DOCSLIB.ORG

A Micro‑Peptide Encoded by HOXB‑AS3 Promotes the Proliferation And

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
A Micro‑Peptide Encoded by HOXB‑AS3 Promotes the Proliferation And ONCOLOGY LETTERS 22: 697, 2021 A micro‑peptide encoded by HOXB‑AS3 promotes the proliferation and viability of oral squamous cell carcinoma cell lines by directly binding with IGF2BP2 to stabilize c‑Myc FEI LENG, YAN‑YU MIU, YI ZHANG, HAO LUO, XIAO‑LI LU, HUI CHENG and ZHI‑GUO ZHENG The Affiliated Stomatological Hospital of Nanchang University, The Key Laboratory of Oral Biomedicine, Nanchang, Jiangxi 330006, P.R. China Received April 17, 2021; Accepted June 18, 2021 DOI: 10.3892/ol.2021.12958 Abstract. HOXB‑AS3 is a long non‑coding RNA and that increased HOXB‑AS3 expression was associated with recent studies have shown that the HOXB‑AS3‑encoded poor prognosis in OSCC. This indicated that HOXB‑AS3 and micro‑peptide was associated with the progression of colon its encoded protein promoted OSCC cell proliferation and cancer tumorigenesis; however, the biofunction of HOXB‑AS3 viability by maintaining c‑Myc mRNA stability by directly varies in different types of cancer and the potential function in binding to IGF2BP2. oral squamous cell carcinoma (OSCC) is still unknown. The Cancer Genome Atlas (TCGA) database was searched and the Introduction expression patterns of HOXB‑AS3 in head and neck carci‑ noma were analyzed. Reverse transcription‑quantitative PCR Oral cancer is the 6th most common malignancy worldwide and and western blot analysis was used to measure the mRNA oral squamous cell carcinoma (OSCC) represents 90% of all and protein expression level of HOXB‑AS3 in patients with cancer cases (1). The current therapy is only effective for early OSCC, respectively. Next, HOXB‑AS3 was knocked down stage OSCC, and the 5‑year overall survival rate was <50% in in 2 OSCC cell lines to investigate the biological function 2020 (2). Studies have indicated that tobacco addiction, exces‑ of the HOXB‑AS3‑encoded protein using a Cell Counting sive alcohol consumption and human papillomavirus (HPV) Kit‑8 and colony formation assays. To further identify the infection are the main risk factors for tumorigenesis and the potential mechanism of the HOXB‑AS3‑encoded protein, development of OSCC (3). Current targeted therapies, such as co‑immunoprecipitation was also used to detect the interaction targeting PD1/PDL1, are far from satisfactory (4); therefore; between HOXB‑AS3 and IGF2BP2, while HOXB‑AS3 was new predictive biomarkers and therapeutic targets are urgently re‑expressed to determine whether the HOXB‑AS3‑encoded required. protein and not HOXB‑AS3 exerted its function in OSCC. Long non‑coding (lnc)RNAs are 200 nucleotides HOXB‑AS3 was upregulated in OSCC tissues, in both TCGA in length (5). With the application of high‑throughput database and in patients with OSCC recruited into the present sequencing, lncRNAs have been reported to be associated study. HOXB‑AS3 was associated with poor prognosis in with the progression of numerous types of cancer. Rs6695584 OSCC. The proliferation and viability decreased in the 2 OSCC single nucleotide polymorphism‑induced lncRNA‑SLCC1 cell lines following knock down of HOXB‑AS3. HOXB‑AS3 drove colorectal cancer by activating glycolysis signaling (6). was also found to encode a protein that directly interacted lncRNA lnc030 maintained breast cancer stemness by stabi‑ with IGF2BP2 and thereby promoted the stability of c‑myc. lizing SQLE mRNA and therefore promoted cholesterol Taken together, the results from the present study indicated synthesis (7). lncRNA CRNDE attenuated chemoresistance in gastric cancer by SRSF6‑regulated alternative splicing of PICALM (8). HOXB‑AS3 was previously reported to encode a micro‑peptide and to suppress tumor progression in colon cancer (9). However, biofunction varies in different types of Correspondence to: Professor Zhi‑Guo Zheng, The Affiliated cancer (10,11). Its potential function