The Role of the Golgi Protein GM130 in Cell Polarity and Tumorigenesis
Dissertation submitted for the degree of Doctor of Natural Sciences (Dr. rer. nat.)
Presented by Francesco Baschieri
at the
Faculty of Sciences Department of Biology University of Konstanz Date of examination: 27.03.2015 1. referent: Prof. Daniel F. Legler 2. referent: PD Dr. Hesso Farhan Konstanz, 2015
Konstanzer Online-Publikations-System (KOPS) URL: http://nbn-resolving.de/urn:nbn:de:bsz:352-0-287758
Table of Contents
Abstract ...... 1
Zusammenfassung ...... 2
Introduction ...... 4
Cell polarity ...... 5 Table 1 – Nomenclature of polarity proteins ...... 8 Par complex ...... 8 Par6 ...... 9 Par3 ...... 9 aPKC ...... 11 Table 2 – List of substrates of aPKC ...... 12 Par complex in cell migration and invasion ...... 12 Par complex in cancer ...... 13 Crumbs complex ...... 17 CRB ...... 17 Pals1 ...... 18 PATJ ...... 19 Crumbs complex in cell migration and invasion ...... 20 Crumbs complex in cancer ...... 20 Scribble complex ...... 21 Scribble ...... 22 DLG ...... 24 LGL ...... 24 Scribble complex in cell migration and invasion ...... 25 Scribble complex in cancer ...... 26 Figure 1 – Schematic of polarity proteins localization in apico-basal and front-rear polarity ...... 29 References ...... 30
Small Rho GTPases ...... 37 Table 1 – Localization of small GTPases ...... 39 Actin regulation by Rho GTPases ...... 39 Figure 1 – Main signaling routes downstream of Cdc42, Rac1 and RhoA 42 Rho GAPs ...... 42 Rho GEFs ...... 44 Rho GDIs ...... 47 Figure 2 – Model of the mechanism of action of GDIs ...... 48 References ...... 51
Table of Contents - I
The secretory pathway ...... 58 Signaling at the secretory pathway ...... 63 The Golgi Apparatus in cell polarity ...... 66 The Golgi Apparatus in cell migration ...... 69 Golgi and cancer ...... 71 Figure 1 – Schematic of some of the signaling routes to and from the secretory pathway ...... 72 References ...... 73
Aim of the Thesis ...... 80
Results...... 82 Part 1 - Spatial Cdc42 signalling regulates polarity and tumorigenesis ...... 82 The Golgi pool of Cdc42 controls cell polarity ...... 82 Directed trafficking causes asymmetric distribution of Cdc42 ...... 83 The GM130-Cdc42 crosstalk does not involve GEFs ...... 84 The GM130-Cdc42 crosstalk involves RasGRF ...... 84 Regulation of the GM130-RasGRF complex ...... 85 The GM130-RasGRF complex controls Ras activity ...... 86 Expression of GM130 in colon cancer ...... 86 Figures ...... 88 Figure 1. GM130 spatially regulates Cdc42 activity to control polarity ... 88 Figure 2. Models for the GM130-Cdc42 crosstalk ...... 91 Figure 3. Screening for GEFs that regulate the Golgi pool of Cdc42 ...... 92 Figure 4. The effect of GM130 on Cdc42 is dependent on RasGRF ...... 94 Figure 5. The GM130-RasGRF complex is regulated by serum ...... 96 Figure 6. GM130 depletion increases Ras activity ...... 98 Figure 7. Dysregulation of GM130 in human colon cancer ...... 99
Suppl. Figure 1. Effect of GM130 on Cdc42 activity and on polarity proteins ...... 101 Suppl. Figure 2. GM130 depletion does not affect Golgi integrity ...... 104 Suppl. Figure 3. GM130 depletion does not affect trafficking, Golgi structure or microtubule regrowth ...... 106 Suppl. Figure 4. Effect of ARHGEF 9, 11 &12 on Cdc42 activity, cell migration and Golgi orientation ...... 108 Suppl. Figure 5. TUBA is not involved in mediating the GM130 effect on Cdc42 ...... 110 Suppl. Figure 6. Characterizing the GM130-RasGRF complex ...... 112 Suppl. Figure 7. Effect of GM130 depletion of ERK activation ...... 114 Suppl. Figure 8. Effect of GM130 on PC12 cell differentiation ...... 115 Suppl. Figure 9. Downregulation of GM130 in colorectal cancer...... 117 Additional results ...... 118
Table of Contents - II
Part 2 - Regulation of spatial Cdc42 signaling by GM130 and its effects on cell migration, invasion and polarity ...... 119 GM130 expression in breast cancer ...... 119 Golgi morphology in breast cancer cells ...... 119 GM130 depletion does not affect proliferation, apoptosis or adhesion . 120 Effect of GM130 depletion on cell motility ...... 120 Table 1 - Main characteristics of the cell lines analyzed ...... 122 Figures ...... 123 Figure 1 ...... 123 Figure 2 ...... 124 Figure 3 ...... 126 Figure 4 ...... 128 Figure 5 ...... 130
References ...... 132
Materials and Methods ...... 136 Cell Culture and transfection ...... 136 Plasmids ...... 137 Pull-down experiments ...... 137 ERK1/2 activation assays ...... 137 PC12 differentiation ...... 138 Antibodies and immunofluorescent labels ...... 138 Microtubule nucleation assay ...... 139 Caco2 Cysts ...... 139 Confocal microscopy image analysis and FRET ...... 140 GEF screening ...... 141 FRET of directional migrating cells ...... 141 Video acquisition of VSVG-GFP vesicles ...... 142 Golgi orientation, cell migration and aPKC recruitment assay ...... 142 Wound Assays ...... 142 Random Migration ...... 143 Coimmunoprecipitations ...... 143 ER-Golgi trafficking ...... 144 RT-PCR ...... 144 Immunohistochemistry ...... 145 Adhesion assay ...... 146 Apoptosis assay ...... 146 Proliferation assay ...... 147 Invasion assay ...... 147 Statistical analysis ...... 148 References ...... 149
Table of Contents - III
Discussion ...... 152 Cdc42 signaling from endomembranes ...... 152 Golgi Orientation ...... 155 RasGRF regulation by GM130 and local regulation of Cdc42 ...... 156 Polarity and cancer ...... 157 Initiation of tumors by polarity proteins ...... 158 Golgi and tumor initiation...... 162 Promotion of tumor growth by polarity proteins ...... 163 Golgi and tumor progression ...... 165 References ...... 167
Acknowledgements ...... 173
Table of Contents - IV
Abstract The Golgi apparatus is linked to the establishment of cell polarity, but the mechanism that allows the organelle to control cell polarity still remains unknown. Research in the area focused primarily on signaling from the plasma membrane to understand how polarity is established, and the small GTPase Cdc42 was identified as a main regulator of this process. Interestingly Cdc42 is mainly localized at the Golgi, thus we investigated the possibility that the Golgi regulates Cdc42 activity and by this mechanism it regulates polarity. We identified a GM130–RasGRF complex as a regulator of Cdc42 at the Golgi. Silencing GM130 results in RasGRF-dependent inhibition of the Golgi pool of Cdc42, but does not affect Cdc42 at the cell surface. Therefore, this is a specific mechanism to control a spatially restricted pool of Cdc42. Furthermore, active Cdc42 at the Golgi is important to sustain asymmetric front–rear Cdc42- GTP distribution in directionally migrating cells. We propose that the Golgi delivers active Cdc42 to the leading edge of migrating cells, thereby establishing asymmetry in Cdc42 activation at the plasma membrane and promoting directional migration. Two further observations supported a possible role for GM130 in cancer. First, concurrent to Cdc42 inhibition, silencing GM130 also results in RasGRF-dependent Ras-ERK pathway activation. Second, depletion of GM130 is sufficient to induce E-cadherin downregulation, indicative of a loss in cell polarity. We found that GM130 expression is frequently lost in colorectal and breast cancer patients. Whether the loss of GM130 solely affects polarity, or whether it affects other processes relevant for tumorigenesis remains unclear. To further investigate the role of GM130 in cancer, we analyzed the effect of GM130 depletion in a panel of breast cancer cells lines looking at processes linked to tumor progression such as survival, proliferation, adhesion, migration and invasion. We show that depletion of GM130 does not drastically affect survival, proliferation and adhesion. However, GM130 depleted cells show increased cellular velocity and increased invasiveness though matrigel, therefore supporting the view that alterations of polarity contribute to tumor progression. These findings establish a previously unrecognized role for a GM130–RasGRF–Cdc42 connection in regulating polarity and tumorigenesis.
Abstract - 1
Zusammenfassung Der Golgi-Apparat spielt eine wichtige Rolle in der Etablierung der Zellpolarität, aber die mechanistische Grundlage dieser Beziehung ist relativ unbekannt. Der Grund hierfür liegt darin dass der Hauptanteil der Forschung in diesem Feld hauptsächlich auf Signalisierung von der Plasmamembran fokussiert hat. Die kleine GTPase Cdc42 wurde als ein Hauptregulator der Zellpolarisierung identifiziert. Interessanterweise, haben frühere Arbeiten gezeigt dass Cdc42 am Golgi Apparat lokalisiert. Ob dieser Pool von Cdc42 aktiv ist, ob und wie dessen Aktivität reguliert werden und ob dieser Pool für Zellpolarität wichtig ist, sind Fragen die bisher unbeantwortet blieben. Die Erforschung dieses Cdc42 Pools könnte auch zu einem besseren Verständnis der Rolle des Golgi-Apparates in der Zellpolarität beitragen. In der vorgestellten Arbeit haben wir ein Golgimatrixoprotein namens GM130 untersucht. Wir haben einen bis dahin unbekannten GM130-RasGRF Komplex entdeckt und diesen als Regulator der Cdc42 Aktivität am Golgi identifiziert. Der Knockdown des GM130 inhibiert den Cdc42 Pool am Golgi, hat aber keinen Einfluss auf die Aktivität des Cdc42 an der Plasmamembran. Daher ist der GM130-RasGRF Komplex ein spezifischer Regulator des Golgi- pools des Cdc42 und bietet somit eine Möglichkeit die Funktionalität dieses räumlich gentrennten Pools zu untersuchen. In einer Reihe von Experimenten konnten wir Hinweise dafür gewinnen dass die Cdc42 Aktivität am Golgi wichtig für die Zellpolarität ist. Einerseits hemmt der Cdc42-knockdown die gerichtete Zellmigration und die Etablierung der Zellpolarität in dreidimensionaler Matrix. Des Weiteren, konnten wir zeigen dass GM130 für die Entstehung einer asymmetrischen Verteilung des GTP-geladenen Cdc42 in migrierenden Zellen wichtig ist. Zwei weitere Beobachtungen haben unser Augenmerk auf eine potenzielle Bedeutung von GM130 in Tumoren gelenkt. Einerseits konnten wir beobachten dass die Depletion von GM130 auch zu einer RasGRF-abhängige Aktivierung des Ras-ERK Signalweges führt, welche gleichzeitig zur Cdc42-Hemmung stattfindet. Andererseits, haben wir beobachtet dass der Knockdown von GM130 ausreicht die Expression des E-Cadherins Herunterzuregulieren. Daher haben wir die Expression von GM130 auch in Darm- und Brustkrebs-Patienten untersucht und stellten fest dass dessen Expression deutlich geringer im Tumorgewebe war, verglichen mit gesundem Gewebe. Ob der Verlust von GM130 ausschließlich Polarität betrifft, oder ob es auch für die Tumorgenese relevant ist, bleibt unklar. Zur weiteren Untersuchung der Rolle von GM130 in Krebs, untersuchten wir die Wirkung von GM130 knockdown in einer
Zusammenfassung - 2
Reihe von Brustkrebs-Zelllinien. Wir analysierten Prozesse die relevant für Tumorprogression sind, wie etwa das Überleben, die Proliferation, die Adhäsion, die Zellmigration und -Invasion. Wir zeigen, dass GM130 keine wichtige Rolle für das Überleben, die Proliferation und Adhäsion spielt. Allerdings führt der Verlust des GM130 dazu dass Zellen schneller wandern und dass dessen Invasivität erhöht wird. Daher vertreten wir die Ansicht, dass Veränderungen der Polarität zur Tumorprogression beitragen. Diese Ergebnisse zeigen eine bisher nicht bekannte Rolle für eine GM130-RasGRF-Cdc42- Verbindung bei der Regulierung der Polarität und der Tumorgenese.
Zusammenfassung - 3
Introduction Cell polarity Cell polarity is the process that aims at generating asymmetry into a cell in order to produce and maintain functionally specialized domains. By compartmentalizing signaling, these domains control many cellular processes such as proliferation, migration and differentiation. In multicellular organisms, cell polarity is necessary for the correct development of the organism, as it shapes the three-dimensional organization of tissues and, ultimately, the entire organism. Different cell types exhibit different types of polarity, according to the function they have in the organism. Neuronal cells establish an axon and several dendrites necessary to transmit signals to the neighbor cells. Immune cells migrate following gradients, thus establishing a frontal leading edge and a retractile rear, then, when they recognize a danger for the body, they form the so called immunological synapse to exert their function of immune surveillance, thus changing their polarity. Stem cells need to divide asymmetrically in order to maintain homeostasis, therefore they polarize during cell division to give rise to two different daughter cells. Epithelia act as barriers between different compartments and epithelial cells have to function as selective filters for nutrients and signaling molecules. To do so, they establish an apical membrane and a baso-lateral membrane, divided by structures called Tight Junctions (TJs) that form physical barriers between neighbor cells. All these different forms of polarity are controlled by the same set of proteins that are distributed in three highly conserved 1 complexes: Par, Crumbs and Scribble. The Par complex is composed by Par3, Par6 aPKC and Cdc42. The Crumbs complex is composed by Crumbs, PALS1 and PATJ. The Scribble complex is composed by Scribble, DLG and LGL (a complete list is shown below in Table 1). Those complexes are interacting with each other in agonistic and antagonistic ways. In epithelial cells, they control via mutual exclusion their subcellular localization: Crumbs is apical, Par is located in the sub-apical region at the tight junctions (TJ) and Scribble is baso-lateral. Mislocalization of one protein belonging to any of these complexes will most probably affect also the other two polarity complexes. Polarity is fundamental for the establishment and maintenance of epithelia. Tight Junctions are critical to the function of epithelia and their formation is coordinated by the Par and Crumbs complexes. Par3, Par6 and Crb3 are among the first proteins clustering at the plasma membrane together with Cadherins 2-4. Those clusters, called primordial adhesions, will establish connections with the actin cytoskeleton 5 and subsequently evolve to form Tight Junctions (that define the border between apical and baso-lateral membrane) and Adherent Junctions, that will link the lateral
Introduction – Cell Polarity - 6 membranes of neighbor cells. Par and Crumbs proteins act as scaffolds to recruit all the components of TJs and if the recruitment of Par and Crumbs proteins is disturbed, TJs as well as epithelia do not form. Polarity is also required for epithelial homeostasis, as polarity proteins control signaling processes that shape the collective response of epithelia to external stimuli, such as the need to proliferate in response to an injury and to stop proliferation at the right moment. Polarity proteins control all these processes and, therefore, play a pivotal role in epithelial homeostasis. Since epithelia are the tissue of origin of the majority of cancers, the processes that regulate their behavior are of clinical interest. Loss of polarity was recently proposed to be causal to cancer, but the mechanism behind this hypothesis is still not completely understood. One possible link between cancer and epithelia lies in the way epithelial homeostasis is maintained. Epithelia in vivo retain a certain stemness that allows them to renew 6. In order to maintain a stem cell population, epithelial stem cells need to undergo asymmetric cell division, thus they need to differentially segregate cell fate determinants (such as the Drosophila Numb and Prospero). Polarity proteins are needed to correctly segregate these proteins 7. Therefore, loss of polarity could impair the ability of stem cells to divide asymmetrically and this was shown to cause cancer in Drosophila 8. Proofs that polarity controls cell division also in mammals and that alterations of this regulation could cause cancer are still missing, but recently the polarity related protein PAR3L was implicated in asymmetrical division and epithelial homeostasis in a mouse model, thus giving polarity proteins a role in asymmetric cell division also in mammals 9.
Introduction – Cell Polarity - 7
Complex Drosophila melanogaster Caenorhabtidis elegans Mammals Pard6A DmPar6 Par6 Pard6B Pard6G Par Pard3A Bazooka Par3 Pard3B PRKCζ DmaPKC PKC3 PRKCι Crb1 Crb2 Crb3 Crb1 Crb MPP1 Eat-20 MPP2 MPP3 Crumbs MPP4 TAG117 MPP5 (Pals1) Stardust C50F2.8 MPP6 (Pals2) Y55B1BR.4 MPP7 INADL (PATJ) Dpatj MPZ-1 MPDZ (MUPP1) Scrib LET-413 Scrib DLG1 DLG2 Dlg-1 Dlg DLG3 Scrib F44D12.1 DLG4 DLG5 LLGL1 Dlgl LLGL2 Table 1 - Nomenclature of polarity proteins in Drosophila, C.elegans and mammals (adapted from Assémat et al. 10)
Par complex The first polarity proteins to be discovered were the components of the Par complex. They were identified by Kemphues et al. in 1988 11 in a screening done in C.elegans embryos. After fertilization, the cells divide asymmetrically, giving rise to daughter cells which have different division times, different size and that ultimately will have different fates. Deletion of a group of 6 genes was found to disrupt this asymmetry, resulting in embryonic death. Those genes were called Par (for Partition defective). Par proteins localize asymmetrically within the embryo, with Par1 and 2 at the posterior cortex, Par3 and 6 at the anterior cortex and Par4 and 5 diffused in the cytoplasm. Later, another protein called PKC3 (atypical protein kinase C, aPKC) was included in the Par complex. PKC3 was found to directly interact with Par3, this interaction playing a pivotal role in the establishment of polarity in C. elegans embryos 12.
Introduction – Cell Polarity - 8
Homologs of the Par proteins were lately described also in Drosophila and in mammals. It is now evident that the complex Par6-Par3-aPKC is well conserved among the vast majority of the animal kingdom 1. Par6 Mammals have three Par6 homologues: Par6A (also called Par6C), Par6B and Par6D (also called Par6G). These proteins share similar structure, with 2 conserved domains: a CRIB (Cdc42-Rac Interaction Binding) domain that binds preferentially to active Cdc42 13, 14, and one PDZ (PSD-95–Discs Large–zona occludens-1) domain that binds to Lgl2, Par3 and other proteins 14, 15. Par6 is one of the first polarity proteins to be recruited to nascent TJs in response to locally activated Cdc42 or Rac. Once Par6 is at TJs, it recruits the kinase aPKC. This interaction is fundamental because aPKC activity will determine the localization of Par3 and Lgl2 (the latter belongs to the Scribble complex). Those two polarity proteins compete for the same binding site on Par6 and only when Lgl2 gets phosphorylated by aPKC, it loses its specificity for Par6, thus allowing the binding between Par6 and Par3 4. Pals1, a component of the Crumbs complex, is another binding partner of Par6, and the two proteins mutually regulate their localization to TJs 15, 16 Comparison of the Par6 isoforms revealed that all Par6 interact with the same affinity with aPKC, Par3 and Lgl. However, Par6A does not interact with Pals1, whereas Par6B does 16. Gao et al. observed that overexpression of Par6A does not interfere with polarity, whereas Par6B overexpression destroyed TJs and proposed that the exceeding Par6B disrupts polarity by sequestering Pals1 to locations other than TJs 16. In this respect, it is interesting to note that Par6B is often overexpressed in tumors, while Par6A is not 17, 18. It could be speculated that overexpression of Par6B confers the tumor an advantage that Par6A overexpression doesn’t offer and this selective advantage could be the loss of polarity mediated by Par6B. Par3 Mammals have two Par3 genes, Par3A and Par3B. Par3 proteins have three PDZ domains and, as it is the case for Par6, they function as scaffolds. Par3 proteins bind to transmembrane proteins localized at the TJs, called Junctional Adhesion Molecules (JAMs). JAMs are recruited at newly formed cell-cell contacts before Par3; thus, they might be the anchor for Par3 localization 19. Given that Par3 binds to both Par6 and aPKC 20, JAM dependent localization of Par3 could contribute to correctly localize the whole Par complex by recruiting Par3 12. In addition to aPKC, Par6 and JAMs, Par3 binds to several other proteins, often implicated in the
Introduction – Cell Polarity - 9 control of processes other than cell polarity. One of its most important partners is the Rac1 specific GEF Tiam1 2, 13, 21. The functional significance of this interaction has been object of controversies. In an epithelial polarity model (MDCK cells), Par3 knockdown was reported to impair TJ formation because of an increased Rac1 activation. Par3 would therefore serve as a localized inhibitor of Tiam1 21. However, Mertens et al. 2 showed that Tiam1 mediated activation of Rac1 is necessary for TJ formation in keratinocytes. In this latter model, Tiam1 was suggested to act upstream of Par3, and Rac1 activation would promote the recruitment of the Par complex to TJ. Cells KO for Tiam1 show strong impairment in TJ assembly, underscoring the relevance of Rac signaling for TJ formation. Finally, Xue et al used fluorescence resonance energy transfer (FRET) microscopy to study the spatio-temporal dynamics of Rac1 on TJ 22. In cells depleted of Par3, Rac1 resulted to be overall more active, but its localization was mainly cytosolic, whereas in the presence of Par3 the activation was restricted to cell-cell contacts 22. This observation shows that spatial restriction of signaling can be more important than the magnitude of the signal itself. In a neuronal polarity model, the binding between Par3 and Tiam1 was shown to be dependent on Cdc42 activation. When Cdc42 is activated, it recruits Par6, which then will bind to Par3 and aPKC. Par3 will subsequently bind to Tiam1, leading to localized activation of Rac1. Failure in localized activation of Rac1 will impair axonal growth 13. It is generally accepted that Tiam1 functions downstream of Par3, however, it was shown that Tiam1 can be recruited to TJs independently on the Par complex and thus, it is possible that Tiam1 recruitment to TJs locally activates Rac that will then recruit the Par complex there 23. In this scenario, the Par complex would sustain its own recruitment to TJ in a positive feedback mediated by Tiam1. Among the numerous binding partners of Par3, worth of notice is the recently identified ASPP2 24, 25. ASPP2 is a pro apoptotic protein that binds to p53 and promotes the transcription of several pro apoptotic genes 26. Par3 interacts with ASPP2 at the level of TJs and this interaction is necessary for maintenance of TJ. Depletion of ASPP2 results in mislocalization of Par3 and loss of apico-basal polarity 24, 25. Polarity proteins have the function to shape cell processes according to the needs imposed by the extracellular environment and it is interesting to note how processes that were previously not connected at all often converge on polarity proteins. The interaction between Par3 and ASPP2 opens the exciting possibility that the Par complex could regulate p53 function. Par3 is often downregulated in cancer and
Introduction – Cell Polarity - 10 placing p53 downstream of Par3 could explain how loss of Par3 provides an advantage for tumor cells. aPKC aPKC is the only protein with a kinase activity belonging to the Par complex, thus it is the only protein that actively transmits signals from the Par complex to downstream effectors. Mammals possess two aPKC genes, aPKCλ/ι and aPKCζ. Those genes encode two proteins of about 75 kDa and function as kinases. Unlike the other PKCs, aPKCλ/ι and aPKCζ are not activated by Ca2+, by DAG or PE. aPKC is implicated in the control of several cellular processes. In the context of polarity, aPKC regulates the localization of Par3 and Lgl2. These two proteins are phosphorylated by the kinase and the phosphorylation status of Par3 and Lgl2 will determine which of the two proteins will interact with Par6 4, 27. Once Lgl2 is phosphorylated, it loses its affinity toward Par6, thus allowing the binding between Par6 and Par3. In addition, phosphorylation of Lgl2 confines the protein to the baso-lateral membrane, and this is another critical event for the correct establishment of epithelial polarity 27. In front-rear polarity, the same mechanism is used to recruit Par3 to the leading edge and to restrict Lgl2 away from the par complex. In addition, during cell migration aPKC controls endocytosis of integrins via the protein Numb 28. Nishimura et al. reported that aPKC dependent phosphorylation of Numb regulates the localization of Numb. When Numb becomes phosphorylated, it loses its affinity for membranes. This in turn reduces the endocytic rate of integrins, which finally results in impaired migration 28. Other functions of aPKC are not due to its kinase activity, but to its function as scaffold. aPKC contributes to the polarization of the exocyst by interacting with the protein Kibra, that in turn recruits the exocyst to the leading edge of migrating cells 29. The binding between aPKC and Kibra was proven to be important for correct localization of both aPKC and the exocyst and perturbations in such interaction disturb cell migration. Finally, aPKC interacts with the E3 ubiquitin ligase Smurf1. Smurf1 selectively leads to degradation of RhoA and this event is key for correct cell migration. In fact, aPKC localizes Smurf1 at the leading edge of migrating cells, causing local degradation of RhoA and preventing the formation of stress fibers that would alter the actin cytoskeleton and impair migration 30.
Introduction – Cell Polarity - 11
Substrate of aPKC Function of phosphorylation Citation Par3 Unknown 4, 20 Lgl2 P-Lgl2 loses affinity for Par6 4, 27, 31 GSK3β Inactivation 32 Loss of membrane localization Numb (reduction in integrin 28 endocytosis) Loss of membrane localization Par1 (MARK) 33 (inactivation) JAM-A Targeting to TJ 34 p21 Inactivation 35 RhoGDI Release of Rac1 36 Table 2 – List of some of the substrates of aPKC with a role in polarity Par complex in cell migration and invasion The Par complex was the first polarity complex to be linked to cell migration. Etienne- Manneville et al. 37, showed that Cdc42-GTP is recruited to the leading edge in a dynein independent manner. Active Cdc42 in turn recruits Par6 and aPKC to the leading edge. The Cdc42-Par6-aPKC complex is necessary to reorient the centrosome and the Golgi Apparatus towards the leading edge (LE). Reorientation of Golgi and centrosome leads to polarization of secretion towards the LE and this is a key event to sustain directed movement of cells. Vesicles traffic from the Trans Golgi Network (TGN) to the LE on microtubules, supplying the plasma membrane with lipids and proteins necessary for migration. The Par complex is necessary for this process because it promotes the stabilization of microtubules pointing to the LE with several mechanisms working in parallel. First, APC, a protein interacting with the plus end of microtubules, is stabilized at the LE. Second, DLG localizes to the LE in an aPKC dependent manner. Third, Par3 together with Tiam1 can interact directly with microtubules and stabilize them. APC stabilization is dependent on Cdc42. Cdc42 is activated at the leading edge, probably by integrins and Src signaling. Active Cdc42 then recruits Par6, Par3 and aPKC, building the Par complex. The interaction between Cdc42 and Par6 activates aPKC, which will in turn phosphorylate and inactivate GSK3β 32. Inactive GSK3β will not be able to promote the degradation of APC, resulting finally in the local stabilization of APC at the leading edge. APC contains an EB1 domain that mediates its interaction with the plus ends of microtubules. DLG is another microtubules binding protein that is also recruited to the LE in a manner dependent on aPKC activity. DLG interacts with APC and this interaction is necessary to stabilize microtubules. Perturbing the Par complex affects the localization of both APC and DLG, but a
Introduction – Cell Polarity - 12 constitutively active GSK3β, that impairs recruitment of APC, does not affect DLG recruitment to the leading edge, meaning that APC and DLG are recruited via two different mechanisms 38. Par3 localizes to the leading edge via its binding to Par6 and there, together with Tiam1, it stabilizes microtubules 39. It was shown that Par3 interacts also with the motor protein dynein, the interaction being necessary for the correct orientation of Golgi and centrosome 40. It could be proposed that by acting on microtubules, dynein will generate a pulling force that will lead to reorientation of Golgi and centrosome. Depletion of Par3 results in impaired migration 40 and impaired ability of the cells to follow a chemoattractant 39. On the contrary, invasion through a 3D environment was enhanced in the absence of Par3 41. This was however not dependent on the motility of cells, but on increased secretion of matrix metalloproteases (MMPs) that contributes to cell invasion by degrading the extracellular matrix (ECM) and thus allowing the cells to go through the ECM 41. In addition to controlling vesicle trafficking, the Par complex controls also endocytic processes via aPKC. As previously discussed, aPKC phosphorylates Numb, a protein normally localized to clathrin coated pits (CCPs), that is necessary for endocytic recycling of β1 and β3 integrins 28. Phosphorylation of Numb reduces integrins endocytosis by displacing Numb from the plasma membrane. During migration, aPKC is activated at the leading edge and, thus, Numb will be selectively inactivated at the leading edge, but it will still function in the rest of the plasma membrane. This will lead to accumulation of integrins at the leading edge and this mechanism will contribute to maintenance of directional migration 28. Par complex in cancer Loss of polarity is proposed to be cause of cancer, but no clear mechanism has been elucidated to explain how this should work. The role of polarity proteins in tumor progression is clearer and polarity proteins are often classified as oncogenes or tumor suppressors 22, 41. All Par complex proteins have been described to be altered in several kinds of cancers. They are somehow unique among the polarity proteins because, contrary to Scribble and Crumbs proteins, Par proteins can act as tumor suppressor or as oncogenes, depending on the context. Even though the Par complex was first described in Drosophila because of its role in asymmetric division, whether it is important in asymmetric division also in mammals is still not clear. The role of Par3 in asymmetric cell division was assessed using the mammary gland regeneration model.
Introduction – Cell Polarity - 13
To assess the role of polarity in cancer, an in vivo model is needed and a model that is often used is the mammary gland regeneration system. This model is based on the ability of the mammary gland to completely regenerate, following the transplant of mammary cells (MECs) into a cleared fat pad 42. MECs can be genetically engineered and then reimplanted, thus making it possible to evaluate the contribution of a specific protein or of a mutation in a developmental process (the growth of the organ) and in cancer. The mammary gland is composed by bilayered epithelial ducts. There is a luminal epithelial layer (cells expressing cytokeratin 8 and cytokeration 18) surrounded by a contractile myoepithelial layer (cells expressing cytokeratin 14 and smooth muscle actin). Even though there are no specific markers for mammary stem cells 43, the terminal parts of the ducts, termed terminal end buds (TEB), were identified as the niche of such stem cells 44. Those regions are normally rich in cells double positive for K8 and K14. Par3 depletion resulted in complete failure in the regrowth of the organ 45. However, this was not dependent on loss of stem cells, as the TEB of Par3 knockdown organs were bigger than normal and contained more double positive cells 45. Instead, the polarity related protein Par3L was found to be important in asymmetric cell division and stem cell maintenance in breast morphogenesis 9. Par3L does not interact with aPKC or Par6, but it interacts with and inhibits LKB1 (homologous to Drosophila Par4) 9. LKB1 is a tumor suppressor in mammals 46 and its deletion results in development of the cancer- prone Peutz-Jeghers syndrome (PJS). Interestingly, LKB1 is frequently targeted for inactivation in several cancers 46. LKB1 activates AMPK and TSC2, thus leading to inactivation of the mTor pathway, that will make the cell cycle progress slower. Another recent study identified a link between LKB1 and YAP/TAZ signaling. In this study, Mohseni et al. showed that mutations in LKB1 resulted in hyperactivation of YAP/TAZ and subsequent translocation of these two transcription factors to the nucleus 47. LKB1 phosphorylates the Par1 homologues MARK1, 3 and 4. MARK will then phosphorylate MST1/2, then LATS1/2, and this will finally result in YAP phosphorylation (meaning inactivation). In this optic, it seems plausible that Par3L plays a role in cancer initiation via inactivation of LKB1 that will result in increased YAP translocation to the nucleus. However, this speculation needs to be verified experimentally. Interestingly, Scribble forms a complex with LKB1, MARK, MST1/2 and LATS1/2 and mislocalization of Scribble also results in alterations in YAP phosphorylation 47. Crosstalk between Scribble and Par proteins could therefore be important to regulate YAP/TAZ activity and this is of special
Introduction – Cell Polarity - 14 interest because YAP/TAZ nuclear translocation was shown to be sufficient to generate epithelial stem cells in breast cancer 48 Par3 has been extensively studied in different cancer models 22, 41, 49. Depending on the context, Par3 can act as tumor suppressor or as an oncogene. In a skin cancer model, Par3 knockout mice developed significantly less papillomas in response to chemically induced Ras transformation. Par3 depletion resulted in increased apoptosis and reduced proliferation that was explained by a defect in aPKC-mediated ERK activation. However, Par3 depleted mice developed more keratoacanthomas than wild type mice due to abnormal ERK signaling. In fact, Par3 depleted cells had consistently more P-Raf in a vesicular compartment instead that at the membranes. Low levels of Par3 were also observed in keratoacanthomas developing in wt mice, suggesting that Par3 depletion is a mechanism common to keratoachantomas 49. Raf signaling appears to be critical in the development of keratoachantomas. It was observed that several chemotherapeutic agents functioning by inhibiting constitutively active B-Raf gave rise to keratoachantomas in a significant number of patients because of a paradoxical activation of Raf in cells with a wild type Raf 50. In breast cancer, Par3 behaves as a tumor suppressor. In the presence of oncogenic signaling, Par3 depletion causes faster growth of the primary tumor and higher incidence of metastasis. McCaffrey et al. showed that Par3 depletion together with constitutively active Ras or NICD results in a delocalization of P-aPKC, which in turn results in altered signaling, such as hyperphosphorylation of Stat3 that leads to increased secretion of the matrix metalloprotease 9 (MMP9). Silencing MMP9 or inhibiting Stat3 signaling completely abolished the increased invasiveness of Par3 depleted cells both in vitro and in vivo 41. Xue et al. proposed an alternative mechanism that could lead to increased invasiveness of Par3 depleted cells. Par3 depletion leads to hyperactivation of Rac via mislocalization of Tiam1 and this results in decreased stability of E-cadherin at the cell-cell contact sites. Therefore, Par3 depleted cells are less cohesive and more prone to invade the surrounding tissue 22. Common to both studies is the observation that Par3 is altered (lost or mislocalized) in human breast cancers 22, 41. Furthermore, both studies concluded that Par3 depleted cells become more invasive without undergoing EMT 22, 41. Par3 depletion increases cell proliferation 22, 45, but at the same time it also induces apoptosis 45, 49. Expression of an oncogenic gene can overcome the apoptotic phenotype induced by loss of Par3, thereby unmasking the pro-proliferative effect of a loss of Par3.
Introduction – Cell Polarity - 15
Even if Par3 is often downregulated in tumors, it is not clear what mechanism leads to loss of Par3 expression. There are some evidences that Par3 is a target of EMT factors. Par3 was shown to be downregulated upon TGFβ stimulation via upregulation of miRNA-491-5p. TGFβ, a potent EMT inducer 51, stimulates the release of miRNA-491-5p 52, 53, that will in turn silence Par3 expression . Early in EMT, TJ are disassembled and polarity is lost. Therefore, it is expected that some TJ related proteins are affected by EMT inducers. However, Par3 depletion alone does not result in EMT induction, matching the in vivo observations that Par3 depletion promotes invasion in the absence of EMT 22, 41. On the other hand, Par3 depletion potentiates ad its overexpression decreases the ability of TGFβ to induce EMT 52. TGFβ influences also Par6 signaling 54. Par6 colocalizes and interacts with the TGFβ receptor I (TβRI) at TJs 54. Both TβRI and TβRII can phosphorylate Par6 on a highly conserved Serine (S345). This phosphorylation is necessary for TGFβ mediated disruption of TJs, as it is needed to recruit the E3 ligase Smurf that will target RhoA for degradation 54. Strikingly, overexpression of an unphosphorylatable mutant of Par6 strongly inhibited lung metastasis in breast cancer model and partially restored epithelial characteristics in mesenchymal cells in vitro 17. Par6B is often amplified in breast cancer, whereas Par6A and G are not frequently altered 17, 18. Overexpression of Par6B, but not of Par6A, was proposed to affect cell polarity, therefore it could be speculated that polarity loss is needed to promote cancer However other studies failed to see defects in polarity upon overexpression of either Par6A or B 18 and furthermore, Par6A is sometimes overexpressed in lung cancer, implying that another mechanism should exist downstream of Par6 to promote cancer 18, 55. Interestingly, overexpression of Par6A or B wt results in increased cell proliferation 17, 18. This effect requires binding to both Cdc42 and aPKC and is mediated by increased and sustained ERK activation 18. The interaction between Par6A and PKCι was shown to be important for Rac driven transformation of non-small cell lung cancer (NSCLC) 55. An inhibitor that interfers with the binding between Par6A and aPKC (aurothiomalate) blocks PKCι-dependent signaling to Rac1 and inhibits transformed growth of NSCLC cells 56. Knockdown of either Par6A or PKCι results in less active Rac1, which in turn will result in less active ERK and less production of MMP10. The expression of MMP10 downstream of PKCι happens also in an in vivo mouse model and correlates with poor survival 55. Of the two aPKC, PKCι is the most commonly altered in cancer 57. PKCι is an oncogene for pancreatic cancer 58, lung cancer 55, 59 ovarian cancer 60, and many other types of cancer. It was also shown that PKCι activation is a key event downstream of Ras induced oncogenesis
Introduction – Cell Polarity - 16 in colon 61 and in lung 62. The signaling downstream of PKCι which is of crucial importance for cancer progression appears to be the same in all cancer types. PKCι, or better, the interaction between Par6 and PKCι activates Rac1. Rac1 signals then to MEK and ERK via its effector PAK1. ERK signaling will in the end drive transformation 63. Interestingly, the Par complex activates Rac via recruitment of the Rac GEF Ect2 63. In MDCK, Ect2 was reported to interact with the Par complex components and to activate aPKC 64. Ect2 was however dispensable for TJ formation and apico-basal polarity 64. The gene coding for Ect2 is on chromosome 3q26, in the same region of the PKCι gene PRKCI and, interestingly, this region is often amplified in cancer 57 63. Not only PKCι is downstream of Ras; there is evidence that PKCι could also play a role downstream of PI3K, another well known driver of cancer. In breast cancer cell lines, mutations in PI3K correlate with PKCι activation 65. Knockdown of PKCι results in decreased proliferation and increased senescence in PI3K transformed cells, but not in cells where PI3K is not mutated 65. Therefore, aPKC could play a role downstream of PI3K in mediating the balance between proliferation or senescence. A substrate of aPKC is p21, a regulator of the cell cycle and inducer of senescence 65. PKCι phosphorylates and inactivates p21. Thus, silencing of aPKC could result in more active p21 that will induce senescence 65.
Crumbs complex The mammalian genome encodes three Crumbs isoforms (Crb1-3), which are single-pass transmembrane proteins, with an extracellular domain rich in EGF-repeats and a cytosolic tail that interacts with other components of the Crumbs complex. The link between epithelial polarity and Crb was first described in Drosophila epithelia, where Crb was exclusively confined to the apical membranes 66. Mutations of this protein caused drastic defects in the epithelium and were embryonically lethal. Conversely, overexpression of Crb was sufficient to confer apical characteristics to all the plasma membrane of Drosophila epithelial cells67. Even more strikingly, the cytoplasmic tail of Crb was shown to be the mediator of this effect 67. Two more proteins were found to have functions similar to Crb: Stardust 68 and Dpatj (also called Disc Lost) 69. Further characterization of these two proteins showed that they form a complex with Crb and are required to establish epithelial polarity. CRB Humans have 3 Crbs, named Crb1-3 and they differ by tissue distribution. Crb1 is expressed in brain, cornea and retina and mutations in this protein are associated with degenerative pathologies of the retina 70. Crb2 is more widely expressed 71. Also this protein plays a role in
Introduction – Cell Polarity - 17 retinal development, as mutations or depletions of Crb2 are associated with retinal degeneration 71, 72. Both Crb1 and Crb2 have a large extracellular domain with several EGF- like domains and laminin repeats, a single transmembrane domain and a short 37 amino acid intracellular C-terminus containing one FERM (4.1, ezrin, radixin, moesin) and one PDZ protein-binding motif (ending with the aminoacids ERLI) 73. Crb3, instead, does not possess a large extracellular domain. However, its cytosolic tail is strongly conserved and it binds Pals1 (protein associated with Lin-7) and PATJ (Pals1 associated tight junction), the mammalian orthologues of Stardust and Dpatj 74. In addition to the FERM and the PDZ/ERLI domain, Crb3 has an SH3 domain 75. Crb3 is widely expressed in all epithelial tissues 75 and it localizes apically to the TJs 75, 76. Overexpression of Crb3 results in expansion of the apical membrane and delayed assembly of TJs 75, 76. Furthermore, MDCK cells overexpressing Crb3 were unable to correctly form cysts when growing in a 3D matrix 76, meaning that Crb3 overexpression disturbs apico-basal polarity. This could be due to the fact that Crb3 overexpression leads to uncontrolled expansion of the apical membrane, at the expenses of the baso-lateral membrane that does not form. The effect of Crb3 on TJ and apico-basal polarity was dependent on its ERLI domain. There are two proteins known to bind to this domain: Pals1 76 and Par6 75. However, it is still not clear which of these two proteins plays a major role downstream of Crb3. Par6 also interacts directly with Pals1 15. Hurd et al. showed that Crb3 can control Par6 localization in a Pals1 dependent manner 15. Thus, Crb3 could function via recruiting the Par complex to TJs. Crb3 was also shown to recruit the Par complex to cilia, where Crb3 and the Par protein work together in the process of ciliogenesis 77. A splice variant of Crb3 was described to localize to cilia and at the spindle poles during mitosis 78. This variant of Crb3 has a C-terminal sequence ending with CLPI (CRB3-CLP) instead of the highly conserved ERLI domain. Crb3-CLP does not bind to Pals1 or to Par6 78. Its knockdown leads to both a loss of cilia and a multinuclear phenotype associated with centrosomal and spindle abnormalities. Importin β1 was found to be a specific interaction partner of Crb3-CLP responsible for these abnormalities 78. Pals1 Pals1 (protein associated with Lin-7) is the mammalian homolog of Drosophila’s Std. It is also known as MPP5 (membrane-associated palmitoylated protein 5) and belongs to the family of membrane-associated guanylate kinase (MAGUK) proteins. MAGUKs are scaffold proteins that contain PDZ, SH3 (Src homology 3), and guanylate kinase (GUK) domains. Pals1 also
Introduction – Cell Polarity - 18 contains two L27 domains: an L27C domain that binds mLin-7 and an L27N domain that binds to the PDZ domain of PATJ and is needed for localization of Pals1 to TJs 79. Pals1 therefore localizes to TJs via PATJ and serves as a bridge between PATJ and Crb3 79. Pals1 interacts with and stabilizes PATJ 80, 81. Loss of Pals1 leads to polarity defects, but it is not possible to conclude if these defects are caused by the depletion of Pals1 or by the concomitant reduction in the levels of PATJ 80. As previously discussed, Pals1 interacts with Par6 15, 16 and it appears that binding to Par6 and PATJ is mutually exclusive 82. PATJ PATJ (Pals1 associated tight junction) contains 10 PDZ domains in tandem and is a paralogue of MUPP1 (multi PDZ domain protein). PATJ is the orthologue of the Drosophila protein Dpatj (or Disc Lost) 83 and it maintains the same structure of Disc Lost 81. PATJ and MUPP1 localize to TJs 83, 84 and their localization was shown to be dependent on binding to other TJ proteins such as JAMs and ZO-3 81, 83. Even though MUPP1 and PATJ share most of their interaction partners, MUPP1 appears to be dispensable for polarity establishment, whereas PATJ is of crucial importance to recruit both the Crumbs complex and the Par complex to TJs 85. PATJ and, with lower affinity, MUPP1, bind to Par6 85. The binding of PATJ to Par6 seems to be important for Par6 localization at TJs and depletion of PATJ results in mislocalization of Par6 85. Interestingly, overexpression of a constitutively active Cdc42 rescued TJ formation in the absence of PATJ. However, TJs were not concentrated apically, but they were extended laterally 85. From these observation a model could be drawn where the Crumbs complex and the Par complex are recruited to TJs and there the Crumbs complex restricts the localization of the Par complex. PATJ could participate in the recruitment of the Par complex, but active Cdc42 is upstream of it, meaning that the Crumbs complex is not crucial for Par complex localization. Consisted with the above mentioned importance of Pals1 in epithelial polarity is the observation that Pals1 controls the stability of MUPP1 and PATJ 80, 81. MUPP1 competes with PATJ for the binding to Pals1 81 and binding to Pals1 increases the stability of MUPP1 and PATJ 80, 81. Therefore, when MUPP1 is downregulated, PATJ is stabilized and vice versa. Accordingly, downregulation of Pals1 will cause a decrease on protein level of both MUPP1 and PATJ 81. The close connection between these proteins hints that amplification or depletion of only one of these proteins, conditions encountered for example in cancer, will also affect the levels of the others, probably affecting cell polarity.
