRADECIMIENTOS-AGRAÏMENTS Colaboración y ayuda prestada por diferentes instituciones: - Ministerio de Ciencia e Innovación (actual Ministerio de Economía y Competitividad) por la concesión de una Beca de Formación de Personal Investigador FPI (BES-2010- 033297) en el marco del proyecto: Aplicación de técnicas morfológicas y moleculares en la identificación de estados larvarios planctónicos de decápodos braquiuros ibéricos (CGL2009-11225) - Departamento de Ecología y Gestión Costera del Instituto de Ciencias Marinas de Andalucía (ICMAN-CSIC) - Club Náutico del Puerto de Santa María - Centro Andaluz de Ciencias y Tecnologías Marinas (CACYTMAR) - Instituto Español de Oceanografía (IEO), Centros de Mallorca y Cádiz - Institut de Ciències del Mar (ICM-CSIC) de Barcelona - Institut de Recerca i Tecnología Agroalimentàries (IRTA) de Tarragona - Centre d’Estudis Avançats de Blanes (CEAB) de Girona - Universidad de Málaga - Natural History Museum of London - Stazione Zoologica Anton Dohrn di Napoli (SZN) - Universitat de Barcelona AGRAÏSC – AGRADEZCO En primer lugar quisiera agradecer a mis directores, el Dr.
    [Show full text]
  • Exotic Species in the Aegean, Marmara, Black, Azov and Caspian Seas
    EXOTIC SPECIES IN THE AEGEAN, MARMARA, BLACK, AZOV AND CASPIAN SEAS Edited by Yuvenaly ZAITSEV and Bayram ÖZTÜRK EXOTIC SPECIES IN THE AEGEAN, MARMARA, BLACK, AZOV AND CASPIAN SEAS All rights are reserved. No part of this publication may be reproduced, stored in a retrieval system, or transmitted in any form or by any means without the prior permission from the Turkish Marine Research Foundation (TÜDAV) Copyright :Türk Deniz Araştırmaları Vakfı (Turkish Marine Research Foundation) ISBN :975-97132-2-5 This publication should be cited as follows: Zaitsev Yu. and Öztürk B.(Eds) Exotic Species in the Aegean, Marmara, Black, Azov and Caspian Seas. Published by Turkish Marine Research Foundation, Istanbul, TURKEY, 2001, 267 pp. Türk Deniz Araştırmaları Vakfı (TÜDAV) P.K 10 Beykoz-İSTANBUL-TURKEY Tel:0216 424 07 72 Fax:0216 424 07 71 E-mail :[email protected] http://www.tudav.org Printed by Ofis Grafik Matbaa A.Ş. / İstanbul -Tel: 0212 266 54 56 Contributors Prof. Abdul Guseinali Kasymov, Caspian Biological Station, Institute of Zoology, Azerbaijan Academy of Sciences. Baku, Azerbaijan Dr. Ahmet Kıdeys, Middle East Technical University, Erdemli.İçel, Turkey Dr. Ahmet . N. Tarkan, University of Istanbul, Faculty of Fisheries. Istanbul, Turkey. Prof. Bayram Ozturk, University of Istanbul, Faculty of Fisheries and Turkish Marine Research Foundation, Istanbul, Turkey. Dr. Boris Alexandrov, Odessa Branch, Institute of Biology of Southern Seas, National Academy of Ukraine. Odessa, Ukraine. Dr. Firdauz Shakirova, National Institute of Deserts, Flora and Fauna, Ministry of Nature Use and Environmental Protection of Turkmenistan. Ashgabat, Turkmenistan. Dr. Galina Minicheva, Odessa Branch, Institute of Biology of Southern Seas, National Academy of Ukraine.
    [Show full text]
  • 93 Material of This Species Was Examined from the Following Localities: Haifa Bay (Samples 98, 245), Atlit, Tantura, Caesarea (R
    Vol. 7B, I9j8 L. B. HOLTHUIS and E. GOTTLIEB 93 Material of this species was examined from the following localities: Haifa Bay (samples 98, 245), Atlit, Tantura, Caesarea (rock pools, VI. 1946) and Bat Yam. The Haifa specimens were collected at depths of 22 and 29 m, respectively. The carapace lengths of the specimens varied between 4.5 and 23 mm; in two ovigerous females it was 11 and 11.5 mm, respectively. Xantho poressa is also known under the names Xantho hydrophilus (Herbst 1790) and Xantho rivulosus (Risso 1816), both of which are incorrect (see Hol- thuis 1954). The systematics of this and related species of the genus have been dealt with extensively by Drach and Forest (1953). The species inhabits the entire Mediterranean, the Black Sea and the Canary Islands. The records from the E Mediterranean are : Navarino Bay, Methone (=Modon) and Sapientza, S Greece (Guerin 1832, as Cancer cinereus), Phale- ron Bay near Athens (Athanassopoulos 1917), Bosporus (Heller 1863), Istanbul fishmarket (Ninni 1923), near Gallipoli, Sea of Marmara (OstroumorT 1896), near Khania, NW Crete (Lucas 1853, Raulin 1870), Rhodes (Santucci 1928, Tortonese 1947), Cyprus (Heller 1863), Lebanon (Drach and Forest 1953), Sidon ( =Saida), Lebanon (Monod 1931), Israel (Bodenheimer 1935, 1937), Haifa (Steinitz 1933), Caesarea, Israel (Gottlieb 1953), Egypt (Audouin 1826), Port Said (Caiman 1927), near Alexandria, Egypt (Balss 1936). In the U.S. National Museum, Washington, D.C., two specimens of this species from Istanbul (IX., X. 1923, H. C. Kellers) were examined. Xantho granulicarpus Forest, 1953 Xantho? jloridus Gottlieb, 1953, p. 440. Material from the following localities has been examined: Haifa Bay (samples 98, 121, 138, 195, 385), Tantura (7.VII.1952 and 5.VII.1955, coll.
