Alteration in Phosphorylation of P20 Is Associated with Insulin Resistance Yu Wang,1 Aimin Xu,1 Jiming Ye,2 Edward W

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Alteration in Phosphorylation of P20 Is Associated With Insulin Resistance Yu Wang,1 Aimin Xu,1 Jiming Ye,2 Edward W. Kraegen,2 Cynthia A. Tse,1 and Garth J.S. Cooper1,3 We have recently identified a small phosphoprotein, P20, insulin action, such as the activation of insulin receptors, as a common intracellular target for insulin and several postreceptor signal transduction, and the glucose trans- of its antagonists, including amylin, epinephrine, and cal- port effector system, have been implicated in this disease citonin gene-related peptide. These hormones elicit phos- (3,4). Defective insulin receptor kinase activity, reduced phorylation of P20 at its different sites, producing three insulin receptor substrate-1 tyrosine phosphorylation, and phosphorylated isoforms: S1 with an isoelectric point (pI) decreased phosphatidylinositol (PI)-3 kinase activity were value of 6.0, S2 with a pI value of 5.9, and S3 with a pI observed in both human type 2 diabetic patients as well as value of 5.6 (FEBS Letters 457:149–152 and 462:25–30, animal models, such as ob/ob mice (5,6). 1999). In the current study, we showed that P20 is one In addition to the intrinsic defects of the insulin receptor of the most abundant phosphoproteins in rat extensor digitorum longus (EDL) muscle. Insulin and amylin an- and postreceptor signaling components, other circulating tagonize each other’s actions in the phosphorylation of factors, such as tumor necrosis factor-␣, leptin, free fatty this protein in rat EDL muscle. Insulin inhibits amylin- acids, and amylin, may also contribute to the pathogenesis evoked phosphorylation of S2 and S3, whereas amylin of insulin resistance (7–11). For example, amylin, a hor- decreases insulin-induced phosphorylation of S1. In rats mone co-secreted with insulin from pancreatic islet made insulin resistant by dexamethasone treatment, lev- ␤-cells, has been shown to antagonize insulin’s metabolic els of the phosphoisoforms S2 and S3, which were barely actions both in vivo and in vitro (12–16). It can inhibit detectable in healthy rats in the absence of hormone insulin-stimulated glucose uptake and glycogen synthesis. stimulation, were significantly increased. Moreover, the In vivo administration of amylin results in hyperglycemia ability of insulin to inhibit amylin-evoked phosphoryla- and induced insulin resistance similar to that observed in tion of these two isoforms was greatly attenuated. These results suggested that alterations in the phosphoryla- type 2 diabetes. Although some earlier studies have sug- tion of P20 might be associated with insulin resistance gested that amylin’s biological effects on fuel metabolism and that P20 could serve as a useful marker to dissect were only of pharmacological interest, more recent in vivo the cellular mechanisms of this disease. Diabetes 50: studies with an amylin-selective antagonist have strongly 1821–1827, 2001 supported its physiological relevance (17). Moreover, amy- lin-deficient mice have shown increased insulin respon- siveness and more rapid blood glucose elimination after glucose loading, further confirming the role of amylin in nsulin resistance is characterized by diminished causing insulin resistance (18). Indeed, elevated levels of insulin sensitivity of target tissues, including liver, circulating amylin (hyperamylinemia) and an increased skeletal muscle, and adipocytes (1). It is a key factor ratio of amylin to insulin have been observed in patients Iin the pathogenesis of type 2 diabetes and is also with type 2 diabetes and other diseases associated with associated with other pathological states, such as obesity, insulin resistance, such as obesity and glucose intolerance dyslipidemia, hyperinsulinemia, hypertension, and cardio- (19). vascular disease. These clustering metabolic defects have Despite these advances, the detailed cellular mechanisms been termed “syndrome X” or “the insulin-resistance syn- of insulin resistance are far from clear. Recent studies that drome” (2). have used genetic approaches to identify specific genes The molecular basis of insulin resistance is extremely that account for the genetic predisposition to this disease complex and multifactorial. Defects in several steps of have been generally unrewarding (4,20–22). We recently used comparative proteomic analysis to systematically in- vestigate the phosphorylation cascades evoked by insulin From the 1School of Biological Sciences, University of Auckland, Auckland, and its antagonists in rat skeletal muscle and identified a New Zealand; the 2Garvan Institute of Medical Research, Sydney, Australia; and the 3Department of Medicine, School of Medicine, University of Auckland, novel phosphoprotein, P20, as the common intracellular Auckland, New Zealand. target