Introduction – Cell Polarity - 19
Crumbs complex in cell migration and invasion Despite its major role in establishment of apico-basal epithelial polarity, the role of the Crumbs complex in cell migration (i.e. front rear polarity) has not been yet deeply investigate. It was described that PATJ binds to Par3 86, but this binding could be indirect, via the PATJ to Par6 interaction 85. Depletion of PATJ results in mislocalization of Par3 and Par6, with subsequent defect in directed migration. Accordingly, depletion of MUPP1, which increases PATJ levels, resulted in increased Par3 at the leading edge 81. Depletion of Pals1 also resulted in migratory defect, but Crb3 was fully dispensable for the process 86. Most likely, the Crumbs complex is not a major regulator of front-rear polarity; however, some proteins belonging to the complex may have a function in migration. Crumbs complex in cancer The notion that the Crumbs complex regulates cell growth is based on the observation that it regulates the Hippo pathway 87, a cascade that senses cell density and thereby mediates contact inhibition of cell proliferation by regulating the localization of the transcriptional regulators YAP/TAZ. YAP/TAZ are controlled by a kinase cascade comprising MST1/2 and LATS1/2. At low cellular densities, YAP/TAZ are unphosphorylated and localize to the nucleus. At high density, the Hippo pathway kinase LATS1/2 leads to phosphorylation and subsequent cytoplasmic localization of YAP/TAZ. This is the mechanism at the basis of contact-mediated inhibition of cells. TJ integrity is linked to YAP/TAZ translocation to the nucleus. When TJs are destroyed by Ca2+ depletion from the culture medium, the YAP/TAZ associated protein SMAD translocates to the nucleus. SMAD becomes cytoplasmic as soon as TJs reassemble 88. Interestingly, Pals1, MUPP1 and PATJ were found as interaction partners of YAP/TAZ in a mass-spectrometry based screening 88. The binding of these proteins to YAP/TAZ was further validated, but no direct interaction was found between Crb3 and YAP/TAZ. Surprisingly, however, depletion of Pals1, MUPP1 or PATJ did not impair YAP/TAZ recruitment to the Crumbs complex components whereas depletion of Crb3 did. 88. A possible explanation for this observation is that when the Crumbs complex is intact at TJs, it can sequester YAP/TAZ there, preventing their translocation to the nucleus and multiple interactions between YAP/TAZ and several Crumbs complex components are needed in order to sequester the transcription factors. Consistently with this hypothesis, depletion of Crb3 from a monolayer of cells resulted in nuclear relocalization of YAP/TAZ and subsequent proliferation of cells that were before non-proliferating 88. However, there is in vivo evidence that Crb3 does not take
Introduction – Cell Polarity - 20 part in the process of tumor initiation because Crb3 depleted cells do not become tumorigenic when implanted in mice 89. Karp et al. selected cells with tumorigenic abilities in vivo and compared the gene expression of these cells with the expression of their parental non tumorigenic cell lines 89. Unexpectedly, different tumorigenic cell lines showed similar changes in their expression profiles and common to all was the loss of Crb3 These cells exhibited an EMT signature, thus the authors speculated that those tumor cells underwent EMT in vivo. Crb3 overexpression in the tumorigenic cell lines partially restored apico-basal polarity in vitro. When the tumorigenic cells were then retransfected with an empty backbone or with Crb3 and reimplanted in mice, surprisingly, no difference was observed in the size of primary tumors or in their ability to invade the surrounding tissue. Deeper analysis revealed that Crb3 expression was not detectable anymore after 3 weeks from the reimplant, suggesting that the tumor selected for cells where Crb3 was lost. However, when the Crb3 expressing cells were injected in the tail vein of the mice, no colonization of internal organs was observed, in strong contrast with cells expressing an empty plasmid that colonized almost all organs in the abdominal cavity 89. Crb3 could therefore play a role in the process of extravasation or, alternatively, could render the cells more resistant in the circulation. Consistent with the data on Crb3 and EMT progression is the observation that Crb3 is repressed by at least two transcription factors known to induce EMT 90-93. The transcription factor Zeb1 efficiently represses several polarity proteins, such as LGL2, Crb3 and PATJ 90, 91. The transcription factor Snail directly binds to the promoter of Crb3 and silences it 92, 93. In addition to reducing Crb3 on a transcriptional level, Snail induces post-translational modifications such as glycosylation and sialylation on Crb3, resulting in reduced half-life of the polarity protein 92.
Scribble complex Three proteins compose the Scribble complex: Scrib, LGL, DGL. The main function of this complex is to act as scaffolds to restrict apical components to the apical membranes. Interestingly, LGL (letal giant larvae) and DLG (lethal disks large) were identified as tumor suppressor genes in Drosophila 94. Scribble, LGL and DGL are not physically connected, but they are functionally linked.
Introduction – Cell Polarity - 21
Scribble Scribble (Scrib) was first identified in Drosophila in a screen for maternal mutations affecting epithelial morphogenesis 95. Embryos depleted of Scrib had a corrugated cuticle that was riddled with holes. The epidermis became multilayered and cells from the epidermis lost their contacts with the underlying tissues. In Scrib deficient embryos, Crb was localized throughout the plasma membrane. Together with Crb, several other apical proteins were mislocalized in Scrib deficient embryos, but the localization of several basal proteins did not change. Therefore, Scrib is necessary to restrict apical proteins to the apical membrane 95. The human homologue of Drosophila’s Scribble is also called Scribble (hscrib) or VARTUL. It was found in a screening for targets of ubiquitin mediated degradation by the E6 protein of the human papillomavirus 96. Scrib is a large LAP (LRR and PDZ domains) protein localized at cell-cell junctions. It has 16 LRR (Leucine Rich Repeats), 2 LAP domains and 4 PDZ domains. Scribble localizes on the baso-lateral membrane together with E-Cadherin 97. It colocalizes with DLG, however it is not clear whether the two proteins directly interact 97. Scribble interacts with several TJ proteins, such as ZO-1 98, E-Cadherin and β-catenin 99. Scribble and E-Cadherin mutually control their localization. Depletion of E-cadherin from MDCK cells results in mislocalization of Scribble, whereas re-expression of E-cadherin in the breast cancer cell line MDA-MB-231 induces basal localization of Scribble 100. On the other hand, Scribble depletion disrupts E-cadherin mediated cell-cell adhesions 101. However, more than controlling E- Cadherin localization, Scribble controls coupling of E-Cadherin to cytoskeletal components such as α and β catenin 101, 102. It is possible to rescue the cell-cell contact defect induced by Scribble depletion by overexpressing an E-Cadherin-α catenin fusion protein 101. Even if E- Cadherin is still baso-lateral in the absence of Scribble, several cytoplasmic vesicles positive for E-Cadherin and Golgi markers appear 103. E-Cadherin interacts with p120-Catenin and loss of this interaction promotes internalization of E-Cadherin, with subsequent degradation of the protein in lysosomes. Both the interaction between E-Cadherin and p120-catenin and the targeting of E-Cadherin vesicles to lysosomes are dependent on Scribble. Therefore, Scribble depletion results in accumulation of intracellular E-cadherin at the level of the Golgi apparatus 103. It is tempting to speculate that Scribble could be implicated in trafficking and targeting of post Golgi vesicles. In agreement with this hypothesis, Scribble was shown to regulate the endocytic recycling of the G protein‐coupled thyroid stimulating hormone receptor (TSHR) 104 via the Arf GAP GIT1. Scribble recruits the Rac GEF β-PIX that directly interacts with GIT1. The
Introduction – Cell Polarity - 22 ternary complex Scribble- β-PIX-GIT1 was described to be important also for exocytosis in neurons and in epithelia 105. The role of Scribble in apico-basal polarity has been studied both in vitro and in vivo. In a 3D culture model using MCF10A, depletion of Scribble induced a mild defect in apico-basal polarity. When growing in a 3D environment, MCF10A spontaneously organize in rounded, polarized structures called cysts or acini. These spheres are initially filled with cells, then the cells inside the lumen of the cysts undergo apoptosis and are extruded from the structure, resulting in cysts with empty lumen. The remaining cells will be polarized with their apical membrane facing the lumen of the acini. When Scribble knockdown cells were used to produce such cysts, cells filling the lumen did not undergo apoptosis, resulting in acini with altered morphology. Therefore, a role of Scribble in regulating apoptosis was proposed 102. The role of Scribble in polarity was also deeply investigated in vivo, using the mouse mammary gland as model organ. The mammary gland is formed by highly polarized epithelial cells arranged in ducts. It was shown that the correct development of this organ is dependent on the polarity machinery 43. Accordingly to the proposed role of Scribble in controlling apoptosis in vitro, loss of Scribble resulted in deregulation of the balance between apoptosis and proliferation in vivo, which resulted in disorganized growth of the mammary gland 102, 106. The same phenotype was observed also in a mouse model expressing the Scribble mutant P305L, where Scribble is mainly localized in the cytosol 107, meaning that not only the presence but also the correct localization is required for the correct function of the protein. Overall, human Scribble also plays a role in apico-basal polarity. However, its main role is not structural, as it is the case for Crb3 or Par3, which restrict the localization of several proteins to specific domains of the plasma membrane and are required for TJ stability. Instead, Scribble regulates signaling cascades such as ERK and Rac necessary for the correct development of tissues. There is evidence that mammalian Scribble might play a role also in planar cell polarity (PCP). In fact, Yates et al. showed that in lung epithelia, Scribble interacts with the PCP protein Vangl1 99. This interaction is required for correct lung morphogenesis. Lungs of a mouse mutant for Scribble (Circletail - crc) have an abnormal shape, with airways missing open lumen. Scribblecrc (not functional) does not dramatically affect apico-basal polarity, as assessed by staining of apical and basal components, but acts through Vangl1 and RhoA on the cytoskeleton and perturbs AJ and TJ. Therefore, Scribble might be required to maintain normal cell-cell contact regions 99.
Introduction – Cell Polarity - 23
DLG Mammals have 5 different DLG proteins and DLG1 is the most closely related to Drosophila DLG 108. Like Scribble, DLG is a target of the papillomavirus oncoproteins E6 and E4 109. DLGs are MAGUK proteins: they have three or more PDZ domains, a SH3 domain and a GUK domain 108. In addition to the previously mentioned domains, DLG1 has an N-terminal L27 domain. This domain binds to several TJ proteins, such as Lin-2, Lin-7 and MPP7 110, 111. The interaction with MPP7 is important for targeting of DLG1 to cell junctions 111. Matsumine et al. showed that DLG1 binds to APC and, indirectly, to β-catenin 109. Furthermore, DLG and APC were colocalized at the basal membrane in rat colon epithelia 112. The binding between DLG and APC occurs also in migrating fibroblasts, where the two proteins colocalize at the leading edge and contribute to the stabilization of microtubules32, 38. Depletion of DLG or APC impairs microtubules stabilization towards the leading edge and subsequently, cells lose their migratory capacities 38. DLG is strongly linked to PI3K signaling. PI3K was described as interaction partner of DLG1, the interaction regulated by the phosphorylation status of DLG. Phosphorylation of DLG1 on one Tyrosine residue results in increased affinity for PI3K and subsequent recruitment of the kinase to lateral membranes, whereas double phosphorylation on Tyrosine and Serine prevents this interaction 113. The recruitment of PI3K on basolateral membrane is required for AJ assembly and differentiation of human intestinal epithelial cells 113. DLG interacts also with the lipid phosphatase PTEN 114. PTEN dephosphorylates PIP3, antagonizing the action of PI3K and the pro survival signaling of the kinase Akt. DLG forms a ternary complex with the two tumor suppressors APC and PTEN and it is interesting to note that the PDZ domains of DLG responsible for binding APC and PTEN are often mutated in cancer, resulting in disruption of the complex 115. In addition, the binding between DLG and PTEN can be modulated by phosphorylation, as it was shown that phosphorylation of the PDZ domain of PTEN disrupts the interaction with DLG in vitro 114. These observations confer DLG a central role in controlling PI3K signaling. It would be interesting to know whether DLG can control mTOR and cell growth via its ability to modulate PI3K and to know if this proposed function of DLG is of importance in pathologies like cancer. LGL Mammals have two LGL proteins homologues to Drosophila LGL (LGL1 and 2). In addition, two other LGL related proteins have been described: LGL3 (Syntaxin-binding protein-5) and LGL4
Introduction – Cell Polarity - 24
(Syntaxin-binding protein-5-like) 116. LGL localize to the baso-lateral membrane of epithelial cells and interact with the LRR domain of Scribble 117. The baso-lateral localization of LGL is mediated by the Par complex. In fact, LGL exists normally in a complex with Par6 and when aPKC phosphorylates LGL, the protein is dissociates from Par6 and localizes baso-laterally 4. LGL might play a role in establishment of TJ, but not in their maintenance, as overexpression of LGL during the formation of cell-cell contacts destroys polarity, but overexpression in an already confluent monolayer of cells does not have any effect 4.
Scribble complex in cell migration and invasion Scribble was shown to be important for directed cell migration. In Drosophila, loss of Scrib, Dlg or Lgl are associated with defects in dorsal closure 94. In epithelial cells, loss of Scribble impairs directional migration 101 and in a mouse model, reduction of Scribble causes defects in wound healing 118. However, loss of Scribble seems only to slow down migration, not to block the process 101, 118, 119. Interestingly, cell speed is increased by depletion of Scribble 101. Scribble localizes at the leading edge of migrating cells. Its depletion or mislocalization leads to loss of Rac1, Cdc42 and the Rho GEF β-Pix from the leading edge 118-120, but no defect is observed in scratch induced activation of Rac1, whereas for Cdc42 activation there is no clear consensur. This suggests that cell migration requires a spatio temporal coordination of all the proteins taking part in this process. A possible explanation for the role of Scribble in cell migration is that it acts as a scaffold, bringing together the small GTPases Cdc42 and Rac1 and their GEF β-Pix. However, Osmani et al. 119 analyzed the dynamics of Scribble, β-Pix and Cdc42 recruitment to the leading edge of migrating astrocytes and they concluded that recruitment and activation of Cdc42 are events happening in two separate steps. Furthermore, Qin et al. 101 studied the functional connection between Scribble and E-Cadherin and showed that β-Pix is dispensable for the migratory phenotype of Scribble depleted cells. Impaired directed migration can be instead rescued by expression of an E-Cadherin-α-Catenin mutant. Scribble does not interact directly neither with E-Cadherin, nor with α-Catenin, therefore the mechanism by which Scribble controls cell migration via E-Cadherin still has to be fully elucidated. Dlg, another component of the Scribble complex, was shown to have similar functions to Scribble in Drosophila. In mammalian cells, localization of Dlg was analyzed in a wound healing assay. Dlg also localizes at the leading edge, at the plus ends tips of microtubules. APC, a
Introduction – Cell Polarity - 25 protein implicated in polarity and strongly connected with the Par complex, shares the same localization as Dlg. The binding between APC and DLG is stimulated by a polarization cue and occurs at the plasma membrane. Activation and recruitment of the Par complex results in aPKC mediated phosphorylation of GSK3β. This stabilizes APC and promotes APC interaction with the plus ends of microtubules 38. DLG interacts with APC via its PDZ domains and this interaction is necessary to stabilize microtubules. Perturbing the Par complex affects the localization of both APC and DLG, but a constitutively active GSK3β, that impairs recruitment of APC, does not affect DLG recruitment to the leading edge 38. Therefore, localization of DLG appears to be downstream of the Par complex. Lgl, the last component of the Scribble complex, has a less prominent role in cell migration. It was shown in epithelial cells in Drosophila that aPKC phosphorylates Lgl and thus controls its confinement to the basolateral membrane. This is however of more importance for asymmetric cell division than for migration 27, 121. Plant et al. 31 showed that Par6 and aPKC interact with Lgl in a mouse model. Interestingly, Par6 and Lgl were also found colocalizing at the Golgi apparatus. Once directed migration is induced via scratch of a cell monolayer, Lgl can be found localizing both at the Golgi and at the leading edge. If phosphorylation of Lgl by aPKC is inhibited, Lgl is mislocalized, but this only results in a very mild effect in the ability of the cells to polarize. Recently, NMII-A (non-muscle myosin IIA) was described as a new binding partner of LGL 122. NMII-A binds to LGL only when it is not phosphorylated 122. In addition, aPKC and NMII-A bind to the same domain of LGL; thus, aPKC and NMII-A compete for their binding to LGL 122. Once LGL bind to NMII-A, it inhibits NMII-A Filament assembly. In a migrating cell, LGL is at the leading edge with aPKC. Once LGL gets phosphorylated by aPKC, it moves back in the lamellipodium, where it binds to and inhibits NMII-A. This enables the cell to polarize the F-actin necessary to move forward 122. Scribble complex in cancer The Scribble polarity proteins are normally described as tumor suppressors. Therefore, their expression is often lost or downregulated in cancer. Several proteins of the Scribble complex are repressed by EMT transcription factors such as Zeb1 and Snail 91, 123. Zeb1 represses LGL2. In the absence of Zeb1, depletion of LGL2 mimics most of the changes induced by the transcription factor, such as reduced E-Cadherin levels and increased metastases in vivo. Instead, re-expression of LGL2 in tumor cells with high levels of Zeb1 reverts the EMT phenotype and reduces the number of metastasis formed in vivo after the implant of these
Introduction – Cell Polarity - 26 cells in nude mice 91. LGL2 is also repressed by Snail. As reported for Zeb1, LGL2 re-expression can rescue Snail induced EMT and strongly decrease the metastatic power of cells in vivo. The polarity protein DLG is also repressed in cancer, but by an epigenetic mechanism involving hypermethylation of its promoter 124. DLG and Scribble are targeted for degradation by the HPV protein E6 and this event is thought to be crucial for the progression to cancer induced by HPV infection (NAKAGAWA). Scribble is probably the most studied protein of the Scribble complex. It is frequently downregulated and/or mislocalized in different cancers 102, 107, 125, 126. Loss or mislocalization of Scribble results in increased ERK signaling 127-129. Conversely, overexpression of Scribble decreases MEK and ERK phosphorylation 128, 129. Dow et al. showed that loss of Scribble is necessary for H-Ras driven transformation of MCF10A cells. In fact, MCF10A cells transformed by constitutively active H-Ras (H-Rasv12) expressed less E-Cadherin, formed small filopodia when plated on collagen and were only poorly invasive. However, depletion of Scribble induced a strong invasive phenotype. Conversely, Scribble overexpression inhibited the hyperactivation of ERK, completely restored normal E-Cadherin levels, blocked protrusion of cells expressing H-Ras-V12 and inhibited the ability of cells to form colonies on soft agar. ERK signaling was shown to be the key signaling cascade driving all these events; in fact, chemical inhibition of MEK, but not of JNK and p38, mimicked the effects of Scribble overexpression of MCF10A cells expressing H-Ras-V12 127. Overexpression of a mutant of Scribble with impaired localization (P305L) was not able to reduce phosphorylation of ERK and, accordingly, did not restore epithelial characteristics of MCF10A cells expressing H-Ras-V12. However, this mutant was still able to suppress anchorage independent growth of cells, meaning that probably Scribble is not the only player downstream of H-Ras 128. It is not completely clear how Scribble controls ERK phosphorylation. It is known that Scribble interacts directly with ERK 130 and at the same time recruits Protein Phosphatase 1 γ (PP1γ) 131. Despite the evidence that PP1γ dephosphorylates ERK when both proteins are bound to Scribble, the majority of ERK molecules are in the nucleus, so it is not clear how relevant is the impact of Scribble on ERK. Nevertheless, Nagasaka et al. showed that Scribble-mediated ERK signaling is biologically relevant, as a mutant of Scribble lacking the PP1γ interaction domain can no longer repress H-Ras-V12 induced transformation 131. Scribble depletion cooperates with oncogenic c-Myc to generate breast tumors in a mouse model 102. It is known that c-Myc induces both proliferation and apoptosis. When Scribble is lost, the pro-apoptotic effect of c-Myc disappears, leaving only the pro-proliferative response.
Introduction – Cell Polarity - 27
C-Myc drives apoptosis via activation of the small GTPase Rac1 that signals to JNK. Zhan et al. showed that the scaffolding function of Scribble for the Rac GEF β-Pix is necessary for the c- Myc-induced apoptosis. C-Myc binds directly to the promoters of β-Pix and GIT1, increasing their transcription. If Scribble is lost, however, the increased levels of β-Pix due to c-Myc will not lead to activation of the Rac-JNK pathway, resulting in missed induction of apoptosis. Scribble seems to cooperate specifically with c-Myc and not with other oncogenes. In fact, analysis of c-Myc driven breast tumors revealed low levels of Scribble in many of the samples analyzed, whereas HER2 driven tumors did not show this trend 102, 107. Surprisingly, though, Scribble is often upregulated in breast cancer and high levels of Scribble correlate with low survival 107. Deeper analysis shows that even if upregulated, Scribble is often mislocalized in many breast tumors. Mislocalization could be a direct consequence of overexpression or, as it appears to be the case in most tumors, it is caused by mutations in the protein. Even though no recurrent modification of Scribble was observed in tumors, many different mutations were mapped, each of them resulting in mislocalization of the protein. Feigin et al. generated a transgenic mouse expressing a mutant of Scribble known to localize away from the basal membrane (Scrib P305L). Scribble P305L mice develop multifocal hyperplasia in the mammary gland by the age of 1 year. By 2 years of age, hyperplasia progresses to cancer in the majority of the animals. The tumor suppressor PTEN was found as a binding partner of Scribble and it was proposed that mislocalization of Scribble in the cytosol resulted in trapping of PTEN away from the plasma membrane, where the phosphatase can no longer inhibit Akt, Akt and its downstream target mTOR1 will therefore be hyperactive, resulting in faster cell cycle and increased proliferation 107. Interestingly, Scribble was described to interact also with another phosphatase named PHLPP1 that dephosphorylates Akt. Depletion of Scribble resulted in localization of PHLPP1 away from the membranes and release of the inhibition on Akt 132. Overall, Scribble acts as signaling hub for MAPK and Akt cascades and its role in tumorigenesis relies on its ability to modulate these signaling cascades.
Introduction – Cell Polarity - 28
A
B
Figure 1 – Schematic representing the localization of the main polarity proteins in (A) apico-basal polarity and (B) front- rear polarity.
Introduction – Cell Polarity - 29
References
1. Srivastava, M. et al. The Amphimedon queenslandica genome and the evolution of animal complexity. Nature 466, 720-726 (2010). 2. Mertens, A.E.E., Rygiel, T.P., Olivo, C., van der Kammen, R. & Collard, J.G. The Rac activator Tiam1 controls tight junction biogenesis in keratinocytes through binding to and activation of the Par polarity complex. The Journal of Cell Biology 170, 1029-1037 (2005). 3. Suzuki, A. et al. aPKC kinase activity is required for the asymmetric differentiation of the premature junctional complex during epithelial cell polarization. Journal of Cell Science 115, 3565-3573 (2002). 4. Yamanaka, T. et al. Mammalian Lgl Forms a Protein Complex with PAR-6 and aPKC Independently of PAR-3 to Regulate Epithelial Cell Polarity. Current Biology 13, 734-743 (2003). 5. Vasioukhin, V. & Fuchs, E. Actin dynamics and cell–cell adhesion in epithelia. Current Opinion in Cell Biology 13, 76-84 (2001). 6. Macara, Ian G., Guyer, R., Richardson, G., Huo, Y. & Ahmed, Syed M. Epithelial Homeostasis. Current Biology 24, R815-R825 (2014). 7. Albertson, R. & Doe, C.Q. Dlg, Scrib and Lgl regulate neuroblast cell size and mitotic spindle asymmetry. Nat Cell Biol 5, 166-170 (2003). 8. Chia, W., Somers, W.G. & Wang, H. Drosophila neuroblast asymmetric divisions: cell cycle regulators, asymmetric protein localization, and tumorigenesis. The Journal of Cell Biology 180, 267-272 (2008). 9. Huo, Y. & Macara, I.G. The Par3-like polarity protein Par3L is essential for mammary stem cell maintenance. Nat Cell Biol 16, 526-534 (2014). 10. Assémat, E., Bazellières, E., Pallesi-Pocachard, E., Le Bivic, A. & Massey-Harroche, D. Polarity complex proteins. Biochimica et Biophysica Acta (BBA) - Biomembranes 1778, 614-630 (2008). 11. Kemphues, K.J., Priess, J.R., Morton, D.G. & Cheng, N. Identification of genes required for cytoplasmic localization in early C. elegans embryos. Cell 52, 311-320 ( 1988). 12. Tabuse, Y. et al. Atypical protein kinase C cooperates with PAR-3 to establish embryonic polarity in Caenorhabditis elegans. Development 125, 3607-3614 (1998). 13. Nishimura, T. et al. PAR-6-PAR-3 mediates Cdc42-induced Rac activation through the Rac GEFs STEF/Tiam1. Nat Cell Biol 7, 270-277 (2005). 14. Joberty, G., Petersen, C., Gao, L. & Macara, I.G. The cell-polarity protein Par6 links Par3 and atypical protein kinase C to Cdc42. Nat Cell Biol 2, 531-539 (2000). 15. Hurd, T.W., Gao, L., Roh, M.H., Macara, I.G. & Margolis, B. Direct interaction of two polarity complexes implicated in epithelial tight junction assembly. Nat Cell Biol 5, 137- 142 (2003). 16. Gao, L. & Macara, I.G. Isoforms of the Polarity Protein Par6 Have Distinct Functions. Journal of Biological Chemistry 279, 41557-41562 (2004). 17. Viloria-Petit, A.M. et al. A role for the TGFβ-Par6 polarity pathway in breast cancer progression. Proceedings of the National Academy of Sciences 106, 14028-14033 (2009). 18. Nolan, M.E. et al. The Polarity Protein Par6 Induces Cell Proliferation and Is Overexpressed in Breast Cancer. Cancer Research 68, 8201-8209 (2008).
Introduction – Cell Polarity - 30
19. Itoh, M. et al. Junctional adhesion molecule (JAM) binds to PAR-3: a possible mechanism for the recruitment of PAR-3 to tight junctions. The Journal of Cell Biology 154, 491-498 (2001). 20. Lin, D. et al. A mammalian PAR-3-PAR-6 complex implicated in Cdc42/Rac1 and aPKC signalling and cell polarity. Nat Cell Biol 2, 540-547 (2000). 21. Chen, X. & Macara, I.G. Par-3 controls tight junction assembly through the Rac exchange factor Tiam1. Nat Cell Biol 7, 262-269 (2005). 22. Xue, B., Krishnamurthy, K., Allred, D.C. & Muthuswamy, S.K. Loss of Par3 promotes breast cancer metastasis by compromising cell–cell cohesion. Nat Cell Biol 15, 189-200 (2013). 23. Sander, E.E. et al. Matrix-dependent Tiam1/Rac Signaling in Epithelial Cells Promotes Either Cell–Cell Adhesion or Cell Migration and Is Regulated by Phosphatidylinositol 3- Kinase. The Journal of Cell Biology 143, 1385-1398 (1998). 24. Cong, W. et al. ASPP2 Regulates Epithelial Cell Polarity through the PAR Complex. Current Biology 20, 1408-1414 (2010). 25. Sottocornola, R. et al. ASPP2 Binds Par-3 and Controls the Polarity and Proliferation of Neural Progenitors during CNS Development. Developmental Cell 19, 126-137 (2010). 26. Vives, V. et al. ASPP2 is a haploinsufficient tumor suppressor that cooperates with p53 to suppress tumor growth. Genes & Development 20, 1262-1267 (2006). 27. Hutterer, A., Betschinger, J., Petronczki, M. & Knoblich, J.A. Sequential Roles of Cdc42, Par-6, aPKC, and Lgl in the Establishment of Epithelial Polarity during Drosophila Embryogenesis. Developmental Cell 6, 845-854 (2004). 28. Nishimura, T. & Kaibuchi, K. Numb Controls Integrin Endocytosis for Directional Cell Migration with aPKC and PAR-3. Developmental Cell 13, 15-28 (2007). 29. Rosse, C. et al. An aPKC-Exocyst Complex Controls Paxillin Phosphorylation and Migration through Localised JNK1 Activation. PLoS Biol 7, e1000235 (2009). 30. Wang, H.-R. et al. Regulation of Cell Polarity and Protrusion Formation by Targeting RhoA for Degradation. Science 302, 1775-1779 (2003). 31. Plant, P.J. et al. A polarity complex of mPar-6 and atypical PKC binds, phosphorylates and regulates mammalian Lgl. Nat Cell Biol 5, 301-308 (2003). 32. Etienne-Manneville, S. & Hall, A. Cdc42 regulates GSK-3[beta] and adenomatous polyposis coli to control cell polarity. Nature 421, 753-756 (2003). 33. Hurov, J.B., Watkins, J.L. & Piwnica-Worms, H. Atypical PKC Phosphorylates PAR-1 Kinases to Regulate Localization and Activity. Current Biology 14, 736-741 (2004). 34. Iden, S. et al. aPKC phosphorylates JAM-A at Ser285 to promote cell contact maturation and tight junction formation. The Journal of Cell Biology 196, 623-639 (2012). 35. Scott, M., Ingram, A. & Ball, K., Vol. 21(24) 6771-6780 (EMBO Journal; 2002). 36. Kuribayashi, K. et al. Essential role of protein kinase C ζ in transducing a motility signal induced by superoxide and a chemotactic peptide, fMLP. The Journal of Cell Biology 176, 1049-1060 (2007). 37. Etienne-Manneville, S. & Hall, A. Integrin-Mediated Activation of Cdc42 Controls Cell Polarity in Migrating Astrocytes through PKCζ. Cell 106, 489-498 (2001). 38. Etienne-Manneville, S., Manneville, J.-B., Nicholls, S., Ferenczi, M.A. & Hall, A. Cdc42 and Par6–PKCζ regulate the spatially localized association of Dlg1 and APC to control cell polarization. The Journal of Cell Biology 170, 895-901 (2005). 39. Pegtel, D.M. et al. The Par-Tiam1 Complex Controls Persistent Migration by Stabilizing Microtubule-Dependent Front-Rear Polarity. Current Biology 17, 1623-1634 (2007). 40. Schmoranzer, J. et al. Par3 and Dynein Associate to Regulate Local Microtubule Dynamics and Centrosome Orientation during Migration. Current Biology 19, 1065-1074 (2009).
Introduction – Cell Polarity - 31
41. McCaffrey, Luke M., Montalbano, J., Mihai, C. & Macara, Ian G. Loss of the Par3 Polarity Protein Promotes Breast Tumorigenesis and Metastasis. Cancer Cell 22, 601-614 (2012). 42. DeOme, K.B., Faulkin, L.J., Bern, H.A. & Blair, P.B. Development of Mammary Tumors from Hyperplastic Alveolar Nodules Transplanted into Gland-free Mammary Fat Pads of Female C3H Mice. Cancer Research 19, 515 (1959). 43. Shackleton, M. et al. Generation of a functional mammary gland from a single stem cell. Nature 439, 84-88 (2006). 44. Kenney, N., Smith, G., Lawrence, E., Barrett, J. & Salomon, D., Vol. 1(3) 133-143 (J Biomed Biotechnol; 2001). 45. McCaffrey, L.M. & Macara, I.G. The Par3/aPKC interaction is essential for end bud remodeling and progenitor differentiation during mammary gland morphogenesis. Genes & Development 23, 1450-1460 (2009). 46. Jansen, M., ten Klooster, J.P., Offerhaus, G.J. & Clevers, H. LKB1 and AMPK Family Signaling: The Intimate Link Between Cell Polarity and Energy Metabolism. Physiological Reviews 89, 777-798 (2009). 47. Mohseni, M. et al. A genetic screen identifies an LKB1–MARK signalling axis controlling the Hippo–YAP pathway. Nat Cell Biol 16, 108-117 (2014). 48. Cordenonsi, M. et al. The Hippo Transducer TAZ Confers Cancer Stem Cell-Related Traits on Breast Cancer Cells. Cell 147, 759-772 (2011). 49. Iden, S. et al. Tumor Type-Dependent Function of the Par3 Polarity Protein in Skin Tumorigenesis. Cancer Cell 22, 389-403 (2012). 50. Robert, C., Arnault, J.-P. & Mateus, C. RAF inhibition and induction of cutaneous squamous cell carcinoma. Current opinion in oncology 23, 177-182 (2011). 51. Xu, J., Lamouille, S. & Derynck, R. TGF-[beta]-induced epithelial to mesenchymal transition. Cell Res 19, 156-172 (2009). 52. Wang, X. et al. Downregulation of Par-3 expression and disruption of Par complex integrity by TGF-β during the process of epithelial to mesenchymal transition in rat proximal epithelial cells. Biochimica et Biophysica Acta (BBA) - Molecular Basis of Disease 1782, 51-59 (2008). 53. Zhou, Q. et al. TGF-β-induced MiR-491-5p Expression Promotes Par-3 Degradation in Rat Proximal Tubular Epithelial Cells. Journal of Biological Chemistry 285, 40019-40027 (2010). 54. Ozdamar, B. et al. Regulation of the Polarity Protein Par6 by TGFß Receptors Controls Epithelial Cell Plasticity. Science 307, 1603-1609 (2005). 55. Frederick, L.A. et al. Matrix metalloproteinase-10 is a critical effector of protein kinase C[iota]-Par6[alpha]-mediated lung cancer. Oncogene 27, 4841-4853 (2008). 56. Stallings-Mann, M. et al. A Novel Small-Molecule Inhibitor of Protein Kinase Cι Blocks Transformed Growth of Non–Small-Cell Lung Cancer Cells. Cancer Research 66, 1767- 1774 (2006). 57. Murray, N.R., Kalari, K.R. & Fields, A.P. Protein kinase Cι expression and oncogenic signaling mechanisms in cancer. Journal of Cellular Physiology 226, 879-887 (2011). 58. Scotti, M.L., Bamlet, W.R., Smyrk, T.C., Fields, A.P. & Murray, N.R. Protein Kinase Cι Is Required for Pancreatic Cancer Cell Transformed Growth and Tumorigenesis. Cancer Research 70, 2064-2074 (2010). 59. Regala, R.P. et al. Atypical Protein Kinase Cι Plays a Critical Role in Human Lung Cancer Cell Growth and Tumorigenicity. Journal of Biological Chemistry 280, 31109-31115 (2005).
Introduction – Cell Polarity - 32
60. Wang, Y., Hill, K.S. & Fields, A.P. PKCι Maintains a Tumor-initiating Cell Phenotype That Is Required for Ovarian Tumorigenesis. Molecular Cancer Research 11, 1624-1635 (2013). 61. Murray, N.R. et al. Protein kinase Cι is required for Ras transformation and colon carcinogenesis in vivo. The Journal of Cell Biology 164, 797-802 (2004). 62. Regala, R.P. et al. Atypical Protein Kinase Cι Is Required for Bronchioalveolar Stem Cell Expansion and Lung Tumorigenesis. Cancer Research 69, 7603-7611 (2009). 63. Fields, A.P. & Justilien, V. The guanine nucleotide exchange factor (GEF) Ect2 is an oncogene in human cancer. Advances in Enzyme Regulation 50, 190-200 (2010). 64. Liu, X.-F., Ishida, H., Raziuddin, R. & Miki, T. Nucleotide Exchange Factor ECT2 Interacts with the Polarity Protein Complex Par6/Par3/Protein Kinase Cζ (PKCζ) and Regulates PKCζ Activity. Molecular and Cellular Biology 24, 6665-6675 (2004). 65. Paget, J.A. et al. Repression of cancer cell senescence by PKC[iota]. Oncogene 31, 3584- 3596 (2012). 66. Tepass, U., Theres, C. & Knust, E. crumbs encodes an EGF-like protein expressed on apical membranes of Drosophila epithelial cells and required for organization of epithelia. Cell 61, 787-799 (1990). 67. Wodarz, A., Hinz, U., Engelbert, M. & Knust, E. Expression of crumbs confers apical character on plasma membrane domains of ectodermal epithelia of drosophila. Cell 82, 67-76 (1995). 68. Tepass, U. & Knust, E. crumbs and stardust Act in a Genetic Pathway That Controls the Organization of Epithelia in Drosophila melanogaster. Developmental Biology 159, 311- 326 (1993). 69. Bhat, M.A. et al. Discs Lost, a Novel Multi-PDZ Domain Protein, Establishes and Maintains Epithelial Polarity. Cell 96, 833-845 (1999). 70. den Hollander, A.I. et al. Mutations in a human homologue of Drosophila crumbs cause retinitis pigmentosa (RP12). Nat Genet 23, 217-221 (1999). 71. van den Hurk, J. et al., Vol. 11 263-273 (Molecular Vision; 2005). 72. Alves, C.H. et al. Targeted ablation of Crb2 in photoreceptor cells induces retinitis pigmentosa. Human Molecular Genetics 23, 3384-3401 (2014). 73. Bulgakova, N.A. & Knust, E. The Crumbs complex: from epithelial-cell polarity to retinal degeneration. Journal of Cell Science 122, 2587-2596 (2009). 74. Makarova, O., Roh, M.H., Liu, C.-J., Laurinec, S. & Margolis, B. Mammalian Crumbs3 is a small transmembrane protein linked to protein associated with Lin-7 (Pals1). Gene 302, 21-29 (2003). 75. Lemmers, C. et al. CRB3 Binds Directly to Par6 and Regulates the Morphogenesis of the Tight Junctions in Mammalian Epithelial Cells. Molecular Biology of the Cell 15, 1324- 1333 (2004). 76. Roh, M.H., Fan, S., Liu, C.-J. & Margolis, B. The Crumbs3-Pals1 complex participates in the establishment of polarity in mammalian epithelial cells. Journal of Cell Science 116, 2895-2906 (2003). 77. Fan, S. et al. Polarity Proteins Control Ciliogenesis via Kinesin Motor Interactions. Current Biology 14, 1451-1461 (2004). 78. Fan, S. et al. A novel Crumbs3 isoform regulates cell division and ciliogenesis via importin β interactions. The Journal of Cell Biology 178, 387-398 (2007). 79. Roh, M.H. et al. The Maguk protein, Pals1, functions as an adapter, linking mammalian homologues of Crumbs and Discs Lost. The Journal of Cell Biology 157, 161-172 (2002).
Introduction – Cell Polarity - 33
80. Straight, S.W. et al. Loss of PALS1 Expression Leads to Tight Junction and Polarity Defects. Molecular Biology of the Cell 15, 1981-1990 (2004). 81. Assémat, E. et al. The multi-PDZ domain protein-1 (MUPP-1) expression regulates cellular levels of the PALS-1/PATJ polarity complex. Experimental Cell Research 319, 2514-2525 (2013). 82. Wang, Q., Hurd, T.W. & Margolis, B. Tight Junction Protein Par6 Interacts with an Evolutionarily Conserved Region in the Amino Terminus of PALS1/Stardust. Journal of Biological Chemistry 279, 30715-30721 (2004). 83. Roh, M.H., Liu, C.-J., Laurinec, S. & Margolis, B. The Carboxyl Terminus of Zona Occludens-3 Binds and Recruits a Mammalian Homologue of Discs Lost to Tight Junctions. Journal of Biological Chemistry 277, 27501-27509 (2002). 84. Hamazaki, Y., Itoh, M., Sasaki, H., Furuse, M. & Tsukita, S. Multi-PDZ Domain Protein 1 (MUPP1) Is Concentrated at Tight Junctions through Its Possible Interaction with Claudin- 1 and Junctional Adhesion Molecule. Journal of Biological Chemistry 277, 455-461 (2002). 85. Adachi, M. et al. Similar and Distinct Properties of MUPP1 and Patj, Two Homologous PDZ Domain-Containing Tight-Junction Proteins. Molecular and Cellular Biology 29, 2372-2389 (2009). 86. Shin, K., Wang, Q. & Margolis, B. PATJ regulates directional migration of mammalian epithelial cells. EMBO reports 8, 158-164 (2007). 87. Grzeschik, N.A., Parsons, L.M., Allott, M.L., Harvey, K.F. & Richardson, H.E. Lgl, aPKC, and Crumbs Regulate the Salvador/Warts/Hippo Pathway through Two Distinct Mechanisms. Current Biology 20, 573-581 (2010). 88. Varelas, X. et al. The Crumbs Complex Couples Cell Density Sensing to Hippo-Dependent Control of the TGF-β-SMAD Pathway. Developmental Cell 19, 831-844 (2010). 89. Karp, C.M. et al. Role of the Polarity Determinant Crumbs in Suppressing Mammalian Epithelial Tumor Progression. Cancer Research 68, 4105-4115 (2008). 90. Aigner, K. et al. The transcription factor ZEB1 ([delta]EF1) promotes tumour cell dedifferentiation by repressing master regulators of epithelial polarity. Oncogene 26, 6979-6988 (2007). 91. Spaderna, S. et al. The Transcriptional Repressor ZEB1 Promotes Metastasis and Loss of Cell Polarity in Cancer. Cancer Research 68, 537-544 (2008). 92. Harder, J.L., Whiteman, E.L., Pieczynski, J.N., Liu, C.-J. & Margolis, B. Snail Destabilizes Cell Surface Crumbs3a. Traffic 13, 1170-1185 (2012). 93. Whiteman, E.L., Liu, C.J., Fearon, E.R. & Margolis, B. The transcription factor snail represses Crumbs3 expression and disrupts apico-basal polarity complexes. Oncogene 27, 3875-3879 (2008). 94. Bilder, D., Li, M. & Perrimon, N. Cooperative Regulation of Cell Polarity and Growth by Drosophila Tumor Suppressors. Science 289, 113-116 (2000). 95. Bilder, D. & Perrimon, N. Localization of apical epithelial determinants by the basolateral PDZ protein Scribble. Nature 403, 676-680 (2000). 96. Nakagawa, S. & Huibregtse, J.M. Human Scribble (Vartul) Is Targeted for Ubiquitin- Mediated Degradation by the High-Risk Papillomavirus E6 Proteins and the E6AP Ubiquitin-Protein Ligase. Molecular and Cellular Biology 20, 8244-8253 (2000). 97. Dow, L.E. et al. hScrib is a functional homologue of the Drosophila tumour suppressor Scribble. Oncogene 22, 9225-9230 (2003). 98. Métais, J.-Y., Navarro, C., Santoni, M.-J., Audebert, S. & Borg, J.-P. hScrib interacts with ZO-2 at the cell–cell junctions of epithelial cells. FEBS Letters 579, 3725-3730 (2005).
