Alteration in Phosphorylation of P20 Is Associated With Insulin Resistance Yu Wang,1 Aimin Xu,1 Jiming Ye,2 Edward W. Kraegen,2 Cynthia A. Tse,1 and Garth J.S. Cooper1,3 We have recently identified a small phosphoprotein, P20, insulin action, such as the activation of insulin receptors, as a common intracellular target for insulin and several postreceptor signal transduction, and the glucose trans- of its antagonists, including amylin, epinephrine, and cal- port effector system, have been implicated in this disease citonin gene-related peptide. These hormones elicit phos- (3,4). Defective insulin receptor kinase activity, reduced phorylation of P20 at its different sites, producing three insulin receptor substrate-1 tyrosine phosphorylation, and phosphorylated isoforms: S1 with an isoelectric point (pI) decreased phosphatidylinositol (PI)-3 kinase activity were value of 6.0, S2 with a pI value of 5.9, and S3 with a pI observed in both human type 2 diabetic patients as well as value of 5.6 (FEBS Letters 457:149–152 and 462:25–30, animal models, such as ob/ob mice (5,6). 1999). In the current study, we showed that P20 is one In addition to the intrinsic defects of the insulin receptor of the most abundant phosphoproteins in rat extensor digitorum longus (EDL) muscle. Insulin and amylin an- and postreceptor signaling components, other circulating tagonize each other’s actions in the phosphorylation of factors, such as tumor necrosis factor-␣, leptin, free fatty this protein in rat EDL muscle. Insulin inhibits amylin- acids, and amylin, may also contribute to the pathogenesis evoked phosphorylation of S2 and S3, whereas amylin of insulin resistance (7–11). For example, amylin, a hor- decreases insulin-induced phosphorylation of S1. In rats mone co-secreted with insulin from pancreatic islet made insulin resistant by dexamethasone treatment, lev- ␤-cells, has been shown to antagonize insulin’s metabolic els of the phosphoisoforms S2 and S3, which were barely actions both in vivo and in vitro (12–16). It can inhibit detectable in healthy rats in the absence of hormone insulin-stimulated glucose uptake and glycogen synthesis. stimulation, were significantly increased. Moreover, the In vivo administration of amylin results in hyperglycemia ability of insulin to inhibit amylin-evoked phosphoryla- and induced insulin resistance similar to that observed in tion of these two isoforms was greatly attenuated. These results suggested that alterations in the phosphoryla- type 2 diabetes. Although some earlier studies have sug- tion of P20 might be associated with insulin resistance gested that amylin’s biological effects on fuel metabolism and that P20 could serve as a useful marker to dissect were only of pharmacological interest, more recent in vivo the cellular mechanisms of this disease. Diabetes 50: studies with an amylin-selective antagonist have strongly 1821–1827, 2001 supported its physiological relevance (17). Moreover, amy- lin-deficient mice have shown increased insulin respon- siveness and more rapid blood glucose elimination after glucose loading, further confirming the role of amylin in nsulin resistance is characterized by diminished causing insulin resistance (18). Indeed, elevated levels of insulin sensitivity of target tissues, including liver, circulating amylin (hyperamylinemia) and an increased skeletal muscle, and adipocytes (1). It is a key factor ratio of amylin to insulin have been observed in patients Iin the pathogenesis of type 2 diabetes and is also with type 2 diabetes and other diseases associated with associated with other pathological states, such as obesity, insulin resistance, such as obesity and glucose intolerance dyslipidemia, hyperinsulinemia, hypertension, and cardio- (19). vascular disease. These clustering metabolic defects have Despite these advances, the detailed cellular mechanisms been termed “syndrome X” or “the insulin-resistance syn- of insulin resistance are far from clear. Recent studies that drome” (2). have used genetic approaches to identify specific genes The molecular basis of insulin resistance is extremely that account for the genetic predisposition to this disease complex and multifactorial. Defects in several steps of have been generally unrewarding (4,20–22). We recently used comparative proteomic analysis to systematically in- vestigate the phosphorylation cascades evoked by insulin From the 1School of Biological Sciences, University of Auckland, Auckland, and its antagonists in rat skeletal muscle and identified a New Zealand; the 2Garvan Institute of Medical Research, Sydney, Australia; and the 3Department of Medicine, School of Medicine, University of Auckland, novel phosphoprotein, P20, as the common intracellular Auckland, New Zealand. target of these hormones (23,24). Insulin and its antag- Address correspondence and reprint requests to Garth J.S. Cooper, Level 4, onistic hormones amylin, epinephrine, and calcitonin School of Biological Sciences, University of Auckland, Private Bag 92019, Auckland, New Zealand. E-mail: [email protected]. gene-related peptide (CGRP), through distinctive signaling Received for publication 16 October 2000 and accepted in revised form 17 pathways, phosphorylate P20 at different serine residues April 2001. CGRP, calcitonin gene-related peptide; 2-DE, two-dimensional gel electro- to produce multiple phosphoisoforms of this protein. In phoresis; DMEM, Dulbecco’s modified Eagle’s medium; ECL, enhanced chemi- this study, we demonstrated that P20 in skeletal muscle luminescence; EDL, extensor digitorum longus; GLUT4myc, myc-tagged from insulin-resistant diabetic rats has an abnormal phos- GLUT4; HSP, heat shock protein; KHB, Krebs-Henseleit buffer; OD, optical density; pI, isoelectric point; PI, phosphatidylinositol; PSL, photostimulated phorylation pattern, although the expression level of this luminescence; VOL, a feature’s volume. protein is not changed. Moreover, the responsiveness of DIABETES, VOL. 50, AUGUST 2001 1821 PHOSPHOPROTEIN P20 AND INSULIN RESISTANCE P20 to insulin and amylin is also altered in insulin-resistant CCGGGATCCCTACTTGGCAGCAGGTGGTGAC3Ј. The resulting clone was animals. We propose that P20 may serve as a useful marker validated by DNA sequencing and then inserted into the multiple cloning site of cytomegalovirus promoter-driven eukaryotic expression vector pcDNA3.1 for investigating the mechanisms of insulin resistance. (referred to as pcDNA.P20). L6 myoblast cells were transfected with pCXN2-GLUT4myc (27) or co- transfected with pCXN2-GLUT4myc and pcDNA.P20 using Lipofectamine Plus RESEARCH DESIGN AND METHODS reagent (Life Technology) according to the manufacturer’s instructions. Materials. Male Wistar rats were fed standard rat diet (NRM Diet 86, Tegel, Stable transfectants were selected in medium containing the neomycin ana- Auckland, New Zealand) with water ad libitum. [32P]orthophosphate and logue G418 at 400 ␮g/ml. At 10 days after transfection, the clones were D-[U-14C]glucose were purchased from ICN. 2-deoxy-D-[3H]glucose (1 mCi/ml) selected using sterilized steel rings and expanded separately in the presence was obtained from DuPont-NEN and 125I was obtained from Amersham of G418. Clones that expressed P20 and GLUT4myc were chosen by Western Pharmacia. Human insulin (Actrapid) was obtained from Novo Nordisk. Rat blotting and used for further experiments. amylin and CGRP were purchased from Bachem (Torrance, CA); epinephrine Western blotting. Proteins (ϳ50 ␮g) from liver, heart, epididymal fat pad, was from David Bull Laboratories; and dexamethasone was from Sigma. The aortic smooth muscle, EDL muscle, soleus muscle tissue, and whole blood two-dimensional gel electrophoresis (2-DE) system and reagents were ob- obtained from 18 hϪfasted male Wistar rats were separated by SDS-PAGE and tained from Pharmacia. Anti-P20 polyclonal antibody was a generous gift from subsequently transferred to nitrocellulose membranes. The membranes were Dr. Kanefusa Kato (25). Anti-GLUT4 (H-61) was obtained from Santa Cruz blocked overnight at 4°C and then incubated with rabbit anti-P20 poly- Biotechnology. The enhanced chemiluminescence (ECL) detection system clonal antibody (1:1,000) for2hatroom temperature. After incubation with was from Roche Molecular Biochemicals. The total cellular RNA extraction streptavidin-biotinylated horseradish-peroxidaseϪconjugated secondary anti- reagent (TRIZOL), G418, Lipofectamine Plus reagent, and random priming body for another hour at room temperature, the proteins immunoreactive to labeling kits were from Life Technology. pCXN2-GLUT4myc, which expresses the primary antibody were visualized by ECL detection according to the myc-tagged GLUT4 (GLUT4myc) in mammalian cells, was kindly provided by manufacturer’s instructions. Dr. David James (University of Queensland, Australia). Northern blot analysis. Total cellular RNA was isolated from EDL muscle of Establishment of the dexamethasone- or high fat؊induced rat models 18 hϪfasted control and dexamethasone-treated rats using TRIZOL reagent of insulin resistance. All experimental protocols were approved by the (Life Technology). Then, 15 ␮g of RNA from each sample were separated Institutional Animal Ethics Committee. Male Wistar rats were injected with by 1.5% agarose-formaldehyde gel electrophoresis and subsequently trans- Ϫ Ϫ dexamethasone (3.1 mg ⅐ kg 1 ⅐ day 1, i.p.) for 7 days. The weight of rats in ferred to Hybond-Nϩ nylon membranes (Amersham Pharmacia Biotech, both control and dexamethasone-treated groups were monitored daily. By the Uppsala, Sweden)