Lbx1 Controls Limb Muscle Precursor Migration

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Development 127, 413-424 (2000) 413 Printed in Great Britain © The Company of Biologists Limited 2000 DEV1499 Lbx1 is required for muscle precursor migration along a lateral pathway into the limb Michael K. Gross1,*, Laura Moran-Rivard2,*, Tomoko Velasquez1, Martin N. Nakatsu1, Krzysztof Jagla3 and Martyn Goulding2,‡ 1Molecular Neurobiology Laboratory, The Salk Institute, 10010 North Torrey Pines Rd, La Jolla, CA 92037, USA 2Biology Graduate Program, University of California, San Diego, La Jolla, CA 92093, USA 3INSERM U. 384, 63001 Clermont-Ferrand, France *These two authors contributed equally to this work ‡Author for correspondence (e-mail: [email protected]) Accepted 5 November; published on WWW 20 December 1999 SUMMARY In mammalian embryos, myogenic precursor cells emigrate that Lbx1 is not required for the specification of particular from the ventral lip of the dermomyotome and colonize the limb muscles, and the muscle defects that occur in Lbx1−/− limbs, tongue and diaphragm where they differentiate and mice can be solely attributed to changes in muscle precursor form skeletal muscle. Previous studies have shown that migration. c-Met is expressed in Lbx1 mutant mice and Pax3, together with the c-Met receptor tyrosine kinase and limb muscle precursors delaminate from the ventral its ligand Scatter Factor (SF) are necessary for the dermomyotome but fail to migrate laterally into the limb. migration of hypaxial muscle precursors in mice. Lbx1 and Muscle precursors still migrate ventrally and give rise to Pax3 are co-expressed in all migrating hypaxial muscle tongue, diaphragm and some limb muscles, demonstrating precursors, raising the possibility that Lbx1 regulates their Lbx1 is necessary for the lateral, but not ventral, migration migration. To examine the function of Lbx1 in muscle of hypaxial muscle precursors. These results suggest that development, we inactivated the Lbx1 gene by homologous Lbx1 regulates responsiveness to a lateral migration signal recombination. Mice lacking Lbx1 exhibit an extensive loss which emanates from the developing limb. of limb muscles, although some forelimb and hindlimb muscles are still present. The pattern of muscle loss suggests Key words: Lbx1, Pax3, Hypaxial muscles, Cell migration, Mouse INTRODUCTION 1997). The precursors for hypaxial muscles exhibit markedly different morphogenetic behaviours at different axial levels of The somitic mesoderm gives rise to multiple tissues in the the embryo. Cells in the ventral dermomyotome at limb and developing embryo including bone, connective tissue and cervical levels delaminate (Chevallier et al., 1977; Christ et al., muscle. Somites form as an epithelial ball of cells that later 1977; Christ and Ordahl, 1995; Mackenzie et al., 1998) and segregate into sclerotome and dermomyotome in response to undergo long range migration to form diaphragm, tongue patterning signals that arise from adjacent tissues (Dietrich et al., muscles and appendicular muscles. In contrast, hypaxial muscle 1993; Pourquie et al., 1993; Goulding et al., 1994; Fan and precursors at interlimb levels do not migrate. Instead, they retain Tessier-Lavigne, 1994; Munsterberg and Lassar, 1995). Cells in their epithelial morphology, forming a bud that extends ventrally the ventral half of the nascent somite undergo a transition from toward the midline to give rise to ventral body wall muscles epithelium to mesenchyme, forming the sclerotome, that (Parry, 1982; Christ et al., 1983). differentiates further to give rise to the axial skeleton. Cells in A number of genes that control the development and migration the dorsolateral half of the somite retain their epithelial of hypaxial muscles have been identified. Among these are the morphology, forming the dermomyotome, which contains paired domain transcription factor Pax3, which is expressed precursors for both the dermis and for skeletal muscles. throughout the dermomyotome, and c-Met, which is expressed Dermomyotome derived muscle precursors not only generate the in delaminating hypaxial muscle precursors (Bober et al., 1994; epaxial muscles that attach to the vertebral column, but also the Goulding et al., 1994; Williams and Ordahl, 1994). Analysis of hypaxial musculature of the limb, tongue, diaphragm and ventral Splotch (Sp, Pax3−) mutants shows Pax3 is required for the body wall (Christ and Ordahl, 1995). Whereas the epaxial normal development of all hypaxial muscles. Appendicular, muscles arise from cells in the medial dermomyotome, hypaxial tongue and diaphragm muscles are missing from homozygous Sp muscles are derived from precursors in the lateral half of the embryos, while the ventral body wall muscles are greatly reduced dermomyotome (Ordahl and Le Douarin, 1992; Denetclaw et al., in size (Franz et al., 1993; Tajbakhsh et al., 1997). The loss of 414 M. K. Gross and others appendicular muscles in Pax3 mutant embryos is primarily due MATERIALS AND METHODS to a failure of muscle precursors to migrate into the limb (Daston et al., 1996). However, Pax3 also regulates muscle cell Generation of knock-in mice differentiation (Maroto