Introduction – Cell Polarity - 34
99. Yates, L.L. et al. Scribble is required for normal epithelial cell–cell contacts and lumen morphogenesis in the mammalian lung. Developmental Biology 373, 267-280 (2013). 100. Navarro, C. et al. Junctional recruitment of mammalian Scribble relies on E-cadherin engagement. Oncogene 24, 4330-4339 (2005). 101. Qin, Y., Capaldo, C., Gumbiner, B.M. & Macara, I.G. The mammalian Scribble polarity protein regulates epithelial cell adhesion and migration through E-cadherin. The Journal of Cell Biology 171, 1061-1071 (2005). 102. Zhan, L. et al. Deregulation of Scribble Promotes Mammary Tumorigenesis and Reveals a Role for Cell Polarity in Carcinoma. Cell 135, 865-878 (2008). 103. Lohia, M., Qin, Y. & Macara, I.G. The Scribble Polarity Protein Stabilizes E-Cadherin/p120- Catenin Binding and Blocks Retrieval of E-Cadherin to the Golgi. PLoS ONE 7, e51130 (2012). 104. Lahuna, O. et al., Vol. 24(7) 1364-1374 (EMBO Journal, 2005). 105. Audebert, S. et al. Mammalian Scribble Forms a Tight Complex with the βPIX Exchange Factor. Current Biology 14, 987-995 (2004). 106. Godde, N.J. et al. Scribble Modulates the MAPK/Fra1 Pathway to Disrupt Luminal and Ductal Integrity and Suppress Tumour Formation in the Mammary Gland. PLoS Genet 10, e1004323 (2014). 107. Feigin, M.E. et al. Mislocalization of the Cell Polarity Protein Scribble Promotes Mammary Tumorigenesis and Is Associated with Basal Breast Cancer. Cancer Research 74, 3180-3194 (2014). 108. McLaughlin, M. et al. The Distribution and Function of Alternatively Spliced Insertions in hDlg. Journal of Biological Chemistry 277, 6406-6412 (2002). 109. Gardiol, D. et al., Vol. 18 5487-5496 (NCB, Oncogene; 1999). 110. Stucke, V.M., Timmerman, E., Vandekerckhove, J., Gevaert, K. & Hall, A. The MAGUK Protein MPP7 Binds to the Polarity Protein hDlg1 and Facilitates Epithelial Tight Junction Formation. Molecular Biology of the Cell 18, 1744-1755 (2007). 111. Bohl, J., Brimer, N., Lyons, C. & Vande Pol, S.B. The Stardust Family Protein MPP7 Forms a Tripartite Complex with LIN7 and DLG1 That Regulates the Stability and Localization of DLG1 to Cell Junctions. Journal of Biological Chemistry 282, 9392-9400 (2007). 112. Matsumine, A. et al. Binding of APC to the Human Homolog of the Drosophila Discs Large Tumor Suppressor Protein. Science 272, 1020-1023 (1996). 113. Laprise, P., Viel, A. & Rivard, N. Human Homolog of Disc-large Is Required for Adherens Junction Assembly and Differentiation of Human Intestinal Epithelial Cells. Journal of Biological Chemistry 279, 10157-10166 (2004). 114. Adey, N.B. et al. Threonine Phosphorylation of the MMAC1/PTEN PDZ Binding Domain Both Inhibits and Stimulates PDZ Binding. Cancer Research 60, 35-37 (2000). 115. Sotelo, N.S., Valiente, M., Gil, A. & Pulido, R. A functional network of the tumor suppressors APC, hDlg, and PTEN, that relies on recognition of specific PDZ-domains. Journal of Cellular Biochemistry 113, 2661-2670 (2012). 116. Katoh, M. & Katoh, M., Vol. 24(3) 737-742 (International Journal of Oncology; 2004). 117. Kallay, L.M., McNickle, A., Brennwald, P.J., Hubbard, A.L. & Braiterman, L.T. Scribble associates with two polarity proteins, lgl2 and vangl2, via distinct molecular domains. Journal of Cellular Biochemistry 99, 647-664 (2006). 118. Dow, L.E. et al. The tumour-suppressor Scribble dictates cell polarity during directed epithelial migration: regulation of Rho GTPase recruitment to the leading edge. Oncogene 26, 2272-2282 (2006).
Introduction – Cell Polarity - 35
119. Osmani, N., Vitale, N., Borg, J.-P. & Etienne-Manneville, S. Scrib Controls Cdc42 Localization and Activity to Promote Cell Polarization during Astrocyte Migration. Current Biology 16, 2395-2405 (2006). 120. Cau, J. & Hall, A. Cdc42 controls the polarity of the actin and microtubule cytoskeletons through two distinct signal transduction pathways. Journal of Cell Science 118, 2579- 2587 (2005). 121. Betschinger, J., Mechtler, K. & Knoblich, J.A. The Par complex directs asymmetric cell division by phosphorylating the cytoskeletal protein Lgl. Nature 422, 326-330 (2003). 122. Dahan, I., Petrov, D., Cohen-Kfir, E. & Ravid, S. The tumor suppressor Lgl1 forms discrete complexes with NMII-A and Par6α–aPKCζ that are affected by Lgl1 phosphorylation. Journal of Cell Science 127, 295-304 (2014). 123. Kashyap, A. et al. The human Lgl polarity gene, Hugl-2, induces MET and suppresses Snail tumorigenesis. Oncogene 32, 1396-1407 (2013). 124. Feng, X. et al. MPP3 inactivation by promoter CpG islands hypermethylation in colorectal carcinogenesis. Cancer Biomarkers 11, 99-106 (2012). 125. Nakagawa, S. et al. Analysis of the expression and localisation of a LAP protein, human scribble, in the normal and neoplastic epithelium of uterine cervix. Br J Cancer 90, 194- 199 (2004). 126. Gardiol, D., Zacchi, A., Petrera, F., Stanta, G. & Banks, L. Human discs large and scrib are localized at the same regions in colon mucosa and changes in their expression patterns are correlated with loss of tissue architecture during malignant progression. International Journal of Cancer 119, 1285-1290 (2006). 127. Dow, L.E. et al. Loss of human Scribble cooperates with H-Ras to promote cell invasion through deregulation of MAPK signalling. Oncogene 27, 5988-6001 (2008). 128. Elsum, I.A. & Humbert, P.O. Localization, Not Important in All Tumor-Suppressing Properties: A Lesson Learnt from Scribble. Cells Tissues Organs 198, 1-11 (2013). 129. Elsum, I.A., Martin, C. & Humbert, P.O. Scribble regulates an EMT polarity pathway through modulation of MAPK-ERK signaling to mediate junction formation. Journal of Cell Science 126, 3990-3999 (2013). 130. Nagasaka, K. et al. The cell polarity regulator hScrib controls ERK activation through a KIM site-dependent interaction. Oncogene 29, 5311-5321 (2010). 131. Nagasaka, K. et al. A Novel Interaction between hScrib and PP1γ Downregulates ERK Signaling and Suppresses Oncogene-Induced Cell Transformation. PLoS ONE 8, e53752 (2013). 132. Li, X., Yang, H., Liu, J., Schmidt, M. & Gao, T. Scribble-mediated membrane targeting of PHLPP1 is required for its negative regulation of Akt. EMBO Reports Vol. 12(8) 818-824 (2011).
Introduction – Cell Polarity - 36
Small Rho GTPases Small GTPases are molecular switches implicated in the control of a wide variety of cellular processes. They cycle between an active (GTP bound) and inactive (GDP bound) state, with GEF (GTPase Exchange Factors) promoting GTP loading and GAPs (GTPase Activating Proteins) promoting the intrinsic GTPase activity of small GTPases. The largest family of small GTPases is the Ras superfamily which comprises 5 major groups: Ras, Rho, Rab, Arf and Ran. Rho GTPases are more than 20, but the best studied proteins of this family are three: Rac1, RhoA and Cdc42. Over 60 activators (Guanine nucleotide Exchange Factors – GEFs) and 70 inactivators (GTPase Activating Proteins – GAPs) have been described so far for Rho GTPases. In addition, Rho GTPases are regulated also by GDIs (Guanosine Dissociation Inhibitors), which retain the small GTPases in their inactive status. The genes coding for Rho GTPases were first described in 1985 and they were named Ras homologues (Rho) after their similarity to Ras GTPases 1. This gene family was found to be extremely conserved among the animal kingdom 1. Microinjection of purified Rho induced dramatic changes in cell morphology and formation of stress fibers, whereas when Rho was inhibited with the C. botulinum toxin C3 the cells rounded up, thus it was proposed that Rho proteins functioned as cytoskeleton regulators 2. Further studies proofed that and elucidated the mechanisms by which Rac and Rho control the actin cytoskeleton 3, 4. Injection of constitutively active RhoA into fibroblasts led to the assembly of stress fibers and focal adhesions at their end. Two different patterns were identified: FCS or LPA stimulation rapidly induced actin filaments that assembled into stress fibers. PDGF or insulin, instead, promoted first membrane ruffling and then stress fibers formation. By selectively inhibiting RhoA with the C3 toxin, it was possible to abrogate stress fibers and focal adhesions, but not membrane ruffles 4. Injection of constitutively active Rac into fibroblasts promoted membrane ruffling and, later, stress fibers. Dominant negative Rac1 (Rac1 T17N) blocked the formation of lamellipodia and the late stress fibers formation. However, FCS or LPA stimulation in Rac1 T17N microinjected cells still resulted in induction of stress fibers, without any lamellipodia. H-Ras is also an inducer of stress fibers and membrane ruffling. When cells were injected with H-Ras plus the toxin C3 to inhibit Rho, Lamellipodia still formed, but stress fibers were completely absent. Conversely, when H-Ras and Rac1 T17N were injected in the same cell, both membrane ruffling and stress fibers were inhibited. Ridley and Hall therefore identified a link between Ras and Rho GTPases and actin cytoskeleton: H- Ras can activate Rac, and Rac1 activation triggers RhoA activation. Each node of this signaling
Introduction – Small Rho GTPases - 37 cascade can also be individually activated by specific stimuli 3. Nobes and Hall, some years later, observed that injection of active Cdc42 also resulted in focal adhesion assembly and induction of filopodia. Blocking Rho or Rac activation, focal adhesions did not form anymore, but filopodia were still present, meaning that Cdc42 functions upstream of Rac 5.
Structurally, Rho GTPases are quite similar. They have an effector domain that changes conformation between the GTP and GDP bound status of the proteins. This domain is composed of two regions termed Switch I and Switch II that, upon loading of the GTPase with GTP, undergo a conformational change allowing the interaction with downstream effectors 6. The Switch I and II region are critical for the interaction of the GTPase with GAPs and GEFs and probably, the angle between Switch I and II is one mechanism that allows GTPases to be specifically activated or inactivated by some regulators but not by others. At the C terminal, Rho GTPases have the so called hypervariable region that ends with the sequence –CAAX. Prenylation of the cysteine residue on the –CAAX sequence is one of the major determinants of the intracellular localization of Rho GTPases 7. The prenylation consists normally in a geranylgeranylation, but RhoB, RhoD and RhoE are modified with the smaller 15-carbon farnesyl group. After prenylation, proteolysis of the AAX peptide occurs and finally the remaining cysteine is methylated 8. Prenylation is however not enough for plasma membrane targeting. Targeting to the plasma membrane requires a second signal that consists generally of a polybasic region upstream of the –CAAX motif or another prenylation in the hypervariable region. Such second signal has been well characterized for the different Ras isoforms. H and N-Ras are palmitoylated at the Golgi apparatus and this stabilizes their interaction with membranes. K-Ras is not palmitoylated but instead uses a polybasic signal in its carboxyl- terminus to mediate interaction with negatively changed lipids of the plasma membrane. Palmitoylated H- and N-Ras travel to the plasma membrane via the secretory pathway. Once at the plasma membrane, they are depalmitoylated, resulting in their redistribution to all membranes. At the Golgi, they will be palmitoylated and therefore trapped because of their higher affinity for membranes after palmitoylation 9. Unlike Ras isoforms, the role of posttranslational modification in regulating the localization of Rho proteins is more complex and much less understood. For instance, Rac1 (but not Rac2 and 3) is also palmytoilated 10, but it is not accumulated at the Golgi, for a reason that has yet to be determined 7. This could be due to increased binding to RhoGDI that stabilizes Rac1 in the cytosol even when it is
Introduction – Small Rho GTPases - 38 palmitoylated. On the contrary, Cdc42 is not palmitoylated 10, but it is found at the Golgi 7, 11, 12. Finally, RhoA and Rac1 have a polybasic region, but RhoA is actively retained in the cytosol and it is only poorly present at the plasma membrane, probably again because of RhoGDIs 7.
Rho GTPase Official symbol (human) Localization Post-translational modifications RhoA RHOA PM and cytosol 7, 13 GG and PH 14 and 15 RhoB RHOB PM, Golgi and endosomes 7, 13 GG, F and P 15 RhoC RHOC PM and cytosol 13 GG 15 RhoD RHOD PM and endosomes 16 GG (predicted) Rif RHOF PM 17 GG (predicted) Rnd1 RND1 PM 18 F (predicted) Rnd2 RND2 Endosomes and cytosol 19 F (predicted) Rnd3/RhoE RND3 PM, Golgi and cytosol 20 F and PH 21, 22 RhoH/TTF RHOH PM 23 GG (predicted) Rac1 RAC1 PM 7 GG 24 P 10 Rac2 RAC2 PM and cytosol 7 GG 24 Rac3 RAC3 PM and endomembranes 25 GG 25 RhoG RHOG PM and endosomes 26 GG (predicted) Cdc42 CDC42 PM and Golgi 7, 11 GG (predicted) TC10 RhoQ PM and perinuclear 7 F and P (predicted) TCL RHOJ PM and endosomes 27 F and P (predicted) Wrch1 RHOV PM and endomembranes 28 P 28 Chp/Wrch2 RHOU PM and endomembranes 29 P 29 RhoBTB1 RHOBTB1 Vesicular 30 None known RhoBTB2 RHOBTB2 Vesicular 30 None known Miro1 RHOT1 Mitochondria 31 None known Miro2 RHOT2 Mitochondria 31 None known
Abbreviations: PM, plasma membrane; GG, geranylgeranylation; F, farnesylation; P, palmitoylation; PH, phosphorylation. Table 1 – Localization of small Rho GTPases and their post-translational modifications - From Ridley 2006 32
For a very long time, only signals originating at the plasma membrane have been studied, but now it is clear that endomembranes can serve as well as signaling platforms. Therefore, the spatial localization of small Rho GTPases is extremely important for their correct function. Golgi localized Cdc42 controls protein sorting from the TGN and COPI vesicle formation on the cis side of the organelle. In addition it was proposed that Golgi localized Cdc42 could be required to establish cell polarity, but a clear mechanism to explain this is still missing 33. TC10 was also found at the Golgi 7 where it interacts with COPI, thus it is possible that also this GTPase is implicated in the control of Golgi trafficking 34. RhoG is localized at the Golgi via its interaction with RhoGDI3 26, but the function of this GTPase at the Golgi is still unknown 7.
Actin regulation by Rho GTPases Actin is one of the most abundant proteins in the cell. It exists as globular monomers called G-Actin (Globular) that can assemble in filaments called F-Actin (filamentous). Actin filaments
Introduction – Small Rho GTPases - 39 provide a framework that supports the plasma membrane and thus determine cell shape. Two distinct patterns of filaments can be distinguished: bundles, which are composed by parallel, straight filaments, and networks, made by branched filaments. Branched actin filaments are found for example in the lamellipodia, whereas actin bundles sustain fingerlike structures like microvilli. Two major types of proteins are needed in order to assemble actin in bundles or networks. Diaphanous Related Formins (DRFs, a group comprising Dia1, 2 and 3, also called mDia1, 2 and 3) are responsible for nucleating parallel filaments, whereas the Arp2/3 complex leads to formation of a new branch of actin with a 70° angle relative to the original filament, producing branched actin filaments typically referred to as barbed ends 35. Rho GTPases control actin by localizing and activating those actin nucleators. RhoA binds to Diaphanous related formins causing a conformational change that activates them, thus promoting nucleation of parallel filaments of actin that will assemble in bundles to form stress fibers 36. RhoA can also induce stress fiber formation via a cascade involving activation of Rho kinase (ROCK) which activates LIM kinase (LIMK), which in turn phosphorylates and inactivates Cofilin 37. ROCK also phosphorylates MLC (myosin light chain) 38 and at the same time phosphorylates MLC phosphatase 39, thereby increasing myosin contractility, resulting finally in stress fibers formation 40. RhoA signals to Rac1 via two pathways that antagonize each other. mDia binds to Src, promoting phosphorylation of the kinase Cas that will recruit the Rac GEF Dock180, resulting in activation of Rac 41. At the same time, however, ROCK antagonizes Rac1 activation via mechanism that is not completely clear 41. Rac and Cdc42 also signal to LIM kinase via their shared effector PAK1, thus they promote actin polymerization by inhibiting cofilin 42, 43. In addition, Rac1 controls the Arp2/3 complex by localizing and activating it. It was shown that Rac1 activates the WAVE/Scar complex, a direct activator of Arp2/3, by causing the dissociation of WAVE from the complex that keeps it inactive 44. An important effector of Rac is IRSp53, an SH3 domain-containing scaffold protein that, together with Rac1, forms a ternary complex with The Arp2/3 activator WAVE2. Recruitment of IRSp53 by Rac1-GTP promotes local activation of Arp2/3 and results in actin branching and lamellipodia formation 45 46. However, a study by Krugmann et al. found that IRSp53 interacts mainly with Cdc42 and it is responsible for filopodia, but not lamellipodia formation 47. In this model, the complex Cdc42- IRSp53 recruits MENA, a component of the ENA/Vasp complex. The ENA/Vasp complex promotes actin dynamics by interfering with capping proteins, a class of proteins that blocks
Introduction – Small Rho GTPases - 40 monomer addition at the barbed ends of actin filaments, inhibiting the elongation of such filaments 48. ENA/Vasp and capping proteins must both be properly regulated at the leading edge in order to promote migration. When ENA/Vasp activity is too high, capping proteins are totally inhibited and as result there will be very long filaments with few branches that will translate into faster speed, but decreased persistence. Conversely, when capping proteins are highly active, the leading edge will be characterized by highly branched actin filaments and migration will be more persistent 49. With this in mind, it is not surprising that, in addition to recruiting MENA, Cdc42 promotes binding of IRSp53 to the capping protein Esp8 and this protein is also necessary for filopodia formation 50. IRSp53 could therefore play a role in lamellipodia or in filopodia formation and the data on this appear to be contradictory. Probably, an explanation that reconciles all observations is that there are two pools of IRSp53, one that interacts with Rac and activates WAVE, thus promoting lamellipodia, and another pool that binds to Cdc42, leading to the recruitment of MENA and Esp8 and promotion of filopodia. There is also the possibility that those two pools signal to each other, as it was shown that Esp8 indirectly activates Rac by recruiting the Rac GEF Sos1 45, 51, 52. Cdc42 can activate the Arp2/3 activators N-WASP and WASP and thus it can activate the Arp2/3 complex itself 53. Surprisingly, however, depletion of Arp2/3, WAVE and WASP causes loss of lamellipodia, but not of filopodia 54, 55, indicating that networks of branched actin are not critical for the formation of filopodia. If branched actin is not sustaining filopodia, then it is probably parallel actin fibers that provide the structure to grow filopodia. If this is the case, then Cdc42 should also be able to control DRFs. As a matter of fact, Peng et al. showed that Cdc42 interacts directly with DRF3 (mDia2), this interaction being sufficient for filopodia formation 56. Filopodia can be induced also by other small Rho GTPases, namely RIF (RhoF), RhoD and WRCH1 32 and mDia2 was also found downstream of RIF 57.
Introduction – Small Rho GTPases - 41
Figure 1 – Schematic of the main signaling routes downstream of Cdc42, Rac1 and RhoA. Arrows are of the same color of the GTPase from which they depend and if more GTPases control the same pathway, the overlaid color is used. Rho GAPs As with all small GTPases, the intrinsic GTPase activity of Rho proteins is very low and the presence of a GAP is required to promote hydrolysis of the GTP to GDP. The human genome is predicted to encode between 59 to 70 GAPs 58 and not all of them have been already characterized. Several RhoGAPs have been crystallized in complex with a small GTPase 59, 60. The mechanism how GAPs interact with Ras family GTPases is conserved and the key elements are identical between all family members. The switch I and II of the small GTPase stabilize the GTP by coordinating the gamma-phosphate. GAPs use a highly conserved arginine residue (commonly referred to as the arginine finger) to intrude between switch-I&-II. This allows for a hydrophilic attack of the negatively charged gamma-phosphate that is pulled out by the positively charged arginine-finger. There are two main prerequisites for this reaction to happen. Firstly, a conserved glutamine residue (Q61 in Cdc42 and Rac Q63 in RhoA) interacts with the gamma-phosphate and allows the hydrophilic attack. Mutation of this glutamine to nonpolar amino acids (most commonly Q to L mutation) results in constitutively GTP-loaded (i.e. active) GTPases. Secondly, the cavity into which the arginine finger intrudes is rather narrow and is lined up by several conserved glycine residues (glycine is the smallest amino
Introduction – Small Rho GTPases - 42 acid). Mutation of glycine to any other residue results in a steric hindrance of the GAP and therefore in a constitutively active GTPase 60. An important question that is not completely answered to date is why do cells have so many GAPs. The number of RhoGAPs has consistently increased from yeast to mammals, but in all organisms, RhoGAPs outnumber Rho GTPases of a factor of 2-3. In addition, most GAPs display activity towards multiple small GTPases (at least in vitro), thus increasing the complexity of the possible signaling cascades. An explanation for this is that each GAP might specifically regulate a small GTPase in the context of a specific signaling pathway. In addition, GAPs are not only terminators of the signal, but the contribution to the modulation of several signaling routes. For example, active Cdc42 and Rac1 can bind to the inactive GAP p85 and their binding stimulates PI3K activity 61. Almost all RhoGAPs have multiple domains in addition to the GAP domain 58. Those additional domains can target the protein to specific locations. For example, the RhoGAP RICH1 (RhoGAP interacting with CIP4 Homologues1) has a BAR domain that mediates its recruitment to tight junctions. The BAR domain of RICH1 interacts with AMOT, a binding partner of PATJ and Pals1 that mediates RICH1 recruitment at TJs. Using a FRET based method, RICH1was found to be selectively active only on Cdc42 in cells 62. Depletion of RICH1 or overexpression of AMOT result in loss of TJ. The same happens when a GAP-deficient mutant of RICH1 is overexpressed, showing that local control of Cdc42 by RICH1 is necessary for TJ formation 62. Some GAPs are not only directed to specific subcellular locations by binding to other proteins, but they can also be differently active, depending on the membrane to which they are bound. ARAP1, 2 and 3 are GAPs for Rho and Arf GTPases. ARAP1 and 3 localization is dependent on phosphoinositides 63, 64. ARAP1 localizes at Golgi, endosomes and plasma membrane. Inhibition of PI3K shifts ARAP1 localization towards the Golgi, whereas inhibition of PI4K redirects it to endosomes, underlining the importance of PI metabolism in
64 the targeting of such GAP . Interestingly, ARAP3 activity is regulated by binding to PIP3. In vitro, ARAP3 is a GAP for Cdc42, Rac1 and Rho, but does not have GAP activity towards Arf proteins. However, when PIP3 is added to the reaction, the Rho GAP activity of ARAP3 is shut down and instead the GAP activity towards Arf6 is drastically increased 63. The additional domains present on RhoGAPs can therefore serve to localize the GAPs, but also can provide a platform for crosstalk between different signaling cascades, as described for ARAPs, which mediate a bridge between Rho and Arf GTPases. GAPs can also mediate crosstalk between MAPK signaling and Rho GTPases. This is the case for BPGAP1, a GAP specific for RhoA 65, 66 67.
Introduction – Small Rho GTPases - 43
BPGAP1 interacts directly with EEN II (endophilin II) and this interaction is necessary to target EEN to the plasma membrane, where both proteins will promote endocytosis of the EGF receptor. Accordingly, overexpression of BPGAP1 increases endocytosis of EGFR and leads to increased and more sustained ERK activation. EGFR is still active on endosomes, thus ERK activation is sustained until the receptor is recycled. Interestingly, a mutant of BPGAP with no GAP activity is not able to promote endocytosis of EGFR 65. BPGAP1 interacts directly also with MEK2 66 thus, a mutant of BPGAP1 not able to bind EEN does not affect endocytosis of EGFR, but is still able to increase ERK phosphorylation to some extent. Furthermore, MEK2 promotes the binding of Pin2 (Peptidyl-Prolyl cis/trans Isomerase 1) to BPGAP1. Pin1 dampens ERK signaling by decreasing the phosphorylation levels of MEK2 and at the same time it promotes the RhoGAP activity of BPGAP1 66. The functional relevance of such interaction is still not clear, but it would be interesting to test whether RhoA can influence ERK signaling via BPGAP1. Evolution has in some cased privileged the scaffolding function over the GAP activity of RhoGAPsas can be concluded by the discovery of proteins harboring a non functional GAP domain that maintained only their other function. This is the case of IQGAP1 and p85, the catalytic subunit of PI3K. IQGAP1 localizes at adherent junctions of epithelial cells via binding to E-Cadherin 68. In front rear polarity it goes to the leading edge, where it interacts with APC and CLIP170, capturing the plus ends of microtubules 68, 69. IQGAP recruits active Rac and Cdc42 to the leading edge, but does not exert any GAP activity on them. Instead, by promoting local accumulation of the active form of Cdc42 and Rac1, it is responsible for local actin assembly. Therefore, IQGAP1 provides a link between microtubules and actin cytoskeleton 68. IQGAP1 acts also as a scaffold for the ERK signaling cascade 70. Interestingly, IQGAP1 is frequently upregulated in tumors 71. In glioma, it is recruited to the leading edge of tumor cells escaping the primary tumor. This recruitment is mediated by Arf6 and it is required for efficient cell migration. In fact, IQGAP1 recruits active Rac1, promoting actin remodeling at the leading edge 72. The catalytic subunit of PI3K called p85 (α and β) has a RhoGAP domain which lost is GAP function because it is depleted of the critical arginine 61.
Rho GEFs The first mammalian RhoGEF was identified as a transforming gene for diffuse B-cell- lymphoma cells and was named Dbl 73. Since then, almost 70 distinct GEFs have been identified in humans 74. Dbl has a region homologous to the Rho GEF Cdc24. This region is the
Introduction – Small Rho GTPases - 44 prototype GEF region used by all Rho GEFs and it is called Dbl Homology domain (DH). DH domains of different proteins share very little homology with each other, except for 3 short conserved regions (CR1, CR2 and CR3). However, the 3D structure of all GEFs is highly similar: they are all composed by a bundle of α-helices, with the three conserved regions forming the domain core 75-77. CR1 and 3 are α-helices, while CR2 is only the C-terminal part of α-helix 6. CR1 and 3 interact mostly with the switch I of the small GTPase and CR3 interacts with the Switch II. Small GTPases have a Mg2+ binding pocket and binding to Mg2+ is required to stabilize the binding with the guanine nucleotides. The DH domain of GEFs removes the Mg2+ from its pocket, thereby destabilizing the GDP–GTPase complex, and at the same time, they stabilize the nucleotide and Mg2+-free reaction intermediate 78. Because of the high intracellular ratio of GTP/GDP, the released GDP is replaced with GTP, leading to activation. Despite the lack of an evolutionary conserved sequence, the mechanism of action of Rho activators is extremely conserved. The same mechanism of action has been described for the bacterial effector SopE of Salmonella thyphimurium. SopE does not have a DH domain, however it potently activates Cdc42, leading to cytoskeletal rearrangements necessary for the bacteria to enter the cell 79. The protein Dock180 is the archetype for the second family of GEFs, named DOCK 80, 81. Dock180 displays GEF activity towards Rac1 in cells, despite its lack of a DH domain 81. The mechanism by which this protein complex mediates nucleotide exchange on Rac is not totally clear. What is known is that the interaction with ELMO is necessary to confer Dock180 its GEF activity. Dock180 preferentially binds to Rac1 in its nucleotide-free status. Therefore, it is possible that the complex Dock180-ELMO stabilizes Rac1 in a nucleotide-free status, leading to GTP loading, as it is described for the Dbl family GEFs. However, there is evidence that the tertiary structure of the Dock180-ELMO complex is different from the normal structure of GEFs 81. In addition to the DH domain, the vast majority of GEFs possess a PH domain right at the C terminal of the Dbl homology. In several cases, the PH domain participates in the binding to the small GTPase. This is the case for the PH domain of Dbl that directly contacts Cdc42 and is necessary for GDP to GTP exchange 82. However, other GEFs do not require the PH domain to activate small GTPases 77. Furthermore, 4 GEFs completely lack a PH domain 83. Another possible function of PH domain would be the targeting of the GEF to a specific subcellular location. Interestingly, two of the four GEFs lacking PH domains have instead a transmembrane domain that mediates their recruitment to membranes 83 and TUBA has a BAR domain that functionally replaces a PH domain 84.
Introduction – Small Rho GTPases - 45
However, the PH domains of several GEFs are poorly specific for phosphoinositides 85, meaning that it is unlikely that they would target GEFs to specific subcellular regions. Furthermore, there are examples where depletion of the PH domains does not affect localization of the GEF 86. An appealing possible function of PH domains is their ability to modulate GEF activity via binding to PIs 86-88. Han et al. described that the RhoGEF Vav binds directly to Ptdins. Binding to PI4,5P2 strongly inhibits its GEF activity towards Rac, Cdc42 and
Rho in vitro. Instead, binding to PI3,4P2 or to PIP3 stimulates the GEF activity. Vav needs to be
89 phosphorylated by Lck or other kinases in order to exert its GEF activity . Binding to PI3,4P2 or PIP3 increases the Lck dependent phosphorylation of Vav1. This could be one of the mechanisms that allows Rac activation downstream of Ras. In fact, Ras stimulates PI3K, which would reduce the levels of the Vav inhibitorory Ptdins4,5P2 in favor of the presence of PI3,4P2
88 or to PIP3 . GEFs are tightly regulated in their activity. Although there is no general mechanism of regulation, some common rules can be delineated: (1) post-translational modification (e.g. phosphorylation), (2) subcellular sequestration, (3) relief on inhibition by N-terminal truncation. As already described, phosphorylation is critical for Vav activation 88. However, phosphorylation can also result in inactivation of the GEF, as it happens for RasGRF2. RasGRF2 is a Rho GEF and a Ras GEF at the same time. In fact, it possesses a DH-PH domain and a Cdc25 domain, the latter responsible for Ras activation. In CHO cells, overexpression of RasGRF2 leads to increased Rac1 activation, but when RasGRF2 is phosphorylated on Ser737 by p35/Cdk5, Rac1 activation is inhibited 90. Intriguingly, RasGRF was shown to bind to and inhibit Cdc42 in melanoma cell lines 91 and we could confirm this finding. Sequestration to specific subcellular locations is a commonly used mechanism to modulate the activity of RhoGEFs. As already described in the previous part of this introduction, the interaction of β-Pix with Scribble is necessary to correctly activate the Rac-JNK pathway that leads to apoptosis in response to myc 92. In cell migration, Scribble recruits β-Pix to the leading edge, promoting local recruitment of active Rac 93-95. Par3 binding to Tiam1 restricts the GEF activity of Tiam1 towards Rac 96-98 and depletion of Par3 results in aberrant activation of Rac through Tiam1 98. Many GEFs contain an internal inhibitory domain. For several GEFs including Dbl, Vav, Asef, and Ect2, the removal of N-terminal sequences leads to constitutive activation when the protein is expressed in cells 99-102. As it is the case for Rho GAPs, Rho GEFs can serve as a bridge
Introduction – Small Rho GTPases - 46 between Rho proteins signaling and other signaling cascades. Many GEFs possess several other domains, in addition to their DH-PH domains. RasGRF, for instance, contains a Cdc25 domain, which is used to activate Ras. Therefore, RasGRF is a potential link between Rac and Cdc42 on one side and Ras signaling on the other. The activity of RasGRF towards any of the GTPases it regulates is regulated by phosphorylation. p35/Cdk5 mediated phosphorylation of RasGRF was shown to control Rac activation, but did not affect Ras signaling 90. However, phosphorylation on other residues can also affect Ras activation 103. Cdc42-GDP decreases RasGRF mediated MAPK activation 104, 105, thereby providing evidence that Rho GTPases can control Ras signaling.
Rho GDIs Rho GDIs are the third class of regulators for Rho GTPases. They interact with the small GTPase in a 1:1 stoichiometry complex and block nucleotide exchange on the small GTPase 106, 107. Mammals have three GDIs: the ubiquitously expressed RhoGDI (GDI1), the hematopoietically restricted GDI2 (LyD4GDI) and RhoGDI3 (also called RhoGDIγ) 108. GDI1 and 2 are cytosolic, whereas GDI3 is membrane bound and it is normally found on intracellular vesicles 109. The crystal structure of RhoGDI in complex with Cdc42 has been resolved, leading to a deeper understanding on the mechanism of action of GDIs 110. RhoGDI is composed of an N terminal arm that binds to the switch I and II of the small GTPase, blocking nucleotides exchange. The C terminal part of RhoGDI has an immunoglobulin shape and if forms a hydrophilic pocket that is able to host the prenyl motif of the small GTPase, thereby stabilizing the Rho protein in the cytosol 110. Interestingly, RhoGDI is equally affine for Cdc42-GDP and Cdc42-GTP in the cytosol. However, on membranes, its affinity towards the small GTPase changes: GDI1 is now more affine to Cdc42-GDP 107. X-rays crystal structure did not show appreciable differences in the position of the switch I and II of soluble Cdc42 bound to GDP or GTP 111. It is therefore possible to speculate that the association with membranes may help GTP-bound Cdc42 to assume a conformational state that is more readily distinguishable from the GDP-bound GTPase and, thus, more receptive to bind target/effector proteins. RhoGDI does not actively extract Cdc42 from membranes. In fact, Johnson et al. showed that in vitro Cdc42 can dissociate from lipids at the same rates with or without GDI 107. Rather than directly promoting dissociation from membranes, GDI1 stabilizes Cdc42 as it spontaneously dissociates from membranes. Given that GDI1 binds preferentially to Cdc42-GDP on membranes, the overall
Introduction – Small Rho GTPases - 47 result will be the accumulation of Cdc42-GTP on membranes and the stabilization of Cdc42- GDP in the cytosol 107. The same mechanism works also for Rac1, but not for RhoA 107.
Figure 2 - Model representing the mechanism of action of GDIs. GDIs bind to Cdc42-GDP on membranes, stabilizing it as soon as it spontaneously leaves the membrane. Therefore, GDI slows down the reassociation of Cdc42-GDP to membranes. In the cytosol, GDIs can interact with the same affinity with both GTP and GDP bound Cdc42. Cdc42- GTP is more affine for membranes than Cdc42-GDP, therefore the net result of all these movements will be the enrichment of Cdc42-GTP on membranes
There is evidence for GDIs playing important roles in the modulation of intracellular signaling. Overexpression of GDI1 results in decreased levels of active Cdc42, which in turn inhibit RasGRF capacity to activate Ras. Therefore, GDI1 overexpression results in a reduction of MAPK signaling 105. However, this observation should be interpreted carefully as GDI bound Cdc42 is not able to interact with RasGRF or with any other GEF, thus it is difficult to understand how the complex GDI-Cdc42 could modulate RasGRF with respect to its activity toward Ras. An alternative explaination would be that binding of Cdc42 to RasGRF positively modulates Ras activation and overexpression of GDIs would remove Cdc42 from RasGRF, thus reducing its GEF activity towards Ras. Binding of GDI to Cdc42 is important for the ability of Cdc42 to induce transformation 112. A mutant of Cdc42 that undergoes faster GDP/GTP exchange (Cdc42-F28L) was shown to promote transformation in NIH3T3 cells 113. When a mutation that disrupts the binding between Cdc42 and GDI (R66A) was introduced into Cdc42- F28L, the ability of Cdc42-F28L-R66A to induce transformation was completely lost 112. Several important questions remain to be answered to fully understand the role of GDIs. First, how are GDIs dissociated from the small GTPase, in order to reactivate signaling downstream
Introduction – Small Rho GTPases - 48 of the Rho proteins? Second, are GDIs simply cytosolic anchors, or could they work as chaperons for the small GTPases? To answer the first question, a possibility is that another class of proteins will lead to rapid dissociation of the GDI from the small GTPase. This is the case for Rab GTPases, where GDF (GDI Dissociation Factors) displace the RabGDI from Rabs, thereby making it possible for a RabGEF to activate the small GTPase 114. However, to date, no evidence of such proteins has been reported for Rho GTPases. Another possibility is that GDIs are phosphorylated and phosphorylation makes them less affine for the small GTPases. For instance, PAK1 phosphorylates GDI1 on Ser101 and Ser174, leading to decrease in its affinity for Rac 115. In addition, Src can phosphorylate GDI1 on Tyr156 in vitro and in cells. Phosphorylated GDI1 translocates to membranes and shows reduced affinity towards Rho GTPases 116. Finally, aPKC has been reported to phosphorylate RhoGDI, resulting in this case in the liberation of Rac1 117. Alternatively to GDIs being phosphorylated, there is evidence that phosphorylation of small GTPases can change their affinity for GDIs 118. Forget et al. showed that PKA phosphorylation of Cdc42 and RhoA increases the affinity of those two small GTPases towards GDI1 118. GDIs can bind also to GTP loaded GTPases, the binding preventing interaction with effectors of the Rho proteins and with GAPs 107. Once the small GTPase is GDI bound, it is protected by GAPs, meaning that it cannot be inactivated, unless before dissociation of GDI is stimulated. This raises the possibility that GDIs can act as chaperones to translocate active small GTPases between different subcellular locations 119, 120. In agreement with this idea, it was observed that the Cdc42 mutant incapable of binding GDI1 was localized more prominently at the Golgi than the GDI bound protein 112. The same different localization upon impaired binding to GDI1 was described also for Rac1 121. In another study from Boulter et al, depletion of GDI1 resulted in reduced plasma membrane localization of Cdc42, Rac1 and RhoA and concomitant increase of their localization on endomembranes 122. Boulter et al. observed also that in mammalian cells, the level of RhoGDI1 is roughly equivalent to the total levels of RhoA, Rac1 and Cdc42 combined. Therefore, Rho GTPases compete for the binding to GDI and any condition that alters the level of one GTPase will result in disruption of this balance, affecting the normal on/off cycle of Rho GTPases 122. One last function of GDIs is to prevent degradation of small GTPases. Once the Rho protein dissociate from membranes, their geranylgeranilation causes them to unfold and therefore
Introduction – Small Rho GTPases - 49 they are degraded by the proteasome 122. By stabilizing the prenylation, GDIs prevent degradation of small GTPases. This allows cells to have a constant pool of small GTPases that can be rapidly activated in response to stimuli.
Introduction – Small Rho GTPases - 50
References 1. Madaule, P. & Axel, R. A novel ras-related gene family. Cell 41, 31-40 (1985). 2. Paterson, H.F. et al. Microinjection of recombinant p21rho induces rapid changes in cell morphology. J Cell Biol 111, 1001-1007 (1990). 3. Ridley, A.J., Paterson, H.F., Johnston, C.L., Diekmann, D. & Hall, A. The small GTP- binding protein rac regulates growth factor-induced membrane ruffling. Cell 70, 401- 410 (1992). 4. Ridley, A.J. & Hall, A. The small GTP-binding protein rho regulates the assembly of focal adhesions and actin stress fibers in response to growth factors. Cell 70, 389-399 (1992). 5. Nobes, C.D. & Hall, A. Rho, Rac, and Cdc42 GTPases regulate the assembly of multimolecular focal complexes associated with actin stress fibers, lamellipodia, and filopodia. Cell 81, 53-62 (1995). 6. Dvorsky, R. & Ahmadian, M.R. Always look on the bright site of Rho: structural implications for a conserved intermolecular interface. EMBO Reports 5, 1130-1136 (2004). 7. Michaelson, D. et al. Differential Localization of Rho Gtpases in Live Cells: Regulation by Hypervariable Regions and Rhogdi Binding. The Journal of Cell Biology 152, 111- 126 (2001). 8. Clarke, S. Protein Isoprenylation and Methylation at Carboxyl-Terminal Cysteine Residues. Annual Review of Biochemistry 61, 355-386 (1992). 9. Rocks, O. et al. An Acylation Cycle Regulates Localization and Activity of Palmitoylated Ras Isoforms. Science 307, 1746-1752 (2005). 10. Navarro-Lérida, I. et al. A palmitoylation switch mechanism regulates Rac1 function and membrane organization. The EMBO Journal 31, 534-551 (2012). 11. Erickson, J.W., Zhang, C.-j., Kahn, R.A., Evans, T. & Cerione, R.A. Mammalian Cdc42 Is a Brefeldin A-sensitive Component of the Golgi Apparatus. Journal of Biological Chemistry 271, 26850-26854 (1996). 12. Baschieri, F. et al. Spatial control of Cdc42 signalling by a GM130–RasGRF complex regulates polarity and tumorigenesis. Nat Commun 5 (2014). 13. Adamson, P., Paterson, H.F. & Hall, A. Intracellular localization of the P21rho proteins. J Cell Biol 119, 617-627 (1992). 14. Lang, P. et al. Protein kinase A phosphorylation of RhoA mediates the morphological and functional effects of cyclic AMP in cytotoxic lymphocytes. Embo j 15, 510-519 (1996). 15. Adamson, P., Marshall, C.J., Hall, A. & Tilbrook, P.A. Post-translational modifications of p21rho proteins. J Biol Chem 267, 20033-20038 (1992). 16. Murphy, C. et al. Endosome dynamics regulated by a Rho protein. Nature 384, 427- 432 (1996). 17. Ellis, S. & Mellor, H. The novel Rho-family GTPase rif regulates coordinated actin- based membrane rearrangements. Curr Biol 10, 1387-1390 (2000). 18. Nobes, C.D. et al. A new member of the Rho family, Rnd1, promotes disassembly of actin filament structures and loss of cell adhesion. J Cell Biol 141, 187-197 (1998). 19. Tanaka, H., Fujita, H., Katoh, H., Mori, K. & Negishi, M. Vps4-A (vacuolar protein sorting 4-A) is a binding partner for a novel Rho family GTPase, Rnd2. Biochem J 365, 349-353 (2002).
Introduction – Small Rho GTPases - 51
20. Riento, K., Guasch, R.M., Garg, R., Jin, B. & Ridley, A.J. RhoE binds to ROCK I and inhibits downstream signaling. Mol Cell Biol 23, 4219-4229 (2003). 21. Riento, K. et al. RhoE function is regulated by ROCK I-mediated phosphorylation. Embo j 24, 1170-1180 (2005). 22. Foster, R. et al. Identification of a novel human Rho protein with unusual properties: GTPase deficiency and in vivo farnesylation. Mol Cell Biol 16, 2689-2699 (1996). 23. Chae, H.D., Lee, K.E., Williams, D.A. & Gu, Y. Cross-talk between RhoH and Rac1 in regulation of actin cytoskeleton and chemotaxis of hematopoietic progenitor cells. Blood 111, 2597-2605 (2008). 24. Menard, L. et al. Rac1, a low-molecular-mass GTP-binding-protein with high intrinsic GTPase activity and distinct biochemical properties. Eur J Biochem 206, 537-546 (1992). 25. Joyce, P.L. & Cox, A.D. Rac1 and Rac3 are targets for geranylgeranyltransferase I inhibitor-mediated inhibition of signaling, transformation, and membrane ruffling. Cancer Res 63, 7959-7967 (2003). 26. Brunet, N., Morin, A. & Olofsson, B. RhoGDI-3 Regulates RhoG and Targets This Protein to the Golgi Complex Through its Unique N-Terminal Domain. Traffic 3, 342- 358 (2002). 27. de Toledo, M. et al. The GTP/GDP Cycling of Rho GTPase TCL Is an Essential Regulator of the Early Endocytic Pathway. Molecular Biology of the Cell 14, 4846-4856 (2003). 28. Berzat, A.C. et al. Transforming activity of the Rho family GTPase, Wrch-1, a Wnt- regulated Cdc42 homolog, is dependent on a novel carboxyl-terminal palmitoylation motif. J Biol Chem 280, 33055-33065 (2005). 29. Chenette, E.J., Abo, A. & Der, C.J. Critical and distinct roles of amino- and carboxyl- terminal sequences in regulation of the biological activity of the Chp atypical Rho GTPase. J Biol Chem 280, 13784-13792 (2005). 30. Aspenstrom, P., Fransson, A. & Saras, J. Rho GTPases have diverse effects on the organization of the actin filament system. Biochem J 377, 327-337 (2004). 31. Fransson, A., Ruusala, A. & Aspenstrom, P. Atypical Rho GTPases have roles in mitochondrial homeostasis and apoptosis. J Biol Chem 278, 6495-6502 (2003). 32. Ridley, A.J. Rho GTPases and actin dynamics in membrane protrusions and vesicle trafficking. Trends in Cell Biology 16, 522-529 (2006). 33. Kodani, A., Kristensen, I., Huang, L. & Sütterlin, C. GM130-dependent Control of Cdc42 Activity at the Golgi Regulates Centrosome Organization. Molecular Biology of the Cell 20, 1192-1200 (2009). 34. Kanzaki, M. et al. Small GTP-binding Protein TC10 Differentially Regulates Two Distinct Populations of Filamentous Actin in 3T3L1 Adipocytes. Molecular Biology of the Cell 13, 2334-2346 (2002). 35. Pollard, T.D., Blanchoin, L. & Mullins, R.D. Molecular mechanisms controlling actin filament dynamics in nonmuscle cells. Annu Rev Biophys Biomol Struct 29, 545-576 (2000). 36. Kovar, D.R. Molecular details of formin-mediated actin assembly. Current Opinion in Cell Biology 18, 11-17 (2006). 37. Maekawa, M. et al. Signaling from Rho to the Actin Cytoskeleton Through Protein Kinases ROCK and LIM-kinase. Science 285, 895-898 (1999). 38. Amano, M. et al. Phosphorylation and Activation of Myosin by Rho-associated Kinase (Rho-kinase). Journal of Biological Chemistry 271, 20246-20249 (1996).
