sign in sign up
<<
Home , Insulin

Alteration in of P20 Is Associated With Resistance Yu Wang,1 Aimin Xu,1 Jiming Ye,2 Edward W. Kraegen,2 Cynthia A. Tse,1 and Garth J.S. Cooper1,3

We have recently identified a small phosphoprotein, P20, insulin action, such as the activation of insulin receptors, as a common intracellular target for insulin and several postreceptor , and the trans- of its antagonists, including , , and cal- port effector system, have been implicated in this disease citonin -related . These elicit phos- (3,4). Defective insulin kinase activity, reduced phorylation of P20 at its different sites, producing three substrate-1 , and phosphorylated isoforms: S1 with an isoelectric point (pI) decreased phosphatidylinositol (PI)-3 kinase activity were value of 6.0, S2 with a pI value of 5.9, and S3 with a pI observed in both type 2 diabetic patients as well as value of 5.6 (FEBS Letters 457:149–152 and 462:25–30, animal models, such as ob/ob mice (5,6). 1999). In the current study, we showed that P20 is one In addition to the intrinsic defects of the insulin receptor of the most abundant phosphoproteins in rat extensor digitorum longus (EDL) muscle. Insulin and amylin an- and postreceptor signaling components, other circulating tagonize each other’s actions in the phosphorylation of factors, such as tumor necrosis factor-␣, , free fatty this in rat EDL muscle. Insulin inhibits amylin- acids, and amylin, may also contribute to the pathogenesis evoked phosphorylation of S2 and S3, whereas amylin of (7–11). For example, amylin, a hor- decreases insulin-induced phosphorylation of S1. In rats mone co-secreted with insulin from pancreatic islet made insulin resistant by treatment, lev- ␤-cells, has been shown to antagonize insulin’s metabolic els of the phosphoisoforms S2 and S3, which were barely actions both in vivo and in vitro (12–16). It can inhibit detectable in healthy rats in the absence of insulin-stimulated and synthesis. stimulation, were significantly increased. Moreover, the In vivo administration of amylin results in ability of insulin to inhibit amylin-evoked phosphoryla- and induced insulin resistance similar to that observed in tion of these two isoforms was greatly attenuated. These results suggested that alterations in the phosphoryla- type 2 . Although some earlier studies have sug- tion of P20 might be associated with insulin resistance gested that amylin’s biological effects on fuel and that P20 could serve as a useful marker to dissect were only of pharmacological interest, more recent in vivo the cellular mechanisms of this disease. Diabetes 50: studies with an amylin-selective antagonist have strongly 1821–1827, 2001 supported its physiological relevance (17). Moreover, amy- lin-deficient mice have shown increased insulin respon- siveness and more rapid blood glucose elimination after glucose loading, further confirming the role of amylin in nsulin resistance is characterized by diminished causing insulin resistance (18). Indeed, elevated levels of insulin sensitivity of target tissues, including , circulating amylin (hyperamylinemia) and an increased , and (1). It is a key factor ratio of amylin to insulin have been observed in patients Iin the pathogenesis of and is also with type 2 diabetes and other diseases associated with associated with other pathological states, such as , insulin resistance, such as obesity and glucose intolerance , , , and cardio- (19). vascular disease. These clustering metabolic defects have Despite these advances, the detailed cellular mechanisms been termed “syndrome X” or “the insulin-resistance syn- of insulin resistance are far from clear. Recent studies that drome” (2). have used genetic approaches to identify specific The molecular basis of insulin resistance is extremely that account for the genetic predisposition to this disease complex and multifactorial. Defects in several steps of have been generally unrewarding (4,20–22). We recently used comparative proteomic analysis to systematically in- vestigate the phosphorylation cascades evoked by insulin From the 1School of Biological Sciences, University of Auckland, Auckland, and its antagonists in rat skeletal muscle and identified a New Zealand; the 2Garvan Institute of , Sydney, Australia; and the 3Department of Medicine, School of Medicine, University of Auckland, novel phosphoprotein, P20, as the common intracellular Auckland, New Zealand. target of these hormones (23,24). Insulin and its antag- Address correspondence and reprint requests to Garth J.S. Cooper, Level 4, onistic hormones amylin, epinephrine, and School of Biological Sciences, University of Auckland, Private Bag 92019, Auckland, New Zealand. E-mail: [email protected]. gene-related peptide (CGRP), through distinctive signaling Received for publication 16 October 2000 and accepted in revised form 17 pathways, phosphorylate P20 at different serine residues April 2001. CGRP, calcitonin gene-related peptide; 2-DE, two-dimensional gel electro- to produce multiple phosphoisoforms of this protein. In phoresis; DMEM, Dulbecco’s modified Eagle’s medium; ECL, enhanced chemi- this study, we demonstrated that P20 in skeletal muscle luminescence; EDL, extensor digitorum longus; GLUT4myc, myc-tagged from insulin-resistant diabetic rats has an abnormal phos- GLUT4; HSP, heat shock protein; KHB, Krebs-Henseleit buffer; OD, optical density; pI, isoelectric point; PI, phosphatidylinositol; PSL, photostimulated phorylation pattern, although the expression level of this luminescence; VOL, a feature’s volume. protein is not changed. Moreover, the responsiveness of