of these hormones (23,24). Insulin and its antag- Address correspondence and reprint requests to Garth J.S. Cooper, Level 4, onistic hormones amylin, epinephrine, and calcitonin School of Biological Sciences, University of Auckland, Private Bag 92019, Auckland, New Zealand. E-mail: [email protected]. gene-related peptide (CGRP), through distinctive signaling Received for publication 16 October 2000 and accepted in revised form 17 pathways, phosphorylate P20 at different serine residues April 2001. CGRP, calcitonin gene-related peptide; 2-DE, two-dimensional gel electro- to produce multiple phosphoisoforms of this protein. In phoresis; DMEM, Dulbecco’s modified Eagle’s medium; ECL, enhanced chemi- this study, we demonstrated that P20 in skeletal muscle luminescence; EDL, extensor digitorum longus; GLUT4myc, myc-tagged from insulin-resistant diabetic rats has an abnormal phos- GLUT4; HSP, heat shock protein; KHB, Krebs-Henseleit buffer; OD, optical density; pI, isoelectric point; PI, phosphatidylinositol; PSL, photostimulated phorylation pattern, although the expression level of this luminescence; VOL, a feature’s volume. protein is not changed. Moreover, the responsiveness of DIABETES, VOL. 50, AUGUST 2001 1821 PHOSPHOPROTEIN P20 AND INSULIN RESISTANCE P20 to insulin and amylin is also altered in insulin-resistant CCGGGATCCCTACTTGGCAGCAGGTGGTGAC3Ј. The resulting clone was animals. We propose that P20 may serve as a useful marker validated by DNA sequencing and then inserted into the multiple cloning site of cytomegalovirus promoter-driven eukaryotic expression vector pcDNA3.1 for investigating the mechanisms of insulin resistance. (referred to as pcDNA.P20). L6 myoblast cells were transfected with pCXN2-GLUT4myc (27) or co- transfected with pCXN2-GLUT4myc and pcDNA.P20 using Lipofectamine Plus RESEARCH DESIGN AND METHODS reagent (Life Technology) according to the manufacturer’s instructions. Materials. Male Wistar rats were fed standard rat diet (NRM Diet 86, Tegel, Stable transfectants were selected in medium containing the neomycin ana- Auckland, New Zealand) with water ad libitum. [32P]orthophosphate and logue G418 at 400 ␮g/ml. At 10 days after transfection, the clones were D-[U-14C]glucose were purchased from ICN. 2-deoxy-D-[3H]glucose (1 mCi/ml) selected using sterilized steel rings and expanded separately in the presence was obtained from DuPont-NEN and 125I was obtained from Amersham of G418. Clones that expressed P20 and GLUT4myc were chosen by Western Pharmacia. Human insulin (Actrapid) was obtained from Novo Nordisk. Rat blotting and used for further experiments. amylin and CGRP were purchased from Bachem (Torrance, CA); epinephrine Western blotting. Proteins (ϳ50 ␮g) from liver, heart, epididymal fat pad, was from David Bull Laboratories; and dexamethasone was from Sigma. The aortic smooth muscle, EDL muscle, soleus muscle tissue, and whole blood two-dimensional gel electrophoresis (2-DE) system and reagents were ob- obtained from 18 hϪfasted male Wistar rats were separated by SDS-PAGE and tained from Pharmacia. Anti-P20 polyclonal antibody was a generous gift from subsequently transferred to nitrocellulose membranes. The membranes were Dr. Kanefusa Kato (25). Anti-GLUT4 (H-61) was obtained from Santa Cruz blocked overnight at 4°C and then incubated with rabbit anti-P20 poly- Biotechnology. The enhanced chemiluminescence (ECL) detection system clonal antibody (1:1,000) for2hatroom temperature. After incubation with was from Roche Molecular Biochemicals. The total cellular RNA extraction streptavidin-biotinylated horseradish-peroxidaseϪconjugated secondary anti- reagent (TRIZOL), G418, Lipofectamine Plus reagent, and random priming body for another hour at room temperature, the proteins immunoreactive to labeling kits were from Life Technology. pCXN2-GLUT4myc, which expresses the primary antibody were visualized by ECL detection according to the myc-tagged GLUT4 (GLUT4myc) in mammalian cells, was kindly provided by manufacturer’s instructions. Dr. David James (University of Queensland, Australia). Northern blot analysis. Total cellular RNA was isolated from EDL muscle of Establishment of the dexamethasone- or high fat؊induced rat models 18 hϪfasted control and dexamethasone-treated rats using TRIZOL reagent of insulin resistance. All experimental protocols were approved by the (Life Technology). Then, 15 ␮g of RNA from each sample were separated Institutional Animal Ethics Committee. Male Wistar rats were injected with by 1.5% agarose-formaldehyde gel electrophoresis and subsequently trans- Ϫ Ϫ dexamethasone (3.1 mg ⅐ kg 1 ⅐ day 1, i.p.) for 7 days. The weight of rats in ferred to Hybond-Nϩ nylon membranes (Amersham Pharmacia Biotech, both control and dexamethasone-treated groups were monitored daily. By the Uppsala, Sweden)
Recommended publications
  • Protection of Insulin‑Like Growth Factor 1 on Experimental Peripheral Neuropathy in Diabetic Mice

