Hypermethylation of Human DNA: Fine-Tuning Transcription Associated with Development
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
1 the Genetic Architecture of the Human Cerebral Cortex. Katrina L. Grasby1*, Neda Jahanshad2*, Jodie N. Painter1, Lucía Colodr
bioRxiv preprint doi: https://doi.org/10.1101/399402; this version posted September 9, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The genetic architecture of the human cerebral cortex. Katrina L. Grasby1*, Neda Jahanshad2*, Jodie N. Painter1, Lucía Colodro-Conde1, Janita Bralten3,4, Derrek P. Hibar2,5, Penelope A. Lind1, Fabrizio Pizzagalli2, Christopher R.K. Ching2,6, Mary Agnes B. McMahon2, Natalia Shatokhina2, Leo C.P. Zsembik7, Ingrid Agartz8,9,10,11, Saud Alhusaini12,13, Marcio A.A. Almeida14, Dag Alnæs8,9, Inge K. Amlien15, Micael Andersson16,17, Tyler Ard18, Nicola J. Armstrong19, Allison Ashley-Koch20, Manon Bernard21, Rachel M. Brouwer22, Elizabeth E.L. Buimer22, Robin Bülow23, Christian Bürger24, Dara M. Cannon25, Mallar Chakravarty26,27, Qiang Chen28, Joshua W. Cheung2, Baptiste Couvy-Duchesne29,30,31, Anders M. Dale32,33, Shareefa Dalvie34, Tânia K. de Araujo35, Greig I. de Zubicaray36, Sonja M.C. de Zwarte22, Anouk den Braber37,38, Nhat Trung Doan8,9, Katharina Dohm24, Stefan Ehrlich39, Hannah-Ruth Engelbrecht40, Susanne Erk41, Chun Chieh Fan42, Iryna O. Fedko37, Sonya F. Foley43, Judith M. Ford44, Masaki Fukunaga45, Melanie E. Garrett20, Tian Ge46,47, Sudheer Giddaluru48, Aaron L. Goldman28, Nynke A. Groenewold34, Dominik Grotegerd24, Tiril P. Gurholt8,9,10, Boris A. Gutman2,49, Narelle K. Hansell31, Mathew A. Harris50,51, Marc B. Harrison2, Courtney C. Haswell52,53, Michael Hauser20, Stefan Herms54,55,56, Dirk J. Heslenfeld57, New Fei Ho58, David Hoehn59, Per Hoffmann54,55,60, Laurena Holleran25, Martine Hoogman3,4, Jouke-Jan Hottenga37, Masashi Ikeda61, Deborah Janowitz62, Iris E. -
LHX2 (NM 004789) Human Tagged ORF Clone Product Data
OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC210786L4 LHX2 (NM_004789) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: LHX2 (NM_004789) Human Tagged ORF Clone Tag: mGFP Symbol: LHX2 Synonyms: hLhx2; LH2 Vector: pLenti-C-mGFP-P2A-Puro (PS100093) E. coli Selection: Chloramphenicol (34 ug/mL) Cell Selection: Puromycin ORF Nucleotide The ORF insert of this clone is exactly the same as(RC210786). Sequence: Restriction Sites: SgfI-MluI Cloning Scheme: ACCN: NM_004789 ORF Size: 1218 bp This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 2 LHX2 (NM_004789) Human Tagged ORF Clone – RC210786L4 OTI Disclaimer: The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info OTI Annotation: This clone was engineered to express the complete ORF with an expression tag. Expression varies depending on the nature of the gene. RefSeq: NM_004789.3 RefSeq Size: 2416 bp RefSeq ORF: 1221 bp Locus ID: 9355 UniProt ID: P50458, B3KNJ5 Domains: homeobox, LIM Protein Families: Transcription Factors MW: 44.4 kDa Gene Summary: This gene encodes a protein belonging to a large protein family, members of which carry the LIM domain, a unique cysteine-rich zinc-binding domain. -
Six3 Overexpression Initiates the Formation of Ectopic Retina