DIABETES, VOL. 50, AUGUST 2001 1821 PHOSPHOPROTEIN P20 AND INSULIN RESISTANCE

P20 to insulin and amylin is also altered in insulin-resistant CCGGGATCCCTACTTGGCAGCAGGTGGTGAC3Ј. The resulting clone was animals. We propose that P20 may serve as a useful marker validated by DNA sequencing and then inserted into the multiple cloning site of cytomegalovirus -driven eukaryotic pcDNA3.1 for investigating the mechanisms of insulin resistance. (referred to as pcDNA.P20). L6 myoblast cells were transfected with pCXN2-GLUT4myc (27) or co- transfected with pCXN2-GLUT4myc and pcDNA.P20 using Lipofectamine Plus RESEARCH DESIGN AND METHODS reagent (Life Technology) according to the manufacturer’s instructions. Materials. Male Wistar rats were fed standard rat (NRM Diet 86, Tegel, Stable transfectants were selected in medium containing the neomycin ana- Auckland, New Zealand) with water ad libitum. [32P]orthophosphate and logue G418 at 400 ␮g/ml. At 10 days after transfection, the clones were D-[U-14C]glucose were purchased from ICN. 2-deoxy-D-[3H]glucose (1 mCi/ml) selected using sterilized steel rings and expanded separately in the presence was obtained from DuPont-NEN and 125I was obtained from Amersham of G418. Clones that expressed P20 and GLUT4myc were chosen by Western Pharmacia. Human insulin (Actrapid) was obtained from Novo Nordisk. Rat blotting and used for further experiments. amylin and CGRP were purchased from Bachem (Torrance, CA); epinephrine Western blotting. (ϳ50 ␮g) from liver, , epididymal pad, was from David Bull Laboratories; and dexamethasone was from Sigma. The aortic smooth muscle, EDL muscle, soleus muscle tissue, and whole blood two-dimensional gel electrophoresis (2-DE) system and reagents were ob- obtained from 18 hϪfasted male Wistar rats were separated by SDS-PAGE and tained from Pharmacia. Anti-P20 polyclonal antibody was a generous gift from subsequently transferred to nitrocellulose membranes. The membranes were Dr. Kanefusa Kato (25). Anti-GLUT4 (H-61) was obtained from Santa Cruz blocked overnight at 4°C and then incubated with rabbit anti-P20 poly- . The enhanced chemiluminescence (ECL) detection system clonal antibody (1:1,000) for2hatroom temperature. After incubation with was from Roche Molecular Biochemicals. The total cellular RNA extraction streptavidin-biotinylated horseradish-peroxidaseϪconjugated secondary anti- reagent (TRIZOL), G418, Lipofectamine Plus reagent, and random priming body for another hour at room temperature, the proteins immunoreactive to labeling kits were from Life Technology. pCXN2-GLUT4myc, which expresses the primary antibody were visualized by ECL detection according to the myc-tagged GLUT4 (GLUT4myc) in mammalian cells, was kindly provided by manufacturer’s instructions. Dr. David James (University of Queensland, Australia). Northern blot analysis. Total cellular RNA was isolated from EDL muscle of Establishment of the dexamethasone- or high fat؊induced rat models 18 hϪfasted control and dexamethasone-treated rats using TRIZOL reagent of insulin resistance. All experimental protocols were approved by the (Life Technology). Then, 15 ␮g of RNA from each sample were separated Institutional Animal Ethics Committee. Male Wistar rats were injected with by 1.5% agarose-formaldehyde gel electrophoresis and subsequently trans- Ϫ Ϫ dexamethasone (3.1 mg ⅐ kg 1 ⅐ day 1, i.p.) for 7 days. The weight of rats in ferred to Hybond-Nϩ nylon membranes (Amersham Pharmacia Biotech, both control and dexamethasone-treated groups were monitored daily. By the Uppsala, Sweden) by capillary blotting in 20ϫ sodium chlorideϪsodium end of the treatment period, the mean weight of the control group had citrate. The P20 cDNA probe was labeled with 32P-dCTP using a random increased by 12 Ϯ 1%, whereas that of the glucocorticoid-treated group had primer labeling system. The membranes were preincubated with hybridization Ϯ ϭ sharply decreased, by 16 2% (n 3 experiments, each with three rats per buffer (0.5 mol/l Na2HPO4 [pH 7.2], 10 mmol/l EDTA, 7% SDS) for3hat65°C group). Rats were fasted for 18 h before each experiment and were killed by and subsequently incubated with fresh buffer containing the labeled probe for cervical dislocation. Blood was obtained by cardiac puncture from anesthe- 18 h. Membranes were then washed, analyzed using a phosphorimager, and tized animals. The mean blood glucose concentration was 5.4 Ϯ 0.2 and 10.8 Ϯ quantitated by MacBAS v2.5 software (Fuji Machine Manufacturing, Chiryu, 0.6 mmol/l in control and dexamethasone-treated rats, respectively, as mea- Aichi, Japan). For comparison, RNA samples from EDL muscle strips treated sured with a YSI 2300STAT glucose/lactate analyzer (Yellow Springs In- with or without 50 nmol/l amylin were also analyzed in parallel. struments). The insulin-resistant state of the skeletal muscle was further Glucose uptake assays. L6 cells stably overexpressing GLUT4myc or confirmed using an in vitro D-[U-14C]glucose incorporation assay, which GLUT4myc plus P20 were grown in six-well plates and differentiated into showed a Ͼ95% reduction in the rate of insulin-stimulated