    Protection of Insulin‑Like Growth Factor 1 on Experimental Peripheral Neuropathy in Diabetic Mice

    MOLECULAR MEDICINE REPORTS 18: 4577-4586, 2018 Protection of insulin‑like growth factor 1 on experimental peripheral neuropathy in diabetic mice HUA WANG, HAO ZHANG, FUMING CAO, JIAPING LU, JIN TANG, HUIZHI LI, YIYUN ZHANG, BO FENG and ZHAOSHENG TANG Department of Endocrinology, Shanghai East Hospital, Tongji University School of Medicine, Shanghai 200120, P.R. China Received December 24, 2017; Accepted July 19, 2018 DOI: 10.3892/mmr.2018.9435 Abstract. The present study investigated whether insulin-like the IGF-1-PPP group compared with the IGF-1 group; however, growth factor-1 (IGF-1) exerts a protective effect against no significant difference was observed in the expression neuropathy in diabetic mice and its potential underlying levels of p-p38 following treatment with IGF-1. The results mechanisms. Mice were divided into four groups: Db/m of the present study demonstrated that IGF-1 may improve (control), db/db (diabetes), IGF-1-treated db/db and neuropathy in diabetic mice. This IGF-1-induced neurotrophic IGF-1-picropodophyllin (PPP)-treated db/db. Behavioral effect may be associated with the increased phosphorylation studies were conducted using the hot plate and von Frey levels of JNK and ERK, not p38; however, it was attenuated by methods at 6 weeks of age prior to treatment. The motor nerve administration of an IGF-1R antagonist. conduction velocity (NCV) of the sciatic nerve was measured using a neurophysiological method at 8 weeks of age. The Introduction alterations in the expression levels of IGF-1 receptor (IGF-1R), c-Jun N-terminal kinase (JNK), extracellular signal-regulated An epidemiological survey demonstrated that the prevalence kinase (ERK), p38 and effect of IGF-1 on the sciatic nerve of diabetes in adults ≥18 years old in China was ≤11.6% (1).
  • Receptor Activity Modifying Proteins (Ramps) Interact with the VPAC2 Receptor and CRF1 Receptors and Modulate Their Function

    Receptor Activity Modifying Proteins (Ramps) Interact with the VPAC2 Receptor and CRF1 Receptors and Modulate Their Function