Downloaded from genesdev.cshlp.org on October 6, 2021 - Published by Cold Spring Harbor Laboratory Press RESEARCH COMMUNICATION in the developing eye and ventral forebrain. Recently, in Six3 overexpression initiates Drosophila a member of the Six subclass of homeobox the formation of ectopic retina genes, optix, has been isolated, which by sequence com- parison of the homeobox appears to be the ortholog of Felix Loosli, Sylke Winkler, Six3 (Toy et al. 1998). Functional analysis of optix, how- 1 and Joachim Wittbrodt ever, has not yet been reported. In medaka fish (Oryzias latipes) Six3 is expressed in Sonderforschungsbereich (SFB) Junior Group, Institute for Human Genetics, University of Go¨ ttingen, c/o the anterior-most neuroectoderm at gastrula stages and Max-Planck-Institute (MPI) for Biophysical Chemistry, Am later in the developing retina (Loosli et al. 1998). Mosaic Fassberg, 37077 Go¨ttingen, Germany misexpression of mouse Six3 in small clones, in response to injected plasmid DNA, resulted in the formation of The homeobox gene sine oculis (so) is essential for visual ectopic lenses in the region of the otic vesicle, suggesting system formation in Drosophila. A vertebrate member a decisive role for Six3 during vertebrate lens develop- of the so/Six gene family, Six3, is expressed in the devel- ment (Oliver et al. 1996). Considering the expression of oping eye and forebrain. Injection of Six3 RNA into Six3 in the retinal primordia and the essential role of a medaka fish embryos causes ectopic Pax6 and Rx2 ex- Drosophila homolog, so,inDrosophila eye develop- pression in midbrain and cerebellum, resulting in the ment, we investigated a potential role of Six3 in early formation of ectopic retinal primordia. -
Analysis of Trans Esnps Infers Regulatory Network Architecture
Analysis of trans eSNPs infers regulatory network architecture Anat Kreimer Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the Graduate School of Arts and Sciences COLUMBIA UNIVERSITY 2014 © 2014 Anat Kreimer All rights reserved ABSTRACT Analysis of trans eSNPs infers regulatory network architecture Anat Kreimer eSNPs are genetic variants associated with transcript expression levels. The characteristics of such variants highlight their importance and present a unique opportunity for studying gene regulation. eSNPs affect most genes and their cell type specificity can shed light on different processes that are activated in each cell. They can identify functional variants by connecting SNPs that are implicated in disease to a molecular mechanism. Examining eSNPs that are associated with distal genes can provide insights regarding the inference of regulatory networks but also presents challenges due to the high statistical burden of multiple testing. Such association studies allow: simultaneous investigation of many gene expression phenotypes without assuming any prior knowledge and identification of unknown regulators of gene expression while uncovering directionality. This thesis will focus on such distal eSNPs to map regulatory interactions between different loci and expose the architecture of the regulatory network defined by such interactions. We develop novel computational approaches and apply them to genetics-genomics data in human. We go beyond pairwise interactions to define network motifs, including regulatory modules and bi-fan structures, showing them to be prevalent in real data and exposing distinct attributes of such arrangements. We project eSNP associations onto a protein-protein interaction network to expose topological properties of eSNPs and their targets and highlight different modes of distal regulation. -
The Complete Genome Sequences, Unique Mutational Spectra, and Developmental Potency of Adult Neurons Revealed by Cloning