and underlying mecha‑ Stomatological Hospital of Nanchang University, The Key nism in OSCC are still unknown. Laboratory of Oral Biomedicine, 49 Fuzhou Road, Nanchang, Jiangxi 330006, P.R. China In the present study, the expression level of HOXB‑AS3 E‑mail: [email protected] in patients with OSCC was analyzed and its biological func‑ tions and underlying mechanism in OSCC cell lines was Key words: lncRNA, HOXB‑AS3, OSCC, proliferation, c‑Myc, also investigated. The results demonstrated, to the best of IGF2BP2 knowledge, for the first time that HOXB‑AS3 and its encoded protein were upregulated in OSCC tumors. Knocking down HOXB‑AS3 repressed OSCC cell proliferation and viability, 2 LENG et al: HOXB‑AS3 PROMOTES THE PROGRESSION OF OSCC and a Co‑immunoprecipitation (IP) assay indicated that the TCC CTC CAA AAT ‑3' and reverse 5'‑GGC TGT TGT CAT ACT HOXB‑AS3‑encoded protein interacted with IGF2BP2; there‑ TCT CAT GG‑3' and the expression level was normalized to the fore, stabilized c‑Myc. control (13). Materials and methods Cell culture and transfection. The Cal‑27 and UM2 cell lines were gifts from Professor Wang from the Department of Oral Patient information and clinical sample collection. Paired and Maxillofacial Surgery, Affiliated Hospital of Jiangxi OSCC samples and adjacent normal tissues were randomly University of Traditional Chinese Medicine (Jiangxi, China). collected from patients who underwent resection surgery at The cells were cultured with complete DMEM (cat. no. D0697; the Affiliated Stomatological Hospital of Nanchang University Sigma‑Aldrich; Merck KGaA) containing 10% fetal bovine (Jiangxi, China) between January 2012 and December 2013. The serum (cat. no. F8687; Invitrogen; Thermo Fisher Scientific, following inclusion criteria was used: Diagnosed with OSCC Inc.) and 1% penicillin/streptomycin (cat. no. V900929; by pathologists between January 2012 and December 2013 at Sigma‑Aldrich; Merck KGaA). the Affiliated Stomatological Hospital of Nanchang University. To establish a stable cell line, lentivirus was obtained from Patients with metastasis were excluded. A total of 20 cases GenScript, and the following short hairpin (sh)RNAs were (age range, 42‑68 years; 15 male and 5 female) were divided used in pCDH‑CMV‑MCS‑EF1 + Puro (SBI pCD513B‑1): into 4 groups, according to their clinical features and the TNM Scrambled negative control (NC) 5'‑GTA CCT ACG TA‑3', stage system (12). There were 5 patients with stage I, 3 patients shRNA1, 5'‑CCA TCC AAG TCT A‑3' and shRNA2, 5'‑TAA with stage II, 8 patients with stage III and 4 cases with stage 4. TGC AGC GTA AG‑3'. ORF, the open read frame of HOXB‑AS3 Adjacent normal tissues were collected >5 cm from the tumor encoding the protein but not the whole lncRNA. Plasmids site and confirmed by a pathologist as normal tissue. All the (4 µg) were co‑transfected with packaging vectors psPAX2 OSCC tissue samples were confirmed by pathology. The (Addgene, Inc.) (1 µg) and pMD2G (Addgene, Inc.) (3 µg) into present study was approved by the Ethics Committee of The 293T (cat. no. CRL‑11268; ATCC) cells for lentivirus produc‑ Affiliated Stomatological Hospital of Nanchang University tion using Lipofectamine 3000® (Thermo Fisher Scientific (Jiangxi, China). The clinical samples were collected from Inc.) in accordance to the manufacturer's instructions. After patients following written informed consent. 