    British Journal of DOI:10.1111/j.1476-5381.2012.02202.x www.brjpharmacol.org BJP Pharmacology RESEARCH PAPER Correspondence David R Poyner, School of Life and Health Sciences, Aston University, Birmingham, Receptor activity modifying B4 7ET, UK. E-mail: [email protected] ---------------------------------------------------------------- proteins (RAMPs) interact Current address: *Drug Discovery Biology, Monash Institute of Pharmaceutical Sciences, 381 with the VPAC2 receptor Royal Parade, Parkville, Victoria 3052 Australia; †Discovery Sciences, AstraZeneca R&D, and CRF1 receptors and Mölndal, Sweden; ‡R&I iMED, AstraZeneca R&D, Mölndal, Sweden. modulate their function ---------------------------------------------------------------- Keywords D Wootten1*, H Lindmark2†, M Kadmiel3, H Willcockson3, KM Caron3, receptor activity-modifying proteins (RAMPs); RAMP1; J Barwell1, T Drmota2‡ and DR Poyner1 RAMP2; RAMP3; VPAC2 receptor; +/- CRF1 receptor; Ramp2 mice; 1 2 School of Life and Health Sciences, Aston University, Birmingham, UK, Department of Lead G-protein coupling; biased Generation, AstraZeneca R&D, Mölndal, Sweden, and 3Department of Cellular and Molecular agonism Physiology, The University of North Carolina at Chapel Hill, Chapel Hill, NC, USA ---------------------------------------------------------------- Received 10 July 2012 Revised 15 August 2012 Accepted 28 August 2012 BACKGROUND AND PURPOSE Although it is established that the receptor activity modifying proteins (RAMPs) can interact with a number of GPCRs, little is known about the consequences of these interactions. Here the interaction of RAMPs with the glucagon-like peptide 1 receptor (GLP-1 receptor), the human vasoactive intestinal polypeptide/pituitary AC-activating peptide 2 receptor (VPAC2) and the type 1 corticotrophin releasing factor receptor (CRF1) has been examined. EXPERIMENTAL APPROACH GPCRs were co-transfected with RAMPs in HEK 293S and CHO-K1 cells.
  • Clinical Policy: Mecasermin (Increlex) Reference Number: ERX.SPA.209 Effective Date: 01.11.17 Last Review Date: 11.17 Revision Log

    Clinical Policy: Mecasermin (Increlex) Reference Number: ERX.SPA.209 Effective Date: 01.11.17 Last Review Date: 11.17 Revision Log

    Clinical Policy: Mecasermin (Increlex) Reference Number: ERX.SPA.209 Effective Date: 01.11.17 Last Review Date: 11.17 Revision Log See Important Reminder at the end of this policy for important regulatory and legal information. Description Mecasermin (Increlex®) is an insulin growth factor-1 (IGF-1) analogue. FDA Approved Indication(s) Increlex is indicated for the treatment of growth failure in children with severe primary IGF-1 deficiency or with growth hormone (GH) gene deletion who have developed neutralizing antibodies to GH. Limitation(s) of use: Increlex is not a substitute to GH for approved GH indications. Policy/Criteria Provider must submit documentation (which may include office chart notes and lab results) supporting that member has met all approval criteria It is the policy of health plans affiliated with Envolve Pharmacy Solutions™ that Increlex is medically necessary when the following criteria are met: I. Initial Approval Criteria A. Severe Primary IGF-1 Deficiency (must meet all): 1. Diagnosis of IGF-1 deficiency growth failure and associated growth failure with one of the following (a or b): a. Severe primary IGF-1 deficiency as defined by all (i through iii): i. Height standard deviation score (SDS) ≤ –3.0; ii. Basal IGF-1 SDS ≤ –3.0; iii. Normal or elevated GH level; b. GH gene deletion with development of neutralizing antibodies to GH; 2. Prescribed by or in consultation with an endocrinologist; 3. Age ≥ 2 and <18 years; 4. At the time of request, member does not have closed epiphyses; 5. Dose does not exceed 0.12 mg/kg twice daily.
  • Insulin Products and the Cost of Diabetes Treatment