Article The Complete Genome Sequences, Unique Mutational Spectra, and Developmental Potency of Adult Neurons Revealed by Cloning Highlights Authors d Reprogramming neurons by cloning enables high-fidelity Jennifer L. Hazen, Gregory G. Faust, whole-genome sequencing Alberto R. Rodriguez, ..., Sergey Kupriyanov, Ira M. Hall, d Neurons harbor 100 unique mutations but lack recurrent Kristin K. Baldwin DNA rearrangements Correspondence d Neuronal mutations impact expressed genes and exhibit unique molecular signatures [email protected] (I.M.H.), [email protected] (K.K.B.) d Mature adult neurons can generate fertile adult mouse clones In Brief Hazen et al. use cloning to amplify and perform complete genome sequence analyses on adult neurons. They discover unique characteristics of neuronal genomes consistent with postmitotic mutation and further establish neuronal genomic integrity by generating fertile mice from these neurons. Hazen et al., 2016, Neuron 89, 1223–1236 March 16, 2016 ª2016 Elsevier Inc. http://dx.doi.org/10.1016/j.neuron.2016.02.004 Neuron Article The Complete Genome Sequences, Unique Mutational Spectra, and Developmental Potency of Adult Neurons Revealed by Cloning Jennifer L. Hazen,1,8 Gregory G. Faust,2,8 Alberto R. Rodriguez,3 William C. Ferguson,1 Svetlana Shumilina,2 Royden A. Clark,2 Michael J. Boland,1 Greg Martin,3 Pavel Chubukov,1,4 Rachel K. Tsunemoto,1,5 Ali Torkamani,4 Sergey Kupriyanov,3 Ira M. Hall,6,7,* and Kristin K. Baldwin1,5,* 1Department of Molecular and Cellular Neuroscience, The Scripps Research Institute, 10550 N. Torrey Pines Road, La Jolla, CA 92037, USA 2Department of Biochemistry and Molecular Genetics, University of Virginia School of Medicine, 1340 Jefferson Park Avenue, Charlottesville, VA 22901, USA 3Mouse Genetics Core Facility 4Department of Integrative Structural and Computational Biology The Scripps Research Institute, 10550 N. -
Investigation of Functional Genes at Homologous Loci Identified Based
Journal of Atherosclerosis and Thrombosis Vol.22, No.5 455 Original Article Investigation of Functional Genes at Homologous Loci Identified Based on Genome-wide Association Studies of Blood Lipids via High-fat Diet Intervention in Rats using an in vivo Approach Koichi Akiyama, Yi-Qiang Liang, Masato Isono and Norihiro Kato Department of Gene Diagnostics and Therapeutics, Research Institute, National Center for Global Health and Medicine, Tokyo, Japan Aim: It is challenging to identify causal (or target) genes at individual loci detected using genome- wide association studies (GWAS). In order to follow up GWAS loci, we investigated functional genes at homologous loci identified using human lipid GWAS that responded to a high-fat, high-choles- terol diet (HFD) intervention in an animal model. Methods: The HFD intervention was carried out for four weeks in male rats of the spontaneously hypertensive rat strain. The liver and adipose tissues were subsequently excised for analyses of changes in the gene expression as compared to that observed in rats fed normal rat chow (n=8 per group). From 98 lipid-associated loci reported in previous GWAS, 280 genes with rat orthologs were initially selected as targets for the two-staged analysis involving screening with DNA microarray and validation with quantitative PCR (qPCR). Consequently, genes showing a differential expression due to HFD were examined for changes in the expression induced by atorvastatin, which was indepen- dently administered to the rats. Results: Using the HFD intervention in the rats, seven known (Abca1, Abcg5, Abcg8, Lpl, Nr1h3, Pcsk9 and Pltp) and three novel (Madd, Stac3 and Timd4) genes were identified as potential signifi- cant targets, with an additional list of 23 suggestive genes. -