glycogen synthesis myotubes in DMEM containing 2% fetal bovine serum for 7 days. The cells in dexamethasone-treated rats (results not shown). Insulin and amylin con- were deprived of serum for 16 h before experiments. For glucose uptake centrations in the blood of normal and insulin-resistant rats were determined assays, L6 myotubes were rinsed three times with Krebs-Henseleit buffer as previously described (17). Rats with insulin resistance induced by chronic (KHB) and incubated in KHB with or without hormones (insulin or insulin high-fat feeding were generated as described previously (26). plus amylin) at the indicated concentrations for 15 min at 37°C. Carrier- Dissection and metabolic radiolabeling of rat skeletal muscle strips. mediated glucose uptake of 10 ␮mol/l 2-deoxy-D-[3H]glucose in the above Rat extensor digitorum longus (EDL) muscle strips were prepared from solution was measured for 15 min at 37°C. This was followed by rinsing the 18 hϪfasted rats. The dissection and isolation of muscles were carried out cells three times with ice-cold phosphate-buffered saline and cell disruption under anesthesia with pentobarbital (5–7 mg/100 g body wt, i.p.), as described with 0.1 N NaOH. The associated radioactivity was determined by liquid previously (23). Each muscle was split into three ϳ1 mm–wide strips. Muscle scintillation counting. The protein concentration was measured with a bicin- strips were preincubated in a shaking coater bath at 30°C for1hin5mlof choninic acid protein quantitation (Pierce). The nonspecific uptake was Dulbecco’s modified Eagle’s medium (DMEM) without sodium phosphate. All determined in the presence of 10 ␮mol/l cytochalasin B and subtracted from incubation media were gassed with a mixture of 95% O2 and 5% CO2. The each value. muscle strips were subsequently transferred to similar flasks containing Data analysis. Autoradiography films were scanned and digitized using a identical medium plus 0.25 mCi/ml [32P]orthophosphate and incubated for an Sharp JX-325 scanner, and protein spots were detected, quantitated, and additional4htoequilibrate the internal ATP pool (23,24). Human insulin, rat analyzed using the Melanie II software package, version 2.2 (Bio-Rad). The amylin, epinephrine, or CGRP were then added to the incubation media for 30 detection parameters were as follows: smooth, 2; Laplacian threshold, 3; min at stated final concentrations. Reactions were terminated by freezing partials threshold, 1; saturation, 90; peakedness increase, 100; and minimum muscle strips in liquid immediately after incubation. Muscle strips perimeter, 10. The matching of multiple features to one feature was not were then weighed and stored at Ϫ80°C until further analysis. allowed. The pixel value was the optical density (OD). Features were calcu- Muscle extraction and 2-DE. Muscle strips were homogenized in 2-DE lysis lated as a percent of the sum of the feature’s volume ([VOL], i.e., the buffer (9 mol/l urea, 2% vol/vol triton X-100, 2% vol/vol pharmalyte [pH 3–10], integration of OD over the feature’s area) for all features on the gel. The 200 mmol/l dithiothreitol, 8 mmol/l phenylmethylsulfonyl fluoride) for 5 min radioactivity of protein spots was also detected by a phosphorimager and on ice. The lysates were briefly sonicated and microcentrifuged at 16,000g for analyzed by MacBAS v2.5 software. The radiation dosage of each spot was 10 min to remove debris. Protein concentrations of supernatant were deter- displayed in terms of units of photostimulated luminescence (PSL). All of the mined by the Bradford method, and radioactivity was measured by liquid results presented are based on at least three independent experiments. scintillation counting. 32P-labeled lysates with equivalent amounts of radioac- Statistical analysis was performed using the t test (paired, two-way). tivity were isoelectrically focused on IPG Drystrip (pH 4–7 and pH 3–10) linear gels using a Multiphor RII electrophoresis system according to the manufacturer’s instructions. Second dimensional SDS-PAGE was carried out RESULTS AND DISCUSSION using ExcelGel precast 12–14% acrylamide gradient gels. After electrophore- sis, the gels were fixed in 10% glacial acetic acid and 40% , and the P20 is the major insulin-responsive phosphoprotein proteins were visualized by phosphorimaging or autoradiography. In all in rat EDL muscle detected by 2-DE. P20 was initially figures, the gels are displayed with the acidic end of the isoelectric focusing isolated from rat skeletal muscle as a byproduct during the dimension to the right; the SDS-PAGE direction is from top to bottom. purification of the small heat shock proteins (HSPs) cDNA cloning, construction of expression vector, and transfection. ␣ A full-length cDNA encoding wild-type rat P20 was cloned by reverse HSP27/28 and B-crystallin (25). Under normal physiolog- transcriptaseϪpolymerase chain reaction using the forward primer 5ЈGCC- ical conditions, it exists as large aggregates. P20 has been CGCGGATCCATGGAGATCCGGGTGCCTGTG3Ј and the reverse primer 5ЈGC- thought to be a heat shockϪrelated protein, given that it