et al., 1997; Tajbakhsh et al., 1997) and The Lbx1 targeting vector was assembled using the pKSloxPNT vector the dysgenesis of all hypaxial muscles in Sp embryos, including (provided by A. Joyner) that contains HSV TK and lox-P flanked those that do not migrate, suggests Pax3 may also be required for Neomycin gene cassettes in a Bluescript KS backbone. Genomic the differentiation or survival of hypaxial muscle precursors. The sequences encompassing the mouse Lbx1 gene were isolated from a c-Met receptor tyrosine kinase is also expressed in migratory 129SV genomic phage library. The coding region of EGFP was cloned in frame into a NotI site at aa 62 of the mouse Lbx1 protein. A 4.1 kb muscle precursors, and mice lacking c-Met exhibit a muscle XhoI fragment containing EGFP-pA (upstream arm) and a 3.6 kb NotI phenotype that is similar to the Sp muscle phenotype, except that fragment (downstream arm) were cloned seperately into pKSloxPNT the ventral body wall muscles are still present (Bladt et al., 1995). to generate the Lbx1 targeting vector. A frameshift in the Lbx1 c-Met is expressed in the ventral lip of the dermomyotome as homeobox was created by filling in the BglII site in exon 2 of the muscle precursors are delaminating (Daston et al., 1996; Bladt et downstream arm prior to its insertion into the targeting vector. al., 1995). In c-Met mutant mice, muscle precursors fail to W9.5 embryonic stem cells were maintained on primary fibroblast delaminate, and the dermomyotomes remain elongated at limb feeder layers supplemented with LIF. 2×107 ES cells were levels (Dietrich et al., 1999). A similar phenotype is also seen in electroporated with 25 µg of the Lbx1 targeting vector after mice lacking Scatter Factor (SF), the ligand for c-Met (Bladt et linearization with SalI. Fifty clones were screened by Southern al., 1995; Dietrich et al., 1999). Thus, c-Met activation is analysis using an upstream external probe (Fig. 1). Two clones with a recombined Lbx1 allele were identified by Southern analysis and by necessary for cells in the ventrolateral dermomyotome to undergo PCR analysis using primers for Neo and the Lbx1-EGFP boundary. an epithelial to mesenchymal transition prior to migration. Both clones were injected into C57Bl6 blastocysts to generate Pax3 and c-Met are also expressed in non-migratory chimeras. Germline founders and F1 generations were generated on a populations of dermomyotomal cells. Pax3 is expressed C57Bl6 background. Mice and embryos were genotyped by PCR using throughout the dermomyotome (Goulding et al., 1994; Daston et tail or visceral yolk sac DNA. Primers MKG396 (CAGCTGCA- al., 1996), while c-Met is expressed in the ventral dermomyotome GAAGCCAGGACTG; 12 ng/µl), MKG321 (CCGGACACGCTGA- at interlimb levels and in cells located at the dorsal tips of the ACTTGTGG; 12 ng/µl), and MKG333 (ATGACTTCCAAGGAGG- dermomyotome (Yang et al., 1996). Consequently, factors other ACGGCA; 24 ng/µl) were used in a 25 µl reaction containing Taq than Pax3 and c-Met must specify and control the migratory buffer (1.6 mM MgCl2, 0.2 mM dNTPs, 10% DMSO) and 1.25 Units behaviour of hypaxial muscle precursors. The Lbx1 gene is a Taq polymerase (Perkin-Elmer). Amplification of mutant and wild- type Lbx1 alleles generated diagnostic bands of 315 and 445 bp, candidate for regulating the migratory behaviour of these cells. respectively. Lbx1 encodes a homeodomain transcription factor that is expressed specifically in hypaxial muscle precursors that are Generation of antibodies to Pax3 and Lbx1 destined to migrate from the ventrolateral dermomyotome at Rat anti-Pax3 and rabbit anti-Lbx1 antibodies were generated against limb, cervical and occipital levels (Jagla et al., 1995). bacterial fusion proteins containing 122 aa of the Pax3 C terminus and Subsequently, cells expressing Lbx1 leave the ventrolateral 120 aa of the mouse Lbx1 protein that includes the homeodomain, dermomyotomes and migrate into the limb buds and diaphragm respectively. A 365 bp PvuII fragment from the mouse Pax3 C terminus at lower cervical and limb levels, and toward the pharynx at was inserted into SmaI/XhoI fill in vector pGEX4T-2 to generate occipital levels (Mennerich et al., 1998; Dietrich et al., 1999). GST/Pax3(CT). A fragment encoding His6-Pax3(CT) was inserted into the NheI/B cut vector pET11d. A BglII-EarI fragment from exon2 Thus, expression of Lbx1 is restricted to hypaxial muscle of the downstream mouse genomic clone was inserted into the BglII- precursors that undergo long range cell migration. In addition, EarI sites of the human LBX1 cDNA to create BS-Lbx1(C-mm). An Lbx1 is not expressed in the dermomyotome in Sp embryos, Ecl136II/Xho fragment of BS-Lbx1(C-mm) was inserted into the demonstrating Lbx1 lies downstream of Pax3 and may therefore SmaI/XhoI cut vector pGex4T2 to generate GST/Lbx(I120). Soluble contribute to the loss of hypaxial muscles that occurs in Sp GST fusion proteins were purified from BL21(DE3) bacteria according embryos (Mennerich et al., 1998; Dietrich et al., 1999; L.
Recommended publications
  • Analysis of Polycomb Repressive Complexes Binding Dynamics During Limb Development Reveals the Prevalence of PRC2-Independent PRC1 Occupancy