    Insulin Products and the Cost of Diabetes Treatment

    November 19, 2018 Insulin Products and the Cost of Diabetes Treatment Insulin is a hormone that regulates the storage and use of would involve a consistent insulin level between meals sugar (glucose) by cells in the body. When the pancreas combined with a mealtime level of insulin that has a rapid does not make enough insulin (type 1 diabetes) or it cannot onset and duration of action to match the glucose peak that be used effectively (type 2 diabetes), sugar builds up in the occurs after a meal. The original insulin, also called regular blood. This may lead to serious complications, such as heart insulin, is a short-acting type of product with a duration of disease, stroke, blindness, kidney failure, amputation of action of about 8 hours, making it less suitable for toes, feet, or limbs. Prior to the discovery of insulin providing 24-hour coverage. treatment, type 1 diabetics usually died from this disease. In the late 1930s through the 1950s, regular insulin was There were 23.1 million diagnosed cases of diabetes in the altered by adding substances (protamine and zinc) to gain United States in 2015 according to the Centers for Disease longer action; these are called intermediate-acting insulins. Control and Prevention (CDC). Adding an estimated 7.2 One such advance (neutral protamine Hagedorn, or NPH) million undiagnosed cases brings the total to 30.3 million was patented in 1946 and is still in use today. It allowed for (9.4% of U.S. population). People with type 1 diabetes, the combination of two types of insulin in premixed vials about 5% of U.S.
  • Insulin-Induced Hypoglycemia Stimulates Corticotropin-Releasing

    Insulin-Induced Hypoglycemia Stimulates Corticotropin-Releasing

    Insulin-induced hypoglycemia stimulates corticotropin-releasing factor and arginine vasopressin secretion into hypophysial portal blood of conscious, unrestrained rams. A Caraty, … , B Conte-Devolx, C Oliver J Clin Invest. 1990;85(6):1716-1721. https://doi.org/10.1172/JCI114626. Research Article Insulin-induced hypoglycemia (IIH) is a strong stimulator of pituitary ACTH secretion. The mechanisms by which IIH activates the corticotrophs are still controversial. Indeed, in rats the variations of corticotropin-releasing factor (CRF) and arginine vasopressin (AVP) secretion in hypophysial portal blood (HPB) during IIH have been diversely appreciated. This may be due to the stressful conditions required for portal blood collection in rats. We studied the effects of IIH on the secretion of CRF and AVP in HPB and on the release of ACTH and cortisol in peripheral plasma in conscious, unrestrained, castrated rams. After the injection of a low (0.2 IU/kg) or high dose (2 IU/kg) of insulin, ACTH and cortisol levels in peripheral plasma increased in a dose-related manner. After injection of the low dose of insulin, CRF and AVP secretion in HPB were equally stimulated. After injection of the high dose of insulin, CRF secretion was further stimulated, while AVP release was dramatically increased. These results suggest that when the hypoglycemia is moderate, CRF is the main factor triggering ACTH release, and that the increased AVP secretion potentiates the stimulatory effect of CRF. When hypoglycemia is deeper, AVP secretion becomes predominant and may by itself stimulate ACTH release. Find the latest version: https://jci.me/114626/pdf Insulin-induced Hypoglycemia Stimulates Corticotropin-releasing Factor and Arginine Vasopressin Secretion into Hypophysial Portal Blood of Conscious, Unrestrained Rams A.
  • Neuronal, Stromal, and T-Regulatory Cell Crosstalk in Murine Skeletal Muscle

    Neuronal, Stromal, and T-Regulatory Cell Crosstalk in Murine Skeletal Muscle

    Neuronal, stromal, and T-regulatory cell crosstalk in murine skeletal muscle Kathy Wanga,b,1,2, Omar K. Yaghia,b,1, Raul German Spallanzania,b,1, Xin Chena,b,3, David Zemmoura,b,4, Nicole Laia, Isaac M. Chiua, Christophe Benoista,b,5, and Diane Mathisa,b,5 aDepartment of Immunology, Harvard Medical School, Boston, MA 02115; and bEvergrande Center for Immunologic Diseases, Harvard Medical School and Brigham and Women’s Hospital, Boston, MA 02115 Contributed by Diane Mathis, January 15, 2020 (sent for review December 23, 2019; reviewed by David A. Hafler and Jeffrey V. Ravetch) A distinct population of Foxp3+CD4+ regulatory T (Treg) cells pro- reduced in aged mice characterized by poor muscle regeneration + motes repair of acutely or chronically injured skeletal muscle. The (7). IL-33 mSCs can be found in close association with nerve accumulation of these cells depends critically on interleukin (IL)-33 pro- structures in skeletal muscle, including nerve fibers, nerve bun- duced by local mesenchymal stromal cells (mSCs). An intriguing phys- + dles, and muscle spindles that control proprioception (7). ical association among muscle nerves, IL-33 mSCs, and Tregs has been Given the intriguing functional and/or physical associations reported, and invites a deeper exploration of this cell triumvirate. Here + among muscle nerves, mSCs, and Tregs, and in particular, their we evidence a striking proximity between IL-33 muscle mSCs and co-ties to IL-33, we were inspired to more deeply explore this both large-fiber nerve bundles and small-fiber sensory neurons; report axis. Here, we used whole-mount immunohistochemical imag- that muscle mSCs transcribe an array of genes encoding neuropep- ing as well as population-level and single-cell RNA sequencing tides, neuropeptide receptors, and other nerve-related proteins; define (scRNA-seq) to examine the neuron/mSC/Treg triumvirate in muscle mSC subtypes that express both IL-33 and the receptor for the calcitonin-gene–related peptide (CGRP); and demonstrate that up- or hindlimb muscles.
  • Insulin Replacement Therapy