Introduction – Small Rho GTPases - 52
39. Kimura, K. et al. Regulation of the Association of Adducin with Actin Filaments by Rho- associated Kinase (Rho-kinase) and Myosin Phosphatase. Journal of Biological Chemistry 273, 5542-5548 (1998). 40. Riveline, D. et al. Focal Contacts as Mechanosensors: Externally Applied Local Mechanical Force Induces Growth of Focal Contacts by an Mdia1-Dependent and Rock-Independent Mechanism. The Journal of Cell Biology 153, 1175-1186 (2001). 41. Tsuji, T. et al. ROCK and mDia1 antagonize in Rho-dependent Rac activation in Swiss 3T3 fibroblasts. The Journal of Cell Biology 157, 819-830 (2002). 42. Sells, M.A., Boyd, J.T. & Chernoff, J. p21-Activated Kinase 1 (Pak1) Regulates Cell Motility in Mammalian Fibroblasts. The Journal of Cell Biology 145, 837-849 (1999). 43. Edwards, D.C., Sanders, L.C., Bokoch, G.M. & Gill, G.N. Activation of LIM-kinase by Pak1 couples Rac/Cdc42 GTPase signalling to actin cytoskeletal dynamics. Nat Cell Biol 1, 253-259 (1999). 44. Eden, S., Rohatgi, R., Podtelejnikov, A.V., Mann, M. & Kirschner, M.W. Mechanism of regulation of WAVE1-induced actin nucleation by Rac1 and Nck. Nature 418, 790-793 (2002). 45. Miki, H., Yamaguchi, H., Suetsugu, S. & Takenawa, T. IRSp53 is an essential intermediate between Rac and WAVE in the regulation of membrane ruffling. Nature 408, 732-735 (2000). 46. Suetsugu, S. et al. Optimization of WAVE2 complex–induced actin polymerization by membrane-bound IRSp53, PIP3, and Rac. The Journal of Cell Biology 173, 571-585 (2006). 47. Krugmann, S. et al. Cdc42 induces filopodia by promoting the formation of an IRSp53:Mena complex. Current Biology 11, 1645-1655 (2001). 48. Krause, M., Dent, E.W., Bear, J.E., Loureiro, J.J. & Gertler, F.B. Ena/VASP proteins: regulators of the actin cytoskeleton and cell migration. Annu Rev Cell Dev Biol 19, 541- 564 (2003). 49. Krause, M., Bear, J.E., Loureiro, J.J. & Gertler, F.B. The Ena/VASP enigma. J Cell Sci 115, 4721-4726 (2002). 50. Disanza, A. et al. Regulation of cell shape by Cdc42 is mediated by the synergic actin- bundling activity of the Eps8-IRSp53 complex. Nat Cell Biol 8, 1337-1347 (2006). 51. Innocenti, M. et al. Phosphoinositide 3-kinase activates Rac by entering in a complex with Eps8, Abi1, and Sos-1. J Cell Biol 160, 17-23 (2003). 52. Funato, Y. et al. IRSp53/Eps8 Complex Is Important for Positive Regulation of Rac and Cancer Cell Motility/Invasiveness. Cancer Research 64, 5237-5244 (2004). 53. Kolluri, R., Tolias, K.F., Carpenter, C.L., Rosen, F.S. & Kirchhausen, T. Direct interaction of the Wiskott-Aldrich syndrome protein with the GTPase Cdc42. Proceedings of the National Academy of Sciences of the United States of America 93, 5615-5618 (1996). 54. Steffen, A. et al. Filopodia Formation in the Absence of Functional WAVE- and Arp2/3- Complexes. Molecular Biology of the Cell 17, 2581-2591 (2006). 55. Snapper, S.B. et al. N-WASP deficiency reveals distinct pathways for cell surface projections and microbial actin-based motility. Nat Cell Biol 3, 897-904 (2001). 56. Peng, J., Wallar, B.J., Flanders, A., Swiatek, P.J. & Alberts, A.S. Disruption of the Diaphanous-Related Formin Drf1 Gene Encoding mDia1 Reveals a Role for Drf3 as an Effector for Cdc42. Current Biology 13, 534-545 (2003). 57. Pellegrin, S. & Mellor, H. The Rho Family GTPase Rif Induces Filopodia through mDia2. Current Biology 15, 129-133 (2005).
Introduction – Small Rho GTPases - 53
58. Tcherkezian, J. & Lamarche-Vane, N. Current knowledge of the large RhoGAP family of proteins. Biology of the Cell 99, 67-86 (2007). 59. Rittinger, K. et al. Crystal structure of a small G protein in complex with the GTPase- activating protein rhoGAP. Nature 388, 693-697 (1997). 60. Nassar, N., Hoffman, G.R., Manor, D., Clardy, J.C. & Cerione, R.A. Structures of Cdc42 bound to the active and catalytically compromised forms of Cdc42GAP. Nat Struct Mol Biol 5, 1047-1052 (1998). 61. Zheng, Y., Bagrodia, S. & Cerione, R.A. Activation of phosphoinositide 3-kinase activity by Cdc42Hs binding to p85. Journal of Biological Chemistry 269, 18727-18730 (1994). 62. Wells, C.D. et al. A Rich1/Amot Complex Regulates the Cdc42 GTPase and Apical- Polarity Proteins in Epithelial Cells. Cell 125, 535-548 (2006). 63. Krugmann, S. et al. Identification of ARAP3, a Novel PI3K Effector Regulating Both Arf and Rho GTPases, by Selective Capture on Phosphoinositide Affinity Matrices. Molecular Cell 9, 95-108 (2002). 64. Daniele, T., Di Tullio, G., Santoro, M., Turacchio, G. & De Matteis, M.A. ARAP1 Regulates EGF Receptor Trafficking and Signalling. Traffic 9, 2221-2235 (2008). 65. Lua, B.L. & Low, B.C. Activation of EGF receptor endocytosis and ERK1/2 signaling by BPGAP1 requires direct interaction with EEN/endophilin II and a functional RhoGAP domain. Journal of Cell Science 118, 2707-2721 (2005). 66. Pan, C.Q., Liou, Y.-c. & Low, B.C. Active Mek2 as a regulatory scaffold that promotes Pin1 binding to BPGAP1 to suppress BPGAP1-induced acute Erk activation and cell migration. Journal of Cell Science 123, 903-916 (2010). 67. Shang, X., Zhou, Y.T. & Low, B.C. Concerted Regulation of Cell Dynamics by BNIP-2 and Cdc42GAP Homology/Sec14p-like, Proline-rich, and GTPase-activating Protein Domains of a Novel Rho GTPase-activating Protein, BPGAP1. Journal of Biological Chemistry 278, 45903-45914 (2003). 68. Watanabe, T. et al. Interaction with IQGAP1 Links APC to Rac1, Cdc42, and Actin Filaments during Cell Polarization and Migration. Developmental Cell 7, 871-883 (2004). 69. Fukata, M. et al. Rac1 and Cdc42 Capture Microtubules through IQGAP1 and CLIP- 170. Cell 109, 873-885 (2002). 70. McNulty, D.E., Li, Z., White, C.D., Sacks, D.B. & Annan, R.S. MAPK Scaffold IQGAP1 Binds the EGF Receptor and Modulates Its Activation. The Journal of Biological Chemistry 286, 15010-15021 (2011). 71. Sugimoto, N. et al. IQGAP1, a negative regulator of cell-cell adhesion, is upregulated by gene amplification at 15q26 in gastric cancer cell lines HSC39 and 40A. J Hum Genet 46, 21-25 (2001). 72. Hu, B. et al. ADP-Ribosylation Factor 6 Regulates Glioma Cell Invasion through the IQ- Domain GTPase-Activating Protein 1-Rac1–Mediated Pathway. Cancer Research 69, 794-801 (2009). 73. Hart, M.J., Eva, A., Evans, T., Aaronson, S.A. & Cerione, R.A. Catalysis of guanine nucleotide exchange on the CDC42Hs protein by the dbloncogene product. Nature 354, 311-314 (1991). 74. Rossman, K.L., Der, C.J. & Sondek, J. GEF means go: turning on RHO GTPases with guanine nucleotide-exchange factors. Nat Rev Mol Cell Biol 6, 167-180 (2005). 75. Worthylake, D.K., Rossman, K.L. & Sondek, J. Crystal structure of Rac1 in complex with the guanine nucleotide exchange region of Tiam1. Nature 408, 682-688 (2000).
Introduction – Small Rho GTPases - 54
76. Aghazadeh, B. et al. Structure and mutagenesis of the Dbl homology domain. Nat Struct Mol Biol 5, 1098-1107 (1998). 77. Snyder, J.T. et al. Structural basis for the selective activation of Rho GTPases by Dbl exchange factors. Nat Struct Mol Biol 9, 468-475 (2002). 78. Cherfils, J. & Chardin, P. GEFs: structural basis for their activation of small GTP-binding proteins. Trends in Biochemical Sciences 24, 306-311 (1999). 79. Buchwald, G. et al. Structural basis for the reversible activation of a Rho protein by the bacterial toxin SopE. The EMBO Journal 21, 3286-3295 (2002). 80. Côté, J.-F. & Vuori, K. Identification of an evolutionarily conserved superfamily of DOCK180-related proteins with guanine nucleotide exchange activity. Journal of Cell Science 115, 4901-4913 (2002). 81. Brugnera, E. et al. Unconventional Rac-GEF activity is mediated through the Dock180- ELMO complex. Nat Cell Biol 4, 574-582 (2002). 82. Rossman, K.L. et al. A crystallographic view of interactions between Dbs and Cdc42: PH domain-assisted guanine nucleotide exchange. The EMBO Journal 21, 1315-1326 (2002). 83. Schmidt, A. & Hall, A. Guanine nucleotide exchange factors for Rho GTPases: turning on the switch. Genes & Development 16, 1587-1609 (2002). 84. Salazar, M.A. et al. Tuba, a Novel Protein Containing Bin/Amphiphysin/Rvs and Dbl Homology Domains, Links Dynamin to Regulation of the Actin Cytoskeleton. Journal of Biological Chemistry 278, 49031-49043 (2003). 85. Snyder, J.T. et al. Quantitative Analysis of the Effect of Phosphoinositide Interactions on the Function of Dbl Family Proteins. Journal of Biological Chemistry 276, 45868- 45875 (2001). 86. Baumeister, M.A. et al. Loss of Phosphatidylinositol 3-Phosphate Binding by the C- terminal Tiam-1 Pleckstrin Homology Domain Prevents in Vivo Rac1 Activation without Affecting Membrane Targeting. Journal of Biological Chemistry 278, 11457- 11464 (2003). 87. Crompton, A.M. et al. Regulation of Tiam1 Nucleotide Exchange Activity by Pleckstrin Domain Binding Ligands. Journal of Biological Chemistry 275, 25751-25759 (2000). 88. Han, J. et al. Role of Substrates and Products of PI 3-kinase in Regulating Activation of Rac-Related Guanosine Triphosphatases by Vav. Science 279, 558-560 (1998). 89. Crespo, P., Schuebel, K.E., Ostrom, A.A., Gutkind, J.S. & Bustelo, X.R. Phosphotyrosine- dependent activation of Rac-1 GDP/GTP exchange by the vav proto-oncogene product. Nature 385, 169-172 (1997). 90. Kesavapany, S. et al. p35/Cyclin-Dependent Kinase 5 Phosphorylation of Ras Guanine Nucleotide Releasing Factor 2 (RasGRF2) Mediates Rac-Dependent Extracellular Signal-Regulated Kinase 1/2 Activity, Altering RasGRF2 and Microtubule-Associated Protein 1b Distribution in Neurons. The Journal of Neuroscience 24, 4421-4431 (2004). 91. Calvo, F. et al. RasGRF suppresses Cdc42-mediated tumour cell movement, cytoskeletal dynamics and transformation. Nat Cell Biol 13, 819-826 (2011). 92. Zhan, L. et al. Deregulation of Scribble Promotes Mammary Tumorigenesis and Reveals a Role for Cell Polarity in Carcinoma. Cell 135, 865-878 (2008). 93. Dow, L.E. et al. The tumour-suppressor Scribble dictates cell polarity during directed epithelial migration: regulation of Rho GTPase recruitment to the leading edge. Oncogene 26, 2272-2282 (2006).
Introduction – Small Rho GTPases - 55
94. Osmani, N., Vitale, N., Borg, J.-P. & Etienne-Manneville, S. Scrib Controls Cdc42 Localization and Activity to Promote Cell Polarization during Astrocyte Migration. Current Biology 16, 2395-2405 (2006). 95. Cau, J. & Hall, A. Cdc42 controls the polarity of the actin and microtubule cytoskeletons through two distinct signal transduction pathways. Journal of Cell Science 118, 2579-2587 (2005). 96. Chen, X. & Macara, I.G. Par-3 controls tight junction assembly through the Rac exchange factor Tiam1. Nat Cell Biol 7, 262-269 (2005). 97. Mertens, A.E.E., Rygiel, T.P., Olivo, C., van der Kammen, R. & Collard, J.G. The Rac activator Tiam1 controls tight junction biogenesis in keratinocytes through binding to and activation of the Par polarity complex. The Journal of Cell Biology 170, 1029-1037 (2005). 98. Xue, B., Krishnamurthy, K., Allred, D.C. & Muthuswamy, S.K. Loss of Par3 promotes breast cancer metastasis by compromising cell–cell cohesion. Nat Cell Biol 15, 189- 200 (2013). 99. Ron, D., Graziani, G., Aaronson, S.A. & Eva, A. The N-terminal region of proto-dbl down regulates its transforming activity. Oncogene 4, 1067-1072 (1989). 100. Katzav, S., Cleveland, J.L., Heslop, H.E. & Pulido, D. Loss of the amino-terminal helix- loop-helix domain of the vav proto-oncogene activates its transforming potential. Molecular and Cellular Biology 11, 1912-1920 (1991). 101. Miki, T., Smith, C.L., Long, J.E., Eva, A. & Fleming, T.P. Oncogene ect2 is related to regulators of small GTP-binding proteins. Nature 362, 462-465 (1993). 102. Kawasaki, Y. et al. Asef, a Link Between the Tumor Suppressor APC and G-Protein Signaling. Science 289, 1194-1197 (2000). 103. Mattingly, R.R., Saini, V. & Macara, I.G. Activation of the Ras-GRF/CDC25Mm Exchange Factor by Lysophosphatidic Acid. Cellular Signalling 11, 603-610 (1999). 104. Arozarena, I. et al. The Rho Family GTPase Cdc42 Regulates the Activation of Ras/MAP Kinase by the Exchange Factor Ras-GRF. Journal of Biological Chemistry 275, 26441- 26448 (2000). 105. Arozarena, I., Matallanas, D. & Crespo, P. Maintenance of Cdc42 GDP-bound State by Rho-GDI Inhibits MAP Kinase Activation by the Exchange Factor Ras-GRF: EVIDENCE FOR Ras-GRF FUNCTION BEING INHIBITED BY Cdc42-GDP BUT UNAFFECTED BY Cdc42- GTP. Journal of Biological Chemistry 276, 21878-21884 (2001). 106. Hart, M.J. et al. A GDP dissociation inhibitor that serves as a GTPase inhibitor for the Ras-like protein CDC42Hs. Science 258, 812-815 (1992). 107. Johnson, J.L., Erickson, J.W. & Cerione, R.A. New Insights into How the Rho Guanine Nucleotide Dissociation Inhibitor Regulates the Interaction of Cdc42 with Membranes. Journal of Biological Chemistry 284, 23860-23871 (2009). 108. DerMardirossian, C. & Bokoch, G.M. GDIs: central regulatory molecules in Rho GTPase activation. Trends in Cell Biology 15, 356-363 (2005). 109. Adra, C.N. et al. RhoGDIγ: A GDP-dissociation inhibitor for Rho proteins with preferential expression in brain and pancreas. Proceedings of the National Academy of Sciences 94, 4279-4284 (1997). 110. Hoffman, G.R., Nassar, N. & Cerione, R.A. Structure of the Rho Family GTP-Binding Protein Cdc42 in Complex with the Multifunctional Regulator RhoGDI. Cell 100, 345- 356 (2000).
Introduction – Small Rho GTPases - 56
111. Phillips, M.J., Calero, G., Chan, B., Ramachandran, S. & Cerione, R.A. Effector Proteins Exert an Important Influence on the Signaling-active State of the Small GTPase Cdc42. Journal of Biological Chemistry 283, 14153-14164 (2008). 112. Lin, Q., Fuji, R.N., Yang, W. & Cerione, R.A. RhoGDI Is Required for Cdc42-Mediated Cellular Transformation. Current Biology 13, 1469-1479 (2003). 113. Lin, R., Bagrodia, S., Cerione, R. & Manor, D. A novel Cdc42Hs mutant induces cellular transformation. Current Biology 7, 794-797 (1997). 114. Luan, P., Balch, W.E., Emr, S.D. & Burd, C.G. Molecular Dissection of Guanine Nucleotide Dissociation Inhibitor Function in Vivo : Rab-INDEPENDENT BINDING TO MEMBRANES AND ROLE OF RAB RECYCLING FACTORS. Journal of Biological Chemistry 274, 14806-14817 (1999). 115. DerMardirossian, C., Schnelzer, A. & Bokoch, G.M. Phosphorylation of RhoGDI by Pak1 Mediates Dissociation of Rac GTPase. Molecular Cell 15, 117-127 (2004). 116. DerMardirossian, C., Rocklin, G., Seo, J.-Y. & Bokoch, G.M. Phosphorylation of RhoGDI by Src Regulates Rho GTPase Binding and Cytosol-Membrane Cycling. Molecular Biology of the Cell 17, 4760-4768 (2006). 117. Kuribayashi, K. et al. Essential role of protein kinase C ζ in transducing a motility signal induced by superoxide and a chemotactic peptide, fMLP. The Journal of Cell Biology 176, 1049-1060 (2007). 118. Forget, M.-A., Desrosiers, R.R., Gingras, D. & Béliveau, R. Phosphorylation states of Cdc42 and RhoA regulate their interactions with Rho GDP dissociation inhibitor and their extraction from biological membranes. Biochemical Journal 361, 243-254 (2002). 119. Cerione, R.A. Cdc42: new roads to travel. Trends in Cell Biology 14, 127-132 (2004). 120. Garcia-Mata, R., Boulter, E. & Burridge, K. The 'invisible hand': regulation of RHO GTPases by RHOGDIs. Nat Rev Mol Cell Biol 12, 493-504 (2011). 121. Chianale, F. et al. Diacylglycerol kinase α mediates HGF-induced Rac activation and membrane ruffling by regulating atypical PKC and RhoGDI. Proceedings of the National Academy of Sciences 107, 4182-4187 (2010). 122. Boulter, E. et al. Regulation of Rho GTPase crosstalk, degradation and activity by RhoGDI1. Nat Cell Biol 12, 477-483 (2010).
Introduction – Small Rho GTPases - 57
The secretory pathway
Secretory protein trafficking is an essential and homeostatic function of all eukaryotic cells. Proteins are translated on the cytoplasmic side of the rough ER (RER). There, they are either inserted into the ER membrane, if they are transmembrane proteins or translocated in the ER lumen, if they are soluble proteins. Approximately one third of all eukaryotic proteins are targeted to the secretory pathway and the first compartment they encounter is generally the ER. Proteins exit the ER from distinct domains of the ER termed ER exit sites (ERES) that are located in the ribosomes free regions of the rough endoplasmic reticulum. COPII coat components localize at ERES, where they assemble to coat the vesicles leaving the ER. COPII coated vesicles move towards the ER to Golgi intermediate compartment (ERGIC), a compartment which is biochemically distinct from ER and Golgi that sorts cargo to the Golgi or back to the ER 1, 2. Cargo move from the ERGIC to the Golgi on microtubules, using dynein as motor 3. The Golgi apparatus in mammalian cells is a single copy organelle composed of usually 3-7 flattened cisternae that form the Golgi stack. Several Golgi stacks are connected laterally through membranous tubules and thereby form the Golgi ribbon. Typically, the Golgi occupies a perinuclear region and is closely associated with the centrosome. The cisternae of the Golgi stack are oriented with a defined polarity from cis- (closer to the ER) to trans. Several enzymes (like glycosil transferases and mannosidases) are differentially localized along the Golgi cisternae 4. After the trans-cisterna, a meshwork of tubulo-vesicular structures forms the Trans-Golgi Network (TGN) that is distinct from the trans-Golgi cisterna in terms of enzyme composition and markers. From the TGN, transport intermediates will traffic to their final destination such as the endolysosomal system, the plasma membrane or the extracellular space.
Several vesicles are trafficking between ER and Golgi. COPII coated vesicles traffic from the ER to the Golgi, while COPI coated vesicles traffic backward between Golgi cisternae, from the Golgi to the ERGIC and, finally to the ER. The small GTPase Sar1 is responsible for the formation of COPII vesicles. The ER protein Sec12, the only GEF for Sar1 5, activates Sar1. Sar1- GTP deforms the membrane and recruits the first proteins that will compose the inner layer of the coat, Sec23 and Sec24. Sec23/24 will stabilize the curvature of the membrane imposed by Sar1. Finally, Sec13 and Sec31, which form a heterotetramer, are recruited to form the
Introduction – Secretory Pathway - 58
outer layer of the COPII coat and to complete the budding of the vesicle. The final size of the vesicle will be around 50-90nm (dependent on species), similar to the vesicles formed at the other levels of the secretory pathway 6. The different components of the COPII coat fulfill distinct functions. The Sar1 GTPase initiate the COPII coat assembly, deforms membranes and finally also helps in fission of the COPII vesicle. Sec23 acts as a GAP for Sar1 and its activity is stimulated by 10fold upon recruitment of the Sec13-31 hetero-oligomer. This will result in Sar1 inactivation and serves to limit the reaction and to promote disassembly of the COPII coat. Sec24, of which four isoforms exits (A-D), acts as an adaptor for secretory cargo by interacting with various ER export motifs 7. Besides these core COPII components, several other proteins help in assembly of the ERES, stimulate COPII budding, or aid in exporting secretory cargo. Sec16 for instance, is a large (250 kDa) protein that does not incorporate into the COPII vesicle, but is nevertheless essential to form ERES and it stimulates the formation of COPII vesicles 6, 8-11, Sec16, localizes to ERES in a manner independent on COPII components 12 and it interacts with many COPII proteins 9, 11, 12. Soluble cargo in the lumen of the ER does not have access to the cytosolic COPII components and is therefore dependent on so called cargo receptors. Three major families of cargo receptors exist: the ERGIC53 family (ERGIC53, ERGL, VIP36 and VIPL that bind to glycoproteins), the p24 family (8-10 members, probably with differential affinities for different cargo) and the ERV family (binding to soluble and transmembrane proteins cargo). Receptors of these three categories cycle between ER, ERGIC and Golgi and can bind to both COPI and COPII vesicles 13. The mechanism by which COPI coated vesicles form is similar to the biogenesis of COPII vesicles. The Arf small GTPases recruit COPI vesicles. GBF1 is an Arf GEF restricted to Golgi and ERGIC. There are 6 Arfs in mammals, divided in three classes: Class I (Arf 1, 2 and 3) Class II (Arf4 and 5) and Class III (Arf6) 14. Arf6 is on endosomes and at the plasma membrane, whereas Arf1-5 are mainly distributed throughout the secretory pathway. The COPI coat is composed by seven proteins called coatomers that assemble in a subcomplex of three proteins (α, β’, ε) and another of four proteins (β, γ, δ, ζ) 13. The trimeric complex α, β’, ε has some structural similarities to Sec13/31. α, β’ and γ recognize transport motifs of type I transmembrane proteins. Type II transmembrane proteins are recognized by adaptor proteins such as Vps74 and soluble proteins are recognized by the KDEL receptor. There are several γ and ζ isoforms that show different subcellular localization, probably reflecting differences in the composition of COPI coats forming at the Golgi or at the ERGIC 15, 16. COPI vesicles that Introduction – Secretory Pathway - 59
shuttle between Golgi cisternae are different from COPI vesicles trafficking back to the ER 17- 19. Using p115 (ER, ERGIC and Golgi localization) as tether, only COPI vesicles enriched in p24 family members are found, whereas with the Golgi localized tether Golgin84 it is possible to identify COPI vesicles rich in Golgi resident enzymes (such as Mannosidase I and II), but poor in p24 family proteins 17. ArfGAPs are necessary for COPI vesicle formation. The p24 cargo that recycles from the Golgi to the ER can modulate the activity of ArfGAP1. If there is no cargo, ArfGAP activity is high. As soon as p24 proteins accumulate, they inhibit ArfGAP1, thus stabilizing the COPI coat and promoting their recycling 18. Contrary to what happens in COPII vesicles, where the Sar1 GAP is part of the coat, ArfGAPs are only transiently associated with the vesicles. However, even if ArfGAPs are not part of the cytosolic COPI vesicles, they are needed to assemble the COPI coat, thus their function is similar to Sar1 in COPII vesicle formation 20 Once vesicles bud, they move on microtubules until they are captured by tethering proteins that bring them in close proximity to their target membrane. Tethers also bind SNAREs (soluble N-ethylmaleimide-sensitive factor attachment protein receptors) and Rabs, necessary for the fusion of the vesicles 21, 22. Tethers can be either long coiled coil proteins that catch the vesicle from a long distance or multisubunits complexes that act mainly on the target membrane 13. p115 (Uso1p in yeast) is a tether which is dynamically located at the ERGIC and at the Golgi and it is thought to work together with other tethers such as GM130 and GRASP65 to target vesicles to these compartments. Rab1-GTP binds to p115 and recruits it on COPII vesicles. At the same time, Rab1-GTP binds to GM130, either directly, or indirectly via GRASP65, thereby linking the different tethers and allowing fusion of vesicles with their target membrane 21. These data are however, difficult to reconcile with the fact that in mammalian cells, COPII vesicles never reach the Golgi 23, and therefore, the mechanism of carrier arrival at the cis-Golgi remains elusive and the role of p115 needs to be studied in greater detail. The intra-Golgi tether Golgin84 also binds Rab1, but it does not bind p115, GM130 or GRASP65 24. Instead, it interacts with two other tethers localized exclusively at the Golgi: CASP and COG (Conserved Oligomeric Golgi) 17, 24. Golgin84 is required for COPI trafficking and, accordingly, its depletion will cause defects in the distribution of several Golgi proteins 24. GRASP55, a medial-Golgi protein, interacts with the coiled coil Golgin45 and this interaction is necessary for anterograde trafficking within the Golgi 22. Interestingly, GRASP55, Golgin45 and GM130 interact with Rab2 22. This allows to draw a trafficking route within the Golgi, where cargo arrives to the cis-Golgi via p115 and its interacting partners GRASP65 and Introduction – Secretory Pathway - 60
GM130, then, possibly via GM130, cargo moves forward to the GRASP55-Golgin45 tether. Several tethers not only interact with Rab, but also work as Rab GEFs. This is the case of the TRAPP complex, which is a COPII tether with GEF activity towards Rab1 25. TRAPP is a multi- subunit tether and depending on the subunits assembled together, three different TRAPP complexes can be distinguished. The TRAPPI complex binds specifically to COPII vesicles and regulates their homotypic fusion, the TRAPPII complex is a COPI tether and the TRAPPIII complex has a role in autophagy 26. Interestingly, a subunit of the TRAPPII complex was shown to recruit an Arf GEF, therefore conferring to the complex the ability to control the activation of both Arf1 and Rab1 26. This finding is of relevance because Rab1 is also important for COPI vesicles transport. Overexpression of a constitutively active Rab1 prevents recycling of Golgi proteins to the ER upon BFA treatment. Conversely, dominant negative Rab1 promotes retrograde traffic to the ER and causes dissociation of β-COP from membranes. Probably Rab1 acts upstream of Arf because overexpression of Arf1 rescues the phenotype caused by dominant negative Rab1 27. Finally, SNAREs mediate the fusion of the vesicles to the membranes. SNARE proteins are on the vesicle (v-SNARES) or on the target membrane (t-SNARES). Before fusion, SNARE are in trans- (v and t -SNARES are on two different membranes), then after fusion they assume their cis- conformation. Once vesicles are fused, the SNARE complexes are disassembled in an ATP- dependent process through the action of the N-ethylmaleimide-sensitive factor (NSF), thus restoring the original pool of v- and t-SNARES 13. There is no unique model describing how proteins traffic through the Golgi. The two main hypothesis are the cisternal maturation model and the anterograde vesicular transport. Both models are supported by experimental observation, but they all suffer from some weaknesses. According to the anterograde vesicular transport, each compartment of the Golgi possess a unique set of enzymes and cargo moves forward via COPI vesicles. Supporting this model there is the evidence that two populations of COPI vesicles exist, one of which containing anterograde cargo 19. However, big cargo molecules such as pro-collagen, do not fit in COPI vesicles. Therefore, according to this model, large proteins traffic via megavesicles. The existence of such megavesicles is not widely accepted, and evidence for these is sparse 28 29. What also argues for the existence of vesicles is the observation that different types of cargo traverse the Golgi stack at distinct kinetics. The second model predicts that cisternae will move forward from cis- to trans- and change their enzymatic content while moving, Introduction – Secretory Pathway - 61
thereby maturating. According to this model, COPII vesicles coming from the ER-ERGIC fuse to form the first cis-Golgi cisterna. The cisterna will then progress until the TGN, with COPI vesicles recycling Golgi resident enzymes at different speeds, thus producing the polarized distribution of the enzymes across the Golgi 29, 30. The problem with this model is that several Golgi resident enzymes have not been observed in COPI vesicles, therefore it is difficult to explain how would the polarity of such enzymes be maintained 31. In addition, it is difficult to reconcile this model with the fast kinetics observed for small cargo proteins. However, it was observed that cargo arrival to the Golgi induces the formation of tubular connection between Golgi cisternae 32. The presence of these tubular structures can readily account for the fast trafficking of small cargo and for recycling of Golgi-resident enzymes. After crossing all the Golgi cisternae, cargo proteins arrive to the TGN Contrary to what is observed in the rest of the Golgi, the main coat at the TGN is a clathrin coat 33. Arf1 is important also at the TGN to recruit clathrin adaptors such as AP1 and AP3. The adaptor recruited will determine the final destination of the cargo 34, 35. In addition, several transmembrane protein have a signal sequence in their cytosolic tail that functions as a sorting motif 36, 37. Post translational modifications can also work as sorting signals. For instance, O and N glycosylation function as apical targets in MDCK cells 38. Finally, lipid microdomains can participate in the segregation of specific cargo and target such cargo to apical or basal membranes in polarized cells 39. In general, apical signals are less characterized than baso-lateral signals and it seems that baso-lateral signals are dominant, as it is often observed that upon removal of baso-lateral signals, proteins are redirected apically 40. Membranes at the TGN tubulate in an yet unknown mechanism probably involving BAR proteins and lipids 37. Cargo will then traffic to its final destination via microtubules, using the motor kinesin. The nature of post-Golgi carriers remained elusive for a very long time, but recent work indicates the existence of different types of carriers with selectivity for cargos 40- 42. The Adaptor Proteins 1b (AP1b) mediates exit from the TGN of baso-lateral protein in a clathrin-mediated way 35. AP4 was also described to direct baso-lateral proteins from the TGN, but the mechanism directing this process remains to be elucidated and it is probably not dependent on clathrin since AP4 does not interact with clathrin 43. Another class of carriers was recently identified at the TGN that transports proteins directly to the cell surface, and it was termed CARTS (Carriers of the TGN to the cell Surface). They form in a PKD dependent manner and are responsible only for the transport of specific proteins 44. It was shown that Introduction – Secretory Pathway - 62
they exclude collagen and VSVG, but they contain pancreatic adenocarcinoma upregulated factor (PAUF). The discovery of CARTS opens the possibility that many more TGN carriers exist and that the diversity of the carriers could be a mechanism to sort proteins to different destinations. However, several questions need to be answered, such as how those transporters are recruited only to specific cargoes. It is possible that such carriers are regulated by signaling. PKD regulates CARTS, but Cdc42 was shown to modulate exit from the TGN, thus it is tempting to speculate that Cdc42 functions by modulating specific carriers at the TGN. If it is known that Cdc42 plays an important role in sorting proteins from the TGN, still, the mechanism by which the small GTPase exerts its function remains elusive. Overexpression of mutants of Cdc42 defective in hydrolysis or in nucleotide binding resulted in altered exit of baso-lateral and apical proteins from the TGN. In particular, overexpression of the constitutively active Cdc42V12 caused apical proteins to exit faster from the TGN and delayed trafficking of baso-lateral proteins. Concomitantly, intracellular actin was almost completely lost and redistributed to the cell cortex, suggesting that actin filaments at the Golgi might play a role in protein sorting 45. Since both constitutively active and constitutively inactive Cdc42 cause defects in protein sorting from the TGN, it can be concluded that cycling of the small GTPase is necessary to control trafficking from the TGN, thus Cdc42 GEFs and/or GAPs should be also localized to the TGN. To date, only one GEF specific for Cdc42 has been localized there, namely FGD1 46. Accordingly to the role of Cdc42 in protein trafficking, knockdown of FGD1 or overexpression of the inactive form of the GEF impaired exit of all proteins from the TGN 46. Whether FGD1 is the only regulator of Cdc42 at the TGN is a question that still need to be answered.
Signaling at the secretory pathway The secretory pathway is targeted by several signaling cascades which modulate its function in different ways 47, 48. For example, the ER can adapt to changes in its cargo load. When an acute stress induces more trafficking, ERES fuse homotypically resulting in a reduction in the overall number of ERES, but with bigger size. This adaptation is mediated by PI4KIIIa and by Sec16 49. When a chronic cargo is imposed to the cells, the number of ERES increases, plus an induction of Sec16 is observed. In this case, PI4KIIIa is dispensable for the effect, while Sec16 knockdown abolishes this adaptation. The latter response was shown to be dependent on the unfolded protein response, which induces Sec16 and several other trafficking components. Introduction – Secretory Pathway - 63
ERES also respond to environmental stimuli, such as the presence or absence of growth factors and nutrients, which all seem to converge at the level of Sec16 that is targeted by kinases such as ERK2 and ERK8 47, 50, 51. Membranes of the secretory pathway undergo dramatic changes during mitosis and hence a wealth of information exists on mitotic signaling targeting several components of endomembranes. During the G2 phase of the cell cycle, the Golgi is fragmented in response to a series of signaling pathways mediated by kinases 52. CDK1 phosphorylates several proteins localized to the early secretory pathway, like Rab1, GM130 and GRASP65 53, 54. Once phosphorylated, GRASP65 is not able to form oligomers anymore and this is probably the cause of fragmentation of the Golgi 55. At the same time, phosphorylated GM130 loses its ability to bind p115, resulting in a defect in anterograde trafficking and subsequent fragmentation of the Golgi 54, 56. Phosphorylated GRASP65 and Rab1 bind to Polo-Like Kinase 1 (Plk1), a kinase necessary for several aspects of mitotic progression. When Golgi disassembly is prevented by addition of antibodies anti-GRASP65, the cell does not enter mitosis. Treatment with drugs that fragment the Golgi release this mitotic block. Therefore, the Golgi acts as a mitotic check point 57. Plk1 recruitment by GRASP65 is necessary for the correct progression of mitosis 53. Several other kinases have been shown to signal at the Golgi during mitosis and induce fragmentation of the organelle 58, 59. Analysis of the kinome and phosphatome revealed that 8% of the phosphatome and 15% of the kinome signal to the secretory pathway 47, showing that the secretory pathway is a main target for signal transduction cascades. 38 kinases and phosphatases were identified the knockdown of which results in Golgi fragmentation. Knockdown of some of these proteins resulted in impaired cell migration and inhibition of Golgi orientation in a wound assay 47. This is in line with previous reports showing the intact Golgi architecture is important for directed cell motility 60, 61. This observation is a hint that signaling to the secretory pathway can modulate cell polarity. The Golgi was also shown to be target of apoptotic signaling pathways 62-64. Several Golgi proteins are cleaved by caspases during apoptosis 65-67 , which result in Golgi fragmentation or vesiculation. However, this is not simply an epiphenomenon of apoptosis, as Golgi fragmentation was shown to play an active role in the process of cell death. A mutant of GRASP65 resistant to cleavage by Caspase3 blocks Golgi fragmentation 65 and delays apoptosis induced by Fas or by ER stress stimuli 68. The C terminal fragment of GRASP65 is targeted to mitochondria and interacts with the pro-apoptotic protein Bcl-XL in response to Introduction – Secretory Pathway - 64
Fas. Thus, cleavage of GRASP65 results in translocation of Bcl-XL to mitochondria and amplification of the apoptotic signals 68. Caspase3 cleaves also p115, resulting in fragmentation of the Golgi 67. Interestingly, expression of the C-terminal caspase cleavage fragment of p115 is sufficient to induce caspase mediated apoptosis 67. Based on the observation that the C terminal fragment of p115 translocates to the nucleus, it was proposed that such fragments initiates pro-apoptotic stimuli in the nucleus 67. Finally, the cis-Golgi protein Golgin160 is cleaved specifically by Caspase2, a Golgi localized caspase 62, 63. Similar to what has been documented for GRASP65, overexpression of a mutant of Golgin160 not cleavable by caspases rescues Golgi fragmentation and delays apoptosis induced by ER stress stimuli 62. Golgin160 might act by sequestering Caspase2 at the Golgi, thus blocking its function. As it is the case for p115, there is evidence that caspase generated fragments of Golgin160 translocate to the nucleus 69. The case of the Golgi in apoptosis is a further example of how endomembranes are targeted by signaling cascades and since fragments of Golgi proteins were also shown to themselves modulate signaling, it is also an example of how the Golgi can modulate a signaling pathway. However, there are cases where endomembranes are the source of the signaling cascade. A lot of excitement was generated when the small GTPase H-Ras was shown to signal from ER and Golgi 70. Even more surprisingly, activation of Ras from different subcellular locations resulted in differential activation of pathways downstream of Ras. Golgi activation of Ras resulted in a more potent activation of Akt than PM signaling. From the ER, instead, Ras activated preferentially the JNK pathway 70. Src family kinases were shown to be necessary to activate Ras on endomembranes 70. Bivona et al. fully elucidated the mechanism that activates Ras at the Golgi. Src signals to PLCγ1, that in turn recruits the Ras GEF RasGRP1 to the Golgi 71. Importantly, Golgi restricted Ras was still able to mediate differentiation of PC12 cells, demonstrating that this pool is biologically relevant 71. In another study, constitutively active Ras was targeted to ER or Golgi and several processes downstream of Ras were analyzed. ER signaling resulted overall in an antiapoptotic effect, while signaling from the Golgi resulted in reduced proliferation and transformation 72. After Ras signaling, several other signaling cascades were localized to the secretory pathway, and in particular to the Golgi apparatus. Phosphoinositides have been shown to control the Golgi and also to compartmentalize signals from the Golgi 73, 74. Another signaling cascade was identified at the TGN, where GOLPH3 was shown to regulate mTOR signaling 75, but the mechanism behind this connection remains Introduction – Secretory Pathway - 65
elusive. In the context of signaling from the Golgi apparatus, GM130 appears to be a very important protein. In fact, it functions as a scaffold for the Ste20 family kinases YSK1 and MST4, the interaction being of relevance for cell motility 61. The Golgi has long been linked to cell migration and polarity 60, 76, but no clear mechanism elucidating its function in those processes had ever been proposed, therefore the link between GM130 and YSK is of particular importance.
The Golgi Apparatus in cell polarity Preisinger et al. identified the Ste20 family kinases MST4 and YSK1 as interaction partners of GM130 61. GM130 is responsible for the Golgi targeting of those two kinases and for their autophosphorylation that activates them. The binding to GM130 probably favors homodimerization of the kinases, resulting in their activation 61. Overexpression of unphosphorylatable YSK1, as well as depletion of YSK1 or MST4 results in Golgi fragmentation and abolishment of Golgi reorientation in a wound healing assay. Consistently, cells lose their invasiveness into collagen. Instead, unphosphorylatable MST4 does not alter Golgi structure, neither it affect migration or invasion. Overexpression of MST4 wt has the same effects of unphosphorylatable YSK1, speaking in favor of a model where the two kinases antagonize each other. Even if the two kinases are strictly related, they have different effectors. 14-3-3ζ was found to be an effector of YSK1 that most probably mediates the effect of YSK1 in migration and invasion 61. YSK1 and MST4 have also been linked to neuronal polarity and apico-basal polarity 77, 78. In intestinal cells, MST4 is recruited to a complex composed by activated LKB1, STRADα and Mo25, and it is necessary to induce brush border formation downstream of LKB1. In resting cells, MST4 is observed at the Golgi, together with GM130. When LKB1 is activated, MST4 translocates to the apical membrane, where it phosphorylates Ezrin, thus promoting brush border formation. The mechanism behind the decision of MST4 to stay at the Golgi or leave it remains unclear since LKB1 does not activate MST4 directly 77. GM130 and LKB1 could compete for the binding to MST4 or alternatively, they could cooperate to spatially restrict MST4 signaling 61. LKB1 promotes the recruitment of phospholipase D1 (PLD1) to the apical membrane, which converts PI4,5P2 in phosphatic acid, resulting in the recruitment of a GEF for the small GTPase Rap2A. Active Rap2A recruits TNIK, the kinase responsible for the activation of MST4 downstream of LKB1 79. This model raises several question about the role of GM130 in apico-basal polarity. Is the interaction between Introduction – Secretory Pathway - 66
MST4 and GM130 necessary for apical brush border formation? LKB1 depletion impairs the ability of the Golgi to reorient towards a wound in migrating cells 80. Therefore, it can be speculated that LKB1 signals to GM130 and this signaling drives reorientation of the Golgi towards the apical membrane of polarizing cells, ultimately causing polarized delivery of MST4 to the apical membrane. LKB1 and GM130 might thus signal to each other. In neurons, Ysk1 (also called Stk25) mediates crosstalk between GM130 and LKB1. GM130 acts as a scaffold for Ysk1 at the Golgi 78. Ysk1 interacts with STRADα, the activator of LKB1 and depletion of Ysk1 results in less active LKB1 78. Knockdown of either Ysk1, LKB1 or GM130 results in fragmentation of the Golgi and impaired axon formation. Interestingly, expression of both active and inactive Ysk1 rescued axon formation in Ysk1 depleted cells, showing that the scaffolding function of Ysk1 is important in this process 78. Ysk1 overexpression could also rescue the morphology of the Golgi in LKB1 depleted cells, but not in GM130 depleted cells. However it is not clear from this study if LKB1 signals to GM130 or if conversely, GM130 signals to LKB1 via Ysk1. Reorientation of the Golgi towards the growing axon has been observed long time ago and such phenomenon is not simply a passive event of the neuronal differentiation process. It is clear in fact that the position of the Golgi in differentiating neurons will determine which neurite will become the axon 81. By orienting towards the nascent axon, the Golgi polarizes traffic and thus sustains the growth of the structure. If trafficking is blocked the axon does not form 82. However, Golgi reorientation towards the axon is only transient, while in the end the Golgi will position in front of a dendrite that will become the primary dendrite, thus the organelle will determine also dendritic polarity 83, 84. Reorientation of the Golgi precedes and predicts asymmetrical dendritic growth 83. If post Golgi traffic is blocked by BFA treatment or by expression of a kinase dead PKD, dendrites do not grow anymore, showing the importance of traffic to sustain dendrite growth. When polarization of the Golgi is prevented by overexpressing GRASP65, condition where post-Golgi traffic remains unaffected, the dendrites grow well, but no apical dendrite forms, meaning that if traffic sustains dendrite growth, it is the positioning of the Golgi that determines the primary dendrite 83. Golgi outposts are also observed at branching points of dendrites, mainly in the primary dendrite 83, 85. Those Golgi outposts probably work as intermediate stations of protein traffic and are necessary for the dynamical growth and retraction of the dendrites branches 85. Finally, the Golgi shapes polarity of immune cells during the formation of the immunological synapse 86, 87. Recognition of a target by either Cytotoxic T Limphocytes (CTLs) Introduction – Secretory Pathway - 67
or Natural Killer (NK) cells triggers rapid polarization of the MTOC and of the Golgi towards the zone of the plasma membrane that established physical contact with the target, thus establishing the so-called immunological synapse 86, 87. Reorientation of the Golgi makes it possible for CTLs and NK to kill their targets by secreting specialized granules filled with cytotoxic molecules, a process that has been renamed the kiss of death 88.