1822 DIABETES, VOL. 50, AUGUST 2001 Y. WANG AND ASSOCIATES

elicit differential phosphorylation on different sites of P20, thus producing three phosphorylated isoelectric variants of P20 (termed S1, with an isoelectric point [pI] value of 6.0; S2, with a pI value of 5.9; and S3, with a pI value of 5.6) (23,24). Phosphorylation of S1 occurs at serine 157 of P20, and insulin can increase its phosphorylation through a PI-3 kinaseϪmediated pathway. Amylin, CGRP, and epineph- rine evoke phosphorylation at Ser16 of P20 through a FIG. 1. Immunoblotting analysis of P20 expression in several different cAMP-mediated pathway, leading to the production of the rat tissues. Protein (50 ␮g) from each of the indicated rat tissues was phosphoisoform S2. In addition, these catabolic hormones separated by 12.5% SDS-PAGE and immunoblotted to detect P20 as described in RESEARCH DESIGN AND METHODS. The result is the typical also induce the phosphorylation of P20 at another two representation of three independent observations. unidentified sites to produce the phosphoisoform S3. Here, we further investigated the effect of the interplay has significant sequence similarity with ␣B- between insulin and several of its antagonists on the crystallin (47%) and HSP27/28 (35%) (25,28). However, phosphorylation of P20. Interestingly, we found that insu- unlike other small HSPs, heat treatment or chemical stress lin and amylin can antagonize each other’s actions in the does not induce the expression of P20. Several recent phosphorylation of this protein (Fig. 3). On the one hand, studies have suggested that P20 may be an actin-binding insulin-induced phosphorylation of S1 was significantly protein that is involved in cyclic nucleotide-mediated decreased in the presence of amylin. Phosphorylation of vasodilation and relaxation of rat smooth muscle or hista- S1 in samples treated with 50 nmol/l insulin ϩ 50 nmol/l mine- and phorbol esterϪinduced contraction of bovine amylin was 49% lower than that in samples stimulated with carotid artery smooth muscle (29–31). Interestingly, this 50 nmol/l insulin alone. On the other hand, insulin blocked protein is also present at high concentrations in circulating amylin-evoked phosphorylation of S2 and S3. In the pres- whole blood in patients with vascular diseases. It can ence of insulin, phosphorylation of S2 and S3 was de- strongly suppress platelet aggregation in vitro and ex vivo, creased by ϳ72 and ϳ74%, respectively, relative to that in possibly by inhibiting receptor-mediated calcium influx in muscles treated with amylin alone. However, insulin had platelets (32). However, the precise physiological func- no effect on the phosphorylation of S2 and S3 induced by tions of P20 are still uncertain. the other two catabolic hormones, epinephrine and CGRP, Analysis of the protein content of P20 by Western blot and vice versa. This result indicated that cross-talk oc- showed that this protein is mainly expressed in rat soleus curs between only the insulin- and amylin-evoked signal- muscle, EDL muscle, and heart muscle tissues, which ing pathways, although all three catabolic hormones are account for 35.1 Ϯ 3.2, 29.6 Ϯ 2.7, and 23.3 Ϯ 2.5% of the thought to act through G-proteinϪcoupled receptors and total P20 in all the tested tissues, respectively (n ϭ 3; to have similar metabolic effects. Amylin inhibited the means Ϯ SD) (Fig. 1). A small amount of this protein was insulin-evoked PI-3 kinase cascadeϪmediated phosphory- also detected in smooth muscle (4.9 Ϯ 0.6%), adipose lation of S1. Conversely, insulin suppressed the amylin- tissue (1.9 Ϯ 0.3%), and blood (5.2 Ϯ 0.6%). 2-DE analysis evoked cAMP pathwayϪmediated phosphorylation of S2 of 32P-labeled rat EDL muscle revealed ϳ150 phosphopro- and S3. Such an inhibitory effect of insulin on amylin’s teins after insulin stimulation (Fig. 2). Quantitative analy- biological actions could provide a reasonable explanation sis by Melanie II software (Bio-Rad) revealed that P20 is as to why administration of exogenous amylin in physio- the second most abundant phosphoprotein in insulin- logical quantities did not induce hyperglycemia and insulin stimulated rat EDL muscle, representing Ͼ2% of the total resistance in some experimental systems. VOL for all features detected. Moreover, P20 is the only The fact that insulin has separate effects on the inhibi- detected phosphoprotein that is responsive to both insulin tion of biological actions of amylin and CGRP further and its antagonists, as analyzed by the proteome approach. excludes the possibility that amylin acts solely through a Interplay between insulin and amylin on phosphory- CGRP receptor, although the two peptide hormones are lation of P20. Our previous studies demonstrated that members of the calcitonin-related polypeptide family (33). insulin and its antagonists, epinephrine, amylin, and CGRP, The amylin-specific receptor still remains to be identified.

FIG. 2. Two-dimensional phosphoprotein map of insulin-stimulated rat EDL muscle. EDL muscle strips were radiolabeled with 32P and treated with 50 nmol/l insulin for 30 min. Then 100 ␮ from each sample were separated by 2-DE and detected by autora- diography. The denoted proteins were iden- tified by either amino acid sequencing or Western blot analysis. The experiments were performed four times; the figure shown is from one representative experiment. P20 (S1), the isoform of P20 with pI value of 6.0.

DIABETES, VOL. 50, AUGUST 2001 1823 PHOSPHOPROTEIN P20 AND INSULIN RESISTANCE

FIG. 3. Interplay between insulin and its antagonists on the phosphorylation of P20. 32P-labeled EDL muscle strips were treated without (control) or with different hormones for 30 min at the following concentrations: insulin, 50 nmol/l; amylin, 50 nmol/l; epineph- rine, 50 nmol/l; and CGRP, 50 nmol/l. Phos- phorylation of P20 was analyzed by 2-DE and quantitated using phosphorimaging software. The table in the lower panel represents the quantitative data for the three phosphoiso- forms of P20. The results are expressed as mean PSL values ؎ SD for four independent observations. †P < 0.05 for insulin-treated -samples vs. insulin plus amylin؊treated sam ples; ‡P < 0.05 for amylin-treated samples vs. insulin plus amylin؊treated samples. Note that similar results were observed when add- ing these sequentially (i.e., preincu- bation with insulin for 15 min, followed by addition of amylin, CGRP, or epinephrine for another 15 min, or vice versa).