    Insulin Replacement Therapy

    Diabetes Educational Services Training Healthcare Professionals On State of the Art Diabetes Care Insulin Replacement Therapy Another Downloadable Article from the Diabetes Educational Services Site Insulin Replacement Therapy is an excellent review of strategies to effectively dose and adjust insulin for patients with type 1 and type 2 diabetes. It is authored by our faculty member, Evelyne Fleury Milfort. Diabetes Educational Services Beverly Dyck Thomassian 45 Old Chico Way Chico, CA 95928 530 893-8635 [email protected] http://www.diabetesed.net/ Insulin Replacement Therapy Vol. 16 •Issue 11 • Page 32 2009 Diabetes CE Insulin Replacement Therapy Minimizing Complications and Side Effects by Evelyne Fleury-Milfort, NP Objectives: The purpose of this article is to educate nurse practitioners about insulin replacement therapy. After reading this article, the nurse practitioner should be able to: * define insulin replacement therapy and discuss appropriate candidates for this form of insulin management * describe the major components of insulin replacement therapy * identify criteria for choosing insulin regimen modalities * explain the initiation and titration process for multiple daily injections and insulin pump therapy. Insulin therapy is the cornerstone of treatment for all patients with type 1 diabetes and for patients with type 2 diabetes who reach severe beta cell failure. Multiple studies have documented the importance of optimal glucose control to prevent the devastating complications of the disease. The best strategy to achieve optimal glucose control is to imitate normal insulin delivery. This continuing education article discusses strategies for the initiation and titration of insulin replacement therapy. Current State of Diabetes Diabetes has reached an epidemic level in the United States.
  • Insulin As a Growth Factor

    Insulin As a Growth Factor

    003 1-3998/85/1909-0879$02.00/0 PEDIATRIC RESEARCH Vol. 19, No. 9, 1985 Copyright O 1985 International Pediatric Research Foundation, Inc Printed in U.S. A. Insulin as a Growth Factor D. J. HILL AND R. D. G. MILNER Departrnenl c!j'Pucdiutricc, Unive,:sitj. of Sl~effield,Cliildren :s Hospital, Shefic~ld,England ABSTRACT. Insulin is a potent mitogen for many cell attention than its well known, acute metabolic actions. Insulin types in vitro. During tissue culture, supraphysiological also can influence growth in vivo. The poor growth of a chilld concentrations of insulin are necessary to promote cell with diabetes (1) contrasts with the overgrowth of the hyperin- replication in connective or musculoskeletal tissues. Insulin sulinemic infant of a diabetic mother (2). The growth-promoting promotes the growth of these cells by binding, with low effect of insulin in vivo was demonstrated experimentally by affinity, to the type I insulin-like growth factor (IGF) Salter and Best in 1953 (3); these investigators restored growth receptor, not through the high affinity insulin receptor. In to hypophysectomized rats by treatment with insulin and a high other cell types, such as hepatocytes, embryonal carcinoma carbohydrate diet. Rats given insulin grew as well as those given cells, or mammary tumor cells, the type I IGF receptor is growth hormone but consumed substantially more food. Any virtually absent, and insulin stimulates the growth of these analysis of the action of insulin in promoting growth must clearly cells at physiological concentrations by binding to the high separate those effects which are due to anabolism resulting frc~m affinity insulin receptor.
  • Relationship Between Testosterone Levels, Insulin Sensitivity, and Mitochondrial Function in Men