The Golgi Apparatus in cell migration In the context of front-rear polarity, it is known that the Golgi reorients towards the front of a migrating cell 76, but still it is not clear whether this reorientation is a primary event or if it is instead a passive response of the Golgi to cell migration. It is known that the ability of the Golgi to polarize depends on Cdc42 and on dynein 89-91. Src and PI3K are most likely the receptors triggering the activation of Cdc42 at the plasma membrane necessary to reorient the Golgi 89, 92 and the whole secretory machinery towards the leading edge 93. Despite the widely recognized importance of this polarization, it is not yet clear whether the Golgi is instructed to orient towards the leading edge, and therefore is a passive player of the process, or if it is instead an active participant to cell polarization, meaning that it contributes to the whole process by modulating or initiating signaling. The work of Preisinger et al. showed that signaling at the Golgi is important for cell migration 61. This was based on the observation that YSK1 localizes to the Golgi and is important for maintaining its structural integrity. However, a kinase dead mutant of Ysk1 did not affect migration 61, so it cannot be excluded that the defects observed in cell migration and invasion are due to the fragmentation of the Golgi and not a consequence of altered Ysk1 signaling. In fact, there is plenty of examples in the literature of conditions that fragment the Golgi and impair cell migration. Golgin160 or GMAP210 depletion lead to fragmentation of the Golgi. Even if post Golgi trafficking and Golgi to ER trafficking are not affected by fragmentation, the cell lose their ability to polarize secretion of proteins and lipids to the leading edge, thus resulting in impaired directed migration 60. Accordingly with the inability of the Golgi to polarize, no acetylated microtubules pointing to the leading edge form and the actin cytoskeleton does not polarize upon knockdown of Golgin160 or GMAP210 60. The proposed model is that impairment of reorientation of the Golgi will result in impaired polarized trafficking and therefore directed migration will be inhibited. However, to finally answer the
Introduction – Secretory Pathway - 68
question about the role of the Golgi in cell migration, the ideal condition would be to block the polarization cue, leaving intact the structure of the organelle. In order to correctly polarize secretion, cells need to have microtubules oriented towards the leading edge. The Golgi can nucleate microtubules 94 and the current understanding of Golgi derived microtubules assumes that microtubules arising at the Golgi are the only polarized microtubules in a migrating cell, whereas centrosomal microtubules will be radially distributed and thus not useful to sustain polarized secretion 95, 96. Golgi microtubules form independently of the centrosome, but still require the γTubulin Ring Complex (γTuRC) 95. Rivero et al. found that AKAP450, a protein that interacts with γTubulin via p150 Glue, is kept at the Golgi by GM130 and it is necessary to nucleate Golgi microtubules. Knockdown of AKAP450 results in a reduction in the acetylated tubulin normally localized at the Golgi area. In addition, cells migrate less efficiently into a wound, even though their Golgi are oriented in the direction of migration 96. Overexpression of a fragment of AKAP450 containing the GM130 interacting region, but lacking the region binding to p150glue, resulted in loss of Golgi derived microtubules, fragmentation of the Golgi and impaired exit of cargo from the Golgi, with subsequent impairment of cell migration 97. While the defect in cargo exit from the Golgi was only mild, no polarized secretion could be achieved in a migrating cell. Overexpression of the AKAP450 fragment displaces the full length endogenous protein from the Golgi, but leaves unaffected the other pools of AKAP450. Accordingly, centrosome derived microtubules were unaffected in this condition 97. The strong defect observed in polarized secretion could be due to the lack of Golgi derived microtubules, thus supporting the hypothesis that this pool of microtubules is necessary for polarized secretion. By tracking microtubules dynamics in migrating cells, Efimov et al. identified CLASPs as essential components to nucleate microtubules from the Golgi. CLASP1 and 2 are localized at the TGN via an interaction with the golgin GCC185 95. CLASPs stabilize microtubules growing from the Golgi and depletion of either CLASPs or GCC185 impairs Golgi microtubules formation 95. As it was observed for AKAP450, depletion of CLASPs results in a defective persistent migration, but does not affect the reorientation of the MTOC 98. It is possible to combine those two models to explain how microtubules are nucleated at the Golgi: microtubules seeds might be formed at the cis-side of the Golgi via AKAP450, then they either dissociate from membranes and bind again to the TGN or proceed on Golgi membranes until those membranes reach the TGN, where CLASPs stabilize the nascent microtubules and Introduction – Secretory Pathway - 69
promote their growth. Recently, a microtubules crosslinking protein named MTCL1 has been identified at the Golgi, its localization dependent on AKAP450 and CLASPs 99. This protein was previously shown to be important to stabilize the apico-basal bundle of microtubules in MDCK cells. Thus, it can be speculated that Golgi derived microtubules are also involved in the maintenance of apico-basal polarity100.
The mechanism that causes reorientation of the Golgi in response to a migratory stimulus has been studied, but it still not well understood. Cdc42 is activated at the plasma membrane downstream of Src and PI3K 89, 92, 101. Active Cdc42 probably control microtubules dynamics by locally regulating dynein activity. Dynein was shown to be necessary for Golgi reorientation 89, 90 and it is possible that local dynein activity generates a pulling force that leads to Golgi reorientation. The localized polymerization of actin induced by Cdc42 does not seem to be necessary for Golgi reorientation 89, 90, however it has been reported that treatment of cells with CytochalasinD (which disrupts the actin cytoskeleton) inhibited Golgi orientation in an electric field 92. In addition to exerting a pulling force, microtubules serve as roads for vesicle traffic. It has been observed that Cdc42 traffics both backward to the cell center and forward to the leading edge following microtubules 89, 91. In a model of directed migration in an electric field, it has been observed that the first change in the cell in response to a polarizing stimulus is the formation of a lamellipodium. This is followed by reorientation of the Golgi and, if the Golgi does not reorient, the lamellipodium simply disappears, to form again in another point of the plasma membrane 92. An intriguing hypothesis linking these findings would be that the Golgi delivers either active Cdc42, or activators of this GTPase to the leading edge, thereby maintaining an active pool of the small GTPase and allowing persistent directed migration. Proving this hypothesis would be of great importance for the field and in addition similar work is needed for other modes of directed motility, other than migration in an electric field. Phosphorylation of GRASP65 by ERK was shown to be necessary to allow reorientation of the Golgi towads the leading edge 102. Interestingly, ERK phosphorylates GRASP65 on the same residue that is also phosphorylated in mitosis (Ser277) 53 . While this leads to Golgi fragmentation in mitosis, it does not have any appreciable effect on Golgi morphology in migrating cells. This can be probably explained by the fact that in mitosis GRASP65 is phosphorylated on multiple sites, and in addition, other Golgi proteins are phosphorylated 103, 104. During migration, GRASP65 is the only Golgi protein phosphorylated by ERK 102. It might
Introduction – Secretory Pathway - 70
be possible that this phosphorylation makes the Golgi less tight and therefore it is easier for the organelle to polarize, but to proof this imaging at higher resolution such as electron microscopy or super-resolution microscopy would be required. When GRASP65 is mutated on Ser277, the Golgi does not reorient, and neither does the centrosome. However, upon BFA dispersal of the Golgi, the centrosome reorients 102. A possible interpretation is that, because of its bigger size, the Golgi imposes a physical block to the centrosome and when the Golgi is fragmented, this block is removed. The link between Golgi and the centrosome might be mediated by GMAP210. This Golgi protein binds to the minus end of microtubules and it interact with γTubulin 105. This could represent a physical connection between the Golgi and the centrosome and as a proof of this hypothesis, when GMAP210 is artificially targeted to the mitochondria, the mitochondria assume a perinuclear localization, close to the centrosome 105. GM130 could represent another link between Golgi and centrosome 97, 106. GM130 could control centrosome positioning in two ways. First, it interacts with AKAP450, and this interaction is important to maintain Golgi integrity and for the perinuclear localization of the organelle 97. Second, GM130 binds to TUBA, a Cdc42 GEF that is also important for centrosome positioning 107. According to this study, Cdc42 activity is required to correctly localize the centrosome in interphase and mitosis, and GM130 is proposed to regulate a the activity of the small GTPase specifically at the Golgi 107. However, we and others failed to localize TUBA at the Golgi 108-110, therefore further investigation is needed in order to validate this hypothesis.
Golgi and cancer Given that the Golgi is implicated in cell migration and polarity, it is not surprising to find that the Golgi is also important for tumorigenesis or for metastatic dissemination of tumor cells. Indeed, the structure of the Golgi is altered in many cancers 111, 112 and some Golgi resident proteins have been implicated in controlling tumor formation. Surprisingly, however, none of these proteins is implicated in tumorigenesis because of a function in cell migration and polarity. The first Golgi protein to be linked with cancer was GOLPH3 75. GOLPH3 is a component of the TGN that regulates retrograde transport of proteins from endosomes to the TGN. GOLPH3 is often amplified in different tumors. In vitro, GOLPH3 knockdown reduces anchorage independent growth and proliferation, while its overexpression enhances these processes as well as H-Ras driven transformation. GOLPH3 interacts with VPS35, a protein of Introduction – Secretory Pathway - 71
the retromer 113. VPS35 was shown to regulate mTOR activity in yeast 114 and accordingly, GOLPH3 overexpression resulted in increased mTOR activity, as assessed by phosphorylation levels of Akt (downstream of mTORC2) and S6K (downstream of mTORC1). Cells overexpressing GOLPH3 gave rise to bigger tumors in mouse xenotransplants. Finally, tumors overexpressing GOLPH3 resulted to be more sensitive to the mTOR inhibitor Rapamycin 75. The study by Scott et al. provided for the first time a mechanistic insight by which a Golgi protein can regulate tumor progression. However, more work is necessary to fully understand the role of GOLPH3 in cancer. GM130 has ben also linked to cancer. Reduction of GM130 levels by aerosol delivery of shRNA resulted in reduction of tumor growth in the mouse lung 115. The study hints that GM130 loss leads to increased levels of autophagy and reduced proliferation. Even if the proposed mechanism is not completely clear, the finding that a Golgi resident protein is important in cancer is interesting and further studies will be necessary to understand the link between Golgi and cancer.
Figure 1 – Schematic of some of the signaling routes to and from the secretory pathway described in this introduction.
Introduction – Secretory Pathway - 72
References
1. Schweizer, A. et al. Identification of an intermediate compartment involved in protein transport from endoplasmic reticulum to Golgi apparatus. Eur J Cell Biol 53, 185-196 (1990). 2. Ben-Tekaya, H., Miura, K., Pepperkok, R. & Hauri, H.-P. Live imaging of bidirectional traffic from the ERGIC. Journal of Cell Science 118, 357-367 (2005). 3. Presley, J.F. et al. ER-to-Golgi transport visualized in living cells. Nature 389, 81-85 (1997). 4. Rabouille, C. et al. Mapping the distribution of Golgi enzymes involved in the construction of complex oligosaccharides. Journal of Cell Science 108, 1617-1627 (1995). 5. Spang, A. On vesicle formation and tethering in the ER–Golgi shuttle. Current Opinion in Cell Biology 21, 531-536 (2009). 6. Matsuoka, K. et al. COPII-Coated Vesicle Formation Reconstituted with Purified Coat Proteins and Chemically Defined Liposomes. Cell 93, 263-275 (1998). 7. Mancias, J.D. & Goldberg, J. Structural basis of cargo membrane protein discrimination by the human COPII coat machinery. The EMBO Journal 27, 2918-2928 (2008). 8. Watson, P., Townley, A.K., Koka, P., Palmer, K.J. & Stephens, D.J. Sec16 Defines Endoplasmic Reticulum Exit Sites and is Required for Secretory Cargo Export in Mammalian Cells. Traffic (Copenhagen, Denmark) 7, 1678-1687 (2006). 9. Bhattacharyya, D. & Glick, B.S. Two Mammalian Sec16 Homologues Have Nonredundant Functions in Endoplasmic Reticulum (ER) Export and Transitional ER Organization. Molecular Biology of the Cell 18, 839-849 (2007). 10. Connerly, P.L. et al. Sec16 is a Determinant of Transitional ER Organization. Current Biology 15, 1439-1447 (2005). 11. Ivan, V. et al. Drosophila Sec16 Mediates the Biogenesis of tER Sites Upstream of Sar1 through an Arginine-Rich Motif. Molecular Biology of the Cell 19, 4352-4365 (2008). 12. Hughes, H. et al. Organisation of human ER-exit sites: requirements for the localisation of Sec16 to transitional ER. Journal of Cell Science 122, 2924-2934 (2009). 13. Szul, T. & Sztul, E. COPII and COPI Traffic at the ER-Golgi Interface. Physiology 26, 348- 364 (2011). 14. D'Souza-Schorey, C. & Chavrier, P. ARF proteins: roles in membrane traffic and beyond. Nat Rev Mol Cell Biol 7, 347-358 (2006). 15. Moelleken, J. et al. Differential localization of coatomer complex isoforms within the Golgi apparatus. Proc Natl Acad Sci U S A 104, 4425-4430 (2007). 16. Wegmann, D., Hess, P., Baier, C., Wieland, F.T. & Reinhard, C. Novel Isotypic γ/ζ Subunits Reveal Three Coatomer Complexes in Mammals. Molecular and Cellular Biology 24, 1070-1080 (2004). 17. Malsam, J., Satoh, A., Pelletier, L. & Warren, G. Golgin Tethers Define Subpopulations of COPI Vesicles. Science 307, 1095-1098 (2005). 18. Lanoix, J. et al. Sorting of Golgi resident proteins into different subpopulations of COPI vesicles: a role for ArfGAP1. The Journal of Cell Biology 155, 1199-1212 (2001). 19. Orci, L. et al. Anterograde flow of cargo across the Golgi stack potentially mediated via bidirectional “percolating” COPI vesicles. Proceedings of the National Academy of Sciences 97, 10400-10405 (2000).
Introduction – Secretory Pathway - 73
20. Yang, J.-S. et al. ARFGAP1 promotes the formation of COPI vesicles, suggesting function as a component of the coat. The Journal of Cell Biology 159, 69-78 (2002). 21. Moyer, Bryan D., Allan, Bernard B. & Balch, William E. Rab1 Interaction with a GM130 Effector Complex Regulates COPII Vesicle cis-Golgi Tethering. Traffic 2, 268-276 (2001). 22. Short, B. et al. A GRASP55-rab2 effector complex linking Golgi structure to membrane traffic. The Journal of Cell Biology 155, 877-884 (2001). 23. Scales, S.J., Pepperkok, R. & Kreis, T.E. Visualization of ER-to-Golgi Transport in Living Cells Reveals a Sequential Mode of Action for COPII and COPI. Cell 90, 1137-1148 (1997). 24. Sohda, M. et al. Interaction of Golgin-84 with the COG Complex Mediates the Intra- Golgi Retrograde Transport. Traffic 11, 1552-1566 (2010). 25. Cai, Y. et al. The Structural Basis for Activation of the Rab Ypt1p by the TRAPP Membrane-Tethering Complexes. Cell 133, 1202-1213 (2008). 26. Chen, S. et al. Trs65p, a subunit of the Ypt1p GEF TRAPPII, interacts with the Arf1p exchange factor Gea2p to facilitate COPI-mediated vesicle traffic. Molecular Biology of the Cell 22, 3634-3644 (2011). 27. Alvarez, C., Garcia-Mata, R., Brandon, E. & Sztul, E. COPI Recruitment Is Modulated by a Rab1b-dependent Mechanism. Molecular Biology of the Cell 14, 2116-2127 (2003). 28. Volchuk, A. et al. Megavesicles Implicated in the Rapid Transport of Intracisternal Aggregates across the Golgi Stack. Cell 102, 335-348 (2000). 29. Bonfanti, L. et al. Procollagen traverses the Golgi stack without leaving the lumen of cisternae: evidence for cisternal maturation. Cell 95, 993-1003 (1998). 30. Glick, B.S. & Luini, A. Models for Golgi Traffic: A Critical Assessment. Cold Spring Harbor Perspectives in Biology 3 (2011). 31. Orci, L., Amherdt, M., Ravazzola, M., Perrelet, A. & Rothman, J.E. Exclusion of Golgi Residents from Transport Vesicles Budding from Golgi Cisternae in Intact Cells. The Journal of Cell Biology 150, 1263-1270 (2000). 32. Trucco, A. et al. Secretory traffic triggers the formation of tubular continuities across Golgi sub-compartments. Nat Cell Biol 6, 1071-1081 (2004). 33. Deborde, S. et al. Clathrin is a key regulator of basolateral polarity. Nature 452, 719-723 (2008). 34. Anitei, M. & Hoflack, B. Exit from the trans-Golgi network: from molecules to mechanisms. Curr Opin Cell Biol 23, 443-451 (2011). 35. Deborde, S. et al. Clathrin is a key regulator of basolateral polarity. Nature 452, 719-723 (2008). 36. Mostov, K.E., de Bruyn Kops, A. & Deitcher, D.L. Deletion of the cytoplasmic domain of the polymeric immunoglobulin receptor prevents basolateral localization and endocytosis. Cell 47, 359-364 (1986). 37. De Matteis, M.A. & Luini, A. Exiting the Golgi complex. Nat Rev Mol Cell Biol 9, 273-284 (2008). 38. Yeaman, C. et al. The O-glycosylated Stalk Domain Is Required for Apical Sorting of Neurotrophin Receptors in Polarized MDCK Cells. The Journal of Cell Biology 139, 929- 940 (1997). 39. Schuck, S. & Simons, K. Polarized sorting in epithelial cells: raft clustering and the biogenesis of the apical membrane. Journal of Cell Science 117, 5955-5964 (2004). 40. Rodriguez-Boulan, E. & Müsch, A. Protein sorting in the Golgi complex: Shifting paradigms. Biochimica et Biophysica Acta (BBA) - Molecular Cell Research 1744, 455- 464 (2005).
Introduction – Secretory Pathway - 74
41. Mellman, I. & Nelson, W.J. Coordinated protein sorting, targeting and distribution in polarized cells. Nat Rev Mol Cell Biol 9, 833-845 (2008). 42. Bard, F. & Malhotra, V. The formation of TGN-to-plasma-membrane transport carriers. Annu Rev Cell Dev Biol 22, 439-455 (2006). 43. Simmen, T., Honing, S., Icking, A., Tikkanen, R. & Hunziker, W. AP-4 binds basolateral signals and participates in basolateral sorting in epithelial MDCK cells. Nat Cell Biol 4, 154-159 (2002). 44. Wakana, Y. et al. A new class of carriers that transport selective cargo from the trans Golgi network to the cell surface. The EMBO Journal 31, 3976-3990 (2012). 45. Müsch, A., Cohen, D., Kreitzer, G. & Rodriguez-Boulan, E. cdc42 regulates the exit of apical and basolateral proteins from the trans-Golgi network. The EMBO Journal 20, 2171-2179 (2001). 46. Egorov, M.V. et al. Faciogenital Dysplasia Protein (FGD1) Regulates Export of Cargo Proteins from the Golgi Complex via Cdc42 Activation. Molecular Biology of the Cell 20, 2413-2427 (2009). 47. Farhan, H. et al. MAPK signaling to the early secretory pathway revealed by kinase/phosphatase functional screening. The Journal of Cell Biology 189, 997-1011 (2010). 48. Farhan, H. & Rabouille, C. Signalling to and from the secretory pathway. Journal of Cell Science 124, 171-180 (2011). 49. Farhan, H., Weiss, M., Tani, K., Kaufman, R.J. & Hauri, H.P. Adaptation of endoplasmic reticulum exit sites to acute and chronic increases in cargo load. The EMBO Journal 27, 2043-2054 (2008). 50. Zacharogianni, M. et al. ERK7 is a negative regulator of protein secretion in response to amino-acid starvation by modulating Sec16 membrane association. The EMBO Journal 30, 3684-3700 (2011). 51. Tillmann, K.D. et al. Regulation of Sec16 levels and dynamics links proliferation and secretion. J Cell Sci (2014). 52. Rabouille, C. & Kondylis, V. Golgi ribbon unlinking: an organelle-based G2/M checkpoint. Cell Cycle 6, 2723-2729 (2007). 53. Preisinger, C. et al. Plk1 docking to GRASP65 phosphorylated by Cdk1 suggests a mechanism for Golgi checkpoint signalling. Embo j 24, 753-765 (2005). 54. Lowe, M., Gonatas, N.K. & Warren, G. The Mitotic Phosphorylation Cycle of the Cis- Golgi Matrix Protein Gm130. The Journal of Cell Biology 149, 341-356 (2000). 55. Wang, Y., Seemann, J., Pypaert, M., Shorter, J. & Warren, G. A direct role for GRASP65 as a mitotically regulated Golgi stacking factor. Embo j 22, 3279-3290 (2003). 56. Lowe, M. et al. Cdc2 Kinase Directly Phosphorylates the cis-Golgi Matrix Protein GM130 and Is Required for Golgi Fragmentation in Mitosis. Cell 94, 783-793 (1998). 57. Sutterlin, C., Hsu, P., Mallabiabarrena, A. & Malhotra, V. Fragmentation and dispersal of the pericentriolar Golgi complex is required for entry into mitosis in mammalian cells. Cell 109, 359-369 (2002). 58. Jesch, S.A., Lewis, T.S., Ahn, N.G. & Linstedt, A.D. Mitotic Phosphorylation of Golgi Reassembly Stacking Protein 55 by Mitogen-activated Protein Kinase ERK2. Molecular Biology of the Cell 12, 1811-1817 (2001). 59. Shaul, Y.D. & Seger, R. ERK1c regulates Golgi fragmentation during mitosis. The Journal of Cell Biology 172, 885-897 (2006).
Introduction – Secretory Pathway - 75
60. Yadav, S., Puri, S. & Linstedt, A.D. A Primary Role for Golgi Positioning in Directed Secretion, Cell Polarity, and Wound Healing. Molecular Biology of the Cell 20, 1728-1736 (2009). 61. Preisinger, C. et al. YSK1 is activated by the Golgi matrix protein GM130 and plays a role in cell migration through its substrate 14-3-3zeta. J Cell Biol 164, 1009-1020 (2004). 62. Maag, R.S., Mancini, M., Rosen, A. & Machamer, C.E. Caspase-resistant Golgin-160 Disrupts Apoptosis Induced by Secretory Pathway Stress and Ligation of Death Receptors. Molecular Biology of the Cell 16, 3019-3027 (2005). 63. Mancini, M. et al. Caspase-2 Is Localized at the Golgi Complex and Cleaves Golgin-160 during Apoptosis. The Journal of Cell Biology 149, 603-612 (2000). 64. Hicks, S.W. & Machamer, C.E. Golgi structure in stress sensing and apoptosis. Biochimica et Biophysica Acta (BBA) - Molecular Cell Research 1744, 406-414 (2005). 65. Lane, J.D. et al. Caspase-mediated cleavage of the stacking protein GRASP65 is required for Golgi fragmentation during apoptosis. The Journal of Cell Biology 156, 495-509 (2002). 66. Lowe, M., Lane, J.D., Woodman, P.G. & Allan, V.J. Caspase-mediated cleavage of syntaxin 5 and giantin accompanies inhibition of secretory traffic during apoptosis. J Cell Sci 117, 1139-1150 (2004). 67. Chiu, R., Novikov, L., Mukherjee, S. & Shields, D. A caspase cleavage fragment of p115 induces fragmentation of the Golgi apparatus and apoptosis. The Journal of Cell Biology 159, 637-648 (2002). 68. Cheng, J.P.X. et al. Caspase cleavage of the Golgi stacking factor GRASP65 is required for Fas/CD95-mediated apoptosis. Cell Death and Dis 1, e82 (2010). 69. Hicks, S.W. & Machamer, C.E. The NH2-terminal Domain of Golgin-160 Contains Both Golgi and Nuclear Targeting Information. Journal of Biological Chemistry 277, 35833- 35839 (2002). 70. Chiu, V.K. et al. Ras signalling on the endoplasmic reticulum and the Golgi. Nat Cell Biol 4, 343-350 (2002). 71. Bivona, T.G. et al. Phospholipase C[gamma] activates Ras on the Golgi apparatus by means of RasGRP1. Nature 424, 694-698 (2003). 72. Matallanas, D. et al. Distinct Utilization of Effectors and Biological Outcomes Resulting from Site-Specific Ras Activation: Ras Functions in Lipid Rafts and Golgi Complex Are Dispensable for Proliferation and Transformation. Molecular and Cellular Biology 26, 100-116 (2006). 73. Di Paolo, G. & De Camilli, P. Phosphoinositides in cell regulation and membrane dynamics. Nature 443, 651-657 (2006). 74. Mayinger, P. Signaling at the Golgi. Cold Spring Harbor Perspectives in Biology 3 (2011). 75. Scott, K.L. et al. GOLPH3 modulates mTOR signalling and rapamycin sensitivity in cancer. Nature 459, 1085-1090 (2009). 76. Kupfer, A., Louvard, D. & Singer, S.J. Polarization of the Golgi apparatus and the microtubule-organizing center in cultured fibroblasts at the edge of an experimental wound. Proc Natl Acad Sci U S A 79, 2603-2607 (1982). 77. ten Klooster, J.P. et al. Mst4 and Ezrin Induce Brush Borders Downstream of the Lkb1/Strad/Mo25 Polarization Complex. Developmental Cell 16, 551-562 (2009). 78. Matsuki, T. et al. Reelin and Stk25 Have Opposing Roles in Neuronal Polarization and Dendritic Golgi Deployment. Cell 143, 826-836 (2010).
Introduction – Secretory Pathway - 76
79. Gloerich, M. et al. Rap2A links intestinal cell polarity to brush border formation. Nat Cell Biol 14, 793-801 (2012). 80. Zhang, S. et al. The tumor suppressor LKB1 regulates lung cancer cell polarity by mediating cdc42 recruitment and activity. Cancer Res 68, 740-748 (2008). 81. de Anda, F.C. et al. Centrosome localization determines neuronal polarity. Nature 436, 704-708 (2005). 82. Jareb, M. & Banker, G. Inhibition of axonal growth by brefeldin A in hippocampal neurons in culture. J Neurosci 17, 8955-8963 (1997). 83. Horton, A.C. et al. Polarized Secretory Trafficking Directs Cargo for Asymmetric Dendrite Growth and Morphogenesis. Neuron 48, 757-771 (2005). 84. Tanabe, K. et al. Atypical Protein Kinase C Regulates Primary Dendrite Specification of Cerebellar Purkinje Cells by Localizing Golgi Apparatus. The Journal of Neuroscience 30, 16983-16992 (2010). 85. Ye, B. et al. Growing Dendrites and Axons Differ in Their Reliance on the Secretory Pathway. Cell 130, 717-729 (2007). 86. Kupfer, A. & Dennert, G. Reorientation of the microtubule-organizing center and the Golgi apparatus in cloned cytotoxic lymphocytes triggered by binding to lysable target cells. J Immunol 133, 2762-2766 (1984). 87. Stinchcombe, J.C., Majorovits, E., Bossi, G., Fuller, S. & Griffiths, G.M. Centrosome polarization delivers secretory granules to the immunological synapse. Nature 443, 462- 465 (2006). 88. Trambas, C.M. & Griffiths, G.M. Delivering the kiss of death. Nat Immunol 4, 399-403 (2003). 89. Etienne-Manneville, S. & Hall, A. Integrin-Mediated Activation of Cdc42 Controls Cell Polarity in Migrating Astrocytes through PKCζ. Cell 106, 489-498 (2001). 90. Palazzo, A.F. et al. Cdc42, dynein, and dynactin regulate MTOC reorientation independent of Rho-regulated microtubule stabilization. Current Biology 11, 1536-1541 (2001). 91. Osmani, N., Peglion, F., Chavrier, P. & Etienne-Manneville, S. Cdc42 localization and cell polarity depend on membrane traffic. The Journal of Cell Biology 191, 1261-1269 (2010). 92. Pu, J. & Zhao, M. Golgi polarization in a strong electric field. Journal of Cell Science 118, 1117-1128 (2005). 93. Schmoranzer, J., Kreitzer, G. & Simon, S.M. Migrating fibroblasts perform polarized, microtubule-dependent exocytosis towards the leading edge. Journal of Cell Science 116, 4513-4519 (2003). 94. Chabin-Brion, K. et al. The Golgi Complex Is a Microtubule-organizing Organelle. Molecular Biology of the Cell 12, 2047-2060 (2001). 95. Efimov, A. et al. Asymmetric CLASP-Dependent Nucleation of Noncentrosomal Microtubules at the trans-Golgi Network. Developmental Cell 12, 917-930 (2007). 96. Rivero, S., Cardenas, J., Bornens, M. & Rios, R.M. Microtubule nucleation at the cis-side of the Golgi apparatus requires AKAP450 and GM130. The EMBO Journal 28, 1016-1028 (2009). 97. Hurtado, L. et al. Disconnecting the Golgi ribbon from the centrosome prevents directional cell migration and ciliogenesis. The Journal of Cell Biology 193, 917-933 (2011). 98. Drabek, K. et al. Role of CLASP2 in Microtubule Stabilization and the Regulation of Persistent Motility. Current Biology 16, 2259-2264 (2006).
Introduction – Secretory Pathway - 77
99. Sato, Y. et al. MTCL1 crosslinks and stabilizes non-centrosomal microtubules on the Golgi membrane. Nat Commun 5 (2014). 100. Sato, Y. et al. The novel PAR-1-binding protein MTCL1 has crucial roles in organizing microtubules in polarizing epithelial cells. Journal of Cell Science 126, 4671-4683 (2013). 101. Wang, F. et al. Lipid products of PI(3)Ks maintain persistent cell polarity and directed motility in neutrophils. Nat Cell Biol 4, 513-518 (2002). 102. Bisel, B. et al. ERK regulates Golgi and centrosome orientation towards the leading edge through GRASP65. The Journal of Cell Biology 182, 837-843 (2008). 103. Feinstein, T.N. & Linstedt, A.D. GRASP55 regulates Golgi ribbon formation. Mol Biol Cell 19, 2696-2707 (2008). 104. Duran, J.M. et al. The Role of GRASP55 in Golgi Fragmentation and Entry of Cells into Mitosis. Molecular Biology of the Cell 19, 2579-2587 (2008). 105. Rıó s, R.M., Sanchıś , A., Tassin, A.M., Fedriani, C. & Bornens, M. GMAP-210 Recruits γ- Tubulin Complexes to cis-Golgi Membranes and Is Required for Golgi Ribbon Formation. Cell 118, 323-335 (2004). 106. Kodani, A. & Sütterlin, C. The Golgi Protein GM130 Regulates Centrosome Morphology and Function. Molecular Biology of the Cell 19, 745-753 (2008). 107. Kodani, A., Kristensen, I., Huang, L. & Sütterlin, C. GM130-dependent Control of Cdc42 Activity at the Golgi Regulates Centrosome Organization. Molecular Biology of the Cell 20, 1192-1200 (2009). 108. Salazar, M.A. et al. Tuba, a Novel Protein Containing Bin/Amphiphysin/Rvs and Dbl Homology Domains, Links Dynamin to Regulation of the Actin Cytoskeleton. Journal of Biological Chemistry 278, 49031-49043 (2003). 109. Baschieri, F. et al. Spatial control of Cdc42 signalling by a GM130–RasGRF complex regulates polarity and tumorigenesis. Nat Commun 5 (2014). 110. Kovacs, E.M., Makar, R.S. & Gertler, F.B. Tuba stimulates intracellular N-WASP- dependent actin assembly. J Cell Sci 119, 2715-2726 (2006). 111. Kellokumpu, S., Sormunen, R. & Kellokumpu, I. Abnormal glycosylation and altered Golgi structure in colorectal cancer: dependence on intra-Golgi pH. FEBS Letters 516, 217-224 (2002). 112. Weller, S.G. et al. Src kinase regulates the integrity and function of the Golgi apparatus via activation of dynamin 2. Proc Natl Acad Sci U S A 107, 5863-5868 (2010). 113. Bonifacino, J.S. & Hurley, J.H. Retromer. Current Opinion in Cell Biology 20, 427-436 (2008). 114. Xie, M.W. et al. Insights into TOR function and rapamycin response: Chemical genomic profiling by using a high-density cell array method. Proceedings of the National Academy of Sciences of the United States of America 102, 7215-7220 (2005). 115. Chang, S.-H. et al. GOLGA2/GM130, cis-Golgi Matrix Protein, is a Novel Target of Anticancer Gene Therapy. Molecular Therapy 20, 2052-2063 (2012).
Introduction – Secretory Pathway - 78
Aim of the Thesis
Aim of the thesis Rho GTPases are fundamental for polarity and among them, Cdc42 is considered the key regulator of this process. Despite the fact that Cdc42 is largely localized on endomembranes and, particularly, at the Golgi, the possibility that endomembrane signaling of Cdc42 controls polarity has not been investigated. Therefore, we aimed at understanding whether Golgi localized Cdc42 plays any role in the control of cell polarity. It was previously speculated that GM130 could play a role in regulating Cdc42 at the Golgi, thus we analyzed the mechanism by which GM130 controls the activity of the small GTPase. If Golgi-Cdc42 is important for polarity, this would indicate that signaling from endomembranes plays a role in the control of cellular processes that were previously investigated only in the context of plasma membrane signals. Loss of polarity is increasingly being viewed as a tumor promoting process, therefore it would be of special interest to determine if endomembrane signaling is altered in pathological conditions such as tumors. To do so, we analyzed GM130 expression in a panel of colon cancer patients. Finally we assessed the role of GM130 in cancer related process by stably depleting the Golgi protein from different breast cancer cell lines. We determined which processes involved in tumorigenesis are affected by depletion of GM130.
Aim of the Thesis - 80
Results Results
Part 1 - Spatial Cdc42 signalling regulates polarity and tumorigenesis Baschieri F, Confalonieri S, Bertalot G, Di Fiore PP, Dietmaier W, Leist M, Crespo P, Macara IG, Farhan H. Spatial Control of Cdc42 Signalling by a GM130-RasGRF2 Complex Regulates Polarity and Tumorigenesis – Nature Communications. 2014 Sep 11;5:4839.
The Golgi pool of Cdc42 controls cell polarity To study spatial Cdc42 activation patterns we used a Cdc42 Raichu probe 1, 2. For all our measurements we used the probe containing the C-terminal domain of Cdc42 2 (Cdc42-EM hereafter). This C-terminal domain targets the FRET reporter to different membranes including the plasma membrane and various cellular endomembranes such as the Golgi or endosomes (Supplementary Fig 1A) localizing as endogenous Cdc42 does 3. Cdc42-EM appeared in a juxtanuclear pool colocalizing with GM130, indicating its presence at the Golgi complex (Fig. S1B), thus allowing us to monitor Cdc42 activation at this cellular location where Cdc42 is active 4 (Fig. 1 A). Measuring FRET outside the Golgi-area or the plasma membrane did not reveal any specific signal, thus supporting the specificity of our FRET measurements (Fig. 1A). Silencing GM130 reduced the total cellular pool of Cdc42-GTP 5 (Fig. S1C), reducing substantially the activity of Cdc42 at the Golgi (Fig. 1B). However, GM130 depletion did not affect the activity of this reporter at the plasma membrane indicating that it did not affect Cdc42 activation therein (Fig. 1C). Silencing GM130 inhibited 2D cell migration (Fig S1E) indicating that alteration of spatial Cdc42 signalling is relevant for directed cell motility. Moreover, the recruitment of aPKC to the leading edge of directionally migrating cells was also reduced (Supplementary Fig. 1F). To test for effects on polarity in a 3D cell culture model, we used Caco-2 cells, which are known to spontaneously polarize when plated in a 3D matrix forming cysts with a single lumen. Previous work showed that alteration of Cdc42 activity (and thus of polarity) leads to the formation of multi-lumen (aberrant) cysts 6, 7. Depletion of GM130 in Caco-2 cells led to an increase in the number of aberrant cysts, which is indicative of a polarity defect (Fig. 1D). These results suggested that regulation of spatial Cdc42 activity by GM130 was relevant for cell polarization in 2D and 3D cell culture. Contrarily, GM130 depletion did not affect: Golgi morphology (Supplementary Fig 2); ER-Golgi trafficking; Golgi-to-plasma membrane trafficking; and coatomer recruitment
Results - 82 to the Golgi (Supplementary Fig. 3A-C). Furthermore, the capability of the Golgi to nucleate microtubules was also unaffected (Supplementary Fig. 3D), in agreement with previous findings 8. Thus, the indirect impact of these processes on polarity could be excluded 9.
Directed trafficking causes asymmetric distribution of Cdc42 To obtain more direct evidence for the role of the GM130-regulated Golgi pool of active Cdc42, we measured Cdc42 activity at the front and the rear of directionally migrating cells using the Cdc42-EM probe. Strikingly, Cdc42 activity exhibited an asymmetric distribution, being more active at the front compared to the rear of the cell (Fig. 1E, F). Silencing GM130 reduced the amount of activated Cdc42 at the leading edge, thereby breaking the asymmetric distribution of active Cdc42 (Fig. 1E, F). These results were confirmed by immunofluorescence staining against endogenous Cdc42-GTP (Fig. 1G). Sustained accumulation of active Cdc42 at the leading edge could be the consequence of an increased local activation. Alternatively, the Golgi might deliver Cdc42-GTP to the leading edge. If the latter mechanism was true, then blocking trafficking from the Golgi ought to diminish the amount of Cdc42-GTP at the leading edge. To prove this point, directionally migrating cells in a wound closure assay were incubated at 20°C for one hour, which blocks exit from the trans-Golgi 10. Measuring FRET reporter activity or staining for Cdc42-GTP revealed that blocking post-Golgi trafficking diminished the presence of GTP-Cdc42 at the cell front, thereby abolishing Cdc42-GTP asymmetry (Fig. 1E&F). Importantly, re-incubation of the cells at 37°C for one hour re-established Cdc42-GTP asymmetry with higher levels at the leading edge compared to the rear (Fig. 1F). The loss of Cdc42-GTP asymmetry in GM130 knockdown cells was likely due to an abrogation of directed trafficking. Live cell imaging GFP-VSVG tracks forming from the Golgi showed that while carriers formed readily in GM130-depleted cells, they were non-directed, contrarily to tracks in control cells which mostly trafficked towards the leading edge (Fig. 1H). Of note, only the directionality of post-Golgi trafficking was affected, but not the global rate of post-Golgi trafficking (Fig. S3B). Since, both GDP- and GTP-restricted Cdc42 is known to block post-Golgi trafficking 11 we conclude that GM130 depletion does not affect the GTP/GDP cycling of Cdc42. Taken together, the Golgi pool of active Cdc42 is relevant for cell polarization.
Results - 83
The GM130-Cdc42 crosstalk does not involve GEFs Next we asked how the Cdc42 activity at the Golgi was regulated by GM130. One possibility is that GM130 recruited a Cdc42 GEF leading to local activation of this GTPase. If true, then this GEF must interact with GM130 and localize to the Golgi in a GM130-dependent manner (schematic in Fig.2). To identify GEFs that contribute to activate Cdc42 at the Golgi, we screened a library of 51 siRNAs against Rho family GEFs for effects on the Golgi pool of Cdc42 using the Cdc42-EM FRET probe. We focused primarily on the knockdowns that affected Cdc42 activity at the Golgi in a manner stronger than GM130 depletion. While several GEF knockdowns decreased the FRET values at the Golgi, only three had an effect that was comparable to the effect of GM130, namely ARHGEF9, 11 and 12 (Fig. 3A). Depletion of GEF11 and 12 also resulted in reduced total cellular Cdc42-GTP (Supplementary Fig. 4B) supporting the FRET measurements. Depletion of any of these GEFs also resulted in an inhibition of directed migration as determined in a wound healing assay (Supplementary Fig. 4C). In addition, polarization of the Golgi to the leading edge of migrating cells was also affected (Supplementary Fig. 4D). However, none of these GEFs interacted with GM130 in co- immunoprecipitation experiments, nor did they localize to the Golgi (Fig. 3B, C). We also failed to detect any evidence for an involvement of the GEF Tuba, as it did not localize to the Golgi (Fig. S5A, B), nor did it interact with GM130 (Supplementary Fig. 5C, D) contrarily to previous findings 5, and in agreement with others who failed to detect this GEF at the Golgi 12, 13. In addition, nor Tuba depletion (Fig 3A, Fig S5E) neither its overexpression (Supplementary Fig. 5F) changed the activation of Cdc42 at the Golgi. Of note, none of the GEFs tested localizes to the Golgi. Therefore, the GM130-Cdc42 crosstalk was not mediated via recruitment of a GEF for local activation of Cdc42.
The GM130-Cdc42 crosstalk involves RasGRF Another explanation for the GM130-Cdc42 connection could be that GM130 was preventing the function of some Cdc42 inhibitor (schematic in Fig.2). One possible candidate was the GEF RasGRF2, the RasGRF isoform expressed in epithelial cells, which has been recently shown to act as an inhibitor of Cdc42 14. A marked association of endogenous GM130 and RasGRF2 could be detected in co-immunoprecipitation experiments (Fig. 4A). Moreover, in about 50% of the cells, RasGRF2 co-localized with GM130 at the juxtanuclear region,
Results - 84 consistent with Golgi complex localization (Fig. 4B, C). RasGRF in addition also exhibited a localization pattern reminiscent of the ER, which is in agreement with previous work 15. Noticeably, upon GM130 depletion, RasGRF2 juxtanuclear localization dropped strongly to less than 10% of the cells (Fig. 4B, C). Moreover we found that the interaction between these proteins was mediated by the C-terminal domain of GM130 and the Cdc25 domain of RasGRF2 (Supplementary Fig. 6A& B). These data suggested that GM130 is involved in localizing RasGRF to the Golgi complex. Overexpression of RasGRF1 or 2 blocked activation of Cdc42 at the Golgi as determined using the Cdc42-EM probe, in a manner dependent on the GEFs DH domain (Fig. S6C). Importantly, co-knockdown of GM130 and RasGRF2 restored Cdc42 activation levels at the Golgi (Fig. 1A). The involvement of RasGRF in the GM130-Cdc42 crosstalk was further supported by the finding that GM130 depletion did not affect the levels of GTP-Cdc42 in CHL cells which naturally lack all RasGRF isoforms (Fig. 4D). Therefore, we conclude that RasGRF is an essential mediator in the GM130-Cdc42 crosstalk.