72 h, the suspension was collected. The lentivirus was stored at 1x108/ml. The cells were seeded into the 6‑well plate with 40% Survival analysis. Using data from The Cancer Genome Atlas density and incubated overnight at 37˚C, following which 10 µl (TCGA) database, the time of the end point of each patient (12 MOI) each lentivirus was added into the corresponding was collected, this was defined as the survival end point of well and incubated at 37˚C for 3 days to successfully establish each patient, all the survival end points in of the whole cohort the stable cell line. No selection method was used due to the was defined as overall survival. The overall survival analysis high transfection rate. was thus automatically determined using the Gene Expression Profiling Interactive Analysis online tool by analyzing Western blot analysis. The cells were harvested and washed these data (gepia.cancer‑pku.cn) by inputing the gene name 3 times with ice cold PBS and lysed with RIPA buffer (HOXB‑AS3) and cancer type (OSCC), 519 patients were (cat. no. 20‑188; Sigma‑Aldrich; Merck KGaA). The protein enrolled and 44 normal tissues were collected. For the patients was quantified using the BCA kit (Beyotime Institute of recruited into the present study, the survival time was collected Biotechnology), according to the manufacturer's protocol. between 2012 and 2018. From the patients recruited into the Equal amounts of protein (40 µg/lane) were separated using present study, they were divided into 2 groups according to 12% SDS‑PAGE, then transferred onto a PVF membrane and the mean mRNA expression (3.56) and Kaplan‑Meier survival blocked with 5% skimmed milk for 1 h at room temperature. analysis was performed and the GraphPad software v.7.0 The membranes were subsequently incubated with the primary (GraphPad Software, Inc.). antibodies overnight at 4˚C, washed with 0.1% TBS‑Tween‑20, then incubated with the donkey anti mouse/rabbit secondary Reverse transcription‑quantitative analysis (RT‑qPCR) antibody (1:10,000; cat. no. 5724; KPL, Inc.) for 1 h at room analysis. Tissues and cells were harvested and lysed using temperature. The target proteins were detected using an ECL TRIzol® (cat. no. 93289; Sigma‑Aldrich; Merck KGaA) (EMD Millipore) kit. The following primary antibodies were following the manufacturer's protocol. After purification and used: HOXB‑AS3 (1:1,000; cat. no. SBSN250; Genscript), reverse transcription (60˚C for 5 min, 37˚C for 15 min and β‑actin (cat. no. 3700; 1:1,000; Cell Signaling Technology, 85˚C for 5 sec) cDNA was collected. Specific primers were Inc.), IGF2BP2 (cat. no. ab109284; 1:1,000; Abcam), and used for qPCR using the SYBR‑Green RT‑PCR system with c‑Myc (cat.
Load more

Recommended publications
  • Analysis of Polycomb Repressive Complexes Binding Dynamics During Limb Development Reveals the Prevalence of PRC2-Independent PRC1 Occupancy
    bioRxiv preprint doi: https://doi.org/10.1101/2020.09.21.306688; this version posted September 21, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Analysis of Polycomb Repressive Complexes binding dynamics during limb development reveals the prevalence of PRC2-independent PRC1 occupancy Claudia Gentile1,2,#, Alexandre Mayran3,~, Fanny Guerard-Millet1, and Marie Kmita1,2,4,5* 1Genetics and Development Research Unit, Institut de Recherches Cliniques de Montréal, Montréal, Québec, Canada. 2Department of Experimental Medicine, McGill University, Montréal, Québec, Canada 3Molecular Genetics Research Unit, Institut de Recherches Cliniques de Montréal, Montréal, Québec, Canada 4Department of Medicine, Université de Montréal, Montreal, Quebec, Canada 5Lead Contact #Present address: Department of Pediatric Oncology, Dana-Farber Cancer Institute and Harvard Medical School, Boston, MA 02215, USA ~Present address: School of Life Sciences, Federal Institute of Technology, Lausanne, Lausanne 1015, Switzerland *Corresponding author: Marie Kmita Email: [email protected] Tel: (1) 514-987-5749 bioRxiv preprint doi: https://doi.org/10.1101/2020.09.21.306688; this version posted September 21, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract The Polycomb group (PcG) proteins are key players in the regulation of tissue-specific gene expression through their known ability to epigenetically silence developmental genes. The PcG proteins form two multicomponent complexes, Polycomb Repressive Complex 1 and 2 (PRC1 and PRC2), whereby the hierarchical model of recruitment postulates that PRC2 triggers the trimethylation of Histone H3 lysine 27 (H3K27me3) leading to the recruitment of PRC1.