    Relationship Between Testosterone Levels, Insulin Sensitivity, and Mitochondrial Function in Men

    Pathophysiology/Complications ORIGINAL ARTICLE Relationship Between Testosterone Levels, Insulin Sensitivity, and Mitochondrial Function in Men 1 4 NELLY PITTELOUD, MD DEVJIT TRIPATHY, MD, DM nsulin resistance has assumed increas- 2 1 VAMSI K. MOOTHA, MD MARIA YIALAMAS, MD ing importance as a risk factor for car- 1 4 ANDREW A. DWYER, BA LEIF GROOP, MD, PHD 1 diovascular disease coincident with the EGAN ARDIN BA 5 I M H , DARIUSH ELAHI, PHD dramatic increase in the prevalence of 3 1 HANG LEE, PHD RANCES AYES MB, BCH, BAO 4 F J. H , obesity in the Western world. Recent KARL-FREDRIK ERIKSSON, MD studies using genetic analysis (1,2), func- tional imaging (3,4), and animal models of differential aerobic capacity (5) have shed light on the role of mitochondrial function in inducing the metabolic distur- OBJECTIVE — The goal of this study was to examine the relationship between serum bances characteristic of insulin-resistant testosterone levels and insulin sensitivity and mitochondrial function in men. states. Using gene set enrichment analysis RESEARCH DESIGN AND METHODS — A total of 60 men (mean age 60.5 Ϯ 1.2 to look for changes in sets of genes com- years) had a detailed hormonal and metabolic evaluation. Insulin sensitivity was measured using piled on the basis of function, Mootha et a hyperinsulinemic-euglycemic clamp. Mitochondrial function was assessed by measuring max- al. (1) showed decreased maximal aerobic O imal aerobic capacity (VO2max) and expression of oxidative phosphorylation genes in skeletal capacity (V 2max) and decreased expres- muscle. sion of mitochondrial genes involved in oxidative phosphorylation (OXPHOS) in RESULTS — A total of 45% of subjects had normal glucose tolerance, 20% had impaired men of Northern European descent with glucose tolerance, and 35% had type 2 diabetes.
  • Inactivation of Corticotropin- Releasing Hormone–Induced Insulinotropic Role by High- Altitude Hypoxia

    Inactivation of Corticotropin- Releasing Hormone–Induced Insulinotropic Role by High- Altitude Hypoxia

    Diabetes Volume 64, March 2015 785 Ke Hao,1 Fan-Ping Kong,1 Yu-Qi Gao,2 Jia-Wei Tang,1 Jian Chen,2 A. Mark Evans,3 Stafford L. Lightman,4 Xue-Qun Chen,1 and Ji-Zeng Du1 Inactivation of Corticotropin- Releasing Hormone–Induced Insulinotropic Role by High- Altitude Hypoxia Diabetes 2015;64:785–795 | DOI: 10.2337/db14-0500 We have shown that hypoxia reduces plasma insulin, dysfunction and illness, particularly acute mountain sick- which correlates with corticotropin-releasing hormone ness (AMS) (1). During the construction of the Qinghai- (CRH) receptor 1 (CRHR1) in rats, but the mechanism Tibet railway (at altitudes of 3,000–5,000 m) in China, remains unclear. Here, we report that hypobaric hypoxia at .100,000 construction workers were involved, and 51% an altitude of 5,000 m for 8 h enhances rat plasma CRH, of them developed AMS (2). Moreover, since the railway METABOLISM corticosterone, and glucose levels, whereas the plasma began service, .10 million travelers have visited the Tibet insulin and pancreatic ATP/ADP ratio is reduced. In islets region in 2012, of whom 31% developed AMS despite cultured under normoxia, CRH stimulated insulin release in traveling with an oxygen supply on the train (3). Increas- a glucose- and CRH-level–dependent manner by activat- ing CRHR1 and thus the cAMP-dependent protein kinase ing evidence in both humans and animals suggests that pathway and calcium influx through L-type channels. In exposure to either high-altitude or hypobaric hypoxia fl islets cultured under hypoxia, however, the insulinotropic in uences plasma insulin levels and glucose homeostasis, effect of CRH was inactivated due to reduced ATP and depending on the oxygen level and duration of exposure cAMP and coincident loss of intracellular calcium oscilla- (4–9).
  • Insulin-Like Growth Factor II Stimulates Motor Nerve Regeneration (Somatomedin/Sdatic Nerve/Axon/Neurotropiuc/Neurite) STEPHANIE L