Regulation of the GM130-RasGRF complex We hypothesized that GM130 could sequester RasGRF, thereby preventing it from binding and inhibiting Cdc42. Thus, under conditions that activate Cdc42, GM130 would sequester RasGRF to prevent it from inhibiting Cdc42. To test this hypothesis, we determined whether the GM130-RasGRF complex is affected by serum-starvation, a condition where Cdc42 is not activated. Under these conditions, GM130 did not co-immunoprecipitate with RasGRF (Fig. 5A), contrary to cells in steady-state cultured under complete conditions (Fig. 3). Treatement with 10% FCS for 10 min resulted in re-formation of the GM130-RasGRF complex (Fig. 5A). If RasGRF were free under serum-starved conditions, then we would expect the Golgi pool of Cdc42 to be unresponsive to GM130 depletion. Cdc42 at the Golgi responded to serum treatment in control siRNA transfected cells, while GM130 depleted cells did not respond to this treatment (Fig. 5B). Of note, the FRET values at the Golgi we similar in control and GM130 silenced serum-starved cells, further supporting the notion that this pool becomes GM130-independent under serum-starved conditions (Fig. 5B). If GM130 acts to protect Cdc42 from inhibition by RasGRF, then depletion of GM130 ought to increase the association between RasGRF and Cdc42. Co-immunoprecipitation
Results - 85 experiments demonstrated that this was the case: the amount of RasGRF in association with Cdc42 increased in GM130 knockdown cells compared to control cells (Fig. 5C). Finally, we tested whether RasGRF is relevant for the GM130-Cdc42 crosstalk in the context of polarity. This was the case, as co-depletion of RasGRF2 and GM130 rescued the polarity defects imposed by GM130 depletion (Fig. 3F&G).
The GM130-RasGRF complex controls Ras activity Our data indicated that GM130 acts as a repressor of RasGRF. Consistent with this model (Fig. 6A), knockdown of GM130 would release RasGRF, allowing it to inhibit Cdc42. However, RasGRF is also a well-known activator of Ras. Thus, in agreement with our model, loss of GM130 should also result in an increase of Ras activation. To test this prediction, we performed a knockdown of GM130 and measured Ras activation using a pulldown assay. Depletion of GM130 increased the levels of GTP-loaded Ras and co-knockdown of RasGRF abolished this effect (Fig. 6B), indicating that the increase in Ras activity was dependent on RasGRF. We also tested whether signalling downstream of Ras was affected at the level of ERK1/2 response to mitogen treatment. Knockdown of GM130 increased ERK1/2 activation in response to serum stimulation and this effect was again dependent on RasGRF (Supplementary Fig. 7A). To test whether the effect on ERK1/2 signaling is biologically relevant, we depleted GM130 in PC12 cells. These cells are a standard model for ERK- dependent cell fate decisions 16. The higher and the more sustained ERK1/2 signalling, the higher is the likelihood that PC12 cells shift from proliferation to differentiation (evident by the emergence of neurites). Depletion of GM130 resulted in elevated and sustained ERK1/2 activation (Supplementary Fig. 8A) and accordingly the percentage of cells that underwent differentiation was significantly increased (Supplementary Fig. 8B&C). Thus, the effects of GM130 on Ras signalling are relevant for ERK-dependent cell fate decisions.
Expression of GM130 in colon cancer Loss of polarity is a frequent feature of epithelial tumours, associated with dysplasia and increased metastatic potential 17, 18. Our results indicated that GM130 regulates polarity by modulating the Golgi pool of active Cdc42 and, in addition, Ras activity. Therefore, we asked whether GM130 could be associated to the malignant phenotype. To investigate this possible connection, we used two strategies. First, we analysed GM130 expression in a colon
Results - 86 cancer progression TMA comparing normal colon mucosa (29 cases), adenoma (16 cases), and adenocarcinoma (109 cases) (Fig 7A). While the expression of GM130 did only marginally differ in normal colon and adenoma, the expression in carcinoma was reduced markedly (Fig. 7B-D). We next extended this analysis in samples from 16 patients, present on TMA, with matched normal and cancer tissues. We compared the scored intensity of GM130 expression and found that in 14 out of 16 individual patients the expression of GM130 was reduced in tumour compared to the matched normal tissue (Fig. 7E&F). The downregulation of GM130 in cancer was further confirmed by the analysis of 11 matched normal and cancer colon tissues from a different source (Supplementary Fig. 9). In this case, the intensity of the GM130 staining was measured and healthy tissues were compared with the matching cancerous tissues. In agreement with the previous results, GM130 was downregulated in the cancerous tissue of 9 out of 11 patients (Supplementary Fig. 9A-C). In support for a role of GM130 loss in tumour progression is our finding that knockdown of GM130 in Caco-2 cells led to a loss of E-cadherin expression (Supplementary Fig. 9D), a condition that is often considered to be linked to tumour progression and a loss of epithelial identity and is in line with the notion that loss of polarity is a typical phenomenon in EMT 19. We could show that the effect of GM130 on E-Cadherin was not cell line specific, as it turned out that depletion of GM130 caused loss of E-Cadherin also in another epithelial cell line (Supplementary Fig. 9D).
Results - 87
Figures
Results - 88
Figure 1. GM130 spatially regulates Cdc42 activity to control polarity. (A) One representative HEK293 cell transfected with the Cdc42-EM FRET reporter is shown here. Areas where FRET was measured are marked in red and average FRET values ± standard deviation calculated from 5 independent experiments in control transfected cells are shown. Scale bar = 25 µm. (B, C) HEK293 cells were transfected with the indicated siRNA. After 48h, cells were transfected with the Cdc42-EM FRET reporter. After additional 24 h, cells were fixed and FRET at the Golgi region (B) or at the plasma membrane (C). Averages of at least 3 independent experiments ± standard deviations (at least 15 cells per condition in every experiment) are shown on the graph. Asterisks indicate statistically significant differences tested using ANOVA with Newman-Keuls multiple comparison test (*p<0.05). (D) Caco-2 cells were transfected with the indicated siRNA. Cells were grown in Geltrex® matrix for four days and cysts were stained for Giantin (red) and GM130 (green) using immunofluorescence and for F-actin (blue) using fluorescent phalloidin. A magnification of a single cyst is displayed in the upper row and an overview of several cysts in shown in the lower row. Scale bar = 7.5 µm for the magnified images (upper images) and 75 µm for the overview images. (E) HeLa cells were transfected with the indicated siRNA. After 48 h, cells were transfected with a plasmid encoding the Cdc42-EM Raichu probe. After 24 h, a wound was generated using a 10 µl pipette tip and cells were allowed to migrate and polarize for approximately 6 h at 37°C followed by fixation. Representative images of cells expressing the Raichu probe which are facing the wound are shown. FRET was measured on the plasma membrane part facing the wound (indicated as “Front”) and on the opposing end of the cell (indicated as “Rear”). Scale bar is 10 μm. (F) Graphic representation of FRET measurements from three independent experiments of HeLa cells expressing the indicated Raichu probe and that that were transfected with the indicated siRNA 72 h prior to the experimental measurements. Above the graph a schematic of the experimental setup: control cells have Cdc42-GTP at the Golgi and deliver it to the leading edge in a polarized way. GM130 knockdown cells have less Cdc42-GTP at the Golgi and lose the ability to polarize their traffic towards the leading edge. Blocking post-Golgi traffic by incubation at 20°C abolishes front-rear asymmetry and re- warming the cells to 37°C re-established asymmetry. White bars represent Front/Rear ratios of FRET values. Results are means ± SD from four independent experiments. Asterisks indicate statistically significant differences tested using ANOVA with Newman-Keuls multiple comparison test (** p<0.01). (G) HeLa cells were transfected with siRNA. After 72 hours, a
Results - 89 wound was made with a 10 μl tip and the cells were allowed to migrate for 6 hours. Cells were then fixed and immunostained for Giantin and Cdc42-GTP. Intensities of Cdc42-GTP were measured and the Front/Rear ratio is plotted as a bar graph. Results are means ± SD of 3 independent experiments. Asterisks indicate statistically significant differences tested using ANOVA with Newman-Keuls multiple comparison test (** p<0.01). Scale bar = 25 µm. (H) HeLa cells were transfected with the indicated siRNA. After 48 h, cells were transfected with the plasmid encoding for VSVG-RUSH-GFP. After further 24 h, a wound was made with a 10 μl tip and cells were allowed to migrate at 37°C for approximately 6 hours followed by live video microscopy. VSVG-RUSH-GFP was released from the ER by addition of biotin and after 25 min VSVG carriers were tracked using ImageJ. Individual tracks are displayed on the representative images. Results are means ± SD from three independent experiments. Asterisks indicate statistically significant differences tested using Student’s T-test (** p<0.01).
Results - 90
Figure 2. Models for the GM130-Cdc42 crosstalk Schematic representation of two different models. On the left-hand side: GM130 acts as a scaffold for a Cdc42-GEF at the Golgi. In this case, a GEF should be located at the Golgi in a GM130 dependent manner. Upon GM130 depletion, the GEF is lost from the Golgi and subsequently, Cdc42-GTP doesn’t accumulate at the organelle. In the second scenario (right- hand side), GM130 binds to an inhibitor of Cdc42, protecting the small GTPase from inactivation. If GM130 is lost, the inhibitor will bind to Cdc42 in places other than the Golgi, thereby preventing a GEF mediated activation of Cdc42. In this way, Cdc42-GTP will not be accumulated at the Golgi.
Results - 91
Results - 92
Figure 3. Screening for GEFs that regulate the Golgi pool of Cdc42 (A) HEK293 cells were transfected with control or with the indicated siRNA. After 48h, cells were transfected with the plasmid encoding for the Cdc42-EM-FRET probe. After further 24h the cells were fixed and mounted. FRET was measured as described in the Material and Methods section and FRET values are displayed as fold of control and are averages from the measurements of at least 30 cells per condition. Red bars represent CI95 intervals (B) HeLa cells were transfected with plasmids encoding the indicated GEF. 24 h later, cells were lysed and the lysates were subjected to immunoprecipitation either with a GM130 antibody (+) or with protein G sepharose beads alone. “5% input” indicates lanes where 5% of the total material that was used in the IP is loaded. The immunoprecipitated material was eluted and subjected to SDS-PAGE followed by immunoblotting against the indicated proteins. (C) HeLa cells were plated on coverslips, then transfected with plasmids encoding the specified GEF. 24 h later, cells were fixed and immunostained for GM130 and Flag. Intensity plot corresponding to the region marked by a white arrow are shown on the right. Scale bar is 10 µm.
Results - 93
Results - 94
Figure 4. The effect of GM130 on Cdc42 is dependent on RasGRF (A) HeLa cells were lysed and the lysate was subjected to immunoprecipitation either with a GM130 antibody (+) or with proteinG sepharose beads alone. “5% input” indicates lanes where 5% of the total material that was used in the IP is loaded. The immunoprecipitated material was eluted and subjected to SDS-PAGE followed by immunoblotting against the indicated protein. (B) Quantification of cells with RasGRF at the Golgi. (C) HeLa cells grown on glass cover slips were fixed followed by immunofluorescence staining of RasGRF and GM130. Images were acquired using a confocal laser scanning microscope. The magnifications correspond to the areas inside the white squares. Scale bar is 25 µm. An intensity plot corresponding to the region marked by a white arrow is shown. (D) CHL cells were depleted of GM130 by siRNA transfection. After 72 h, cells were lysed and GST-PAK1 was added to the lysate followed by pulldown with GSH-sepharose. The eluate was subjected to SDS-PAGE followed by immunoblotting against Cdc42 (Cdc42-GTP). 5% of the original lysate were subjected to SDS-PAGE followed by immunoblotting against Cdc42 (Tot-Cdc42) and against GM130. Bar graph in the right panel represents a quantification of the amount active Cdc42 (GTP-Cdc42) to total Cdc42. Results are means ± SD from three independent experiments. (E) RT-PCR of RasGRF2 comparing HeLa and CHL cells. (F) Cells were transfected with the indicated siRNA. After 72 h, a wound was made using a 10µl pipette tip and cells were allowed to migrate and polarize for approximately 6 h at 37°C followed by fixation and immunofluorescence staining of Giantin to label the Golgi. The Golgi was counted as oriented towards the wound if its major mass was located in a 120° angle facing the wound edge. The red line shows the average orientation of the Golgi immediately after wounding. Results are means ± SD from three independent experiments. Asterisk indicates statistically significant differences using ANOVA with Newman-Keuls multiple comparison test (*p<0.05). (G) Caco- 2 cells were transfected with siRNA against GM130, or RasGRF2, or with both siRNA. Cells were grown in Matrigel® for four days to allow cyst formation. Afterwards, cysts were stained for GM130 using immunofluorescence and for F-actin using fluorescent phalloidin as described in “Materials and Methods”. Cysts with a single lumen were counted as normal, while cysts with multiple or no lumen were counted as aberrant. The percentage of normal and aberrant cysts in each condition was counted from three independent experiments which are displayed in the bar graph in the lower panel. Results are means ± SD. Asterisk
Results - 95 indicates statistically significant differences using ANOVA with Newman-Keuls multiple comparison test (*p<0.05; **p<0.01). Scale bar is 7.5 μm.
Results - 96
Figure 5. The GM130-RasGRF complex is regulated by serum (A) MCF7 cells were grown to confluency. Then, cells were serum-starved for 2 h followed by stimulation with 10% FCS for the indicated time points. Cell lysates were subjected to immunoprecipitation against GM130. The immunoprecipitate was subjected to SDS-PAGE followed by immunoblotting against the indicated proteins. (B) HeLa cells were transfected with control or GM130 siRNA 72h prior to the experiment. After 48 h, cells were transfected with the plasmid encoding for the Cdc42 Raichu probe. Cells were serum-starved for 2 h followed by stimulation with 10% FCS for 0,1 and 5 min and FRET was measured as indicated in “Materials and Methods. Results are means ± SD from three independent experiments. Asterisks indicate statistically significant differences tested using ANOVA with Newman- Keuls multiple comparison test (*p<0.05). (C) HeLa cells were transfected with the indicated siRNA. After 48 h, cells were transfected with empty vector or with a plasmid encoding HA- tagged RasGRF1. After 24 h, cells were serum-starved for 2 h followed by stimulation with 10% FCS for the indicated time points. Cell lysates were subjected to immunoprecipitation against HA. The immunoprecipitate was subjected to SDS-PAGE followed by immunoblotting against the indicated proteins.
Results - 97
Figure 6. GM130 depletion increases Ras activity (A) Working model: GM130 acts as suppressor of RasGRF activity, thereby modulating the activities of Ras and Cdc42. According to this model, the knockdown of GM130 will result in increased Ras activation and decreased Cdc42 activation. (B) HepG2 cells were transfected with the indicated siRNAs. After 72 h, cells were lysed and Ras pull-down was performed using GST-RBD. The eluate form the beads was subjected to SDS-PAGE followed by immunoblotting with a pan-Ras antibody (Ras-GTP). 5% of the original lysate was subjected to SDS-PAGE followed by immunoblotting against tubulin and GM130. Bar graph represents a quantification of the amount active Ras (Ras-GTP) normalized to tubulin. Results are means ± SD from three independent experiments. Asterisks indicate statistically significant differences tested using ANOVA with Newman-Keuls multiple comparison test (*p<0.05; ** p<0.01).
Results - 98
Results - 99
Figure 7. Dysregulation of GM130 in human colon cancer. GM130 expression was measured by IHC on a Colon Progression TMA. (A) Graphic representation of the neoplastic evolution of colon carcinoma from the normal colon mucosa through the adenoma. (B) Bar graphs depicting the average expression level (± SD) of GM130 in Normal Colon Mucosa, Colon Tubulovillous Adenomas and Colon Adenocarcinomas or (C) the percentage of low and high GM130-expressing samples when using a cut off score value of 1.5 (differences are significant as assessed by Pearson 2 analysis P < 0.001). (D) Representative images of immunohistochemical staining for GM130. (E) Bar graphs depict the expression score of GM130 in 16 patients for which matched normal and tumor tissue were available on the TMAs. GM130 is downregulated in colon cancer with respect to the normal colon mucosa in 14 out of 16 patients. (F) Representative core images of normal and tumor tissue from patient 14 and 19. Scale bar, 100 m
Results - 100
Results - 101
Supplementary Figure 1. Effect of GM130 on Cdc42 activity and on polarity proteins. (A) Schematic representation of the Raichu FRET probes. Starting from the N-Term we find CFP, the CRIB domain of PAK1 (effector of Cdc42), Cdc42 deprived of its C-Term, YFP and a C-terminal motif which is either the K-Ras C-Term sequence (PM-Probe) or the Cdc42 C-Term sequence (EM-Probe). Once Cdc42 is activated, the probe binds and CFP and YFP are brought close to each other, resulting in FRET. (B) HeLa cells were plated on coverslips. 24 h later, cells were transfected with the plasmid encoding for the Cdc42-EM FRET probe. 48 h later, cells were fixed and processed for immunofluorescence staining of GM130. (C) Caco-2 (left panel) or HeLa (right panel) cells were transfected with the indicated siRNA (#1 = Dharmacon, #2= Qiagen). After 72 h, cells were lysed and GST-PAK1 was added to the lysate followed by pulldown with GSH-sepharose. The eluate was subjected to SDS-PAGE followed by immunoblotting against Cdc42 (GTP-Cdc42). 5% of the original lysate was subjected to SDS- PAGE followed by immunoblotting against Cdc42 (Total Cdc42) and against GM130. The amount of active Cdc42 (GTP-Cdc42) was quantified and normalized to total Cdc42. Results are means ± SD from three independent experiments. Asterisks indicate statistically significant difference (p<0.01) tested using one-side Student’s t-test. (D) HeLa cells were transfected with the indicated siRNA (QIAGEN SI04329941). After 72 h, cells were lysed and total RNA was extracted with the Qiagen RNeasy kit. The RNA was then retrotrascribed to cDNA by using the high capacity cDNA reverse transcription kit (Applied Biosystems) following manufacturers' instructions. Q-PCR was performed by using Fast SYBR green PCR MasterMix (Applied Biosystems) and primers specific for the cDNA of interest. (E) HeLa cells were transfected with the indicated siRNA (#1 = Dharmacon, #2= Qiagen). After 48h, cells were plated into IBiDi chambers and after additional 24 h, the plastic support was removed to allow cells to migrate for 19 h. After 19 h of migration, cells were fixed and immunostained with concanavalin-488. The length of the remaining wound was then measured with ImageJ. The distance migrated by control cells was set as 1 and the other conditions were normalized to it. On the graph, averages of at least 4 independent experiments are shown ± standard deviation. Asterisks indicate statistically significant differences tested using ANOVA with Newman-Keuls multiple comparison test (**p<0.01; *** p<0.001). (F) HeLa cells were transfected with the indicated siRNA. After 72 h, a wound was made and cells were allowed to polarize for 1 h at 37°C followed by fixation and staining
Results - 102 for aPKC and GM130. The position of the wound is indicated by the white lines. Cells facing the wound showing an enrichment of aPKC at the leading edge were counted in control and GM130 knockdown cells. Results are displayed as bar graphs in the right panel. Results are means ± SD from three independent experiments. Asterisks indicate statistically significant differences at p<0.01 (Student’s t-test).
Results - 103
Results - 104
Supplementary Figure 2. GM130 depletion does not affect Golgi integrity. (A) HeLa cells were transfected with the indicated siRNA. After 72 h, cells were fixed and processed for immunofluorescence staining of GM130 and Giantin. In case the cells exhibit more than three fragments of the Golgi, they were termed “fragmented”. The percentage of cells exhibiting a fragmented Golgi was counted and the results are displayed as a bar graph in the lower panel. Results are means ± SD from 3 independent experiments where at least 80 cells were counted per condition per experiment. The statistical difference was tested using a Student’s t-test and found not be significant. White bars correspond to 25 µm. (B) HeLa cells were transfected with control siRNA or GM130 siRNA. 48h later, cells were transfected with a plasmid encoding a fluorescent protein targeted to the Golgi (pmTurquoise-Golgi). After another 24 h, cells were analysed at the microscope. A region corresponding to approximately 1/3 of the Golgi was bleached and the fluorescence recovery was monitored. Results are average of 3 different experiments ± SD. No significative differences were observed between control siRNA and GM130 siRNA. White bars correspond to 10 µm.
Results - 105
Results - 106
Supplementary Figure 3. GM130 depletion does not affect trafficking, Golgi structure or microtubule regrowth. (A) HeLa cells stably expressing the RUSH-ManII-GFP construct were transfected with the indicated siRNA. After 72 h, cells were either fixed directly (0 min) or treated with biotin followed by fixation at 30 min after treatment (30 min). The amount of cells displaying a Golgi pattern at 30 min after treatment was evaluated and is shown in the left panel. Results are means ± SD from 3 independent experiments. No significant difference was detected (Student’s t-test). White bars correspond to 25 µm. (B) HeLa cells were transfected with the indicated siRNA. After 48 h, cells were transfected with a plasmid encoding the temperature sensitive GFP-tagged VSVG-ts045 (VSVG-GFP). Cells were incubated overnight at 40°C to accumulate the protein in the ER. On the next day, cells were either fixed directly (0 h) or were incubated at 37°C for 1 h followed by fixation. Cells were stained by immunofluorescence for GM130. The amount of VSVG-GFP at the plasma membrane was measured using ImageJ and normalized to the GFP-fluorescence inside the cell. Results are displayed as a bar graph in the right panel. Results are means ± SD from 3 independent experiments where at least 15 cells per condition were evaluated per experiment. The statistical difference was tested using a Student’s t-test and found not be significant. White bars correspond to 25 µm. (C) HeLa cells were transfected with the indicated siRNA. After 72 h, cells were fixed followed by immunofluorescence staining of β-COP and Giantin. The intensity of β-COP staining at the Golgi was normalized to the intensity β-COP in the cytosol. The results are displayed as a bar graph in left part of the panel. Results are means ± SD from 3 independent experiments. No significant difference was detected (Student’s t-test). White bars correspond to 25 µm. (D) RPE-1 cells were transfected with control or GM130 siRNA. After 72 h, cells were processed to stain nucleating microtubules, as described in the “Materials and Methods” section. With bars correspond to 10 µm. Cells showing microtubules nucleating from the Golgi were counted. The result is shown in the upper bar graph. In addition, the average number of Golgi derived microtubules was calculated and the result is shown in the lower bar graph. Results are averages of at least 3 independent experiments ± SD. No significant difference was detected (Student’s t-test).
Results - 107
Supplementary Figure 4. Effect of ARHGEF 9, 11 &12 on Cdc42 activity, cell migration and Golgi orientation. (A) RT-PCR quantification of the expression of ARHGEF9, 11 & 12 in cells transfected control siRNA or with siRNA against the given ARHGEF. (B) HeLa cells stably expressing Venus-Cdc42 were transfected with the indicatd siRNA. After 72 h, cells were lysed and GST-PAK1 was
Results - 108 added to the lysate followed by pulldown with GSH-sepharose. The eluate was subjected to SDS-PAGE followed by immunoblotting against Cdc42 (Cdc42-GTP). 5% of the original lysate was subjected to SDS-PAGE followed by immunoblotting against Cdc42 (Total Cdc42). (C) HeLa cells were transfected with the indicated siRNA. After 48h, cells were plated into IBiDi chambers and after additional 24 h, the plastic support was removed to allow cells to migrate for 19 h. After 19 h of migration, cells were fixed and immunostained with concanavalin-488. The length of the remaining wound was then measured with ImageJ. The distance migrated by control cells was set as 1 and the other conditions were normalized to it. On the graph, averages of three independent experiments are shown ± standard deviation (left image). (D) Cells were transfected with the indicated siRNA. After 72 h, a wound was made using a 10µl pipette tip and cells were allowed to migrate and polarize for approximately 6 h at 37°C followed by fixation and immunofluorescence staining of Giantin to label the Golgi. The Golgi was counted as oriented towards the wound if its major mass was located mainly in a 120° angle facing the wound edge. The red line shows the average orientation of the Golgi immediately after wounding (45%). Results are means ± SD from three independent experiments. The red line represents the average % of oriented Golgi in cells fixed immediately after wounding. Asterisks indicates statistically significant differences using ANOVA with Newman-Keuls multiple comparison test (*p<0.05).
Results - 109
Results - 110
Supplementary Figure 5. TUBA is not involved in mediating the GM130 effect on Cdc42. (A&B) HeLa cells were transfected with a plasmid encoding HA tagged Tuba. After 24 h, cells were fixed and stained for HA and GM130 or Giantin. An intensity plot corresponding to the region marked by an arrow is shown. (C) HeLa cells were transfected with an empty vector (-) or a plasmid encoding HA tagged Tuba (+). After 24 h, cells were lysed and an IP against HA was performed. “5% input” indicates lanes where 5% of the total material that was used in the IP is loaded. The immunoprecipitate was then subjected to SDS-PAGE followed by immunoblotting against the indicated proteins. (D) HeLa cells were transfected with an empty vector or a plasmid encoding HA tagged Tuba. After 24 h, cells were lysed and IP against GM130 was performed either with a GM130 antibody (+) or with proteinG-sepharose beads alone (-).5% input indicates lanes where 5% of the total material that was used in the IP is loaded. The immunoprecipitate was then subjected to SDS-PAGE followed by mmunoblotting against the indicated proteins. (E) HeLa cells were transfected with control or TUBA siRNA (QIAGEN - nr SI04220237) 72h prior to the experiment. FRET was measured as indicated in “Materials and Methods. Results are means ± SD from three independent experiments. Asterisks indicate statistically significant differences tested using one-side Student’s T-Test (*p<0.05). (F) HEK293 cells were transfected with a plasmid encoding for the Cdc42 Raichu probe plus another plasmid encoding for HA-TUBA or for HA alone. After 24 h, cells were fixed. FRET was measured at the Golgi as described in the Materials and Methods section. Results are averages of 3 independent experiments. No significative difference was observed between control or TUBA KD cells (Student T-Test). (G) HEK293 cells were transfected with siRNA against TUBA (QIAGEN nr. SI04220237 or siRNA from the GEF siRNA library - Dharmacon). After 72 h, cells were lysed and the expression of TUBA was quantified using RT-PCR.
Results - 111
Results - 112
Supplementary Figure 6. Characterizing the GM130-RasGRF complex. (A) HeLa cells were transfected with plasmids encoding HA-tagged RasGRF1 (RasGRF1-HA) and myc-tagged GM130 lacking its first 690 amino acids (GM130-Δ690-myc). After 24 h, cells were lysed and the lysate was subjected to immunoprecipitation with an anti-myc antibody followed by SDS-PAGE and immunoblotting against the indicated proteins. (B) HeLa cells were transfected with plasmids encoding Flag tagged wild type RasGRF2 (RasGRF2-Flag) or Flag-tagged RasGRF2 where the DH domain has been deleted (RasGRF2ΔDH-Flag) or with Flag-tagged RasGRF2 where the Cdc25 domain has been replaced by GFP (Flag-ΔCdc25). After 24 h, cells were lysed and the lysate was subjected to immunoprecipitation with an anti-GM130 antibody followed by SDS-PAGE and immunoblotting against the indicated proteins. (C) HeLa cells were transfected with control or GM130 siRNA 72 h prior to the experiment. RasGRF1 or RasGRF2 indicate conditions where control HeLa cells were expressing Flag-tagged RasGRF2 or HA-tagged RasGRF1 were co-expressed together with the Raichu probe. RasGRF2ΔDH indicates a condition where RasGRF2 lacking the DH domain was co-expressed together with the Raichu probe. FRET was measured as indicated in “Materials and Methods”. Results are means ± SD from three independent experiments. Asterisks indicate statistically significant differences tested using ANOVA with Newman-Keuls multiple comparison test (*p<0.05; ** p<0.01).
Results - 113
Supplementary Figure 7. Effect of GM130 depletion of ERK activation. (A) HEK293 cells were transfected with the indicated siRNA. After 72h, cells were serum starved for 2h and then stimulated with 10% FCS fort he indicated time points. Cells were subsequently lysed and the lysates were subjected to SDS-PAGE followed by immunoblotting against the indicated proteins. Results are means ± SD from five independent experiments. Asterisks indicate statistically significant differences tested using ANOVA with Newman- Keuls multiple comparison test (*p<0.05).
Results - 114
Supplementary Figure 8. Effect of GM130 on PC12 cell differentiation (A) PC12 cells were transfected with plasmids encoding either non-targeting shRNA constructs (control; blue line) or shRNA against GM130 (red line). Cells were treated with
Results - 115
NGF followed by fixation at the indicated time points and staining of dually phosphorylated ERK1/2 (p-ERK). (B&C) PC12 cells were transfected with plasmids encoding either non- targeting shRNA constructs (control) or different shRNAs against GM130 (shRNA 1-4). Cells were treated with differentiation medium for 24 h and cells were fixed and the amount of differentiated cells was scored. A cell was termed differentiated if it had a process that is longer than 1 cell diameter.
Results - 116
Supplementary Figure 9. Downregulation of GM130 in colorectal cancer. (A) Two examples of normal colonic mucosa (left) and the matching cancerous tissue (right) stained for GM130 (brown) and DNA (nuclei, blue). (B) Median value of the GM130 staining from 11 patients. Asterisks indicate statistically significant differences at **p<0.01 (Student’s t-test). (C) Quantification of the GM130 staining (normalized to the number of nuclei) in 11 patients measured with ImageJ. (D) The indicated cells lines were transduced with lentiviruses encoding either control or GM130 shRNA. After 4-6 passages in culture, cells were grown in culture dishes to 90% density, lysed and the cell lysates were subjected to SDS-PAGE followed by immunoblotting against the indicated proteins.
Results - 117
Additional results
HeLa cells grown to confluency were serum starved and restimuated with 10% FCS for the indicated time points or alternatively they were treated for 24 h with either ionomycin or PMA. Cells were then lysed and the lysate was subjected to immunoprecipitation either with a GM130 antibody or with protein G sepharose beads alone. ‘5% input’ indicates lanes where 5% of the total material that was used in the immunoprecipitation is loaded.
Results - 118
Part 2 - Regulation of spatial Cdc42 signaling by GM130 and its effects on cell migration, invasion and polarity Baschieri F, Uez Von-Allmen E, Legler DF, Farhan H. Regulation of spatial Cdc42 signaling by GM130 and its effects on cell migration, invasion and polarity – Cell Cycle – Accepted on January 8th, 2015.
GM130 expression in breast cancer We showed previously that GM130 expression is reduced in colorectal cancer 20. Searching the Oncomine database (https://www.oncomine.org), we found several studies that reported lower GM130 mRNA levels in breast cancer compared to normal mammary tissue and two examples are displayed in Figure 1B. Thus, the defect in polarity imposed by GM130 depletion potentially represents a selective advantage to breast cancer, which is in line with findings of others who showed that loss of polarity genes promotes tumor progression 17, 21, 22. We compared the levels of GM130 mRNA and protein expression in a panel of breast cancer cells (five basal and four luminal cell lines). There was no significant difference between the two subtypes with respect to GM130 levels (Fig. 2A&B). Interestingly, while most cell lines had relatively comparable amounts of GM130 mRNA (Fig.2B), the variability in the levels of GM130 protein was more pronounced (Fig.2A) and did not correlate with the differences observed at the mRNA level. For instance while BT20 cells had higher GM130 mRNA levels than BT549 cells, the situation was opposite at the protein level.
Golgi morphology in breast cancer cells Since cancer cells were shown to often display altered Golgi structure 23, we determined the Golgi compactness index as described previously 24. Some cell lines displayed strongly fragmented Golgi phenotypes, while others exhibited the Golgi as a single copy organelle located in the center of the cell (Fig. 2C&Fig.3). Overall, there was a weak correlation (R2=0.42) between the expression levels of GM130 and the degree of Golgi compactness (Fig. 2D). However, when the two subtypes were analyzed separately we observed that luminal cell lines have a stronger correlation between Golgi compactness and GM130 levels, while basal cell lines displayed a very weak correlation.
Results - 119
GM130 depletion does not affect proliferation, apoptosis or adhesion Based on our previous work 20, we speculate that the effect of GM130 loss is that it de- regulates cell polarity and thereby promotes tumorigenesis. However, we did not consider the possibility of effects on other cancer hallmarks such as proliferation, apoptosis or adhesion 25, which could arise from pathways independent on polarity or from the defect on polarity itself 26, 27. We therefore stably depleted GM130 in two luminal (MCF7 and T47D) and two basal (MDA-MB231 and BT549) cell lines (Fig. 4A). In none of the cells could we detect an appreciable effect on adhesion or proliferation (Fig. 4B&C). In the case of apoptosis, we compared the basal level of apoptosis as well as cell death induced by the cytostatic drug Doxorubicin. In all cell lines, we observed a significant increase in apoptosis after treatment with the cytostatic agent (Fig. 4D). We next compared the sensitivity towards Doxorubicin treatment in mock-depleted and GM130-depleted conditions. In T47D cells, GM130 knockdown led to a reduced sensitivity towards Doxorubicin treatment, although the result was statistically significant, it was very weak. In MDA-MB231 cells, depletion of GM130 increased sensitivity and this effect was not only statistically significant, but was also strong.
Effect of GM130 depletion on cell motility We finally tested the effects of GM130 depletion on cell migration. A classic is to perform wound-scratch assays and as shown previously for HeLa cells 20, directed motility of four breast cancer cell lines was inhibited by GM130 depletion (Fig. 5A). This is consistent with the defect in cell polarization imposed by GM130 depletion. Furthermore, we performed an invasion assay wherein cells had to invade through Matrigel towards a gradient (serum). In agreement with a polarization defect, GM130 knockdown reduced the invasive capacity of cells (Fig. 5B). However, loss of polarity genes was previously shown to promote metastasis 17, 21, and GM130, which we identified as a polarity regulator, also appears to be downregulated in breast (Fig. 1B) and colonic 20 cancer. It is difficult to reconcile a pro- tumorigenic effect with an inhibition of invasion. However, we stress that the wound scratch assay and invasion assays towards a chemoattractant are strictly dependent on polarity and therefore are of limited use to evaluate the role of polarity proteins in cancer. Using intra- vital microscopy, it was shown recently that tumors exhibit two populations of cells, one that is fast moving and one that is slow 28. There, it was hypothesizes that the fast moving cells are those who cover large distances until they reach the proximity of a vessel, where they
Results - 120 become slower. Another report showed that cancer cells that move faster are those which are more likely to metastasize, as they give rise to more circulating tumor cells 29. We therefore tested the effect of GM130 depletion on random motility of two breast cancer cells, BT549 and MDA-MB231, both of which are of the basal subtype, which is known to give rise to more metastasis than luminal cells. In BT549 cells, we observed a robust increase in a random motility assay (Fig. 5C). The magnitude of the effect of GM130 depletion is in the range of what has been observed for other genes of relevance to cell motility 30. Of note, persistency of cell movement was reduced by GM130 knockdown (Fig. 5C). A similar observation has been made for HeLa cells migrating on collagen (not shown). In MDA-MB231 cells, velocity tended to increase by GM130 depletion, but the effect did not reach statistical significance and was weaker compared to BT549 cells (Fig. 5C). This is potentially due to the fact that MDA-MB231 cells express a constitutively active K-Ras oncogene (table 1). Hyperactive Ras signaling will over-activate ERK1/2, which is a positive driver of cell movement. In addition, GM130 depletion itself hyperactivates ERK1/2 20. Therefore, it might not be possible to detect the contribution of GM130 towards motility in cells with an already highly active Ras-ERK pathway. Finally, we wanted to determine the effect of GM130 depletion on invasion using an experimental setting that does not rely on a gradient. Strikingly, GM130 depletion in BT549 cells strongly increased the invasive capacity (Fig. 5D). On the contrary, MDA-MB231 cells, which did not respond in the random migration assay, did not show the same phenotype (Fig. 5D). Luminal cells are less invasive than basal cells. Nevertheless, T47D were shown to be slightly invasive 31 and when we tested the effect of GM130 depletion in this cell line, we found that the invading cells doubled. However, the total number of invading cells remained markedly below what we observed for the two basal cell lines (data not shown).
Results - 121
Table 1 Cell line Type ER PR ERBB2 Mutations Ref. MCF7 Luminal + + - PI3KCA 31-34 MDA-MB-361 Luminal + + - PI3KCA 31, 32, 34 SKBR3 Luminal - - + TP53 31, 32, 35 T47D Luminal + + + PI3KCA 31, 32, 34 CDKN2A, 31, 32 BT20 Basal - - - PI3KCA, TP53 PTEN, RB1, 31, 32 36 BT549 Basal - - - TP53 CAL51 Basal - n.a. + PI3KCA 33, 36 BRAF, 31, 32 36 CDKN2A, MDA-MB-231 Basal - - - KRAS, NF2, TP53, PDGFRA PTEN, RB1, 31, 32 36 MDA-MB-468 Basal - - - SMAD4, TP53 Table 1 – Main characteristics of the cell lines analyzed
Results - 122
Figures
Results - 123
Figure 1 (A) Schematic representing the mechanism of action of GM130: GM130 binds to RasGRF and blocks its function. Once Cdc42 is activated, it accumulates on membranes and the Golgi sends Cdc42 in a polarized fashion to the Leading Edge of the migrating cell, thereby conferring persistence to the migration. GM130 will therefore contribute to maintain the balance between Cdc42 and Ras signaling. When GM130 is lost, the cell cannot migrate persistently and there is an imbalance between Cdc42 and Ras signaling. (B) Box Plots of two studies 37, 38 comparing the mRNA levels of GM130 in normal tissues and in breast cancer tissues (obtained from Oncomine).
Figure 2 (A) Histogram representing the quantification of GM130 levels compared to actin, obtained from 3 independent western blots. Results are showed as averages ± SE. Below, a
Results - 124 representative western blot. (B) mRNA levels of GM130 normalized to GAPDH mRNA. Results are shown as 1/(CtGM130-CtGAPDH). Bar graphs are averages of 3 independent experiments ± SE. GAPDH was amplified at cycle 15.8687 ± 0.3265, confirming that it can be considered an housekeeping gene also when comparing different cell lines. (C) The Golgi Compactness Index (GCI) was calculated as described in the materials and methods. More than 20 cells per experiment in three independent experiment were scored for each cell line. Results are shown as averages ± SE. (D) GCI was plotted on the x axis, the average of the protein levels of GM130 was plotted on the y axis. The linear correlation between these two parameters was assessed for all data points (black), only for luminal cell lines (blue) or only for basal cell lines (red).
Results - 125
Results - 126
Figure 3 Cells were plated on coverslips and processed for immunofluorescence staining using antibodies against GM130 (green) and Giantin (red) to visualize the Golgi, and DAPI to stain the nuclei. Scale bars, 10µm. (A) Representative images of Golgi in luminal cell lines. (B) Representative images of Golgi in basal cell lines.
Results - 127
Results - 128
Figure 4 (A) The indicated cell lines were stably transduced with either a control plasmid (pLVTHM) or a plasmid encoding a shRNA against GM130 (GM130 shRNA). The cells were lysed and processed for western blot with antibodies against GM130 and actin to verify the efficiency of the shRNA against GM130. (B) The capacity of the indicated cells to adhere to a soft substrate (Collagen type IV) were assessed as described in the materials and methods. Results are shown as averages of three independent experiments ± SE. No significant difference was observed using the Student T test. (C) Cells were plated on coverslips, grown to subconfluency and processed for immunostaining against the proliferative marker Ki67 and DAPI. The percentage of cells positive for Ki67 was calculated counting at least 300 cells per experiment in three independent experiments. Results are shown as averages ± SE. No significant difference was observed using the student T test. (D) 200.000 cells were plated on 6-well plates. The next day, cells were either left untreated or treated with the indicated concentration of doxorubicin overnight. MDA-MB231 were also left overnight in the absence of FCS, in addition to the addition of doxorubicin. Cells were then processed for Annexin-V- APC as described in materials and methods. The mean fluorescence of the Annexin-V staining was measured in at least three independent experiments for every condition. Results are shown as averages ± SE. Asterisks indicate statistically significant differences calculated with ANOVA using the Newman-Keuls correction for multiple comparisons (*P<0.05; **P<0.01, ***P<0.001).
Results - 129
Results - 130
Figure 5 (A) Wound healing assays were performed as described in materials and methods. The area migrated by the cells was measured. Results are expressed as percentage of migration compared to control conditions. Results are shown as averages of at least three independent experiments ± SE. Asterisks indicate statistically significant differences calculated using Student T test (*P<0.05; **P<0.01). (B) Cells were plated on top of Geltrex covered membranes with 8 µm pores and let invade in the presence of a chemotactic gradient (FCS) for 24 h. The number of cells which invaded through Geltrex was then counted. Results are shown as averages of at least three independent experiments ± SE. Asterisks indicate statistically significant differences calculated using Student T test (*P<0.05). Below the bar- graph, schematic of the experimental settings. (C) Cells were plated on glass bottom slides and imaged overnight. Velocity and persistence were calculated as described in the materials and methods. Results are shown as averages of three independent experiments ± SE. Asterisks indicate statistically significant differences calculated using Student T test (*P<0.05). (D) Cells were plated on top of Geltrex covered membranes with 8 µm pores and let invade in the absence of a chemotactic gradient for 24 h. The number of cells which invaded through Geltrex was then counted. Results are shown as averages of at least three independent experiments ± SE. Asterisks indicate statistically significant differences calculated using Student T test (*P<0.05). Below the bar-graph, schematic of the experimental settings.
Results - 131
References
1. Itoh, R.E. et al. Activation of Rac and Cdc42 Video Imaged by Fluorescent Resonance Energy Transfer-Based Single-Molecule Probes in the Membrane of Living Cells. Mol Cell Biol 22, 6582-6591 (2002). 2. Yoshizaki, H. et al. Activity of Rho-family GTPases during cell division as visualized with FRET-based probes. The Journal of Cell Biology 162, 223-232 (2003). 3. Erickson, J.W., Zhang, C.-j., Kahn, R.A., Evans, T. & Cerione, R.A. Mammalian Cdc42 Is a Brefeldin A-sensitive Component of the Golgi Apparatus. Journal of Biological Chemistry 271, 26850-26854 (1996). 4. Nalbant, P., Hodgson, L., Kraynov, V., Toutchkine, A. & Hahn, K.M. Activation of Endogenous Cdc42 Visualized in Living Cells. Science 305, 1615-1619 (2004). 5. Kodani, A., Kristensen, I., Huang, L. & Sütterlin, C. GM130-dependent Control of Cdc42 Activity at the Golgi Regulates Centrosome Organization. Mol Biol Cell 20, 1192-1200 (2009). 6. Durgan, J., Kaji, N., Jin, D. & Hall, A. Par6B and Atypical PKC Regulate Mitotic Spindle Orientation during Epithelial Morphogenesis. Journal of Biological Chemistry 286, 12461- 12474 (2011). 7. Jaffe, A.B., Kaji, N., Durgan, J. & Hall, A. Cdc42 controls spindle orientation to position the apical surface during epithelial morphogenesis. J Cell Biol 183, 625-633 (2008). 8. Oddoux, S. et al. Microtubules that form the stationary lattice of muscle fibers are dynamic and nucleated at Golgi elements. The Journal of Cell Biology 203, 205-213 (2013). 9. Yadav, S., Puri, S. & Linstedt, A.D. A Primary Role for Golgi Positioning in Directed Secretion, Cell Polarity, and Wound Healing. Mol Biol Cell 20, 1728-1736 (2009). 10. Matlin, K.S. & Simons, K. Reduced temperature prevents transfer of a membrane glycoprotein to the cell surface but does not prevent terminal glycosylation. Cell 34, 233- 243 (1983). 11. Wang, B., Wylie, F.G., Teasdale, R.D. & Stow, J.L. Polarized trafficking of E-cadherin is regulated by Rac1 and Cdc42 in Madin-Darby canine kidney cells. American Journal of Physiology - Cell Physiology 288, C1411-C1419 (2005). 12. Kovacs, E.M., Makar, R.S. & Gertler, F.B. Tuba stimulates intracellular N-WASP- dependent actin assembly. J Cell Sci 119, 2715-2726 (2006). 13. Salazar, M.A. et al. Tuba, a Novel Protein Containing Bin/Amphiphysin/Rvs and Dbl Homology Domains, Links Dynamin to Regulation of the Actin Cytoskeleton. J Biol Chem 278, 49031-49043 (2003). 14. Calvo, F. et al. RasGRF suppresses Cdc42-mediated tumour cell movement, cytoskeletal dynamics and transformation. Nat Cell Biol 13, 819-826 (2011). 15. Arozarena, I. et al. Activation of H-Ras in the Endoplasmic Reticulum by the RasGRF Family Guanine Nucleotide Exchange Factors. Mol Cell Biol 24, 1516-1530 (2004). 16. Teng, K. & Greene, L. Cultured PC12 cells: a model for neuronal function and differentiation. Cell Biology: A Laboratory Handbook (Celis JE, ed). San Diego: Academic Press 218, 224 (1994). 17. McCaffrey, Luke M., Montalbano, J., Mihai, C. & Macara, Ian G. Loss of the Par3 Polarity Protein Promotes Breast Tumorigenesis and Metastasis. Cancer Cell 22, 601-614 (2012).