    Analysis of Polycomb Repressive Complexes Binding Dynamics During Limb Development Reveals the Prevalence of PRC2-Independent PRC1 Occupancy

    bioRxiv preprint doi: https://doi.org/10.1101/2020.09.21.306688; this version posted September 21, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Analysis of Polycomb Repressive Complexes binding dynamics during limb development reveals the prevalence of PRC2-independent PRC1 occupancy Claudia Gentile1,2,#, Alexandre Mayran3,~, Fanny Guerard-Millet1, and Marie Kmita1,2,4,5* 1Genetics and Development Research Unit, Institut de Recherches Cliniques de Montréal, Montréal, Québec, Canada. 2Department of Experimental Medicine, McGill University, Montréal, Québec, Canada 3Molecular Genetics Research Unit, Institut de Recherches Cliniques de Montréal, Montréal, Québec, Canada 4Department of Medicine, Université de Montréal, Montreal, Quebec, Canada 5Lead Contact #Present address: Department of Pediatric Oncology, Dana-Farber Cancer Institute and Harvard Medical School, Boston, MA 02215, USA ~Present address: School of Life Sciences, Federal Institute of Technology, Lausanne, Lausanne 1015, Switzerland *Corresponding author: Marie Kmita Email: [email protected] Tel: (1) 514-987-5749 bioRxiv preprint doi: https://doi.org/10.1101/2020.09.21.306688; this version posted September 21, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract The Polycomb group (PcG) proteins are key players in the regulation of tissue-specific gene expression through their known ability to epigenetically silence developmental genes. The PcG proteins form two multicomponent complexes, Polycomb Repressive Complex 1 and 2 (PRC1 and PRC2), whereby the hierarchical model of recruitment postulates that PRC2 triggers the trimethylation of Histone H3 lysine 27 (H3K27me3) leading to the recruitment of PRC1.
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes

    SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes

    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
  • A Novel Role for Lbx1 in Xenopus Hypaxial Myogenesis

    A Novel Role for Lbx1 in Xenopus Hypaxial Myogenesis

    RESEARCH ARTICLE 195 Development 133, 195-208 doi:10.1242/dev.02183 A novel role for lbx1 in Xenopus hypaxial myogenesis Benjamin L. Martin and Richard M. Harland* We have examined lbx1 expression in early X. laevis tadpoles. In contrast to amniotes, lbx1 is expressed in all of the myoblasts that contribute to the body wall musculature, as well as in a group of cells that migrate into the head. Despite this different expression, the function of lbx1 appears to be conserved. Morpholino (MO) knockdown of lbx1 causes a specific reduction of body wall muscles and hypoglossal muscles originating from the somites. Although myoblast migratory defects are observed in antisense MO injected tadpoles targeting lbx1, this results at least in part from a lack of myoblast proliferation in the hypaxial muscle domain. Conversely, overexpression of lbx1 mRNA results in enlarged somites, an increase in cell proliferation, but a lack of differentiated muscle. The control of cell proliferation is linked to a strong downregulation of myoD expression in gain-of-function experiments. Co-injection of myoD mRNA with lbx1 mRNA eliminates the overproliferation phenotype observed when lbx1 is injected alone. The results indicate that a primary function of lbx1 in hypaxial muscle development is to repress myoD, allowing myoblasts to proliferate before the eventual onset of terminal differentiation. KEY WORDS: Hypaxial, Rectus abdominus, Rectus cervicus, Geniohyoideus, lbx1, myoD, myf5, Xenopus laevis, Cell proliferation, Myogenesis INTRODUCTION The expression of myf5, a muscle regulatory factor (MRF), is similar The ladybird homeobox (lbx1) gene is a member of the NK-class of to that of pax3 in the hypaxial myoblasts.
  • Characterization of Human-Ipscs Derived Spinal Motor Neurons by Single

    Characterization of Human-Ipscs Derived Spinal Motor Neurons by Single

    bioRxiv preprint doi: https://doi.org/10.1101/2019.12.28.889972; this version posted December 28, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Characterization of human-iPSCs derived spinal motor neurons by single- cell RNA sequencing Louise Thiry1, Regan Hamel2, Stefano Pluchino2, Thomas Durcan1,3, Stefano Stifani1* 1Department of Neurology and Neurosurgery, Montreal Neurological Institute-Hospital, McGill University, 3801, rue University, Montreal (Quebec) H3A 2B4, Canada 2Department of Clinical Neurosciences, Clifford Allbutt Building - Cambridge Biosciences Campus and NIHR Biomedical Research Centre, University of Cambridge, Hills Road, CB2 0HA Cambridge, UK 3Early Drug Discovery Unit, Montreal Neurological Institute-Hospital *Corresponding author: [email protected] 1 bioRxiv preprint doi: https://doi.org/10.1101/2019.12.28.889972; this version posted December 28, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract Human induced pluripotent stem cells (iPSCs) offer the opportunity to generate specific cell types from healthy and diseased individuals, allowing the study of mechanisms of early human development, modelling a variety of human diseases, and facilitating the development of new therapeutics. Human iPSC-based applications are often limited by the variability among iPSC lines originating from a single donor, as well as the heterogeneity among specific cell types that can be derived from iPSCs. The ability to deeply phenotype different iPSC-derived cell types is therefore of primary importance to the successful and informative application of this technology.
  • Lbx1 Acts As a Selector Gene in the Fate Determination of Somatosensory and Viscerosensory Relay Neurons in the Hindbrain