However, several recent studies have suggested that the phosphorimaging (Fig. 4). Under the incubation conditions identity of an amylin-selective receptor may be determined without hormone stimulation, phosphorylation of S2 and in part by receptor activityϪmodifying proteins (34). S3 was hardly detected in the nondiabetic control rats Alteration in phosphorylation of P20, but not its (Fig. 4A). By contrast, these two phosphoisoforms were expression, is associated with insulin resistance. We clearly visualized in muscle samples from the insulin- next investigated the phosphorylation patterns of P20 and resistant rats (Fig. 4B). Quantitative analysis by phosphor- the effect of insulin and amylin on this protein in dexa- imager and MacBAS software showed that the signals methasone-induced diabetic rats with insulin resistance. associated with both S2 and S3 in dexamethasone-treated The diabetic state of these rats was confirmed by the rats were about fivefold higher (Table 1). This phenomenon demonstrated loss of body weight, hyperglycemia, and was also observed in a high-fatϪinduced insulin-resistant rat decrease in insulin-stimulated incorporation of glucose model (Fig. 5), suggesting that the increased phosphorylation into glycogen (results not shown). In dexamethasone- of two isoforms of P20 (S2 and S3) may be associated with treated rats, the fasted basal plasma concentrations of both insulin (789 Ϯ 94 vs. 203 Ϯ 28 pmol/l in control rats) insulin-resistant states in general. Analysis of P20 expression and amylin (144 Ϯ 17 vs. 22.7 Ϯ 5.9 pmol/l in control rats) revealed that the mRNA level and protein abundance of P20 were significantly increased (P Ͻ 0.01 in each case). was not changed in either the diabetic rats or the amylin- EDL muscle strips from these rats were radiolabeled treated muscle strips (Fig. 6). These results indicated that with 32P and treated with or without insulin and amylin. the increased phosphorylation of S2 and S3 was not attrib- Then, phosphorylation of P20 was analyzed by 2-DE and utable to the increased expression of P20, but rather to a

FIG. 4. Changes in the phosphorylation of P20 and its responsiveness to insulin and amylin in dexamethasone-treated rats with insulin resis- tance. EDL muscle strips from nondiabetic con- trol rats (left) or rats with insulin resistance (right) were radiolabeled with 32P and then treated with buffer only (A and B), 50 nmol/l insulin (C and D), 50 nmol/l amylin (E and F), or 50 nmol/l insulin ؉ 50 nmol/l amylin (G and H) for 30 min. Phosphorylation of P20 was analyzed by 2-DE and phosphorimaging. The results shown are a typical representation of four independent observations.

1824 DIABETES, VOL. 50, AUGUST 2001 Y. WANG AND ASSOCIATES

TABLE 1 Quantitative analysis of the radioactivity associated with the three isoforms of P20 in nondiabetic control and dexamethasone-treated rats Nondiabetic control rats Dexamethasone-treated rats S1 S2 S3 S1 S2 S3 Basal state 434 Ϯ 13 21.6 Ϯ 1.9 15.1 Ϯ 2.8 439 Ϯ 15 102 Ϯ 6.2* 98.6 Ϯ 4.3* Insulin 831 Ϯ 40 20.3 Ϯ 3.4 13.3 Ϯ 1.3 843 Ϯ 9 96.6 Ϯ 5.5* 92 Ϯ 4* Amylin 191 Ϯ 9 289 Ϯ 20 226 Ϯ 17 181 Ϯ 11 280 Ϯ 13 208 Ϯ 15 Insulin ϩ amylin 417 Ϯ 16 82 Ϯ 460Ϯ 4 407 Ϯ 21 269 Ϯ 16* 192 Ϯ 15* Data are mean PSL values Ϯ SD. Radiolabeled EDL muscle strips from control and dexamethasone-treated rats were incubated in the absence of hormone (basal state), in the presence of insulin (50 nmol/l), amylin (50 nmol/l), or both hormones. 32P-labeled isoforms of P20 (S1, S2, and S3) were separated, as in Fig. 4, detected using a phosphorimager, and analyzed by MacBAS software. *P Ͻ 0.01 vs. corresponding values in control rats (n ϭ 4). possible defect in the intracellular signal transduction path- though expression of this transporter was paradoxically ways that lead to generation of its phosphorylated isoforms. slightly increased (37). Another major alteration in insulin-resistant rats is Pieber et al. (38) observed that whenever diabetes insulin’s ability to inhibit amylin-evoked phosphorylation occurred in dexamethasone-treated rats, the level of amy- of S2 and S3. In normal rats, 50 nmol/l insulin decreased lin and the ratio of amylin to insulin were significantly phosphorylation of S2 and S3 by 71.6 and 73%, respec- increased. The increase in the amylin-to-insulin ratio was tively, compared with that in samples treated with 50 associated with elevated content of proamylin mRNA nmol/l amylin alone (Figs. 4E and G). In diabetic rats, on relative to mRNA. Those study results implied the other hand, amylin-evoked phosphorylation of S2 and that amylin could also be an important contributing factor S3 was little affected by insulin (Figs. 4F and H). Under to the development of dexamethasone-induced insulin this condition, the radioactivity of both S2 and S3 was resistance. The results of our present study support such a ϳ3.3-fold higher than that of nondiabetic control rats role for amylin. The phosphoisoforms S2 and S3, which (Table 1). were hardly detected in healthy rats but could be induced Insulin resistance is a well-known effect of glucocorti- by amylin, were clearly present in diabetic rats (Fig. 4B). coid excess, but its mechanisms are still uncertain (35). This may have been because of the increased amylin level Although muscle is quantitatively the most important or the increased amylin-to-insulin ratio. It is interesting to tissue for glucose disposal in response to insulin, there are note that in normal rats, insulin specifically suppresses few studies on the effects of glucocorticoids in this tissue. amylin’s actions on the phosphorylation of P20 and eleva- Administration of dexamethasone did not affect the num- tion of cAMP levels, but has no detectable effect on the ber or affinity of insulin receptors in skeletal muscle but actions of two other catabolic hormones, epinephrine and did reduce insulin receptor tyrosine CGRP (Fig. 3). Such an action of insulin was significantly and decrease IRS-1 activation of PI-3 kinase, suggesting the existence of postreceptor defects (36). It has recently been reported that dexamethasone treatment significantly inhibited the insulin-stimulated translocation of GLUT4 from an intracellular pool to the plasma membrane, al-