Table S1 the Four Gene Sets Derived from Gene Expression Profiles of Escs and Differentiated Cells
Table S1 The four gene sets derived from gene expression profiles of ESCs and differentiated cells Uniform High Uniform Low ES Up ES Down EntrezID GeneSymbol EntrezID GeneSymbol EntrezID GeneSymbol EntrezID GeneSymbol 269261 Rpl12 11354 Abpa 68239 Krt42 15132 Hbb-bh1 67891 Rpl4 11537 Cfd 26380 Esrrb 15126 Hba-x 55949 Eef1b2 11698 Ambn 73703 Dppa2 15111 Hand2 18148 Npm1 11730 Ang3 67374 Jam2 65255 Asb4 67427 Rps20 11731 Ang2 22702 Zfp42 17292 Mesp1 15481 Hspa8 11807 Apoa2 58865 Tdh 19737 Rgs5 100041686 LOC100041686 11814 Apoc3 26388 Ifi202b 225518 Prdm6 11983 Atpif1 11945 Atp4b 11614 Nr0b1 20378 Frzb 19241 Tmsb4x 12007 Azgp1 76815 Calcoco2 12767 Cxcr4 20116 Rps8 12044 Bcl2a1a 219132 D14Ertd668e 103889 Hoxb2 20103 Rps5 12047 Bcl2a1d 381411 Gm1967 17701 Msx1 14694 Gnb2l1 12049 Bcl2l10 20899 Stra8 23796 Aplnr 19941 Rpl26 12096 Bglap1 78625 1700061G19Rik 12627 Cfc1 12070 Ngfrap1 12097 Bglap2 21816 Tgm1 12622 Cer1 19989 Rpl7 12267 C3ar1 67405 Nts 21385 Tbx2 19896 Rpl10a 12279 C9 435337 EG435337 56720 Tdo2 20044 Rps14 12391 Cav3 545913 Zscan4d 16869 Lhx1 19175 Psmb6 12409 Cbr2 244448 Triml1 22253 Unc5c 22627 Ywhae 12477 Ctla4 69134 2200001I15Rik 14174 Fgf3 19951 Rpl32 12523 Cd84 66065 Hsd17b14 16542 Kdr 66152 1110020P15Rik 12524 Cd86 81879 Tcfcp2l1 15122 Hba-a1 66489 Rpl35 12640 Cga 17907 Mylpf 15414 Hoxb6 15519 Hsp90aa1 12642 Ch25h 26424 Nr5a2 210530 Leprel1 66483 Rpl36al 12655 Chi3l3 83560 Tex14 12338 Capn6 27370 Rps26 12796 Camp 17450 Morc1 20671 Sox17 66576 Uqcrh 12869 Cox8b 79455 Pdcl2 20613 Snai1 22154 Tubb5 12959 Cryba4 231821 Centa1 17897 -
Analysis of Polycomb Repressive Complexes Binding Dynamics During Limb Development Reveals the Prevalence of PRC2-Independent PRC1 Occupancy
bioRxiv preprint doi: https://doi.org/10.1101/2020.09.21.306688; this version posted September 21, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Analysis of Polycomb Repressive Complexes binding dynamics during limb development reveals the prevalence of PRC2-independent PRC1 occupancy Claudia Gentile1,2,#, Alexandre Mayran3,~, Fanny Guerard-Millet1, and Marie Kmita1,2,4,5* 1Genetics and Development Research Unit, Institut de Recherches Cliniques de Montréal, Montréal, Québec, Canada. 2Department of Experimental Medicine, McGill University, Montréal, Québec, Canada 3Molecular Genetics Research Unit, Institut de Recherches Cliniques de Montréal, Montréal, Québec, Canada 4Department of Medicine, Université de Montréal, Montreal, Quebec, Canada 5Lead Contact #Present address: Department of Pediatric Oncology, Dana-Farber Cancer Institute and Harvard Medical School, Boston, MA 02215, USA ~Present address: School of Life Sciences, Federal Institute of Technology, Lausanne, Lausanne 1015, Switzerland *Corresponding author: Marie Kmita Email: [email protected] Tel: (1) 514-987-5749 bioRxiv preprint doi: https://doi.org/10.1101/2020.09.21.306688; this version posted September 21, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract The Polycomb group (PcG) proteins are key players in the regulation of tissue-specific gene expression through their known ability to epigenetically silence developmental genes. The PcG proteins form two multicomponent complexes, Polycomb Repressive Complex 1 and 2 (PRC1 and PRC2), whereby the hierarchical model of recruitment postulates that PRC2 triggers the trimethylation of Histone H3 lysine 27 (H3K27me3) leading to the recruitment of PRC1. -
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. -