    Lbx1 Acts As a Selector Gene in the Fate Determination of Somatosensory and Viscerosensory Relay Neurons in the Hindbrain

    4902 • The Journal of Neuroscience, May 2, 2007 • 27(18):4902–4909 Development/Plasticity/Repair Lbx1 Acts as a Selector Gene in the Fate Determination of Somatosensory and Viscerosensory Relay Neurons in the Hindbrain Martin A. Sieber,1* Robert Storm,1* Margaret Martinez-de-la-Torre,2 Thomas Mu¨ller,1 Hagen Wende,1 Katja Reuter,1 Elena Vasyutina,1 and Carmen Birchmeier1 1Department of Neuroscience, Max-Delbru¨ck-Center for Molecular Medicine, 13125 Berlin, Germany, and 2Department of Human Anatomy and Psychobiology, University of Murcia, 30100 Murcia, Spain Distinct types of relay neurons in the hindbrain process somatosensory or viscerosensory information. How neurons choose between these two fates is unclear. We show here that the homeobox gene Lbx1 is essential for imposing a somatosensory fate on relay neurons in the hindbrain. In Lbx1 mutant mice, viscerosensory relay neurons are specified at the expense of somatosensory relay neurons. Thus Lbx1 expression distinguishes between the somatosensory or viscerosensory fate of relay neurons. Key words: neuronal specification; homeobox gene; nucleus of the solitary tract; spinal trigeminal nucleus; genetic lineage tracing; development Introduction following prospective NTS neurons during their development Hindbrain neurons receive viscerosensory and somatosensory and migration. The Phox2bϩ viscerosensory neurons express, in information from the periphery and integrate and relay this in- addition, Tlx3 and Lmx1b and are known to require Tlx3 for their formation. Neurons that receive somatosensory information of development (Qian et al., 2001, 2002; Cheng et al., 2004). These the face locate to the spinal trigeminal nucleus (SpV), whereas the neurons arise from a Mash1ϩ progenitor domain and are gener- major relay station for visceral sensory information is the nucleus ated delayed and at reduced numbers in Mash1 mutant mice of the solitary tract (NTS) (Blessing, 1997; Qian et al., 2002).
  • Supplementary File Table S1

    Supplementary File Table S1

    Supplementary file Table S1 Grouping of Homeobox genes according to their main known function. Anatomical Structure Morphogenesis EN1, HOXC10, HOXC13, HOXD3, LBX1, SIX2, SIX4 Organ Morphogenesis CDX1, CDX2, HOXA11, HOXA13, ISL1, LHX1, PAX3, PDHX, PITX2, PITX3, PROX1, SIX6 Body Pattern Formation ALX3, EMX2, HHEX, HOXA11, HOXA2, HOXA4, HOXA5, HOXA6, HOXB1, HOXB5, HOXB6, HOXC5, HOXD10, HOXD8, LMX1B, PITX2 Ectoderm Development PROX1, VAX2 Endoderm Development HOXC11 Brain & Nervous System Development Brain Development ALX1, DLX2, EMX2 Nervous System Development: ARX, DLX5, DLX6, HOXD10, LBX1, LHX1, OTP, PAX3, PHOX2A, PHOX2B Skeletal Development: ALX3, ALX4, DLX3, DLX5, DLX6, EN1, HOXA11, HOXA13, HOXA2, HOXB6, HOXD10, HOXD13, MSX2 Muscle Development: BARX2, MKX, SIRT1, SIRT2, SIX1 Other Homeobox Genes Involved In BARX1, CDX4, CUX1, DLX1, EMX1, EN2, Multicellular Organismal HOXA1, HOXA7, HOXA9, HOXB13, HOXB2, Development: HOXB3, HOXB4, HOXB7, HOXB8, HOXB9, HOXC12, HOXC8, HOXC9, HOXD1, HOXD11, HOXD12, HOXD9, ISL2, LBX2, LMX1A, MEIS1, NKX3-1, OTX1, TLX1, VAX1, VSX1, VSX2 Homeobox Genes Involved In Cell ARX, EMX2, HHEX, HLX, HOPX, LBX1, LHX1, Differentiation: LMX1B, MIXL1, OTP, PHOX2A, SIRT1, VSX2 Other Genes: PHTF1, SIRT3, SIRT6, SIRT7, ZHX1, ZHX2 Homeobox genes include two subsets of genes coding for transcription factors involved in multiple functions. The clustered HOX genes are indicated in bold. Supplementary file Figure S2 5’ Spatial collinearity 3’ HOXA Chr. 7p15.3 HOXB Chr. 17q21.3 HOXC Chr. 12q13.3 HOXD Chr. 2q31 13 12 11 10 9 8 7 6 5 4 3 2 1 Paralogous HOX groups Distribution of the 39 human HOX genes in four clusters located in different chromosomal regions*. Blue indicates anterior HOX genes. Yellow, paralogy group 3 Hox genes, green and purple indicatete central HOX genes and Red the posterior HOX genes.
  • Hypermethylation of Human DNA: Fine-Tuning Transcription Associated with Development