Results - 132
18. Xue, B., Krishnamurthy, K., Allred, D.C. & Muthuswamy, S., K. Loss of Par3 promotes breast cancer metastasis by compromising cell–cell cohesion. Nat Cell Biol 15, 189-200 (2012). 19. Nieto, M.A. Epithelial Plasticity: A Common Theme in Embryonic and Cancer Cells. Science 342 (2013). 20. Baschieri, F. et al. Spatial control of Cdc42 signalling by a GM130–RasGRF complex regulates polarity and tumorigenesis. Nat Commun 5 (2014). 21. Xue, B., Krishnamurthy, K., Allred, D.C. & Muthuswamy, S.K. Loss of Par3 promotes breast cancer metastasis by compromising cell–cell cohesion. Nat Cell Biol 15, 189-200 (2013). 22. Zhan, L. et al. Deregulation of Scribble Promotes Mammary Tumorigenesis and Reveals a Role for Cell Polarity in Carcinoma. Cell 135, 865-878 (2008). 23. Weller, S.G. et al. Src kinase regulates the integrity and function of the Golgi apparatus via activation of dynamin 2. Proc Natl Acad Sci U S A 107, 5863-5868 (2010). 24. Bard, F., Mazelin, L., Péchoux-Longin, C., Malhotra, V. & Jurdic, P. Src Regulates Golgi Structure and KDEL Receptor-dependent Retrograde Transport to the Endoplasmic Reticulum. Journal of Biological Chemistry 278, 46601-46606 (2003). 25. Hanahan, D. & Weinberg, R.A. Hallmarks of cancer: the next generation. Cell 144, 646- 674 (2011). 26. Qiao, X., Roth, I., Feraille, E. & Hasler, U. Different effects of ZO-1, ZO-2 and ZO-3 silencing on kidney collecting duct principal cell proliferation and adhesion. Cell Cycle 13, 3059- 3075 (2014). 27. Bilder, D. Epithelial polarity and proliferation control: links from the Drosophila neoplastic tumor suppressors. Genes & Development 18, 1909-1925 (2004). 28. Gligorijevic, B., Bergman, A. & Condeelis, J. Multiparametric Classification Links Tumor Microenvironments with Tumor Cell Phenotype. PLoS Biol 12, e1001995 (2014). 29. Patsialou, A. et al. Intravital multiphoton imaging reveals multicellular streaming as a crucial component of in vivo cell migration in human breast tumors. Intravital 2, e25294 (2013). 30. Dang, I. et al. Inhibitory signalling to the Arp2/3 complex steers cell migration. Nature 503, 281-284 (2013). 31. Neve, R.M. et al. A collection of breast cancer cell lines for the study of functionally distinct cancer subtypes. Cancer cell 10, 515-527 (2006). 32. Riaz, M. et al. Low-risk susceptibility alleles in 40 human breast cancer cell lines. BMC Cancer 9, 236 (2009). 33. Kao, J. et al. Molecular Profiling of Breast Cancer Cell Lines Defines Relevant Tumor Models and Provides a Resource for Cancer Gene Discovery. PLoS ONE 4, e6146 (2009). 34. Weigelt, B., Warne, P.H. & Downward, J. PIK3CA mutation, but not PTEN loss of function, determines the sensitivity of breast cancer cells to mTOR inhibitory drugs. Oncogene 30, 3222-3233 (2011). 35. Krypuy, M. et al. High resolution melting for mutation scanning of TP53 exons 5-8. BMC Cancer 7, 168 (2007). 36. Lehmann, B.D. et al. Identification of human triple-negative breast cancer subtypes and preclinical models for selection of targeted therapies. The Journal of Clinical Investigation 121, 2750-2767 (2011). 37. Finak, G. et al. Stromal gene expression predicts clinical outcome in breast cancer. Nat Med 14, 518-527 (2008). 38. Curtis, C. et al. The genomic and transcriptomic architecture of 2,000 breast tumours reveals novel subgroups. Nature 486, 346-352 (2012).
Results - 133
Materials and Methods
Materials and Methods Cell Culture and transfection HeLa, HEK293, HepG2, MCF7, MDA-MB-361, T47D cells were cultured in Dulbecco’s modified Eagles medium (DMEM) supplemented with 10% FCS and 100 U/ml penicillin/streptomycin. RPE-1 cells were grown in DMEM/F12 supplemented with 10% FCS and 100U/ml penicillin/streptomycin. MDA-MB-468, SKBR3, CAL51 were cultured in Dulbecco’s modified Eagles medium (DMEM) supplemented with 20% FCS and 100 U/ml penicillin/streptomycin. BT20 were cultured in Advanced MEM supplemented with 10% FCS, 2mM ultraglutamine, and 100 U/ml penicillin/streptomycin. MDA-MB-231 and BT549 were cultured in RPMI supplemented with 10% FCS and 100 U/ml penicillin/streptomycin. PC12 cells were cultured in RPMI supplemented with 10% HS, 5% FCS and 100U/ml penicillin/streptomycin. Caco-2 cells were cultured in minimal essential medium supplemented with 20% FCS and 100 U/ml penicillin/streptomycin. To generate stable cell lines, cells were transduced with lentiviruses (produced according to the protocols of Trono’s lab) and transduced cells were either selected with antibiotics or sorted via FACS (using a BD FACSAriaTM cell sorter).. Transfection of siRNA was performed using HiPerFect (Qiagen) or Lipofectamine2000 (Invitrogen) according to the manufacturer’s instructions. The siRNAs used for the GEF screening were purchased from Thermo Fisher Scientific. Control siRNA was purchased from Thermo Fisher Scientific (ON_TARGETplus Control pool – Cat. Nr. D-001810-10-20). The siRNAs against GM130 were from Thermo Fisher Scientific (ON-TARGETplus smart pool – Cat. Nr. L-017282-00 – indicated in the text as siRNA1) and from QIAGEN (SI04235147 - indicated in the text as siRNA2 – and SI00429191, indicated in the text as siRNA3). The siRNA against RasGRF2 was from Qiagen (SI04329941). The siRNA against TUBA was from QIAGEN (SI04220237 – used in Fig 1B). Plasmid transfection was performed using Fugene6 (Promega) according to the manufacturer’s instructions. Cells were typically transfected 24 h prior to the experiment. PC12 cells were transfected with FugeneHD according to the manufacturer’s instructions.
Materials and Methods - 136
Plasmids Cdc42-GFP-wt (nr. 12599), Cdc42-GFP-TN (nr. 12601), Cdc42-GFP-QL (nr. 12600) were from Addgene (Klaus Hahn’s Laboratory1). RasGRF1-HA, RasGRF2-FLAG, RasGRF1- ΔPH-DH, RasGRF1ΔCdc25, RasGRF2-ΔDH and RasGRF2-ΔCdc25 were described previously2. myc-GM130-ΔN690 was cloned using pcDNA 3.1 myc-His as backbone pL- Venus-Cdc42 was cloned using a modified version of pLVTHM as backbone. RAICHU- Cdc42-EM and RAICHU-Cdc42-PM were kind gifts from Dr. Michiyuki Matsuda (Kyoto University, Japan). The RUSH-MannII-GFP expressing HeLa cells, as well as the VSVG- GFP-RUSH plasmid were a kind gift from Dr. Franck Perez3. Temperature sensitive VSVGts045-GFP was kind gift from Dr. Kai Simons. Flag tag ARHGEF9, 11 and 12 were a gift from Dr. Oliver Rocks. Lentiviral packaging plasmids were bought from Addgene (psPAX2 nr. 12260, pMD2.G nr. 12259 and pLVTHM nr. 12247, from Didier Trono’s laboratory). GM130 GIPZ shRNA was bought from Thermo Scientific (Clone ID: V3LHS_313361). GM130 rat shRNAs (RSH050521 nr 1 to 4) and Control shRNAs (MSH029723-CH1) were bought from Genecopoeia. pmTurquoise2-Golgi was from Addgene (nr. 36205 4).
Pull-down experiments To pull down active Cdc42 cells were lysed in buffer (25mM HEPES pH7.5, 150mM
Nacl, 1% Nonidet-P-40, 10mM MgCl2). Purified GST-tagged effector domain of PAK1 immobilized on GSH-sepharose beads was added to the lysate that was pre-cleared by centrifugation at 21’000xg for 5 min at 4°C. After 1 h incubation at 4 °C, beads were washed twice followed by boiling in sample buffer to elute bound material. To pulldown active Ras, the same procedure was used with the exception the purified GST-tagged Raf1-RBD immobilized to GSH-sepharose beads were added to the lysate.
ERK1/2 activation assays 250.000 HeLa or HEK293 cells were plated in 35mm dishes and transfected with siRNA at the same time (HiPerFect from Qiagen). After 72h cells were serum-starved for at
Materials and Methods - 137
least 2 h. Cells were subsequently stimulated with 10% FCS followed by lysis in ice cold MAPK buffer (150mM NaCl 20mM TRIS-HCl pH7.5, 1% Triton X-100) supplemented with protease and phosphatase inhibitors. The amount of phosphorylated ERK1/2 was determined by immunoblotting.
PC12 differentiation PC12 cells were plated at low density on Collagen coated coverslips. 24 h later, cells were transfected with plasmids encoding either control shRNA or GM130 shRNA. Cells were then starved overnight. Cells were restimulated with 10% NGF and 1% HS for 48h, then the coverslips were stained and fixed. Cells with neurites as long as the body length were counted as differentiated. Due to the presence of a GFP in the plasmid encoding for the shRNAs, we were able to count only cells effectively transfected. To measure P-ERK intensity, cells were stimulated as described above for 0, 30 or 90 minutes and then stained.
Antibodies and immunofluorescent labels Rabbit monoclonal anti-Cdc42 (dilution 1:300 – Cat. Nr. 2466), rabbit polyclonal ERK1/2 (dilution 1:1000 – Cat. Nr. 4695) and rabbit polyclonal against phospho- ERK1/2 (dilution 1:1000 – Cat. Nr. 9101) were purchased from Cell Signalling. Mouse monoclonal GTP-Cdc42 was purchased from NewEast Biosciences (dilution 1:50 - Cat. Nr. 26905). To stain for GTP-Cdc42, Image-iT, FX Signal Enhancer from Invitrogen was used according to manufacturer’s instructions. Mouse monoclonal anti-GM130 antibody was from BD-Biosciences (IF dilution: 1:1000 – WB dilution 1:250 – Cat. Nr. 610823). Rabbit monoclonal anti-GM130 was from cell signalling (dilution 1:500 – Cat. Nr. 12480). Rabbit monoclonal anti-RasGRF (WB dilution 1:200 – IF dilution 1:50 – Cat. Nr. Sc-863) and Mouse monoclonal E-Cadherin antibody (dilution 1:500 – Cat. Nr. 21791) were purchased from Santa-Cruz. Rabbit polyclonal anti-Giantin antibody was from Covance (dilution 1:1000 – Cat. Nr. PRB-114C). Monoclonal ANTI-FLAG® M2- Peroxidase (HRP) was from Sigma (dilution 1:2000 – Cat. Nr. A8592). Mouse monoclonal anti-HA 12CA5 antibody was from Roche (WB dilution 1:4000 – IF dilution
Materials and Methods - 138
1:500 – Cat. Nr. 11583816001). Mouse monoclonal anti-γ-tubulin (dilution 1:1000 – Cat. Nr. Ab11317), Rabbit polyclonal anti TGN46 (dilution 1:1000 – Cat. Nr. Ab50595) werefrom Abcam, Mouse monoclonal anti-GFP (dilution 1:1000 – Cat. Nr. 11814460001) was from Roche. AlexaFluor647 Phalloidin (Cat. Nr. A22287) and AlexaFluor488 concanavalin (Cat. Nr. C11252) and AlexaFluor647HPA (Cat. Nr. L32454) were from Invitrogen. Rabbit polyclonal anti-Ki67 antibody was from Abcam (IF dilution 1:1000 in PBS-BSA 3% – Cat nr. 15580). For immunofluorescence staining cells were grown on glass coverslips. To stain for RasGRF, cells were fixed on ice with 4% formaldehyde for 10 min followed by permeabilization with PBS containing 0.05% triton X100 for 3 min at RT. To stain for β-COP cells were fixed with methanol-acetone (50/50) for 2 min on ice. For all other stainings, cells were fixed with 4% paraformaldehyde for 15 min at RT followed by permebilization with PBS containing 3% BSA and 0.2% triton X100. . DAPI Fluoromount G (Southern biotech – Cat nr. 0100- 20) was used in most cases to mount the coverslips.
Microtubule nucleation assay RPE-1 cells were plated on coverslips and transfected with siRNAs using HIPerFect. After 72 h, 100μM HEPES pH 7.35 was added to the cells and the cells were then transferred on ice for 40 minutes. Then cells were put back at room temperature and fixed after 0, 3 and 4 minutes at room temperature in fixation/permeabilization buffer (10mM Citric Acid, 0.05% Tween 20, pH 6.0, PFA 2% in buffer CB, 0,025% glutaraldheide, 0,2% Tx-100). Immunostaining was then performed using antibodies against GM130, TGN46 and Tubulin.
Caco2 Cysts Caco-2 cells were plated in 35mm dishes. 24 h later they were transfected with siRNAs using Lipofectamine 2000. After additional 24 h cells were trypsinized and an additional siRNA transfection using Lipofectamine 2000 was performed. Cells (6x104) were re-suspended in 60% DMEM + 40% Matrigel (previously thawed overnight on
Materials and Methods - 139
ice). 100ul of this solution was plated into 8-wells chambers (BD-biosciences), incubated at 37°C for 30 minutes and, once solid, Matrigel was covered with 400ul of DMEM. Media was changed every other day. On the 4th day of culture cysts were fixed with 300ul of paraformaldehyde (4%) 30 min at RT, washed with PBS, permeabilized with 0.5% triton X-100 for 10 min and washed with PBSG (PBS containing 7.5mg/ml glycine). Non-specific staining was blocked with 300ul of blocking buffer (7.7mM
NaN3, 0.1% BSA, 0.2% Triton X-100, 0.05% Tween20) and afterwards the 8-wells chambers were incubated overnight with the primary antibodies diluted in PBS containing 3% BSA. On the next day, cells were washed with blocking buffer and secondary antibodies + fluorescent phalloidin were added for 2 h at RT. Cells were washed again with blocking buffer and the plastic support was removed. A glass coverslip was put on the top of the matrigel and the samples were imaged.
Confocal microscopy image analysis and FRET Microscopy was performed on a LeicaSP5 confocal laser scanning microscope equipped with a Ludin chamber. Most imaging was performed using the 63X objective (1.4 NA). Alternatively, a Zeiss Axiovert 200M with 37°C incubation chamber was used. A 10X objective (NA 0.45) was used for live images with the Zeiss system. Fluorescent Images were acquired on the Zeiss Axiovert 200M using 20X objective (NA 0.4) or a 100X oil immersion objective (NA 1.4). Images were converted into TIFF files and analysed using ImageJ. FRET was performed using the donor-recovery after acceptor photobleaching method using the FRET-AB wizard of the Leica software. Acceptor (YFP) fluorescence was bleached at 100% laser intensity assuring a minimal extent of bleaching by 75%. As for FRET at the Golgi, we chose a region in the juxtanuclear region where this reporter accumulated. To test whether we could recognize the Golgi correctly when looking at the reporter, we initially performed experiments where we colocalized the reporter with Golgi markers and found that we could always recognize the Golgi correctly. To measure FRET at the plasma membrane, we chose random regions at the plasma membrane of cells grown up to 80% confluency. Briefly, cells were divided into 4 regions (quadrants of a Cartesian Coordinates Plane) and FRET Materials and Methods - 140
was measured every time in one different region (the first cell was measured in the first quadrant, the next cell in the second quadrant, and so on). The only limitation we imposed was to avoid regions overlapping with neighbor transfected cells. ImageJ was used to process the images. Briefly, the process “subtract background” was used on every image. If needed to improve visibility, brightness and contrast of the images were corrected (linearly) using the “adjust” menu of ImageJ. Images coming from the same experiment were all modified the same way to leave unaltered the information. Merged images were created with the appropriate function of ImageJ, after correcting the single channel images as described above. The Golgi compactness index was calculated using the formula GCI = 4π × Area/Σ Perimeter2 as described in Bard et al. 5, with GM130 as Golgi marker.
GEF screening FRET measurements at the Golgi were performed in HEK293 cells expressing the Cdc42-EM probe. We calculated the CI95 of GM130 knockdown vs. control cells according to: CI95 = (FRET value of control - FRET value of GM130 knockdown) ± 2.SE Any value below the CI95 (red line in Fig. 2) was considered a hit. Our previous measurements of control and GM130 knockdown cells were used to quantitate the CI95 with the formula described above. 30-45 cells were measured for each condition from two-three independent experiments. The rationale for measuring at least 30 cells was based on our calculation that 18 data points (i.e. cells) are necessary to distinguish a population that differs from the control by 80% of the GM130 effect.
FRET of directional migrating cells HeLa cells were plated on glass coverslips and transfected with siRNA (HIPerfect). After 48 h, cells were transfected with plasmids encoding for the Cdc42-EM or Cdc42- PM FRET probe (Fugene6). After 72 h, a wound was made using a 200µl pipette tip and cells were allowed to migrate at 37°C for 6 hours. Then cells were either fixed or incubated for 1 h at 20°C and subsequently fixed. To measure FRET, we selected the
Materials and Methods - 141
region of the cells directly facing the wound and named it “front”. For regions designated as “rear” we chose regions from the side of the cell opposing the wound. Up to 3 different regions were measured in the “rear” and averaged. We did not detect any dependency on where we measured as long as the plasma membrane was opposing the wound. We avoided to measure FRET in regions overlapping with neighbor transfected cells.
Video acquisition of VSVG-GFP vesicles HeLa cells were plated on glass coverslips and transfected with siRNA (HIPerfect). After 48 h, cells were transfected with plasmids encoding for the VSVG-GFP-RUSH (Fugene6). After 72 h, a wound was made using a 200µl pipette tip and cells were allowed to migrate at 37°C for 4 hours. Then imaging was started and biotin added to release the VSVG construct from the ER. Images were acquired every 1.5 sec.
Golgi orientation, cell migration and aPKC recruitment assay For Golgi orientation assays, cells were plated on glass coverslips. After 72 h, a wound was made manually using a 200µl pipette tip. Cells were stained with antibodies anti γ-tubulin and anti-giantin immediately after wounding and after 6 hours. For the assays measuring aPKC recruitment to the leading edge, cells were fixed already 1 h after wounding. For migration assays, cells were transfected with siRNA, and trypsinized after 48 h and plated into Ibidi® chambers placed on glass cover slips. This insert consists of two chambers separated by a 600 μm wall. Removal of the insert generates a wound with a defined width of 600 μm. 12000 cells were plated into each chamber. After 6h, the IBiDi insert was removed and cells were allowed to migrate at 37°C for 24 h. Then, cells were fixed and stained with concanavalin-alexa 488.
Wound Assays Cells were grown on glass coverslips, or on 8 wells glass bottom chambers (BD Falcon Cat Nr. 354108), or on 4 well glass bottom chambers (Lab Tek Cat Nr. 177399). Once
Materials and Methods - 142
confluency was reached, a wound was made using a 10 µm pipette tip. HEPES at a final concentration of 100mM was added to the cells before starting the overnight imaging. One image every 5 minutes was taken using transmitted light for at least 8 hours. Alternatively, wound scratches were imaged immediately after scratching and after overnight migration. The area covered by the cell sheets during migration was measured. The area migrated by control cells was set as 100% and the other values were calculated subsequently. At least three matched experiments (control and GM130 shRNA cells) per conditions were performed.
Random Migration 2E4 cells were plated per well in an 8-well glass bottom chamber slide (BD Falcon Cat Nr. 354108) or alternatively on glass bottom dishes (MatTek corp. P35G-1.5-20-C). Imaging was started after an appropriate time to allow cells to adhere (at least 4 h after plating). HEPES at a final concentration of 100mM was added to the cells before starting the imaging. 1 image every 5 minutes was acquired using transmitted light for at least 8 hours. Individual cells were manually tracked with the ImageJ plugin MTrackJ. Average velocity is automatically given by MTrackJ. Persistency was calculated using the formula: D2S/LEN. D2S = linear distance between first and last position, LEN = total length of the track. At least 5 cells/experiment were tracked in every condition, in at least 3 different experiments.
Coimmunoprecipitations 1x106 cells were plated in 10cm2 cell culture dishes. After 24 h, cells were transfected. After additional 24 h, cells were lysed in IP buffer (20mM HEPES pH 7.3, 200mM KCl, 0,5% Triton X-100), then centrifuged for 15 min at 20’000xg. The supernatant was incubated with protein G sepharose beads coupled to the appropriate antibodies. For anti-HA immunoprecipitation commercially available anti-HA beads (Sigma) were used. After 2 h incubation at 4°C, beads were recovered by centrifugation, washed and the bound material was eluted by boiling in sample buffer.
Materials and Methods - 143
ER-Golgi trafficking The RUSH assay was performed as described previously 3. Briefly, 250’000 HeLa cells stably expressing RUSH-ManII-GFP were plated in 35mm cell culture dishes and transfected with siRNA (using HiPerFect from Qiagen). After 72 h, cells were either fixed directly or were treated with 40 μM of biotin for 1 h followed by fixation in 4% paraformaldehyde at RT. To study Golgi to plasma membrane trafficking, ts045VSVG-GFP was used. HeLa cells were plated on glass coverslips. 24 h later, cells were transfected with siRNA (using Lipofectamine 2000®). Another 24 h later, cells were transfected with a plasmid encoding for temperature sensitive VSVG-GFP (ts045VSVG-GFP). 8 h after transfection, HEPES was added to the medium to a final concentration of 100mM, plates were sealed with parafilm and incubated overnight at 40°C to accumulate VSVG-GFP in the ER. Then, coverslips were either fixed (T0) or incubated at 37°C for a hour to allow trafficking of VSVG-GFP to the plasma membrane and then fixed.
RT-PCR Total RNA was isolated from cells by using the Qiagen RNeasy kit. cDNA was prepared from 100ng total RNA by using the high capacity cDNA reverse transcription kit (Applied Biosystems) following manufacturers' instructions. Q-PCR was performed by using Fast SYBR green PCR MasterMix (Applied Biosystems). RT-PCR were run on 7900HT Fast RT-PCR system (Applied Biosystems). Expression of each gene was normalized to the expression of ubiquitin and β-2-microglobulin. Specific primers for RasGRF2 were described in Jacinto et al. 6. Primers for TUBA, ARHGEF9, ARHGEF11 and ARHGEF12 were designed using PrimerExpress®. Specific primers for GM130 were designed with the online software Primer3Plus (http://www.bioinformatics.nl/cgi- bin/primer3plus/primer3plus.cgi). Specific primers for GAPDH were previously described 7. Sequences are provided below: TUBA: F: 5' TGCGCTGCTTGAAATCTACG 3' - R: 5' ATTTGTGCATCCCCATTCGT 3' – RasGRF2: F: 5' CTACTTCGAGGGCGAGCA 3' - R: 5' TCCAGTGGCTTCTGACCTTC 3' -
Materials and Methods - 144
GAPDH: F: 5' CGCTCTCTGCTCCTCCTGTT 3' - R: 5' CCATGGTGTCTGAGCGATGT 3' - GM130: F: 5' TGCCAGTCTCACTAGCATGG 3' - R: 5' TGACACATGTCGCAGACTCA 3'.
Immunohistochemistry Three-µm slides cut from three different tissue microarray block containing a total of 229 different formalin-fixed, paraffin-embedded samples from colorectal cancers (n=133), tubulovillous adenomas (n=27) and normal colonic mucosa (n=69) were used (duplicate cores for each samples). The project was approved by the ethical committee of the IEO and consent from patients was obtained. Samples were rehydrated through xylene and graded alcohols. Antigen retrieval was accomplished using 1 mM EDTA, 0.05% Tween. After peroxidase block with 3% H2O2 for 5 min, then blocked with 2% goat serum in PBS for 1 h, samples were incubated with primary antibodies (Mouse monoclonal anti-GM130 antibody, BD-Biosciences) in a 1:50 dilution for 60’ min at RT in 2% goat serum. Immunocomplexes were visualized by the EnVision™+ HRP Rabbit (DAKO, K4011), and acquired with the Aperio ScanScope system. Duplicate cores for every sample were evaluated and then the scores were averaged and considered as weak expression (average score 0.5 - 1), moderate expression (average score 1.5 - 2), strong expression (average score 2.5 - 3), or as negative if they scored 0. IHC data for GM130 expression were available only for 29 normal colonic mucosa, 16 tubulovillous adenoma and 109 colorectal cancer samples, since in some cases, individual cores detached from the slides during the manipulations. 11 matched colon cancer samples were analysed at the University of Regensburg according to the following procedure: two-µm slides cut from a tissue microarray block containing 60 different formalin-fixed, paraffin-embedded samples from colorectal cancers (n=20) and matched normal tissues (n=40) were used. Immunohistochemistry of GM130 was carried out in a BenchMark ULTRA (VENTANA) autostainer according to the manufacturer´s instructions. Briefly, retrieval was done using a cictrate buffer, pH6.0 for 44 min. The anti-GM130 antibody was used in a 1:100 dilution and incubated for 32 min. The slides were detected using the ULTRA View Materials and Methods - 145
DAB detection kit (VENTANA). Negative controls without primary antibody were included in each experiment.
Adhesion assay The adhesion assay was performed as described previously 8. Briefly, glass coverslips or glass bottom dishes were coated with tail vein rat collagen type IV at a concentration of 2mg/ml (Roche Cat nr. 11 179 179 001). Surfaces were covered with collagen and air dried followed by washing with PBS and storage at +4°C. Cells were trypsinized and counted. Imaging was performed on a LeicaSP5 confocal laser scanning microscope using a 10X objective (NA 0,3) at 37°C. Imaging was started immediately after plating cells onto the glass bottom dish. The time point when cells settled on the bottom of the coverslip was used as time point 0. One image was acquired every 10 minutes until cells started to adhere on the substrate. The final time point was chosen according on when the morphological changes of control transduced cells became evident. This corresponded to 80 minutes after plating for MCF7 and BT549, 50 minutes for MDA-MB-231 and 460 minutes for T47D. The total area occupied by the cells present in one field of view was measured with ImageJ at the time point 0 and at the final time point. The ratio between the area at the final time point and the area at time point 0 was then calculated (Area After/Before). At least 3 matched experiments (control and GM130 shRNA cells) per condition were performed.
Apoptosis assay 3E5 cells were plated on 6 well plates. 24 h later, Doxorubicin was added to the cells at the minimum concentration required to induce apoptosis (determined experimentally). Cells were stained with Annexin V-APC (BD Pharmingen – Cat nr. 550474) according to manufacturer’s instructions. 24 h later, cells were trypsinized, resuspended in 1ml of medium, washed with ice cold PBS, resuspended in binding buffer (0.1 M Hepes (pH 7.4) 1.4 M NaCl, 25 mM CaCl2) at a density of 1E6 cells/ml. 1E5 cells were then mixed with 5 µl of Annexin-V-APC (BD Pharmingen – Cat nr.
Materials and Methods - 146
550474) and incubated at RT for 15 minutes. Then, flow cytometry analysis was performed on a BD LSR II. At least 3 matched experiments per conditions were performed.
Proliferation assay 1.5E5 cells were plated on glass coverslips. 48 h later, cells were fixed with PFA 3% for 10 minutes and subsequently stained with an anti Ki67 antibody and DAPI. Images were acquired with the Zeiss Axiovert 200m using a 20x objective. 3 to 4 images per condition were taken. Cells positive for Ki67 were counted manually in ImageJ with the “cell counter” plugin and compared with the total number of cells (counting of DAPI stainings). At least 300 cells per experiment were counted, in at least 3 matched experiments.
Invasion assay Fluoroblok™ inserts with 8 µm membrane pores, 24 well plate format (BD Falcon – Ref. 351152) were coated with 50 µl Geltrex (Gibco – Life Technologies – Cat. Nr. A14132-02) diluted in RPMI or DMEM with 0.5% FCS (gradient) or with 10% FCS (random) to a final concentration of 1.2-1.8 mg/ml. Then, coated inserts were stored at 37°C for 1 h, to allow Geltrex to polymerize. In the lower chamber of the invasion well, 600 µl RPMI or DMEM supplemented with 10% FCS were added. 1E5 cells were resuspended in a volume of 200 µl of medium with 0.5% FCS (gradient) or 10% FCS (random) and subsequently were plated in the upper chamber of the invasion well. Plates were then stored at 37°C and allowed to invade for 24 h. Afterwards, the upper chamber was cleaned with a cotton swab and the inserts were analyzed on a Zeiss Axiovert 200M with a 10x objective. 4 images/well, corresponding to ¼ of the total area of the invasion insert, were analyzed in every condition. Cells were counted in every image with the “cell counter” plugin of ImageJ and each condition was compared to control cells.
Materials and Methods - 147
Statistical analysis The data were analysed using Student T Test, Chi Square test or ANOVA test for multiple comparison in GraphPad Prism. All IF images are representative of at least 3 independent experiments. Western blots evaluations and IF evaluations are averages of at least 3 independent experiments. For TMA analysis differences between experimental groups were examined for statistical significance using the nonparametric comparisons for each pair using Wilcoxon Method (Figure 7B – Results Part 1) or Pearson Chi Square test (Figure 7C – Results Part 1). Where applicable, data are expressed as average ± SD. TMA data analysis were performed using JMP 10.0 statistical software (SAS Institute, Inc).
Materials and Methods - 148
References
1. Nalbant, P., Hodgson, L., Kraynov, V., Toutchkine, A. & Hahn, K.M. Activation of Endogenous Cdc42 Visualized in Living Cells. Science 305, 1615-1619 (2004). 2. Calvo, F. et al. RasGRF suppresses Cdc42-mediated tumour cell movement, cytoskeletal dynamics and transformation. Nat Cell Biol 13, 819-826 (2011). 3. Boncompain, G. et al. Synchronization of secretory protein traffic in populations of cells. Nat Meth 9, 493 - 498 (2012). 4. Goedhart, J. et al. Structure-guided evolution of cyan fluorescent proteins towards a quantum yield of 93%. Nat Commun 3 (2012). 5. Bard, F., Mazelin, L., Péchoux-Longin, C., Malhotra, V. & Jurdic, P. Src Regulates Golgi Structure and KDEL Receptor-dependent Retrograde Transport to the Endoplasmic Reticulum. Journal of Biological Chemistry 278, 46601-46606 (2003). 6. Jacinto, F.V., Ballestar, E., Ropero, S. & Esteller, M. Discovery of Epigenetically Silenced Genes by Methylated DNA Immunoprecipitation in Colon Cancer Cells. Cancer Research 67, 11481-11486 (2007). 7. Ma, B., van Blitterswijk, C.A. & Karperien, M. A Wnt/β-catenin negative feedback loop inhibits interleukin-1–induced matrix metalloproteinase expression in human articular chondrocytes. Arthritis & Rheumatism 64, 2589-2600 (2012). 8. Xue, B., Krishnamurthy, K., Allred, D.C. & Muthuswamy, S.K. Loss of Par3 promotes breast cancer metastasis by compromising cell–cell cohesion. Nat Cell Biol 15, 189-200 (2013).
Materials and Methods - 149
Discussion Discussion The results of our work clearly indicate that cell polarity is subject to regulation by an endomembrane pool of Cdc42 that is regulated by a GM130-RasGRF complex that we identified. This finding is of interest for cell biology as it provides the first evidence for a biological role of an endomembrane pool of Cdc42. In addition, our results have further implications for biomedicine as we observed that GM130 is down-regulated in colon cancer and we found evidence in databases that the expression of this Golgi matrix protein is also reduced in breast cancer. In the Introduction, I gave an overview of the link between polarity and cancer, and in light of this, the downregulation of GM130 could be interpreted as further supportive evidence for a role of polarity in cancer. In the following sections, I will critically discuss whether this conjecture is true, which also necessitates a critical discussion on what is already known about the role of polarity in cancer.
Cdc42 signaling from endomembranes An active role for the Golgi in controlling cell polarity had already been proposed in previous researches, but the evidence supporting this claim was weak. Preisinger et al. showed that GM130 anchors the kinase YSK1 at the Golgi and promotes autophosphorylation and activation of the kinase. YSK1 will promote then migration and invasion via its effector 14-3- 3-ζ 1. However, such model suffers of two major problems: (i) a kinase dead version of YSK1 (ATP binding site mutant YSK1K49R) is still able to support migration and (ii) unphosphorylatable YSK1 fragments the Golgi. Therefore an alternative conclusion is that the kinase activity of YSK1 is not needed for migration and that YSK1 plays instead a structural role at the Golgi apparatus. 14-3-3 proteins play also a role in ER to Golgi traffic by competing away βCOP from cargo proteins, thus allowing the release of such proteins from the ER 2, 3. Thus, it is reasonable to think that if 14-3-3-ζ is not recruited at the Golgi, a defect in ER to Golgi traffic will lead to fragmentation of the organelle that will cause the defects in migration and invasion and it is possible that altered YSK1 signaling will lead to mispositioning of 14-3- 3. Yadav et al. found that when GMAP210 and Golgin160 are depleted, cell migration in a wound assay is impaired. Knockdown of these two Golgi proteins leads to fragmentation of the Golgi, but secretion still works. When cells polarize, trafficking of proteins is also polarized mostly to the leading edge and if GMAP210 or Golgin160 are depleted, the secretory traffic does not reorient, thus causing the observed defect in migration 4. In order to polarize post-
Discussion - 152
Golgi traffic, the Golgi itself has to orient towards the leading edge, but when the Golgi Apparatus is fragmented, no orientation is possible. Therefore, also the model proposed by Yadav does not provide strong evidence for an active role of the Golgi in the establishment of front-rear polarity. It is evident that to conclude that to conclude that signaling originating at the Golgi supports cell migration, it is necessary to find a condition where Golgi structure is preserved, but cell migration is impaired. Kodani et al. found that GM130 somehow controls Cdc42 activation and they propose that such regulation happens at the Golgi apparatus 5. They propose that GM130 recruits the Cdc42 GEF TUBA at the Golgi, but some key experiments are missing in their report. If TUBA is the link between GM130 and Cdc42, then TUBA should colocalizes with GM130 and in order to conclude this, confocal imaging is required. Contradicting this possibility, several papers where the localization of the GEF was investigated did not find trace of TUBA at the Golgi 6, 7. We also found no evidence of TUBA interacting with GM130 either in co-immunoprecipitation experiments or in immunofluorescence, where we also excluded the possibility that TUBA could colocalize with a second Golgi marker Giantin. If in the absence of GM130, TUBA is artificially targeted to the Golgi, then Cdc42 activation should be rescued, but this was not tested. Finally, it is not possible to conclude that Cdc42 is activated at the Golgi by performing biochemical pull-down assays. By using FRET reporters we overcame this problem and we were able not only to confirm the finding that GM130 is implicated in the control of Cdc42, but we could also expand such statement by showing that GM130 specifically controls Cdc42 at the Golgi, without exerting any effect on plasma membrane pool of the small GTPase. Knockdown of GM130 impairs the ability of the Golgi to reorient towards the LE of a migrating cell, but does not affect the secretory function of the Golgi. What is affected is polarized secretion, as in the absence of GM130, secretion remains unpolarized. The difference with the previously proposed models is that GM130 knockdown did not fragment the Golgi in our experimental settings, thus we have a model where a structurally intact Golgi is not able to reorient and, subsequently, trafficking does not reorient too. The fact that GM130 knockdown does not affect Golgi structure is in contradiction with some publications 8, 9, but in agreement with others 5, 10. Technical differences in the experimental setting could provide a possible reason for this contradiction. While we use 10 pmol of siRNA (5 nM), in other publications between 4 and 6 folds more siRNA were used to knockdown GM130 8, 9. In addition, we use HiPerFect for siRNA transfections, while Puthenveedu et al and Marra et al used Oligofectamine 8, 9 and
Discussion - 153
HiPerFect is known to be less toxic for the cells than other transfection reagents. Finally, Golgi matrix proteins are to a certain level redundant in their function, so it is possible that depending on the cell line, the function of GM130 could be taken over by other Golgins 11, 12. Our FRAP data show that there is still continuity between Golgi membranes when GM130 is depleted, but electron microscopy would be required to assess if minor changes occur when the Golgi protein is depleted. We could show that Cdc42 is active at the Golgi and that different regulatory mechanisms exist to regulate Golgi-Cdc42 and plasma membrane-Cdc42. We provide evidence that the Golgi supplies the leading edge with active Cdc42, therefore sustaining migration over a long period. Such flux of active Cdc42 is necessary for two reasons. First, once it arrives at the plasma membrane, Cdc42 is not physically restricted to the LE and it will quickly diffuse away. Second, the plasma membrane contains several GEFs and GAPs for Cdc42, thus once the small GTPase reaches the LE, not only it will diffuse away, but it will also be inactivated. Instead, the Golgi is poor in both Rho GEFs and GAPs 13 (personal communication from Dr. Oliver Rocks), therefore when Cdc42 reaches the Golgi, its activation status is preserved. So, the polarized flux of Cdc42 from the Golgi provides a mechanism to localize Cdc42 and its activity at the LE during migration. Another possible interpretation of our data is that the Golgi supplies the leading edge with a Cdc42 GEF. However, such model would not fit with our finding that co- knockdown of GM130 and RasGRF restores normal activation levels of Cdc42 at the Golgi and would require a GEF to be localized at the Golgi, while with our current knowledge we have no evidence for a GEF localizing at the Golgi. An open question in our model regards Ccd42 activation. We showed that the Golgi preserves the activation status of Cdc42, but we didn’t find evidence of Cdc42 being activated locally at the Golgi. Cdc42-GTP is more membrane bound than the inactive protein. Therefore it is possible that once Cdc42 is activated, it will bind to any membrane in the cell. This is supported by the fact that Cdc42 was localized at Golgi, ER and plasma membrane 14. Being the Golgi poor in Cdc42 GAPs, Cdc42 will remain active at the Golgi for a longer period than on other membranes, thus resulting in the trapping of the small GTPase at the organelle. However, such model would predict that any generic condition that decreases Cdc42 activity would lead to decreased Cdc42 activity at the Golgi and this is not the case. In fact, we found that knockdown of only 3 out of 51 Rho GEFs affected Cdc42 at the Golgi, hinting for the existence of a more specific model to locally regulate Cdc42. The three GEFs (ARHGEF9, 11
Discussion - 154 and 12) responsible for activating the Golgi pool of Cdc42 appear to be cytosolic, thus future experiments should try to resolve the spatial regulation of Cdc42 by these GEFs. Based on our model, where Golgi localized Cdc42 is important for directed cell migration, we would expect that tumor cells exhibit abnormal Cdc42 activity at the Golgi. Interestingly, changes in the expression level or in the GEF activity of ARHGEF9, 11 and 12 have been reported in cancer. High levels of ARHGEF9 were found in hepatocellular carcinoma, and it was shown that high levels of this Cdc42 GEF are responsible for increased invasiveness and metastatic ability of cells in mice 15. Alternative splicing of ARHGEF11 was observed mostly in cells at the end of EMT. The result of this alternative splicing is a protein missing its C-terminal domain that exhibits more GEF activity, especially towards RhoA 16. High levels of ARHGEF11 were also reported in the invasive areas of human breast cancers 17. In line with our findings, depletion of ARHGEF11 resulted in impaired directed migration and polarization of cells 17. Knockdown of ARHGEF11 resulted also in enhanced adherent junctions and in the loss of a pool of actin from the center of the cell 17. Considering that Cdc42 was implicated in the control of post-Golgi trafficking, it would be important to check whether this actin pool is situated at the Golgi and whether ARHGEF11, by regulating Cdc42, plays any role in post-Golgi trafficking 18, that would explain the alteration of adherent junction observed upon depletion of the GEF. Finally, ARHGEF12 was shown to support migration and invasion in different types of cancers 19-21. The involvements of those GEFs in cancer speaks in favor of an important role for endomembrane signaling in tumorigenesis. Future work should aim to better elucidate the role of such GEFs in endomembrane signaling and in cell polarity.
Golgi Orientation An indirect conclusion that can be drawn out of our data is that the Golgi pool of Cdc42 is necessary for Golgi orientation. In fact, conditions where the activity of Cdc42 is reduced specifically at the Golgi, but not at the plasma membrane (depletion of GM130, ARHGEF9, 11 or 12) impair the ability of the Golgi to reorient towards the leading edge. How the Golgi reorients is still unclear. Golgi microtubules are captured and stabilized at the leading edge by several proteins (CLASPs, APC, DLG, Par3). Furthermore, the Golgi can capture centrosomal microtubules via the recently described protein MTCL1 22. Because of the localization of the Golgi, these microtubules will grow in direction of the leading edge and will be stabilized by LE proteins. Therefore the simplest way to explain Golgi reorientation would be via
Discussion - 155 microtubules that pull the organelle. However, when Golgi microtubules are disrupted or when MTCL1 is knocked down, no defect in Golgi orientation is observed 23. Vesicular trafficking, which is known to be dependent on MTs, is severely affected in these conditions, thus resulting in impaired migration of cells despite the presence of oriented Golgi and MTOC. CLASPs 24, AKAP450 25 and MTCL1 23 have all been implicated in the nucleation of Golgi microtubules and/or in the ability of the Golgi to capture centrosomal microtubules. It is possible that those proteins are redundant in their function and that in order to assess if Golgi derived microtubules are necessary for Golgi reorientation, all these proteins have to be depleted at the same time. In addition, based on our data that active Cdc42 at the Golgi is necessary for Golgi polarization, it would be interesting to test whether reorientation of the Golgi is made possible by an effector of Cdc42 localized at the Golgi. Such effector could be a motor protein like dynein, which is present at the Golgi and necessary for trafficking.
RasGRF regulation by GM130 and local regulation of Cdc42 The interaction we describe between RasGRF and GM130 is most likely dynamic and thus it is possible that by regulating this interaction, a fine tuning of Cdc42-GTP at the Golgi could be achieved. Indeed, we found that growth signal deprivation and Ca2+ increase abolish the interaction between GM130 and RasGRF, which is then reestablished upon re-addition of FCS to the medium. Switching from a low to high Ca2+ medium induces TJ formation in epithelial cells 26 and concomitantly, an increase in the intracellular levels of Ca2+ is observed 27. RasGRF1/2 have IQ domains that directly respond to calcium 28, 29, therefore it can be speculated that Ca2+ induces a conformational change in the structure of RasGRF that causes its release from GM130, thus activating the protein towards Ras and Rho GTPases. The reason why intracellular calcium increases is not clear, but intracellular calcium is proposed to be as important as extracellular calcium in the establishment of polarity 27. In order to form TJs, cell needs to locally activate Rac or Cdc42. Therefore, it would be expected that an inhibitor of Cdc42 has to remain sequestered at the Golgi. However, since RasGRF has been reported to be an active GEF for Rac, we can speculate that upon release from the Golgi, RasGRF is recruited to primordial junctions where it locally activates Rac. An alternative and less speculative hypothesis is that increased Ca2+ will modulate the interaction between RasGRF and GM130, thus resulting in precise regulation of Cdc42 activity at the Golgi, which could be important for sorting of TJ proteins from the TGN. In neurons, RasGRF1 activates Ras in
Discussion - 156 response to an increase in intracellular Ca2+ 29. The activity of RasGRFs can be modulated by phosphorylation 30-33. In particular, signals from G-protein coupled receptors, as well as PKA signaling cause an increase in the GEF activity of RasGRF1 towards Ras by phosphorylating the protein 30, 34. Src signaling leads to phosphorylation of RasGRF1 (probably on multiple sites), thus triggering its GEF activity towards Rac1, but leaving unaltered its activity on Ras 31. In this study, RasGRF1 was found to have GEF activity only on Rac, but not on Cdc42 or RhoA 31. RasGRF2 activity can also be modulated via signaling. The complex p35/Cdk5 was found to be responsible for phosphorylating the protein on Ser737 and phosphorylation of this residue led to downregulation of Rac1-GTP 32. Thus, the GEF activity of RasGRF can be drastically affected by signaling. RasGRF1/2 was reported to be an inactive GEF for Cdc42 35, but the importance of signaling in the specificity of RasGRF1/2 towards Cdc42 has not been investigated. We can speculate that GM130 works as a scaffold between RasGRF and a kinase that phosphorylates and thus inactivates RasGRF. Indeed, GM130 directly interacts with MST4 and YSK1 1, kinases implicated in polarity processes. In order to establish front rear polarity, RasGRF has to be kept inactive towards Cdc42. This could be the mechanism by which YSK1 regulates migration. Further work will be required to assess whether GM130 prevents RasGRF from acting on Cdc42 simply via sequestration, or if some signaling events are also involved in this regulation.