FIG. 6. mRNA abundance and protein concentration of P20 is not altered in rats treated with dexamethasone. I: Northern blot analysis. RNA was prepared from the EDL muscles of saline- (A) or dexametha- sone-injected rats (B) or EDL muscle strips treated without (C) or FIG. 5. Enhanced phosphorylation of S2 and S3 is associated with with 50 nmol/l amylin (D) for 30 min in vitro, blotted, and probed with insulin-resistant rats induced by high-fat feeding. Protein (100 ␮g) the labeled P20 cDNA. The negative image of the ethidium from muscle strips from healthy rats or high fat؊induced diabetic rats bromide؊stained RNA loaded in each lane is also shown. Quantitative was separated by 2-DE, and the three phosphoisoforms of P20 (S1, S2, analysis was performed using a phosphorimager. II: Western blot and S3) were visualized by probing with anti-p20 antibody, as de- analysis of P20. Total protein (30 ␮g) from EDL muscles treated as for scribed in Fig. 1. The table in the lower panel represents the quanti- Northern blot analysis was separated by 12.5% SDS-PAGE and probed tative analysis for the abundance of each phosphoisoform of P20 in with anti P20 antibody, as in Fig. 1. III: Table represents the increased/ nondiabetic control rats and high fat؊induced diabetic rats. The decreased fold in P20 mRNA and protein levels under the respective ؎ abundance of each isoform is expressed as the mean PSL value ؎ SD. treatment, relative to saline-treated control rats. Results are means .SD from three individual experiments .(4 ؍ P < 0.01 vs. corresponding values in control rats (n*

DIABETES, VOL. 50, AUGUST 2001 1825 PHOSPHOPROTEIN P20 AND INSULIN RESISTANCE

could regulate glucose transport by modulating the phos- phorylation states of P20. To validate this hypothesis, we established stable transfectants of L6 cells that overexpress P20 (Fig. 7A). GLUT4myc was also coexpressed in these transfectants to increase insulin sensitivity (27). In the myotube cells over- expressing GLUT4myc alone, 50 nmol/l insulin increased 2-deoxyglucose uptake by 2.94- Ϯ 0.31-fold over the basal level (Fig. 7B). This insulin-stimulated glucose uptake was decreased by 28% in the presence of 50 nmol/l amylin. However, in cells overexpressing both P20 and GLUT4myc, insulin-stimulated glucose uptake was signif- icantly decreased by 41 Ϯ 3% (n ϭ 4; P Ͻ 0.05), whereas the inhibitory effect of amylin was significantly increased by 24 Ϯ 2% (n ϭ 4; P Ͻ 0.05). These results demonstrated that overexpression of P20 suppresses insulin-stimulated glucose uptake and enhances amylin’s ability to inhibit insulin’s action in L6 myotubes, thus suggesting a direct role of this protein in the regulation of glucose metabo- lism. The cellular mechanisms underlying such a regula- tory role of P20 are currently under investigation in our laboratory. In summary, our results demonstrated that insulin resis- tance in skeletal muscle is associated with the appearance of the two P20 phosphoisoforms, S2 and S3, and also with FIG. 7. The effect of P20 overexpression on glucose uptake in L6 the inability of insulin to suppress the phosphorylation of myotubes. A: L6 cells were transfected with pCXN2-GLUT4myc or these two isoforms. The role of P20 in the signal transduc- pCXN2-GLUT4myc and pcDNA.P20. Following selection with 400 ␮g/ml tion pathways of insulin and amylin in skeletal muscle and G418, clones expressing GLUT4myc alone or GLUT4myc ؉ P20 were expanded and differentiated, as described in RESEARCH DESIGN AND the significance of the alterations in phosphorylation of METHODS. Cell lysates (30 ␮g) from L6 myotubes were separated by 10% this protein in insulin resistance remain to be clarified. SDS-PAGE. The levels of P20 and GLUT4myc expression were analyzed Nevertheless, working backward toward receptors from by Western blot using specific anti-p20 and anti-GLUT4 antibodies, respectively. B: The cell lines selected in A were differentiated in phosphorylation of the three isoforms of P20 could serve six-well plates and assayed for 2-deoxyglucose uptake in response to as a method for elucidating postreceptor events of amylin insulin or insulin plus amylin, as described in RESEARCH DESIGN AND and insulin and the functional interactions between these -means ؎ SD). Shown is the result of a typical experi ;4 ؍ METHODS (n ment; similar results were also obtained from at least another two two hormones. Further studies on the intracellular defect independent transfectants that express GLUT4myc (Ⅺ) or GLUT4myc that leads to the alteration of P20 phosphorylation in the ؉ P20 (f). *P < 0.01 vs. corresponding values in cells overexpressing GLUT4myc alone. insulin-resistant state could also help in understanding the pathogenesis of this disease. attenuated in dexamethasone-induced diabetic rats (Figs. ACKNOWLEDGMENTS 4F and H). Based on these results, it is tempting to These studies were supported by grants from the En- speculate that under physiological conditions, amylin’s docore Research Trust and the Health Research Council of antagonism of insulin-stimulated glucose disposal is inhib- New Zealand. ited by insulin itself. The impairment of this action by We thank Dr. David James for kindly providing the insulin may lead to the enhanced catabolic action of pCXN2-GLUT4myc vector and Dr. Bernard Choong, Dr. amylin and thus partly cause insulin resistance in dexa- Anthony Phillips, and Tom Mulvey for expert technical methasone-induced diabetic rats. assistance. P20 is involved in the regulation of the glucose up- take process in L6 myotube cells. Although the physi- ological role of P20 is uncertain, the high abundance of REFERENCES this protein and its diverse responsiveness to insulin and 1. Moller DE, Flier JS: Insulin resistance: mechanisms, syndromes, and implications. N Engl J Med 325:938–948, 1991 its antagonists suggest that it could be a mediator involved 2. Reaven GM: Pathophysiology of insulin resistance in human disease. in the biological actions of these metabolic hormones. Physiol Rev 75:473–486, 1995 Notably, P20 has recently been shown to be an actin- 3. Hunter SJ, Garvey WT: Insulin action and insulin resistance: diseases binding protein (31). Both cytoskeletal actin filaments and involving defects in insulin receptors, signal transduction, and the glucose actin-binding proteins have been suggested to play a role transport effector system. Am J Med 105:331–345, 1998 4. Kahn BB: Type 2 diabetes: when insulin fails to compensate for in directing traffic of glucose transporters to the cell mem- insulin resistance. Cell 92:593–596, 1998 brane (39,40). Interestingly, two other proteins whose 5. Folli F, Saad MJA, Backer JM, Kahn CR: Regulation of phosphatidylinositol increased expression may contribute to insulin resistance 3-kinase activity in liver and muscle of animal models of insulin-resistant in type 2 diabetes, Rad and PED/PEA-15, are also cytoskel- and insulin-deficient diabetes mellitus. J Clin Invest 92:1787–1794, 1993 6. Bjornholm M, Kawano Y, Lehtihet M, Zierath JR: Insulin receptor sub- eton-associated proteins involved in the regulation of glu- strate-1 phosphorylation and phosphatidylinositol 3-kinase activity in skele- cose transport (41,42). Thus, it is intriguing to speculate tal muscle from NIDDM subjects after in vivo insulin stimulation. Diabetes that metabolic hormones, such as insulin and amylin, 46:524–527, 1997