    Hypermethylation of Human DNA: Fine-Tuning Transcription Associated with Development

    bioRxiv preprint doi: https://doi.org/10.1101/212191; this version posted October 31, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Hypermethylation of human DNA: Fine-tuning transcription associated with development Carl Baribault1,2, Kenneth C. Ehrlich3, V. K. Chaithanya Ponnaluri4, Sriharsa Pradhan4, Michelle Lacey2, and Melanie Ehrlich1,3,5* 1Tulane Cancer Center, Tulane University Health Sciences Center, New Orleans, LA 70112, USA. 2Department of Mathematics, Tulane University, New Orleans, LA 70118, USA. 3Center for Bioinformatics and Genomics, Tulane University Health Sciences Center. 4 New England Biolabs, Ipswich, MA 01938, USA. 5Hayward Genetics Center Tulane University Health Sciences Center, New Orleans, LA 70112, USA. *Correspondence: [email protected] Email addresses of other authors: [email protected] , [email protected] , [email protected], [email protected], [email protected] , and [email protected] Key words: DNA methylation, chromatin, development, epigenetic memory, CTCF, NR2F2 (COUP-TFII), NKX2-5, LXN (Latexin), EN1, and PAX3 1 bioRxiv preprint doi: https://doi.org/10.1101/212191; this version posted October 31, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract Tissue-specific gene transcription can be affected by DNA methylation in ways that are difficult to discern from studies focused on genome-wide analyses of differentially methylated regions (DMRs). We studied 95 genes in detail using available epigenetic and transcription databases to detect and elucidate less obvious associations between development-linked hypermethylated DMRs in myoblasts (Mb) and cell- and tissue- specific expression.
  • (12) Patent Application Publication (10) Pub. No.: US 2009/0269772 A1 Califano Et Al

    (12) Patent Application Publication (10) Pub. No.: US 2009/0269772 A1 Califano Et Al