    [Show full text]
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
    [Show full text]
  • A Novel Role for Lbx1 in Xenopus Hypaxial Myogenesis
    RESEARCH ARTICLE 195 Development 133, 195-208 doi:10.1242/dev.02183 A novel role for lbx1 in Xenopus hypaxial myogenesis Benjamin L. Martin and Richard M. Harland* We have examined lbx1 expression in early X. laevis tadpoles. In contrast to amniotes, lbx1 is expressed in all of the myoblasts that contribute to the body wall musculature, as well as in a group of cells that migrate into the head. Despite this different expression, the function of lbx1 appears to be conserved. Morpholino (MO) knockdown of lbx1 causes a specific reduction of body wall muscles and hypoglossal muscles originating from the somites. Although myoblast migratory defects are observed in antisense MO injected tadpoles targeting lbx1, this results at least in part from a lack of myoblast proliferation in the hypaxial muscle domain. Conversely, overexpression of lbx1 mRNA results in enlarged somites, an increase in cell proliferation, but a lack of differentiated muscle. The control of cell proliferation is linked to a strong downregulation of myoD expression in gain-of-function experiments. Co-injection of myoD mRNA with lbx1 mRNA eliminates the overproliferation phenotype observed when lbx1 is injected alone. The results indicate that a primary function of lbx1 in hypaxial muscle development is to repress myoD, allowing myoblasts to proliferate before the eventual onset of terminal differentiation. KEY WORDS: Hypaxial, Rectus abdominus, Rectus cervicus, Geniohyoideus, lbx1, myoD, myf5, Xenopus laevis, Cell proliferation, Myogenesis INTRODUCTION The expression of myf5, a muscle regulatory factor (MRF), is similar The ladybird homeobox (lbx1) gene is a member of the NK-class of to that of pax3 in the hypaxial myoblasts.
    [Show full text]
  • Characterization of Human-Ipscs Derived Spinal Motor Neurons by Single
    bioRxiv preprint doi: https://doi.org/10.1101/2019.12.28.889972; this version posted December 28, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Characterization of human-iPSCs derived spinal motor neurons by single- cell RNA sequencing Louise Thiry1, Regan Hamel2, Stefano Pluchino2, Thomas Durcan1,3, Stefano Stifani1* 1Department of Neurology and Neurosurgery, Montreal Neurological Institute-Hospital, McGill University, 3801, rue University, Montreal (Quebec) H3A 2B4, Canada 2Department of Clinical Neurosciences, Clifford Allbutt Building - Cambridge Biosciences Campus and NIHR Biomedical Research Centre, University of Cambridge, Hills Road, CB2 0HA Cambridge, UK 3Early Drug Discovery Unit, Montreal Neurological Institute-Hospital *Corresponding author: [email protected] 1 bioRxiv preprint doi: https://doi.org/10.1101/2019.12.28.889972; this version posted December 28, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract Human induced pluripotent stem cells (iPSCs) offer the opportunity to generate specific cell types from healthy and diseased individuals, allowing the study of mechanisms of early human development, modelling a variety of human diseases, and facilitating the development of new therapeutics. Human iPSC-based applications are often limited by the variability among iPSC lines originating from a single donor, as well as the heterogeneity among specific cell types that can be derived from iPSCs. The ability to deeply phenotype different iPSC-derived cell types is therefore of primary importance to the successful and informative application of this technology.