1826 DIABETES, VOL. 50, AUGUST 2001 Y. WANG AND ASSOCIATES

7. Peraldi P, Spiegelman B: TNF-alpha and insulin resistance: summary and nisms of liver and muscle insulin resistance induced by chronic high-fat future prospects. Mol Cell Biochem 182:169–175, 1998 feeding. Diabetes 46:1768–1774, 1997 8. Boden G: Free fatty acids (FFA), a link between obesity and insulin 27. Robinson R, Robinson L J, James DE, Lawrence JC Jr: Glucose transport in resistance. Front Biosci 3:D169–D175, 1998 L6 myoblasts overexpressing GLUT1 and GLUT4. J Biol Chem 268:22119– 9. Cooper GJS, Leighton B, Dimitriadis GD, Parry-Billings M, Kowalchuk JM, 22126, 1993 Howland K, Rothbard JB, Willis AC, Reid KBM: Amylin found in 28. Inaguma Y, Hasegawa K, Kato K, Nishida Y: cDNA cloning of a 20-kDa deposits in human type 2 diabetes mellitus may be a hormone that protein (p20) highly homologous to small heat shock proteins: develop- regulates glycogen metabolism in skeletal muscle. Proc Natl Acad Sci U S mental and physiological changes in rat hindlimb muscles. Gene 178:145– A 85:7763–7766, 1988 150, 1996 10. Leighton B, Cooper GJ: Pancreatic amylin and calcitonin gene-related 29. Woodrum DA, Brophy CM, Wingard CJ, Beall A, Rasmussen H: Phosphor- peptide cause resistance to insulin in skeletal muscle in vitro. Nature ylation events associated with cyclic nucleotide-dependent inhibition of 335:632–635, 1988 smooth muscle contraction. Am J Physiol 277:H931–H939, 1999 11. Bjorntorp P: Neuroendocrine perturbations as a cause of insulin resis- 30. Beall AC, Kato K, Goldenring JR, Rasmussen H, Brophy CM: Cyclic tance. Diabetes Metab Res Rev 15:427–441, 1999 nucleotide-dependent vasorelaxation is associated with the phosphoryla- 12. Frontoni S, Choi SB, Banduch D, Rossetti L: In vivo insulin resistance tion of a small heat shock-related protein. J Biol Chem 272:11283–11287, induced by amylin primarily through inhibition of insulin-stimulated 1997 glycogen synthesis in skeletal muscle. Diabetes 40:568–573, 1991 31. Brophy CM, Lamb S, Graham A: The small heat shock-related protein-20 is 13. Molina JM, Cooper GJS, Leighton B, Olefsky JM: Induction of insulin an actin-associated protein. J Vasc Surg 29:326–333, 1999 resistance in vivo by amylin and calcitonin gene-related peptide. Diabetes 32. Niwa M, Kozawa O, Matsuno H, Kato K, Uematsu T: Small molecular 39:260–265, 1990 weight heat shock-related protein, HSP20, exhibits an anti-platelet activity 14. Castle AL, Kuo CH, Ivy JL: Amylin influences insulin-stimulated glucose by inhibiting receptor-mediated calcium influx. Life Sci 66:L7–L12, 2000 metabolism by two independent mechanisms. Am J Physiol 274:E6–E12, 33. Cooper GJS: Amylin compared with calcitonin gene-related peptide: 1998 15. Young AA, Wang MW, Cooper GJ: Amylin causes elevated plasma structure, , and relevance to metabolic disease. Endocr Rev 15:163– lactate and glucose in the rat. FEBS Lett 291:101–104, 1991 201, 1994 16. Young DA, Deems RO, Deacon RW, Mcintosh RH, Foley JE: Effects of 34. Christopoulos G, Perry KJ, Morfis M, Tilakaratne N, Gao Y, Fraser NJ, Main amylin on glucose metabolism and in vivo and in vitro. MJ, Foord SM, Sexton PM: Multiple amylin receptors arise from receptor Am J Physiol 259:E457–E461, 1990 activity-modifying protein interaction with the calcitonin receptor gene 17. Hettiarachchi M, Chalkley S, Furler SM, Choong