    [Show full text]
  • Mediterranean Marine Science Vol
    Mediterranean Marine Science Vol. 5/2, 2004, 53-64 Key for the identification of Mediterranean brachyuran megalopae D. PESSANI, T. TIRELLI & S. FLAGELLA Dipartimento di Biologia Animale e dell’Uomo, Via Accademia Albertina 17, 10123 Torino, Italy e-mail: [email protected] Abstract Based on larval literature, an identification key has been constructed for the megalopae of 55 species of Mediterranean Brachyura. This key is based mainly on external morphological characteristics visible, by using a microscope, limiting the necessity for dissection of specimens. Characteristics used include presence/absence of ornamentation on the carapace, number of abdominal somites, number and position of setae and/or spines on antennula, antenna, pereiopods and structure of uropods, etc. Partial dissection is only required to count the setae on the scaphognathite margin. Using the above characters, it is also possible to gather almost all the families into groups. However, the megalopae of Portunidae as well as those of the three species of Brachynotus genus are similar to each other and their identification at a specific level requires the use of features somehow variable and difficult to count. In the Majidae, the megalopae of 14 species are already known. The complexity of morphological characters typical of this family makes it difficult to define characters common to all spider crab megalopae. Nevertheless, the key may be an aid for carcinology studies, especially those including sorting and identification of megalopae from plankton samples. Keywords: Larval development; Larval morphology; Key; Decapoda; Brachyura; Mediterranean Sea. Introduction obtaining this phase usually results in a high zoeal mortality. The larval development of Brachyura Of the 138 species of Brachyura totally present (Crustacea, Decapoda) includes two or more in the Mediterranean (d’Udekem d’Acoz, 1999), planktonic stages of zoea and the plankto- one or more zoeal stages are known for 78 benthonic stage of megalopa.
    [Show full text]
  • Patterns and Traits Associated with Invasions By
    A peer-reviewed open-access journal NeoBiota 39: 79–102Patterns (2018) and traits associated with invasions by predatory marine crabs 79 doi: 10.3897/neobiota.39.22002 RESEARCH ARTICLE NeoBiota http://neobiota.pensoft.net Advancing research on alien species and biological invasions Patterns and traits associated with invasions by predatory marine crabs Cheruscha Swart1, Vernon Visser2,3, Tamara B. Robinson4 1 Department of Botany and Zoology, Stellenbosch University, Matieland, 7602, South Africa 2 SEEC – Sta- tistics in Ecology, Environment and Conservation, Department of Statistical Sciences 3 African Climate and Development Initiative, University of Cape Town, Rondebosch 7701, South Africa 4 Centre for Invasion Biology, Department of Botany and Zoology, Stellenbosch University, Matieland, 7602, South Africa Corresponding author: Tamara B. Robinson ([email protected]) Academic editor: G. Ruiz | Received 1 November 2017 | Accepted 7 August 2018 | Published 28 August 2018 Citation: Swart C, Visser V, Robinson TB (2018) Patterns and traits associated with invasions by predatory marine crabs. NeoBiota 39: 79–102. https://doi.org/10.3897/neobiota.39.22002 Abstract Predatory crabs are considered amongst the most successful marine invasive groups. Nonetheless, most studies of these taxa have been descriptive in nature, biased towards specific species or regions and have seldom considered traits associated with invasiveness. To address this gap in knowledge, this study presents a global review of invasions by this group and applies biological trait analysis to investigate traits associated with invasion success. A total of 56 species belonging to 15 families were identified as having spread out- side their native ranges. The family Portunidae supported the highest number of alien species (22).