    [Show full text]
  • Lbx1 Acts As a Selector Gene in the Fate Determination of Somatosensory and Viscerosensory Relay Neurons in the Hindbrain
    4902 • The Journal of Neuroscience, May 2, 2007 • 27(18):4902–4909 Development/Plasticity/Repair Lbx1 Acts as a Selector Gene in the Fate Determination of Somatosensory and Viscerosensory Relay Neurons in the Hindbrain Martin A. Sieber,1* Robert Storm,1* Margaret Martinez-de-la-Torre,2 Thomas Mu¨ller,1 Hagen Wende,1 Katja Reuter,1 Elena Vasyutina,1 and Carmen Birchmeier1 1Department of Neuroscience, Max-Delbru¨ck-Center for Molecular Medicine, 13125 Berlin, Germany, and 2Department of Human Anatomy and Psychobiology, University of Murcia, 30100 Murcia, Spain Distinct types of relay neurons in the hindbrain process somatosensory or viscerosensory information. How neurons choose between these two fates is unclear. We show here that the homeobox gene Lbx1 is essential for imposing a somatosensory fate on relay neurons in the hindbrain. In Lbx1 mutant mice, viscerosensory relay neurons are specified at the expense of somatosensory relay neurons. Thus Lbx1 expression distinguishes between the somatosensory or viscerosensory fate of relay neurons. Key words: neuronal specification; homeobox gene; nucleus of the solitary tract; spinal trigeminal nucleus; genetic lineage tracing; development Introduction following prospective NTS neurons during their development Hindbrain neurons receive viscerosensory and somatosensory and migration. The Phox2bϩ viscerosensory neurons express, in information from the periphery and integrate and relay this in- addition, Tlx3 and Lmx1b and are known to require Tlx3 for their formation. Neurons that receive somatosensory information of development (Qian et al., 2001, 2002; Cheng et al., 2004). These the face locate to the spinal trigeminal nucleus (SpV), whereas the neurons arise from a Mash1ϩ progenitor domain and are gener- major relay station for visceral sensory information is the nucleus ated delayed and at reduced numbers in Mash1 mutant mice of the solitary tract (NTS) (Blessing, 1997; Qian et al., 2002).
    [Show full text]
  • Lbx1 Controls Limb Muscle Precursor Migration
    Development 127, 413-424 (2000) 413 Printed in Great Britain © The Company of Biologists Limited 2000 DEV1499 Lbx1 is required for muscle precursor migration along a lateral pathway into the limb Michael K. Gross1,*, Laura Moran-Rivard2,*, Tomoko Velasquez1, Martin N. Nakatsu1, Krzysztof Jagla3 and Martyn Goulding2,‡ 1Molecular Neurobiology Laboratory, The Salk Institute, 10010 North Torrey Pines Rd, La Jolla, CA 92037, USA 2Biology Graduate Program, University of California, San Diego, La Jolla, CA 92093, USA 3INSERM U. 384, 63001 Clermont-Ferrand, France *These two authors contributed equally to this work ‡Author for correspondence (e-mail: [email protected]) Accepted 5 November; published on WWW 20 December 1999 SUMMARY In mammalian embryos, myogenic precursor cells emigrate that Lbx1 is not required for the specification of particular from the ventral lip of the dermomyotome and colonize the limb muscles, and the muscle defects that occur in Lbx1−/− limbs, tongue and diaphragm where they differentiate and mice can be solely attributed to changes in muscle precursor form skeletal muscle. Previous studies have shown that migration. c-Met is expressed in Lbx1 mutant mice and Pax3, together with the c-Met receptor tyrosine kinase and limb muscle precursors delaminate from the ventral its ligand Scatter Factor (SF) are necessary for the dermomyotome but fail to migrate laterally into the limb. migration of hypaxial muscle precursors in mice. Lbx1 and Muscle precursors still migrate ventrally and give rise to Pax3 are co-expressed in all migrating hypaxial muscle tongue, diaphragm and some limb muscles, demonstrating precursors, raising the possibility that Lbx1 regulates their Lbx1 is necessary for the lateral, but not ventral, migration migration.