    Insulin-Like Growth Factor II Stimulates Motor Nerve Regeneration (Somatomedin/Sdatic Nerve/Axon/Neurotropiuc/Neurite) STEPHANIE L

    Proc. Nati. Acad. Sci. USA Vol. 89, pp. 11716-11720, December 1992 Neurobiology Insulin-like growth factor II stimulates motor nerve regeneration (somatomedin/sdatic nerve/axon/neurotropiuc/neurite) STEPHANIE L. NEAR*, L. RAYMOND WHALEN*, JAMES A. MILLERt, AND DOUGLAS N. ISHII0§ Departments of *Anatomy and Neurobiology, *Physiology, and §Biochemistry, Colorado State University, Fort Collins, CO 80523; and tAmgen Inc., Thousand Oaks, CA 91320 Communicated by Dale Purves, September 14, 1992 (receivedfor review, June 17, 1992) ABSTRACT Injury to mammalian motor nerves can lead can increase the regeneration of motor axons in vivo and (ii) to paralysis, but relatively succul regeneration may occur endogenous IGFs contribute to the spontaneous regeneration when conditions are favorable. Elucidation of the mcanism of motor axons. A positive finding for hypothesis i is poten- upholding successful regeneration is of theoretical and clincal tially ofclinical significance, irrespective ofwhether hypoth- interest. In this study, the hypothesis that insulin-like growth esis ii is validated. factor H (IGF-ll) can stimulate motor nerve regeneration was tested. When IGF-H was infused continuously near a site of MATERIALS AND METHODS crush on the sciatic nerve, the distance of motor axon regen- eration was increased snlfcantly in rats. In contrast, spon- Materials. Recombinant human IGF-II (Amgen) was >97% taneous regeneration was inhibited when an anti-IGF-H anti- pure based on HPLC; only a single band was visible on serum was infused through a "window" in the epineurium. reducing SDS/PAGE. To produce antiserum, 0.3 mg of Thus, infused IGF-il can increase, and endogenous IGFs can keyhole limpet hemocyanin was added to 50 pg of IGF-II in support, the regeneration of motor axons in lesioned nerves.
  • Advances in Insulin Treatment Over the Past Century

    Advances in Insulin Treatment Over the Past Century

    ADVANCES IN INSULIN TREATMENT OVER THE PAST CENTURY Although insulin carries the same name it did 100 years ago, it is far from the same treatment. Three distinct eras— animal insulins, synthetic human insulins and insulin analogs—make up the rich history of insulin treatments. Diabetes Treatment Approaches Insulin is a naturally occurring hormone secreted by the pancreas that helps people properly absorb sugar. Patients with diabetes cannot make insulin (Type 1) or do not produce enough insulin and/or do respond properly to insulin (Type 2). In 1922, researchers discovered how to extract insulin from animal pancreases for safe use in humans. It took another 80 years for researchers to discover how to synthesize human insulins and alter them at the molecular level to resemble natural insulin release. Insulin treatments generally fall into two categories: • Basal insulins provide a long-acting background level of insulin in the body throughout the day and are often administered once a day. • Bolus insulins are more rapid acting and are administered at meals or other instances where blood glucose may be high. Insulin dependence varies widely, but patients requiring daily insulin injections often administer long-acting basal insulin for coverage throughout the day and supplement that with bolus insulins to regulate spikes. THE RICH HISTORY OF INSULIN ADVANCEMENTS The Animal Insulin Era: 1922 to 1970s BEFORE 1922: The only available treatment is With the discovery of a viable method of using a “starvation diet” and animal insulin in humans in 1922, life expectancy patients with diabetes 1922: Banting and colleagues for diabetes patients dramatically improved.