    US 20090269772A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2009/0269772 A1 Califano et al. (43) Pub. Date: Oct. 29, 2009 (54) SYSTEMS AND METHODS FOR Publication Classification IDENTIFYING COMBINATIONS OF (51) Int. Cl. COMPOUNDS OF THERAPEUTIC INTEREST CI2O I/68 (2006.01) CI2O 1/02 (2006.01) (76) Inventors: Andrea Califano, New York, NY G06N 5/02 (2006.01) (US); Riccardo Dalla-Favera, New (52) U.S. Cl. ........... 435/6: 435/29: 706/54; 707/E17.014 York, NY (US); Owen A. (57) ABSTRACT O'Connor, New York, NY (US) Systems, methods, and apparatus for searching for a combi nation of compounds of therapeutic interest are provided. Correspondence Address: Cell-based assays are performed, each cell-based assay JONES DAY exposing a different sample of cells to a different compound 222 EAST 41ST ST in a plurality of compounds. From the cell-based assays, a NEW YORK, NY 10017 (US) Subset of the tested compounds is selected. For each respec tive compound in the Subset, a molecular abundance profile from cells exposed to the respective compound is measured. (21) Appl. No.: 12/432,579 Targets of transcription factors and post-translational modu lators of transcription factor activity are inferred from the (22) Filed: Apr. 29, 2009 molecular abundance profile data using information theoretic measures. This data is used to construct an interaction net Related U.S. Application Data work. Variances in edges in the interaction network are used to determine the drug activity profile of compounds in the (60) Provisional application No. 61/048.875, filed on Apr.
  • MLL1 Is Required for PAX7 Expression and Satellite Cell Self-Renewal in Mice

    MLL1 Is Required for PAX7 Expression and Satellite Cell Self-Renewal in Mice

    ARTICLE https://doi.org/10.1038/s41467-019-12086-9 OPEN MLL1 is required for PAX7 expression and satellite cell self-renewal in mice Gregory C. Addicks 1,2,6, Caroline E. Brun1,2,6, Marie-Claude Sincennes1,2, John Saber1,2, Christopher J. Porter3, A. Francis Stewart4, Patricia Ernst5 & Michael A. Rudnicki 1,2 PAX7 is a paired-homeobox transcription factor that specifies the myogenic identity of muscle stem cells and acts as a nodal factor by stimulating proliferation while inhibiting 1234567890():,; differentiation. We previously found that PAX7 recruits the H3K4 methyltransferases MLL1/2 to epigenetically activate target genes. Here we report that in the absence of Mll1, myoblasts exhibit reduced H3K4me3 at both Pax7 and Myf5 promoters and reduced Pax7 and Myf5 expression. Mll1-deficient myoblasts fail to proliferate but retain their differentiation potential, while deletion of Mll2 had no discernable effect. Re-expression of PAX7 in committed Mll1 cKO myoblasts restored H3K4me3 enrichment at the Myf5 promoter and Myf5 expression. Deletion of Mll1 in satellite cells reduced satellite cell proliferation and self-renewal, and significantly impaired skeletal muscle regeneration. Pax7 expression was unaffected in quiescent satellite cells but was markedly downregulated following satellite cell activation. Therefore, MLL1 is required for PAX7 expression and satellite cell function in vivo. Further- more, PAX7, but not MLL1, is required for Myf5 transcriptional activation in committed myoblasts. 1 Sprott Centre for Stem Cell Research, Regenerative Medicine Program, Ottawa Hospital Research Institute, Ottawa, ON K1H 8L6, Canada. 2 Department of Cellular and Molecular Medicine, Faculty of Medicine, University of Ottawa, Ottawa, ON K1H 8M5, Canada.
  • Characterization of a Novel Lbx1 Mouse Loss of Function Strain

    Characterization of a Novel Lbx1 Mouse Loss of Function Strain

    bioRxiv preprint doi: https://doi.org/10.1101/2021.08.25.457618; this version posted August 25, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 1 2 3 Characterization of a novel Lbx1 mouse loss of function strain 4 5 6 Lyvianne Decourtye, Jeremy A. McCallum-Loudeac, Sylvia Zellhuber-McMillan, Emma Young, 7 Kathleen J. Sircombe, Megan J. Wilson* 8 9 10 11 Department of Anatomy, Otago School of Medical Sciences, University of Otago, 9054 12 Dunedin, New Zealand 13 14 15 16 *Corresponding author: 17 Email: [email protected] Phone: +64 347 046 95 18 19 20 1 bioRxiv preprint doi: https://doi.org/10.1101/2021.08.25.457618; this version posted August 25, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 1 Abstract 2 Adolescent Idiopathic Scoliosis (AIS) is the most common type of spine deformity affecting 2- 3 3% of the population worldwide. The etiology of this disease is still poorly understood. Several 4 GWAS studies have identified single nucleotide polymorphisms (SNPs) located near the gene 5 LBX1 that is significantly correlated with AIS risk. LBX1 is a transcription factor with roles in 6 myocyte precursor migration, cardiac neural crest specification, and neuronal fate 7 determination in the neural tube. Here, we further investigated the role of LBX1 in the 8 developing spinal cord of mouse embryos using a CRISPR-generated mouse model expressing 9 a truncated version of LBX1 (Lbx1Δ).
  • Studying the Foxp Genes in the Spinal Cord