    [Show full text]
  • Supplementary File Table S1
    Supplementary file Table S1 Grouping of Homeobox genes according to their main known function. Anatomical Structure Morphogenesis EN1, HOXC10, HOXC13, HOXD3, LBX1, SIX2, SIX4 Organ Morphogenesis CDX1, CDX2, HOXA11, HOXA13, ISL1, LHX1, PAX3, PDHX, PITX2, PITX3, PROX1, SIX6 Body Pattern Formation ALX3, EMX2, HHEX, HOXA11, HOXA2, HOXA4, HOXA5, HOXA6, HOXB1, HOXB5, HOXB6, HOXC5, HOXD10, HOXD8, LMX1B, PITX2 Ectoderm Development PROX1, VAX2 Endoderm Development HOXC11 Brain & Nervous System Development Brain Development ALX1, DLX2, EMX2 Nervous System Development: ARX, DLX5, DLX6, HOXD10, LBX1, LHX1, OTP, PAX3, PHOX2A, PHOX2B Skeletal Development: ALX3, ALX4, DLX3, DLX5, DLX6, EN1, HOXA11, HOXA13, HOXA2, HOXB6, HOXD10, HOXD13, MSX2 Muscle Development: BARX2, MKX, SIRT1, SIRT2, SIX1 Other Homeobox Genes Involved In BARX1, CDX4, CUX1, DLX1, EMX1, EN2, Multicellular Organismal HOXA1, HOXA7, HOXA9, HOXB13, HOXB2, Development: HOXB3, HOXB4, HOXB7, HOXB8, HOXB9, HOXC12, HOXC8, HOXC9, HOXD1, HOXD11, HOXD12, HOXD9, ISL2, LBX2, LMX1A, MEIS1, NKX3-1, OTX1, TLX1, VAX1, VSX1, VSX2 Homeobox Genes Involved In Cell ARX, EMX2, HHEX, HLX, HOPX, LBX1, LHX1, Differentiation: LMX1B, MIXL1, OTP, PHOX2A, SIRT1, VSX2 Other Genes: PHTF1, SIRT3, SIRT6, SIRT7, ZHX1, ZHX2 Homeobox genes include two subsets of genes coding for transcription factors involved in multiple functions. The clustered HOX genes are indicated in bold. Supplementary file Figure S2 5’ Spatial collinearity 3’ HOXA Chr. 7p15.3 HOXB Chr. 17q21.3 HOXC Chr. 12q13.3 HOXD Chr. 2q31 13 12 11 10 9 8 7 6 5 4 3 2 1 Paralogous HOX groups Distribution of the 39 human HOX genes in four clusters located in different chromosomal regions*. Blue indicates anterior HOX genes. Yellow, paralogy group 3 Hox genes, green and purple indicatete central HOX genes and Red the posterior HOX genes.