YS, Heller M, Cooper GJS, product. Mol Pharmacol 56:235–242, 1999 Kraegen EW: Rat amylin-(8–37) enhances insulin action and alters lipid 35. Andrews RC, Walker BR: Glucocorticoids and insulin resistance: old metabolism in normal and insulin resistant rats. Am J Physiol 273:E859– hormones, new targets. Clin Sci 96:513–523, 1999 E867, 1997 36. Giorgino F, Almahfouz A, Goodyear L J, Smith RJ: Glucocorticoid regula- 18. Gebre-Medhin S, Mulder H, Pekny M, Westermark G, Tornell J, Wester- tion of insulin receptor and substrate IRS-1 tyrosine phosphorylation in rat mark P, Sundler F, Ahren B, Betsholtz C: Increased insulin secretion and skeletal muscle in vivo. J Clin Invest 91:2020–2030, 1993 glucose tolerance in mice lacking islet amyloid polypeptide (amylin). 37. Dimitriadis G, Leighton B, Parry-Billings M, Sasson S, Young M, Krause U, Biochem Biophys Res Commun 250:271–277, 1998 Bevan S, Piva T, Wegener G, Newsholme EA: Effects of glucocorticoid 19. Enoki S, Mitsukawa T, Takemura J, Nakazato M, Aburaya J, Toshimori H, excess on the sensitivity of glucose transport and metabolism to insulin in Matsukara S: Plasma islet amyloid polypeptide levels in obesity, impaired rat skeletal muscle. Biochem J 321:707–712, 1997 glucose tolerance and non-insulin-dependent diabetes mellitus. Diabetes 38. Pieber TR, Stein DT, Ogawa A, Alam T, Ohneda M, McCorkle K, Chen L, Res Clin Pract 15:97–102, 1992 McGarry JD, Unger RH: Amylin-insulin relationships in insulin resistance 20. Moller DE, Bjorbaek C, Vidal-Puig A: Candidate genes for insulin resis- with and without diabetic hyperglycemia. Am J Physiol 265:E446–E453, tance. Diabetes Care 19:396–400, 1996 1993 21. DeFronzo RA: Pathogenesis of type 2 diabetes: metabolic and molecular 39. Kao AW, Noda Y, Johnson JH, Pessin JE, Saltiel AR: Aldolase mediates the implications for identifying diabetes genes. Diabetes Review 5:177–269, association of F-actin with the insulin-responsive 1997 GLUT4. J Biol Chem 274:17742–17747, 1999 22. Kahn CR: Insulin action, diabetogenes, and the cause of type 2 diabetes. 40. Tsakiridis T, Vranic M, Klip A: Disassembly of the actin network inhibits Diabetes 43:1066–1084, 1994 insulin-dependent stimulation of glucose transport and prevents recruit- 23. Wang Y, Xu A, Cooper GJS: Amylin evokes phosphorylation of P20 in rat ment of glucose transporters to the plasma membrane. J Biol Chem skeletal muscle. FEBS Lett 457:149–152, 1999 269:29934–29942, 1994 24. Wang Y, Xu A, Pearson RB, Cooper GJ: Insulin and insulin antagonists 41. Moyers JS, Bilan PJ, Reynet C, Kahn CR: Overexpression of Rad inhibits evoke phosphorylation of P20 at serine 157 and serine 16, respectively in glucose uptake in cultured muscle and fat cells. J Biol Chem 271:23111– rat skeletal muscle. FEBS Lett 462:25–30, 1999 23116, 1996 25. Kato K, Goto S, Inaguma Y, Hasegawa K, Morishita R, Asano T: Purification 42. Condorelli G, Vigliotta G, Iavarone C, Caruso M, Tocchetti CG, Andreozzi and characterization of a 20-kDa protein that is highly homologous to F, Cafieri A, Tecce MF, Formisano P, Beguinot L, Beguinot F: PED/PEA-15 alpha B crystallin. J Biol Chem 269:15302–15309, 1994 gene controls glucose transport and is overexpressed in type 2 diabetes 26. Oakes ND, Cooney GJ, Camilleri S, Chisholm DJ, Kraegen EW: Mecha- mellitus. EMBO J 17:3858–3866, 1998

DIABETES, VOL. 50, AUGUST 2001 1827