Genome-Wide DNA Methylation Profiling Reveals Methylation Markers Associated with 3Q Gain for Detection of Cervical Precancer and Cancer
Published OnlineFirst January 24, 2017; DOI: 10.1158/1078-0432.CCR-16-2641 Biology of Human Tumors Clinical Cancer Research Genome-wide DNA Methylation Profiling Reveals Methylation Markers Associated with 3q Gain for Detection of Cervical Precancer and Cancer Wina Verlaat1, Peter J.F. Snijders1, Putri W. Novianti1,2, Saskia M. Wilting1, Lise M.A. De Strooper1, Geert Trooskens3, Johan Vandersmissen3, Wim Van Criekinge3, G. Bea A. Wisman4, Chris J.L.M. Meijer1, Danielle€ A.M. Heideman1, and Renske D.M. Steenbergen1 Abstract Purpose: Epigenetic host cell changes involved in cervical PCR (MSP) resulted in 3 genes (GHSR, SST, and ZIC1) that cancer development following a persistent high-risk human pap- showed a significant increase in methylation with severity of illomavirus (hrHPV) infection, provide promising markers for the disease in both tissue specimens and cervical scrapes (P < management of hrHPV-positive women. In particular, markers 0.005). The area under the ROC curve for CIN3 or worse varied based on DNA methylation of tumor suppressor gene promoters between 0.86 and 0.89. Within the group of CIN2/3, methylation are valuable. These markers ideally identify hrHPV-positive wom- levels of all 3 genes increased with duration of lesion existence en with precancer (CIN2/3) in need of treatment. Here, we set out (P < 0.0005), characterized by duration of preceding hrHPV to identify biologically relevant methylation markers by genome- infection, and were significantly higher in the presence of a 3q wide methylation analysis of both hrHPV-transformed cell lines gain (P < 0.05) in the corresponding tissue biopsy. and cervical tissue specimens. -
Functional Genomics Atlas of Synovial Fibroblasts Defining Rheumatoid Arthritis
medRxiv preprint doi: https://doi.org/10.1101/2020.12.16.20248230; this version posted December 18, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. All rights reserved. No reuse allowed without permission. Functional genomics atlas of synovial fibroblasts defining rheumatoid arthritis heritability Xiangyu Ge1*, Mojca Frank-Bertoncelj2*, Kerstin Klein2, Amanda Mcgovern1, Tadeja Kuret2,3, Miranda Houtman2, Blaž Burja2,3, Raphael Micheroli2, Miriam Marks4, Andrew Filer5,6, Christopher D. Buckley5,6,7, Gisela Orozco1, Oliver Distler2, Andrew P Morris1, Paul Martin1, Stephen Eyre1* & Caroline Ospelt2*,# 1Versus Arthritis Centre for Genetics and Genomics, School of Biological Sciences, Faculty of Biology, Medicine and Health, The University of Manchester, Manchester, UK 2Department of Rheumatology, Center of Experimental Rheumatology, University Hospital Zurich, University of Zurich, Zurich, Switzerland 3Department of Rheumatology, University Medical Centre, Ljubljana, Slovenia 4Schulthess Klinik, Zurich, Switzerland 5Institute of Inflammation and Ageing, University of Birmingham, Birmingham, UK 6NIHR Birmingham Biomedical Research Centre, University Hospitals Birmingham NHS Foundation Trust, University of Birmingham, Birmingham, UK 7Kennedy Institute of Rheumatology, University of Oxford Roosevelt Drive Headington Oxford UK *These authors contributed equally #corresponding author: [email protected] NOTE: This preprint reports new research that has not been certified by peer review and should not be used to guide clinical practice. 1 medRxiv preprint doi: https://doi.org/10.1101/2020.12.16.20248230; this version posted December 18, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. -
SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line