Polarity and cancer The role of polarity in cancer represents an expanding research area. Loss of polarity has been shown to promote tumor growth and metastasis 36-40. However, the mechanism by which polarity loss promotes tumorigenesis is to date not completely clear and some hypothesis may even appear to be contradicting existing data. The effect of polarity on cancer has to be analyzed at two different levels: initiation and local growth of the tumor and metastatic dissemination. Classically, a cancer-initiating condition is considered if an alteration of cell homeostasis confers growth advantage and immortality to cells, which is achieved by activation of pro-proliferative pathways and by overcoming senescence. Once initiated, it is the current consensus that additional mutations foster the initial events. For instance, it is very important for many tumor types to lose contact-inhibition. Too rapid growth of the tumor results in the inner parts of the tumor rapidly developing hypoxia. Therefore, tumors need to promote angiogenesis to maintain a constant supply of oxygen. Furthermore, the
Discussion - 157 rapid growth of tumors necessitates the remodeling of cellular metabolism. While most normal cells generate energy by relatively low levels of glycolysis followed by oxidation of pyruvate, tumor cells satisfy their higher energetic demand by high levels of glycolysis (>100 times higher than in normal cells) followed by lactic acid fermentation. This phenomenon is known as the Warburg effect. Finally, some tumors develop a hyper-migratory phenotype and invade locally, break into vessels and disseminate systemically, thereby forming metastasis. In epithelial cancers, this is often accompanied by a loss of epithelial characteristics and the gain of mesenchymal features, a process called epithelial-mesenchymal transition (EMT). The connection of cell polarity to each of the aforementioned processes must be discussed carefully.
Figure 1 – Polarity pathways possibly involved in tumor initiation and promotion of metastasis. Polarity proteins are colored in orange.
Initiation of tumors by polarity proteins In order to acquire a growth advantage, cells can either acquire mutations that will render them hyperproliferative, or alternatively, they can inhibit growth suppression. Unlimited replicative potential is a characteristic of stem cells and it is possible that differentiated cells revert to an undifferentiated state, thus gaining back their stemness. Those new stem cells could be responsible for starting a tumor and they are called Cancer Stem Cells (CSC) 41. Whether polarity can initiate cancer is currently unclear. Loss of polarity is one of the first hallmarks of cancer, but whether this is cause or consequence of cancer is not clear. Almost all core polarity protein have been implicated in regulation of proliferation. Depletion of Par3
Discussion - 158 in normal mammary epithelial cells leads to increased rates of apoptosis 42, 43, indicating that loss of polarity per se is not sufficient to increase proliferation. Based on this, loss of polarity cannot be considered an initiator of cancer. This work is important as it is one of the few examples where loss of polarity has been introduced into normal cells, which are neither transformed, nor immortalized. Nevertheless, it has to be stressed that this conclusion is not safe. The experiments in the work cited above were performed in primary mammary epithelial cells that were transplanted into mammary fat pads. The conclusion on apoptosis was based on the observation that Par3-depleted cells are less efficient in generating a new mammary gland. Whether loss of Par3 per se induced apoptosis cannot be concluded as the result could also be interpreted such that Par3-depleted cells more sensitive to the stress imposed by cell transplantation. Notably, if an oncogenic signal is used to overcome apoptosis, an increase in proliferation is detected upon depletion of the polarity protein 36, 44. Therefore, loss of polarity seems to promote tumorigenesis, rather than initiating it. Par6b overexpression resulted in hyperactive ERK and increased proliferation in breast cancer cell lines 45. Since ERK1/2 is a major growth-promoting pathway, this result tempts to conclude that loss of polarity induces hyperproliferation. However, since the work relied on the use of transformed breast cancer cells, it is not correct to consider polarity loss as an initiating event because initiation has already occurred in transformed cell lines. At best, this finding can be interpreted such that loss of polarity promotes growth of an already initiated tumor. Interestingly, Par3 was also shown to control ERK1/2 signaling 37 and the interaction between Par6 and Par3 was not required to control ERK1/2, thus implying that Par3 and Par6 can regulate this MAP kinase pathway via two independent pathways. Finally, the Par complex can activate Rac and Cdc42, which was proposed to lead to malignant transformation of the cells. Par3 regulates the activity of the Rac GEF Tiam1 46. When Par3 is depleted, Tiam1 is hyperactive and mislocalized and this will result in increased Rac signaling 39. Downstream of Rac1, the kinase PAK will phosphorylate MEK and ERK, thus resulting in increased ERK signaling and increased proliferation of MCF10A cells. Par6, Par3 and PKCζ interact also with another Rho GEF, named Ect2 47, which is a known oncogene in many cancers 48. Disruption of the Par complex could result in mislocalization and uncontrolled activation of Ect2 49, leading to increased Rac signaling. Ect2 is on the same locus of aPKCι, and these two proteins are often amplified together in cancer 48. Furthermore, Ect2 promotes aPKCι activation 47. One of the substrates of aPKC is the senescence inducer p21. Hyperactive aPKC will inhibit p21,
Discussion - 159 thus suppressing senescence signaling 50. This function of aPKC appears to be restricted to cancer cells as in non-transformed cells like MCF10A, depletion of aPKC did not result in induction of senescence, which was instead the case in breast cancer and glioblastoma cells 50. Therefore, the same set of proteins promotes hyperphosporylation of ERK and hyperproliferation, and in addition suppress senescence. If this is of relevance in cancer, it would be expected that tumors lose Par3, while upregulate Par6 and/or aPKC. This is indeed the case. Par3 depletion is often observed in tumors, though it is unlikely that this will be the driving mutation of the cancer because of the pro-apoptotic effect generated by loss of the polarity protein. Par6 and aPKCι on the contrary, are often overexpressed in tumors. Those two proteins could collaborate to induce hyperproliferation in the tumors: Par6 would increase ERK signaling, whereas aPKC would inhibit senescence, which could be triggered by ERK. Overexpression of a protein can also result in its mislocalization and disruption of the Par complex will lead to hyperactivation of Rac that in turn can drive transformation. Two other Par proteins could be involved in the generation of CSC. LKB1 (Par4) is a critical factor needed to establish cell polarity 51. Loss of this protein causes the Peutz-Jeghers syndrome, also known as hereditary intestinal polyposis syndrome, where the patient spontaneously develops benign polyps in the intestine. LKB1 is often inactivated or lost in lung and breast cancer and in MCF10A cells, loss of LKB1 cooperates with the oncogene myc to induce hyperproliferation 52. The effect of LKB1 loss on proliferation could be due to hyperactivation of the mTOR pathway. In fact, LKB1 inactivates mTOR through its downstream effector AMPK that in turn phosphorylates the mTOR inhibitor TSC2 53. LKB1 loss could also lead to evade contact mediated inhibition. The kinase negatively regulates the Hippo pathway. LKB1 phosphorylates MARKs that in turn phosphorylate MST1/2. The signal converges to the kinase LATS1/2 that phosphorylates YAP/TAZ. Once the transcription factors are phosphorylated, they are excluded from the nucleus and therefore they are inactive 54. YAP/TAZ translocation to the nucleus is sufficient to confer stemness to a cell and this system is exploited in cancer to generate CSC 55. This puts LKB1 at the center of the stage among all Par proteins because it is the only protein that controls both proliferation and replicative potential of cells, the two characteristics needed to initiate a cancer. In Drosophila it was demonstrated that perturbing asymmetric division in the larval neuroblast led to hyperproliferation and neoplastic transformation 56. Even though a similar evidence in mammal is still missing, it can be proposed that impaired segregation of cell fate
Discussion - 160 determinants will result in promotion of proliferation of undifferentiated cells. Asymmetric cell division is typical of stem cells and interestingly, a recent paper showed that there is a strong correlation between the number of stem cell divisions in a tissue and the risk of developing cancer in that tissue 57. Based on this observation, it is tempting to speculate that alterations in the control of stem cell division is crucial for the development of cancer also in mammals. Considering that the Par proteins were identified is C.elegans for their ability to segregate cell fate determinants in the daughter cells, Par complex proteins could be implicated in asymmetric cell division and thus in stem cell renewal also in mammals. However, very little is known about the role of Par proteins in asymmetric division in mammals. Only recently it was shown that Par3L, a protein similar to Par3, but lacking the interaction sites for Par6 or aPKC, is responsible for the maintenance of a pool of stem cells in the epithelium of the mouse breast 58. Surprisingly, Par3L functions by inhibiting LKB1. It would be interesting to assess whether Par3L is upregulated in cancers and if this upregulation leads to the formation of CSC by activation of YAP/TAZ. The Hippo pathway is a point of convergence of all the polarity complexes. In fact it can be regulated also by Scribble and Crumbs. If cells are plated very sparse, YAP/TAZ are active, whereas, as soon as the cells establish contact with other cells, YAP/TAZ are inactivated and contact inhibition of growth is achieved. The Crumbs complex plays an important role in the process as all its components interact with YAP/TAZ retaining them at TJs. Depletion of Crb3 disrupts the Crumbs complex and results in translocation of YAP/TAZ to the nucleus, that renders the cells insensitive to contact inhibition and causes hyperproliferation 59. Scribble acts as a scaffold for MST1/2, LATS1/2 and TAZ 54, 55. The close proximity of the transcription factor to the kinases responsible for its inactivation cause the silencing of the hippo pathway. However, when Scribble is mislocalized or lost, its scaffolding function is lost and YAP/TAZ translocates to the nucleus 55. Interesting, Scribble is very often mislocalized in breast cancer and lost in several other types of tumors 38. The possibility that loss of mislocalization of Scribble might generate cancer stem cell is currently not well investigated, but it appears a likely scenario. Conversely, the role of Scribble on cell proliferation is well studied. Mislocalization or loss of the polarity protein inhibit the apoptotic response generated by the oncogene Myc, thus potentiating the pro-proliferatory ability of Myc 40. Several proteins related to the ERK pathway directly bind to Scribble 60, 61 and loss of Scribble results in hyperactivation of ERK and promotion of cell proliferation. Scribble bind directly to 2
Discussion - 161 antagonists of Akt signaling, PTEN 38 and PHLPP1 62. It was possible to show in vivo that mislocalization of Scribble resulted in hyperactivation of Akt and subsequent hyperproliferation 38. Transgenic mice expressing a variant of Scribble that does not correctly localize showed hyperproliferation of the mammary gland epithelial cells and the hyperproliferation eventually progressed to tumors in the aging mice 38. However, the tumors were very heterogeneous, meaning that probably they harbored several other mutations in addition to mislocalization of Scribble that could have initiated the process. Together with LKB1, Scribble is the only polarity gene that could control proliferation and stemness. However, it was recently observed that cells depleted of Scribble undergo apoptosis induced by contact with the surrounding cells expressing Scribble and the hyperactivation of the Hippo pathway was observed only in tissue composed entirely by cells lacking the polarity protein 63, 64. Thus it appears difficult to imagine how loss of Scribble could initiate a tumor without further mutations. Golgi and tumor initiation GM130 depletion results in increased ERK signaling and promotion of differentiation of PC12 cells in response to NGF. However, we did not find any relevant effect of GM130 depletion on cell proliferation or apoptosis in transformed breast cancer cell lines, thus we have no evidence to speculate that loss of GM130 could be sufficient to initiate a tumor. The Golgi has a role in controlling entry into mitosis. GRASP65 phosphorylation was shown to be a key event in this process and preventing this event resulted in block of the cell cycle 65. However, hyperphosphorylation of GRASP65 does not lead to a faster entry into mitosis and thus it does not cause hyperproliferation. Several Golgi proteins are targeted by caspases during apoptosis and the proteolytic fragments of these proteins are important to sustain progression of the apoptotic process 66-69. Whether alterations preventing the cleavage of such Golgi proteins are present in tumors is not investigated and it is possible to speculate that mutations in the Golgi proteins that control apoptosis could result in increased survival of tumor cells. The recent discovery that GOLPH3 regulates mTOR could confer the Golgi a role in tumor initiation. GOLPH3 overexpression increases the speed of the cell cycle by modulating mTOR signaling and this results in hyperproliferation 70. In addition, GOLPH3 is implicated in the response to DNA damage and high levels of GOLPH3 prevent apoptosis induced by DNA damage 71. When DNA is damaged, the kinase DNA-PK is activated and phosphorylates
Discussion - 162
GOLPH3, promoting the interaction between GOLPH3 and the unconventional myosin MYO18A. This gives rise to an increased tensile force of the actin filaments that impairs post- Golgi trafficking and eventually leads to Golgi fragmentation. Golgi fragmentation requires DNA-PK, GOLPH3, MYO18A and F-actin and if this pathway is blocked at any step (by inhibition of the kinase, depletion of GOLPH3 or MYO18A or expression of unphosphorylatable GOLPH3), the Golgi remains compact 71. Interestingly, when GOLPH3 or MYO18A are depleted, the Golgi remains intact and cells are sensitized to apoptosis induced by DNA damage. On the contrary, when GOLPH3 is overexpressed, cells become more resistant to apoptosis, meaning that GOLPH3 plays a role in apoptotic pathways downstream of DNA damage 71. Tumor cells have often alterations in the DNA damage response machinery and chemotherapies and radiotherapies take advantage of this by inducing DNA damage that will specifically kill cancerous cells 72. However, if GOLPH3 is overexpressed, this approach could fail. Therefore, high levels of GOLPH3 activate mTOR, which results in hyperproliferation, and at the same time, protect cancer cells from apoptosis in response to DNA damage, thus further increasing the hyperproliferatve effect due to mTOR. This confers to GOLPH3 an important role in tumor formation and progression that doubtless needs to be studied carefully in the future. Finally, a role for the Golgi in asymmetric cell division has been proposed. ACBD3 (also called GCP60) localizes to the Golgi by an interaction with Giantin. During mitosis the Golgi fragments and ACBD3 is released in the cytosol, where it modulates the activity of the cell fate determinant Numb 73. The mechanism causing trapping of ACBD3 at the Golgi and its release during mitosis is not known yet, so it is not possible to conclude whether Golgi localized proteins could function as oncogenes by deregulating asymmetric cell division and thus affecting stem cell renewal.
Promotion of tumor growth by polarity proteins Loss of polarity profoundly affects the migratory capacities of the cells. If the polarity machinery is not intact, directed migration is inhibited and the ability of cells to invade through matrigel following a chemoattractant is strongly impaired. However, there is strong evidence that loss of polarity increases the metastatic power of a tumor 36, 39. For a process known to increase metastasis, this is at first sight counterintuitive. How can a cell that cannot migrate or invade towards a gradient produce more metastasis? Perturbation of polarity reduces directionality of cells, but increases the speed of cells migrating in 2D 74, 75. In addition,
Discussion - 163
Par3 depletion cooperates with oncogenic Ras, NICD and HerB to increase invasion through ECM 36, 39. This could be unique to Par3 depletion because it was shown that loss of this polarity protein leads to increased STAT3 signaling and release of MMP7, that will degrade the ECM and thus promote invasion 36. Protease dependent movement was thought to be important for tumor dissemination, but clinical trials with MMP inhibitors did not have any impact on patient survival 76. The reason lies probably in the high plasticity of the cells. When proteases are inhibited, cells compensate by moving both in an amoeboid and mesenchymal way. Thus, using the holes present in the ECM, cells can move without the need of actively carving their own road. We could show that depletion of GM130 resulted in increased invasiveness of breast cancer cells in an assay not dependent on polarity. We could not find evidence of upregulation of any MMP, as it was the case for Par3 depletion, thus we speculate that the increased invasion is due to the fact that cells depleted of GM130 move faster in 2D. We can speculate that when the polarity machinery is broken, cells become less organized and switch between amoeboid and mesenchymal movement, resulting in increased speed. More polarity related genes should be tested to understand if this is a general mechanism by which polarity loss promotes metastatic spread. However, this hypothesis is based on the assumption that metastatic spread is not driven by any gradient and it is just the result of cells moving randomly until they encounter a blood vessel. To date, no clear evidence has been provided for the existence of such a gradient, even though directed motility of cancer cells towards newly generated blood vessels has been documented 77. EGF might drive metastatic cells towards the blood vessels as it was observed that metastatic cells have more EGF receptor than the non-metastatic cells from which they derive 78. Tumor associated macrophages could provide a paracrine gradient of EGF and accordingly, it was observed that macrophages enhance the motility of cancer cells 79. In a recent report, two patterns of migration were described for cancer cells escaping the primary tumor, single cells moving randomly and streams of cells (not connected between each other), with streaming cells moving faster than single cells. The presence of macrophages was found to be correlated with the streaming pattern, where cells move faster. Inhibition of macrophages resulted in an abolishment of this type of movement and in a striking decrease of circulating tumor cells. Therefore, it was proposed that the fast moving cells are the ones that will give rise to metastasis 80. Still, the fact that streaming depends on macrophages points to the possibility that a gradient might be driving the migration of streaming cells. In another study, several
Discussion - 164 parameters known to be associated with tumor cell motility were taken in exam (vasculature, ECM, and macrophages). Again, faster and slower cells were identified, but the speed of the cells did not correlate with any of the parameters considered 81. Anyway, a correlation between appearance of protrusions and distance from the blood vessels was found, thus the authors proposed that blood vessels could be responsible for the establishment of a gradient driving cell migration 81. Melanoma cells metastasize by following self-generated gradients 82. This observation could partially reconcile the contradiction that polarity loss increases metastasis, but decreases the ability of cells to follow a gradient. Muinonen-Martin et al. showed that melanoma cells break down LPA faster than normal cells because they express more LPAR1 on their surface. Once reached a critical mass, the gradient becomes robust enough to force polarization and migration of the cells away from the primary tumor 82. Thus, cells follow a gradient to escape from the primary tumor, but they are not directed towards a blood vessel. Once cells are too far from the tumor and do not sense the gradient anymore, polarity defective cells will move faster than the cells where the polarity machinery is still intact, thus they will explore a wider area and will have more probabilities of encountering a blood vessel. Golgi and tumor progression Given the widely recognized connection between Golgi and cell migration, it is somehow surprising that studies on Golgi and tumor progression are still very scarce. It is known that most highly invasive tumors have elevated levels of the O-GalNac glycan Tn on the cell surface 83. The presence of glycans at the plasma membrane is known to promote adhesion of cells 84 and could also be involved in the recognition of tumor cells by immune cells 85. Interestingly, tumors with high Tn levels at the plasma membrane show a relocalization of N- acetylgalactosamine-transferases (GalNAc-Ts) from the Golgi to the ER and this causes cells to form more invadopodia and to migrate better 83. Relocalization of several glycosyltransferases was described to happen as a consequence of Golgi fragmentation in prostate cancer 86. Tumors cells often display a fragmented Golgi 87 and we could speculate that Golgi fragmentation is induced to promote cell motility and invasion. However, Golgi fragmentation results in most of the cases in impaired migration of cells in a wound assay, meaning that cells with a fragmented Golgi have a polarity defect. It should be tested whether Golgi fragmentation increases the speed of randomly migrating cells, as it is the case for other conditions where polarity is disrupted. Petrosyan et al. showed that Rab6a associates with
Discussion - 165
NMIIA (non-muscle myosin IIA) and NMIIA prevents Rab6 association with Giantin, necessary to maintain Golgi structure. If NMIIA is depleted, the Golgi becomes compact again, mislocalized glycosyltransferases relocalize to the Golgi and cancer cells become more susceptible to galectin-1 induced apoptosis 86. Our data confer the Golgi protein GM130 a main role in controlling cell polarity and migration. We showed that GM130 is progressively lost in colon cancer and often downregulated in breast cancer and thus we speculate an involvement of the Golgi in metastatic spreading. GM130 depleted cells retain a compact Golgi, but are defective in directional migration. Despite being not directional, GM130 depleted cells move faster than control cells and become more invasive. GM130 depletion alters two pathways, Cdc42 and Ras. Cdc42 and Ras are both important in cell migration and we could show that inhibition of Ras together with GM130 depletion resulted in a stronger decrease in the ability of the cells to close a wound. This implies that Cdc42 and Ras affect migration via two different pathways. MDA-MB-231 cells, which have a consitutively active Ras, didn’t migrate faster and didn’t become more invasive after GM130 depletion, whereas cell lines with no mutation in the Ras pathway became faster and more motile upon GM130 depletion. We speculate that a constitutively active Ras might mask the effect of GM130 depletion on cell motility. How does GM130 control cell velocity? Depletion of the polarity protein Scribble gives phenotypes very similar to the ones observed upon depletion of GM130, thus it is tempting to speculate that GM130 might control Scribble. Scribble connects β-catenin and E-Cadherin and it was shown that the increase in cell velocity caused by loss of Scribble could be dampened by rescuing the interaction between β-catenin and E-Cadherin. GM130 could control Scribble expression levels or alternatively, it could control its localization. It was reported a role for Cdc42 in sorting proteins from the TGN to apical or basolateral membranes 18, therefore we could speculate that by regulating Cdc42 activity at the Golgi, GM130 regulates Scribble positioning. However, it is not known if the same happens when Scribble is mislocalized or if instead it is necessary to lose Scribble to increase cell velocity.
Discussion - 166
References
1. Preisinger, C. et al. YSK1 is activated by the Golgi matrix protein GM130 and plays a role in cell migration through its substrate 14-3-3zeta. J Cell Biol 164, 1009-1020 (2004). 2. Yuan, H., Michelsen, K. & Schwappach, B. 14-3-3 Dimers Probe the Assembly Status of Multimeric Membrane Proteins. Current Biology 13, 638-646 (2003). 3. O'Kelly, I., Butler, M.H., Zilberberg, N. & Goldstein, S.A.N. Forward Transport: 14-3-3 Binding Overcomes Retention in Endoplasmic Reticulum by Dibasic Signals. Cell 111, 577-588 (2002). 4. Yadav, S., Puri, S. & Linstedt, A.D. A Primary Role for Golgi Positioning in Directed Secretion, Cell Polarity, and Wound Healing. Molecular Biology of the Cell 20, 1728-1736 (2009). 5. Kodani, A., Kristensen, I., Huang, L. & Sütterlin, C. GM130-dependent Control of Cdc42 Activity at the Golgi Regulates Centrosome Organization. Molecular Biology of the Cell 20, 1192-1200 (2009). 6. Salazar, M.A. et al. Tuba, a Novel Protein Containing Bin/Amphiphysin/Rvs and Dbl Homology Domains, Links Dynamin to Regulation of the Actin Cytoskeleton. Journal of Biological Chemistry 278, 49031-49043 (2003). 7. Kovacs, E.M., Makar, R.S. & Gertler, F.B. Tuba stimulates intracellular N-WASP- dependent actin assembly. J Cell Sci 119, 2715-2726 (2006). 8. Puthenveedu, M.A., Bachert, C., Puri, S., Lanni, F. & Linstedt, A.D. GM130 and GRASP65- dependent lateral cisternal fusion allows uniform Golgi-enzyme distribution. Nat Cell Biol 8, 238-248 (2006). 9. Diao, A., Frost, L., Morohashi, Y. & Lowe, M. Coordination of golgin tethering and SNARE assembly: GM130 binds syntaxin 5 in a p115-regulated manner. J Biol Chem 283, 6957- 6967 (2008). 10. Simpson, J.C. et al. Genome-wide RNAi screening identifies human proteins with a regulatory function in the early secretory pathway. Nat Cell Biol 14, 764-774 (2012). 11. Puthenveedu, M.A. & Linstedt, A.D. Evidence that Golgi structure depends on a p115 activity that is independent of the vesicle tether components giantin and GM130. The Journal of Cell Biology 155, 227-238 (2001). 12. Lee, I. et al. Membrane adhesion dictates Golgi stacking and cisternal morphology. Proc Natl Acad Sci U S A 111, 1849-1854 (2014). 13. Gilchrist, A. et al. Quantitative Proteomics Analysis of the Secretory Pathway. Cell 127, 1265-1281 (2006). 14. Michaelson, D. et al. Differential Localization of Rho Gtpases in Live Cells: Regulation by Hypervariable Regions and Rhogdi Binding. The Journal of Cell Biology 152, 111-126 (2001). 15. Chen, L. et al. CHD1L promotes hepatocellular carcinoma progression and metastasis in mice and is associated with these processes in human patients. The Journal of Clinical Investigation 120, 1178-1191 (2010). 16. Shapiro, I.M. et al. An EMT–Driven Alternative Splicing Program Occurs in Human Breast Cancer and Modulates Cellular Phenotype. PLoS Genet 7, e1002218 (2011). 17. Struckhoff, A.P. et al. PDZ-RhoGEF is essential for CXCR4-driven breast tumor cell motility through spatial regulation of RhoA. Journal of Cell Science 126, 4514-4526 (2013).
Discussion - 167
18. Müsch, A., Cohen, D., Kreitzer, G. & Rodriguez-Boulan, E. cdc42 regulates the exit of apical and basolateral proteins from the trans-Golgi network. The EMBO Journal 20, 2171-2179 (2001). 19. Lacoste, C. et al. Iodide Transporter NIS Regulates Cancer Cell Motility and Invasiveness by Interacting with the Rho Guanine Nucleotide Exchange Factor LARG. Cancer Research 72, 5505-5515 (2012). 20. Ariake, K. et al. GCF2/LRRFIP1 promotes colorectal cancer metastasis and liver invasion through integrin-dependent RhoA activation. Cancer Lett 325, 99-107 (2012). 21. Kitzing, T.M. et al. Positive feedback between Dia1, LARG, and RhoA regulates cell morphology and invasion. Genes & Development 21, 1478-1483 (2007). 22. Sato, Y. et al. The novel PAR-1-binding protein MTCL1 has crucial roles in organizing microtubules in polarizing epithelial cells. Journal of Cell Science 126, 4671-4683 (2013). 23. Sato, Y. et al. MTCL1 crosslinks and stabilizes non-centrosomal microtubules on the Golgi membrane. Nat Commun 5 (2014). 24. Efimov, A. et al. Asymmetric CLASP-Dependent Nucleation of Noncentrosomal Microtubules at the trans-Golgi Network. Developmental Cell 12, 917-930 (2007). 25. Rivero, S., Cardenas, J., Bornens, M. & Rios, R.M. Microtubule nucleation at the cis-side of the Golgi apparatus requires AKAP450 and GM130. The EMBO Journal 28, 1016-1028 (2009). 26. Gonzalez-Mariscal, L., Chávez de Ramírez, B. & Cereijido, M. Tight junction formation in cultured epithelial cells (MDCK). The Journal of Membrane Biology 86, 113-125 (1985). 27. Nigam, S.K., Rodriguez-Boulan, E. & Silver, R.B. Changes in intracellular calcium during the development of epithelial polarity and junctions. Proceedings of the National Academy of Sciences 89, 6162-6166 (1992). 28. Fam, N.P. et al. Cloning and characterization of Ras-GRF2, a novel guanine nucleotide exchange factor for Ras. Molecular and Cellular Biology 17, 1396-1406 (1997). 29. Farnsworth, C.L. et al. Calcium activation of Ras mediated by neuronal exchange factor Ras-GRF. Nature 376, 524-527 (1995). 30. Mattingly, R.R. & Macara, I.G. Phosphorylation-dependent activation of the Ras- GRF/CDC25Mm exchange factor by muscarinic receptors and G-protein [beta][gamma] subunits. Nature 382, 268-272 (1996). 31. Kiyono, M., Kaziro, Y. & Satoh, T. Induction of Rac-Guanine Nucleotide Exchange Activity of Ras-GRF1/CDC25Mm following Phosphorylation by the Nonreceptor Tyrosine Kinase Src. Journal of Biological Chemistry 275, 5441-5446 (2000). 32. Kesavapany, S. et al. p35/Cyclin-Dependent Kinase 5 Phosphorylation of Ras Guanine Nucleotide Releasing Factor 2 (RasGRF2) Mediates Rac-Dependent Extracellular Signal- Regulated Kinase 1/2 Activity, Altering RasGRF2 and Microtubule-Associated Protein 1b Distribution in Neurons. The Journal of Neuroscience 24, 4421-4431 (2004). 33. Mattingly, R.R., Saini, V. & Macara, I.G. Activation of the Ras-GRF/CDC25Mm Exchange Factor by Lysophosphatidic Acid. Cellular Signalling 11, 603-610 (1999). 34. Yang, H. et al. Phosphorylation of the Ras-GRF1 Exchange Factor at Ser916/898 Reveals Activation of Ras Signaling in the Cerebral Cortex. Journal of Biological Chemistry 278, 13278-13285 (2003). 35. Calvo, F. et al. RasGRF suppresses Cdc42-mediated tumour cell movement, cytoskeletal dynamics and transformation. Nat Cell Biol 13, 819-826 (2011). 36. McCaffrey, Luke M., Montalbano, J., Mihai, C. & Macara, Ian G. Loss of the Par3 Polarity Protein Promotes Breast Tumorigenesis and Metastasis. Cancer Cell 22, 601-614 (2012).
Discussion - 168
37. Iden, S. et al. Tumor Type-Dependent Function of the Par3 Polarity Protein in Skin Tumorigenesis. Cancer Cell 22, 389-403 (2012). 38. Feigin, M.E. et al. Mislocalization of the Cell Polarity Protein Scribble Promotes Mammary Tumorigenesis and Is Associated with Basal Breast Cancer. Cancer Research 74, 3180-3194 (2014). 39. Xue, B., Krishnamurthy, K., Allred, D.C. & Muthuswamy, S.K. Loss of Par3 promotes breast cancer metastasis by compromising cell–cell cohesion. Nat Cell Biol 15, 189-200 (2013). 40. Zhan, L. et al. Deregulation of Scribble Promotes Mammary Tumorigenesis and Reveals a Role for Cell Polarity in Carcinoma. Cell 135, 865-878 (2008). 41. Lobo, N.A., Shimono, Y., Qian, D. & Clarke, M.F. The biology of cancer stem cells. Annu Rev Cell Dev Biol 23, 675-699 (2007). 42. McCaffrey, L.M. & Macara, I.G. The Par3/aPKC interaction is essential for end bud remodeling and progenitor differentiation during mammary gland morphogenesis. Genes & Development 23, 1450-1460 (2009). 43. Iden, S. et al. aPKC phosphorylates JAM-A at Ser285 to promote cell contact maturation and tight junction formation. The Journal of Cell Biology 196, 623-639 (2012). 44. Archibald, A., Mihai, C., Macara, I.G. & McCaffrey, L. Oncogenic suppression of apoptosis uncovers a Rac1/JNK proliferation pathway activated by loss of Par3. Oncogene 0 (2014). 45. Nolan, M.E. et al. The Polarity Protein Par6 Induces Cell Proliferation and Is Overexpressed in Breast Cancer. Cancer Research 68, 8201-8209 (2008). 46. Nishimura, T. et al. PAR-6-PAR-3 mediates Cdc42-induced Rac activation through the Rac GEFs STEF/Tiam1. Nat Cell Biol 7, 270-277 (2005). 47. Liu, X.-F., Ishida, H., Raziuddin, R. & Miki, T. Nucleotide Exchange Factor ECT2 Interacts with the Polarity Protein Complex Par6/Par3/Protein Kinase Cζ (PKCζ) and Regulates PKCζ Activity. Molecular and Cellular Biology 24, 6665-6675 (2004). 48. Fields, A.P. & Justilien, V. The guanine nucleotide exchange factor (GEF) Ect2 is an oncogene in human cancer. Advances in Enzyme Regulation 50, 190-200 (2010). 49. Saito, S. et al. Deregulation and mislocalization of the cytokinesis regulator ECT2 activate the Rho signaling pathways leading to malignant transformation. J Biol Chem 279, 7169-7179 (2004). 50. Paget, J.A. et al. Repression of cancer cell senescence by PKC[iota]. Oncogene 31, 3584- 3596 (2012). 51. Baas, A.F. et al. Complete Polarization of Single Intestinal Epithelial Cells upon Activation of LKB1 by STRAD. Cell 116, 457-466 (2004). 52. Partanen, J.I., Nieminen, A.I. & Klefstrom, J. 3D view to tumor suppression: Lkb1, polarity and the arrest of oncogenic c-Myc. Cell Cycle 8, 716-724 (2009). 53. Shaw, R.J. et al. The LKB1 tumor suppressor negatively regulates mTOR signaling. Cancer Cell 6, 91-99 (2004). 54. Mohseni, M. et al. A genetic screen identifies an LKB1–MARK signalling axis controlling the Hippo–YAP pathway. Nat Cell Biol 16, 108-117 (2014). 55. Cordenonsi, M. et al. The Hippo Transducer TAZ Confers Cancer Stem Cell-Related Traits on Breast Cancer Cells. Cell 147, 759-772 (2011). 56. Caussinus, E. & Gonzalez, C. Induction of tumor growth by altered stem-cell asymmetric division in Drosophila melanogaster. Nat Genet 37, 1125-1129 (2005). 57. Tomasetti, C. & Vogelstein, B. Variation in cancer risk among tissues can be explained by the number of stem cell divisions. Science 347, 78-81 (2015).
Discussion - 169
58. Huo, Y. & Macara, I.G. The Par3-like polarity protein Par3L is essential for mammary stem cell maintenance. Nat Cell Biol 16, 526-534 (2014). 59. Varelas, X. et al. The Crumbs Complex Couples Cell Density Sensing to Hippo-Dependent Control of the TGF-β-SMAD Pathway. Developmental Cell 19, 831-844 (2010). 60. Nagasaka, K. et al. The cell polarity regulator hScrib controls ERK activation through a KIM site-dependent interaction. Oncogene 29, 5311-5321 (2010). 61. Nagasaka, K. et al. A Novel Interaction between hScrib and PP1γ Downregulates ERK Signaling and Suppresses Oncogene-Induced Cell Transformation. PLoS ONE 8, e53752 (2013). 62. Li, X., Yang, H., Liu, J., Schmidt, M. & Gao, T., EMBO Reports Vol. 12(8) 818-824 (2011). 63. Norman, M. et al. Loss of Scribble causes cell competition in mammalian cells. J Cell Sci 125, 59-66 (2012). 64. Chen, C.-L., Schroeder, M.C., Kango-Singh, M., Tao, C. & Halder, G. Tumor suppression by cell competition through regulation of the Hippo pathway. Proceedings of the National Academy of Sciences 109, 484-489 (2012). 65. Wang, Y., Seemann, J., Pypaert, M., Shorter, J. & Warren, G. A direct role for GRASP65 as a mitotically regulated Golgi stacking factor. Embo j 22, 3279-3290 (2003). 66. Maag, R.S., Mancini, M., Rosen, A. & Machamer, C.E. Caspase-resistant Golgin-160 Disrupts Apoptosis Induced by Secretory Pathway Stress and Ligation of Death Receptors. Molecular Biology of the Cell 16, 3019-3027 (2005). 67. Lowe, M., Lane, J.D., Woodman, P.G. & Allan, V.J. Caspase-mediated cleavage of syntaxin 5 and giantin accompanies inhibition of secretory traffic during apoptosis. J Cell Sci 117, 1139-1150 (2004). 68. Lane, J.D. et al. Caspase-mediated cleavage of the stacking protein GRASP65 is required for Golgi fragmentation during apoptosis. The Journal of Cell Biology 156, 495-509 (2002). 69. Chiu, R., Novikov, L., Mukherjee, S. & Shields, D. A caspase cleavage fragment of p115 induces fragmentation of the Golgi apparatus and apoptosis. The Journal of Cell Biology 159, 637-648 (2002). 70. Scott, K.L. et al. GOLPH3 modulates mTOR signalling and rapamycin sensitivity in cancer. Nature 459, 1085-1090 (2009). 71. Farber-Katz, Suzette E. et al. DNA Damage Triggers Golgi Dispersal via DNA-PK and GOLPH3. Cell 156, 413-427 (2014). 72. Hosoya, N. & Miyagawa, K. Targeting DNA damage response in cancer therapy. Cancer Science 105, 370-388 (2014). 73. Zhou, Y. et al. The Mammalian Golgi Regulates Numb Signaling in Asymmetric Cell Division by Releasing ACBD3 during Mitosis. Cell 129, 163-178 (2007). 74. Qin, Y., Capaldo, C., Gumbiner, B.M. & Macara, I.G. The mammalian Scribble polarity protein regulates epithelial cell adhesion and migration through E-cadherin. The Journal of Cell Biology 171, 1061-1071 (2005). 75. Camand, E., Peglion, F., Osmani, N., Sanson, M. & Etienne-Manneville, S. N-cadherin expression level modulates integrin-mediated polarity and strongly impacts on the speed and directionality of glial cell migration. J Cell Sci 125, 844-857 (2012). 76. Coussens, L.M., Fingleton, B. & Matrisian, L.M. Matrix metalloproteinase inhibitors and cancer: trials and tribulations. Science 295, 2387-2392 (2002). 77. Li, C.-Y. et al. Initial Stages of Tumor Cell-Induced Angiogenesis: Evaluation Via Skin Window Chambers in Rodent Models. Journal of the National Cancer Institute 92, 143- 147 (2000).
Discussion - 170
78. Lichtner, R.B. et al. Ligand mediated activation of ectopic EGF receptor promotes matrix protein adhesion and lung colonization of rat mammary adenocarcinoma cells. Oncogene 10, 1823-1832 (1995). 79. Wyckoff, J. et al. A Paracrine Loop between Tumor Cells and Macrophages Is Required for Tumor Cell Migration in Mammary Tumors. Cancer Research 64, 7022-7029 (2004). 80. Patsialou, A. et al. Intravital multiphoton imaging reveals multicellular streaming as a crucial component of in vivo cell migration in human breast tumors. Intravital 2, e25294 (2013). 81. Gligorijevic, B., Bergman, A. & Condeelis, J. Multiparametric Classification Links Tumor Microenvironments with Tumor Cell Phenotype. PLoS Biol 12, e1001995 (2014). 82. Muinonen-Martin, A.J. et al. Melanoma Cells Break Down LPA to Establish Local Gradients That Drive Chemotactic Dispersal. PLoS Biol 12, e1001966 (2014). 83. Gill, D.J. et al. Initiation of GalNAc-type O-glycosylation in the endoplasmic reticulum promotes cancer cell invasiveness. Proceedings of the National Academy of Sciences of the United States of America 110, E3152-E3161 (2013). 84. Casey, R.C. et al. Cell membrane glycosylation mediates the adhesion, migration, and invasion of ovarian carcinoma cells. Clin Exp Metastasis 20, 143-152 (2003). 85. van Gisbergen, K.P.J.M., Aarnoudse, C.A., Meijer, G.A., Geijtenbeek, T.B.H. & van Kooyk, Y. Dendritic Cells Recognize Tumor-Specific Glycosylation of Carcinoembryonic Antigen on Colorectal Cancer Cells through Dendritic Cell–Specific Intercellular Adhesion Molecule-3–Grabbing Nonintegrin. Cancer Research 65, 5935-5944 (2005). 86. Petrosyan, A., Holzapfel, M.S., Muirhead, D.E. & Cheng, P.-W. Restoration of Compact Golgi Morphology in Advanced Prostate Cancer Enhances Susceptibility to Galectin-1– Induced Apoptosis by Modifying Mucin O-Glycan Synthesis. Molecular Cancer Research 12, 1704-1716 (2014). 87. Weller, S.G. et al. Src kinase regulates the integrity and function of the Golgi apparatus via activation of dynamin 2. Proc Natl Acad Sci U S A 107, 5863-5868 (2010).
Discussion - 171
Acknowledgements The journey that is told in this thesis started 4 years ago and has been one of my most intense periods, with a new research to discover, a new country to explore and new people to know. My ways crossed with the ways of so many other people that it would take hundreds pages to thank everyone, but everybody I met in this time has somehow contributed to this work. First of all I want to express my gratitude to my supervisor Dr. Hesso Farhan for of all the energy and time (and money… a lot of money!) that he invested on me. I learnt that the most effective way of teaching is to provide an example and he does exactly this. He showed me how it is to be a scientist but not only this. He contributed to my personal growth by stimulating new interests and by teaching me how to think critically. Thanks to him, after this PhD I have a new vision of science! A work that is also a passion permeating through all the aspects of your life. I feel really lucky because I am one of the few privileged who like their work and this is all merit of Hesso. Together with Hesso, a special thank goes to all the people of the BITg. Veronika, with her infinite patience, Valentina, especially on Thursdays (got it?), Kerstin, Mark, Ricarda, Johanna, Julia and Cristina with whom “I am on the same boat”, literally translated from Italian, an expression with a thousand meanings that can be summarized in: “we walk together, you all know what a PhD is like, we share stressful times as well as parties and this bonds us”. And speaking about Italy, thanks to Nico and Annette who made me feel at home! Without Nico I would probably have died of starvation! Thanks to Dr. Daniel Legler who has been extremely kind with me since when I came for my interview and a special thanks to him because he found the time to be on my thesis committee. Thanks to Josepha, one of the pillars of the BITg, to Ilona, always ready to help, to Edith and Alexandra and to the last arrived Vladimir. Thanks to Conny and Marianne, who make our lab life easier. Thanks also to Barbara, another positive example during my PhD. Thanks to the Groettrup group at the university, always very available and helpful. An enormous thanks goes also to Dr. Ian Macara, for giving me the opportunity to stay in his lab, where I met new friends like Armelle and Yongliang. Even if I am work addicted, there are many people living outside the walls of the lab that I have to thank. The Italians Nicola and Nina (now officially Itaian), Paolo, Alessia e Alessio, Giovanni (Losannese!) Ambrogio, Carmelo, Michele, Giorgia (she is probably inside other lab walls) e di nuovo Valentina: è una faticaccia insegnarvi l’italiano, ma d’altronde in qualità di toscano devo diffondere la lingua del sì e le sue parole più importanti come “lapis”,
Acknowledgements - 173
“spengere” e simili! To all the flat mates and friends Carlos, Maria, Kim and Michael and Melanie, with whom I am having a wonderful time at home. When work becomes too much, family and friends are always there to rescue me. Of course, a big thank goes to my parents, who supported me throughout all this time. The “funniest sentence award” goes to my mother who, after a few month I left Italy, discovered the world of Skype and internet and declared: “lo sapevi che col computer si possono fare un sacco di cose?”. And since I wrote in English, she won’t be able to understand! Thanks also to my brothers and the rest of my family, who still don’t know what I do all day, but they think it is cool! Thanks to all my scout friends that share my same pathways even from far away. My old friends Leo, Ale, Andrea, Eli, Bene and the not so old friends Helga and Marco all of them shared several adventures with me during this time. Eli, all the best for the big news of these days! We’ll see each other in Helsinki! Leo, since you are the one who came more often to Konstanz, you win a bonus to come to Paris whenever you like (I like to think that you did not came only for the beer!)! A big thank to the always present (and always late) Filippo, who also embarked himself in the 12-hours trip Lucca-Konstanz. You know that I’m waiting for you in Paris! I think I really mentioned almost everybody. That was harder than writing the thesis! It is really true that a person grows by encountering new people, so all the names here are a further proof that this PhD has been a really fruitful period for me. The street that brought me to Konstanz will now bring me to Paris for my post-doc and I leave with a wealth of experience thanks to all of you. To end up with a typical scout expression: the route is for who comes and for who leaves and that’s the beauty of it.
Thank you, Francesco
Acknowledgements - 174