    [Show full text]
  • Hypermethylation of Human DNA: Fine-Tuning Transcription Associated with Development
    bioRxiv preprint doi: https://doi.org/10.1101/212191; this version posted October 31, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Hypermethylation of human DNA: Fine-tuning transcription associated with development Carl Baribault1,2, Kenneth C. Ehrlich3, V. K. Chaithanya Ponnaluri4, Sriharsa Pradhan4, Michelle Lacey2, and Melanie Ehrlich1,3,5* 1Tulane Cancer Center, Tulane University Health Sciences Center, New Orleans, LA 70112, USA. 2Department of Mathematics, Tulane University, New Orleans, LA 70118, USA. 3Center for Bioinformatics and Genomics, Tulane University Health Sciences Center. 4 New England Biolabs, Ipswich, MA 01938, USA. 5Hayward Genetics Center Tulane University Health Sciences Center, New Orleans, LA 70112, USA. *Correspondence: [email protected] Email addresses of other authors: [email protected] , [email protected] , [email protected], [email protected], [email protected] , and [email protected] Key words: DNA methylation, chromatin, development, epigenetic memory, CTCF, NR2F2 (COUP-TFII), NKX2-5, LXN (Latexin), EN1, and PAX3 1 bioRxiv preprint doi: https://doi.org/10.1101/212191; this version posted October 31, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract Tissue-specific gene transcription can be affected by DNA methylation in ways that are difficult to discern from studies focused on genome-wide analyses of differentially methylated regions (DMRs). We studied 95 genes in detail using available epigenetic and transcription databases to detect and elucidate less obvious associations between development-linked hypermethylated DMRs in myoblasts (Mb) and cell- and tissue- specific expression.
    [Show full text]
  • (12) Patent Application Publication (10) Pub. No.: US 2009/0269772 A1 Califano Et Al
    US 20090269772A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2009/0269772 A1 Califano et al. (43) Pub. Date: Oct. 29, 2009 (54) SYSTEMS AND METHODS FOR Publication Classification IDENTIFYING COMBINATIONS OF (51) Int. Cl. COMPOUNDS OF THERAPEUTIC INTEREST CI2O I/68 (2006.01) CI2O 1/02 (2006.01) (76) Inventors: Andrea Califano, New York, NY G06N 5/02 (2006.01) (US); Riccardo Dalla-Favera, New (52) U.S. Cl. ........... 435/6: 435/29: 706/54; 707/E17.014 York, NY (US); Owen A. (57) ABSTRACT O'Connor, New York, NY (US) Systems, methods, and apparatus for searching for a combi nation of compounds of therapeutic interest are provided. Correspondence Address: Cell-based assays are performed, each cell-based assay JONES DAY exposing a different sample of cells to a different compound 222 EAST 41ST ST in a plurality of compounds. From the cell-based assays, a NEW YORK, NY 10017 (US) Subset of the tested compounds is selected. For each respec tive compound in the Subset, a molecular abundance profile from cells exposed to the respective compound is measured. (21) Appl. No.: 12/432,579 Targets of transcription factors and post-translational modu lators of transcription factor activity are inferred from the (22) Filed: Apr. 29, 2009 molecular abundance profile data using information theoretic measures. This data is used to construct an interaction net Related U.S. Application Data work. Variances in edges in the interaction network are used to determine the drug activity profile of compounds in the (60) Provisional application No. 61/048.875, filed on Apr.
    [Show full text]
  • MLL1 Is Required for PAX7 Expression and Satellite Cell Self-Renewal in Mice
    ARTICLE https://doi.org/10.1038/s41467-019-12086-9 OPEN MLL1 is required for PAX7 expression and satellite cell self-renewal in mice Gregory C. Addicks 1,2,6, Caroline E. Brun1,2,6, Marie-Claude Sincennes1,2, John Saber1,2, Christopher J. Porter3, A. Francis Stewart4, Patricia Ernst5 & Michael A. Rudnicki 1,2 PAX7 is a paired-homeobox transcription factor that specifies the myogenic identity of muscle stem cells and acts as a nodal factor by stimulating proliferation while inhibiting 1234567890():,; differentiation. We previously found that PAX7 recruits the H3K4 methyltransferases MLL1/2 to epigenetically activate target genes. Here we report that in the absence of Mll1, myoblasts exhibit reduced H3K4me3 at both Pax7 and Myf5 promoters and reduced Pax7 and Myf5 expression. Mll1-deficient myoblasts fail to proliferate but retain their differentiation potential, while deletion of Mll2 had no discernable effect. Re-expression of PAX7 in committed Mll1 cKO myoblasts restored H3K4me3 enrichment at the Myf5 promoter and Myf5 expression. Deletion of Mll1 in satellite cells reduced satellite cell proliferation and self-renewal, and significantly impaired skeletal muscle regeneration. Pax7 expression was unaffected in quiescent satellite cells but was markedly downregulated following satellite cell activation. Therefore, MLL1 is required for PAX7 expression and satellite cell function in vivo. Further- more, PAX7, but not MLL1, is required for Myf5 transcriptional activation in committed myoblasts. 1 Sprott Centre for Stem Cell Research, Regenerative Medicine Program, Ottawa Hospital Research Institute, Ottawa, ON K1H 8L6, Canada. 2 Department of Cellular and Molecular Medicine, Faculty of Medicine, University of Ottawa, Ottawa, ON K1H 8M5, Canada.