    Studying the Foxp Genes in the Spinal Cord

    UC San Diego UC San Diego Electronic Theses and Dissertations Title FoxP genes subdivide interneuron subclasses in the developing mouse spinal cord Permalink https://escholarship.org/uc/item/81z6h0q6 Author Wong, Timothy Tin Heng Publication Date 2009 Peer reviewed|Thesis/dissertation eScholarship.org Powered by the California Digital Library University of California UNIVERSITY OF CALIFORNIA, SAN DIEGO FoxP Genes Subdivide Interneuron Subclasses in the Developing Mouse Spinal Cord A Thesis submitted in partial satisfaction of the requirements for the degree Master of Science in Biology by Timothy Tin Heng Wong Committee in charge: Professor Martyn D. Goulding, Chair Professor Nicholas Spitzer, Co-Chair Professor Eric Turner 2009 The Thesis of Timothy Tin Heng Wong is approved and it is acceptable in quality and form for publication on microfilm and electronically: Co-Chair Chair University of California, San Diego 2009 iii TABLE OF CONTENTS SIGNATURE PAGE ..........................................................................................................iii TABLE OF CONTENTS................................................................................................... iv LIST OF FIGURES AND TABLES ................................................................................... v ABSTRACT....................................................................................................................... vi INTRODUCTION .............................................................................................................
  • Tlx1 and Tlx3 Coordinate Specification of Dorsal Horn Pain-Modulatory Peptidergic Neurons

    Tlx1 and Tlx3 Coordinate Specification of Dorsal Horn Pain-Modulatory Peptidergic Neurons

    The Journal of Neuroscience, April 9, 2008 • 28(15):4037–4046 • 4037 Development/Plasticity/Repair Tlx1 and Tlx3 Coordinate Specification of Dorsal Horn Pain-Modulatory Peptidergic Neurons Yi Xu,1 Claudia Lopes,1,2 Ying Qian,1 Ying Liu,3 Leping Cheng,4 Martyn Goulding,5 Eric E. Turner,3 Deolinda Lima2, and Qiufu Ma1 1Dana-Farber Cancer Institute and Department of Neurobiology, Harvard Medical School, Boston, Massachusetts 02115, 2Laboratory of Molecular Cell Biology, University of Porto, Porto, Portugal, 3Department of Psychiatry, University of California, San Diego and Veterans Affairs San Diego Healthcare System, La Jolla, California 92093-0603, 4Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031, China, and 5Molecular Neurobiology Laboratory, The Salk Institute for Biological Studies, La Jolla, California 92037 The dorsal spinal cord synthesizes a variety of neuropeptides that modulate the transmission of nociceptive sensory information. Here, we used genetic fate mapping to show that Tlx3ϩ spinal cord neurons and their derivatives represent a heterogeneous population of neurons, marked by partially overlapping expression of a set of neuropeptide genes, including those encoding the anti-opioid peptide cholecystokinin, pronociceptive Substance P (SP), Neurokinin B, and a late wave of somatostatin. Mutations of Tlx3 and Tlx1 result in a loss of expression of these peptide genes. Brn3a, a homeobox transcription factor, the expression of which is partly dependent on Tlx3, is required specifically for the early wave of SP expression. These studies suggest that Tlx1 and Tlx3 operate high in the regulatory hierarchy that coordinates specification of dorsal horn pain-modulatory peptidergic neurons.