    [Show full text]
  • Larval Development of the Brush-Clawed Shore Crab Hemigrapsus Takanoi Abstract Asakura & Watanabe, 2005 (Decapoda, Brachyura, Varunidae)
    Journal of the Marine Larval development of the brush-clawed shore Biological Association of the United Kingdom crab Hemigrapsus takanoi Asakura & Watanabe, 2005 (Decapoda, Brachyura, Varunidae) cambridge.org/mbi Jose M. Landeira1,2, Jose A. Cuesta3 and Yuji Tanaka1 1Department of Ocean Sciences, Tokyo University of Marine Science and Technology, 4-5-7 Konan, Minato, Tokyo Original Article 108-8477, Japan; 2Graduate School of Biosphere Science Hiroshima University, 1-4-4 Kagamiyama, Higashihiroshima, Hiroshima 739-8528, Japan and 3Instituto de Ciencias Marinas de Andalucía (ICMAN-CSIC), Cite this article: Landeira JM, Cuesta JA, Avenida República Saharaui, 2, 11519 Puerto Real, Cádiz, Spain Tanaka Y (2019). Larval development of the brush-clawed shore crab Hemigrapsus takanoi Abstract Asakura & Watanabe, 2005 (Decapoda, Brachyura, Varunidae). Journal of the Marine The brush-clawed shore crab Hemigrapsus takanoi is a native species from the Western Pacific Biological Association of the United Kingdom and an invader of the European Atlantic coast from northern Spain to southern Denmark. – 1 12. https://doi.org/10.1017/ Despite the increasing concern about its rapid expansion, little is known about the early stages S002531541900002X in its life history. In the present study, the larval morphology of H. takanoi is described and Received: 12 June 2018 illustrated from specimens obtained in the laboratory from its type locality, Tokyo Bay, Japan. Revised: 12 November 2018 Its larval development follows the pattern of Varunidae, that involves five zoeae and one Accepted: 3 January 2019 megalopa. The morphological characters of the larvae of H. takanoi are compared with Key words: those of the other known Hemigrapsus species of the North Pacific.
    [Show full text]
  • Oral Presentations
    ORAL PRESENTATIONS 1 Page CLIMATE CHANGE 2 Page SEAWATER WARMING AT THE NORTHERN REACH FOR SOUTHERN SPECIES: APPRAISAL, MONITORING AND NEW RECORDS IN THE GULF OF GENOA Carlo Nike Bianchi, Francesco Caroli, Carla Morri DiSTAV (Department of Earth, Environment and Life Sciences), University of Genoa, Corso Europa 26, 16132 Genoa, Italy One of the predicted effects of global warming is the poleward range expansion of plant and animal species, both on land and in the sea. In the world ocean, evidence of this phenomenon is accumulating especially for warm-temperate areas: major examples are known from California, Australia, the NE Atlantic, and the Mediterranean. In the Mediterranean Sea, in particular, seawater warming has even more dramatic effects, as it offers further scope to the spread of tropical species coming from the Red Sea through the Suez Canal (a man-made seaway) or from the Atlantic through the Straits of Gibraltar (a natural seaway). The concurrent temperature increase and abundance of tropical species is leading to the so-called ‘tropicalisation’ of the Mediterranean Sea, which is particularly obvious in the south-eastern sectors of the basin. At the same time, the colder north- western sectors of the basin have been said to undergo a process of ‘meridionalisation’, that is the arrival of native warm-water species previously restricted to the southern sectors. The Gulf of Genoa (Ligurian Sea) is the north-western reach for southern species of whatever origin in the Mediterranean. The relative occurrences of both tropical aliens and warm-water natives has been monitored between 2009 and 2015 in shallow (0 to a few metres depth) rocky reefs at Genoa, and compared with the trend in air and sea surface temperatures.
    [Show full text]
  • First Record of Brachynotus Atlanticus Forest, 1957 (Decapoda, Varunidae) from Syrian Coast
    REPORT Vol. 20, 2019 REPORT ARTICLE ISSN 2319–5746 EISSN 2319–5754 Species First record of Brachynotus atlanticus Forest, 1957 (Decapoda, Varunidae) from Syrian coast Izdihar Ammar1, Fatima Khalifa2 1Professor, Department of Marine Biology at High Institute of Marine Research, Tishreen University, Latakia, Syria Email: [email protected] 2Master student, Department of Marine Biology at High Institute of Marine Research, Tishreen University, Latakia, Syria Email: [email protected] Corresponding author Professor, Department of Marine Biology at High Institute of Marine Research, Tishreen University, Latakia, Syria Email: [email protected] Article History Received: 13 August 2019 Accepted: 27 September 2019 Published: October 2019 Citation Izdihar Ammar, Fatima Khalifa. First record of Brachynotus atlanticus Forest, 1957 (Decapoda, Varunidae) from Syrian coast. Species, 2019, 20, 151-154 Publication License This work is licensed under a Creative Commons Attribution 4.0 International License. General Note Article is recommended to print as color digital version in recycled paper. ABSTRACT In Syrian coastal water, the number of species that are registered for the first time from various taxonomic units is growing; most of which are non-Mediterranean and belong to warm water species. One specimen of the brachyuran crab Brachynotus atlanticus Forest, 1957, were collected by hand from the Al-shokaifat littoral zone (Syrian coast) on a sandy gravel shore in May2019. It is the first record of this western Atlantic species from the Syrian coast and Eastern Mediterranean. 151 Keywords: Crustaceans, First record, Alien species, Varunidae, Brachynotus Page © 2019 Discovery Publication. All Rights Reserved. www.discoveryjournals.org OPEN ACCESS REPORT ARTICLE 1.
    [Show full text]