    [Show full text]
  • Characterization of a Novel Lbx1 Mouse Loss of Function Strain
    bioRxiv preprint doi: https://doi.org/10.1101/2021.08.25.457618; this version posted August 25, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 1 2 3 Characterization of a novel Lbx1 mouse loss of function strain 4 5 6 Lyvianne Decourtye, Jeremy A. McCallum-Loudeac, Sylvia Zellhuber-McMillan, Emma Young, 7 Kathleen J. Sircombe, Megan J. Wilson* 8 9 10 11 Department of Anatomy, Otago School of Medical Sciences, University of Otago, 9054 12 Dunedin, New Zealand 13 14 15 16 *Corresponding author: 17 Email: [email protected] Phone: +64 347 046 95 18 19 20 1 bioRxiv preprint doi: https://doi.org/10.1101/2021.08.25.457618; this version posted August 25, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 1 Abstract 2 Adolescent Idiopathic Scoliosis (AIS) is the most common type of spine deformity affecting 2- 3 3% of the population worldwide. The etiology of this disease is still poorly understood. Several 4 GWAS studies have identified single nucleotide polymorphisms (SNPs) located near the gene 5 LBX1 that is significantly correlated with AIS risk. LBX1 is a transcription factor with roles in 6 myocyte precursor migration, cardiac neural crest specification, and neuronal fate 7 determination in the neural tube. Here, we further investigated the role of LBX1 in the 8 developing spinal cord of mouse embryos using a CRISPR-generated mouse model expressing 9 a truncated version of LBX1 (Lbx1Δ).
    [Show full text]
  • Studying the Foxp Genes in the Spinal Cord
    UC San Diego UC San Diego Electronic Theses and Dissertations Title FoxP genes subdivide interneuron subclasses in the developing mouse spinal cord Permalink https://escholarship.org/uc/item/81z6h0q6 Author Wong, Timothy Tin Heng Publication Date 2009 Peer reviewed|Thesis/dissertation eScholarship.org Powered by the California Digital Library University of California UNIVERSITY OF CALIFORNIA, SAN DIEGO FoxP Genes Subdivide Interneuron Subclasses in the Developing Mouse Spinal Cord A Thesis submitted in partial satisfaction of the requirements for the degree Master of Science in Biology by Timothy Tin Heng Wong Committee in charge: Professor Martyn D. Goulding, Chair Professor Nicholas Spitzer, Co-Chair Professor Eric Turner 2009 The Thesis of Timothy Tin Heng Wong is approved and it is acceptable in quality and form for publication on microfilm and electronically: Co-Chair Chair University of California, San Diego 2009 iii TABLE OF CONTENTS SIGNATURE PAGE ..........................................................................................................iii TABLE OF CONTENTS................................................................................................... iv LIST OF FIGURES AND TABLES ................................................................................... v ABSTRACT....................................................................................................................... vi INTRODUCTION .............................................................................................................
    [Show full text]