Journal of Atherosclerosis and Thrombosis Vol.22, No.5 455 Original Article
Investigation of Functional Genes at Homologous Loci Identified Based on Genome-wide Association Studies of Blood Lipids via High-fat Diet Intervention in Rats using an in vivo Approach
Koichi Akiyama, Yi-Qiang Liang, Masato Isono and Norihiro Kato
Department of Gene Diagnostics and Therapeutics, Research Institute, National Center for Global Health and Medicine, Tokyo, Japan
Aim: It is challenging to identify causal (or target) genes at individual loci detected using genome- wide association studies (GWAS). In order to follow up GWAS loci, we investigated functional genes at homologous loci identified using human lipid GWAS that responded to a high-fat, high-choles- terol diet (HFD) intervention in an animal model. Methods: The HFD intervention was carried out for four weeks in male rats of the spontaneously hypertensive rat strain. The liver and adipose tissues were subsequently excised for analyses of changes in the gene expression as compared to that observed in rats fed normal rat chow (n=8 per group). From 98 lipid-associated loci reported in previous GWAS, 280 genes with rat orthologs were initially selected as targets for the two-staged analysis involving screening with DNA microarray and validation with quantitative PCR (qPCR). Consequently, genes showing a differential expression due to HFD were examined for changes in the expression induced by atorvastatin, which was indepen- dently administered to the rats. Results: Using the HFD intervention in the rats, seven known (Abca1, Abcg5, Abcg8, Lpl, Nr1h3, Pcsk9 and Pltp) and three novel (Madd, Stac3 and Timd4) genes were identified as potential signifi- cant targets, with an additional list of 23 suggestive genes. Among these 33 genes, Stac3, Fads1 and six known genes exhibited nominally significant expression changes following treatment with atorv- astatin. Six (of 33) genes overlapped with those previously detected in the expression QTL studies. Conclusions: Our experimental in vivo approach increases the ability to identify target gene(s), when combined with other functional studies, thus improving understanding of the mechanisms by which GWAS variants act. See editorial vol. 22: 442-444
J Atheroscler Thromb, 2015; 22: 455-480.
Key words: Lipid, mRNA, Gene expression, Genome-wide association study, Diet
the plasma lipid concentrations1, 2). However, as most Introduction disease- and trait-associated variants lie within non- Genome-wide association studies (GWAS) have coding sequences3), it is difficult to identify causal (or succeeded in identifying a number of genomic loci target) genes at individual GWAS loci. Several lines of associated with complex diseases and traits, including evidence suggest that a substantial proportion of such variants are involved in transcriptional mechanisms, Address for correspondence: Norihiro Kato, Department of including the modulation of cis-regulatory elements Gene Diagnostics and Therapeutics, Research Institute, 3, 4) National Center for Global Health and Medicine, 1-21-1 (e.g., promoter and enhancer elements) . Toyama, Shinjuku-ku, Tokyo 162-8655, JAPAN One of the most popular approaches for finding E-mail: [email protected] associations between target genes and regulatory ele- Received: August 26, 2014 ments is to analyze SNPs. Information on SNP geno- Accepted for publication: September 30, 2014 types, which can be compared with trait phenotypes 456 Akiyama et al.
using GWAS, is analyzed in conjunction with gene level. expression data for particular types of cells derived from individuals. This process enables researchers to Materials and Methods identify associations between specific genetic variants and the gene expression levels using expression quanti- Animals tative trait locus (eQTL) studies5). Therefore, disease- We used the spontaneously hypertensive rats of a and trait-associated variants have been shown to often Japanese colony (SHR/Izm, hereafter referred to as affect the expression of nearby genes (cis-eQTLs) and SHR) for the HFD intervention, as previously those located over long genetic distances (trans- reported7). SHR rats are characterized by prominent eQTLs). In general, authors are inclined to assume the hypertension with a conspicuous response to a high- enrichment of GWAS SNPs in regulatory elements lipid diet and are considered to constitute a rat model when lead SNPs (i.e., SNPs showing the strongest of metabolic syndrome. This model allowed us to association signal) lie within regulatory DNA or examine the lipid GWAS-identified gene loci in the exhibit strong LD (e.g., r2 ≥ 0.8) with SNPs in regula- context of metabolic syndrome. Male rats (n =8 each tory DNA3). That is, since eQTL studies by them- for the HFD and control groups) were weaned at 4 selves show possible relationships between disease- and weeks of age and placed on a diet of normal rat chow trait-associated variants and the gene expression levels, (SP diet, Funabashi Farm, Japan). The rats were fed further investigation is warranted to clarify the mecha- the HFD diet (28.6% fat, Funabashi Farm, Japan) nistic basis in each case4). during the intervention period, which was restricted Recent large-scale GWAS and meta-analyses have to four weeks between 12 and 16 weeks of age, and identified ＞100 genomic loci contributing to inter- thereafter again fed the normal rat chow. The control individual variation in the plasma lipid concentra- rats (n =8) were fed the normal rat chow throughout tions1, 2). However, their practical value, in particular the study period. At two points, before and after the with regard to exact genetic elements and pathogenic dietary intervention, blood samples were drawn from events underlying associations, remains a subject of the tail vein of the rats in an overnight (16-hour) fast- debate. Focusing on human tissues relevant to lipo- ing state to measure the levels of glucose, total choles- protein metabolism (liver and fat—omental and sub- terol, triglycerides and free fatty acids. cutaneous fat), a total of 54 genes located at 35 unique Furthermore, in order to obtain clues regarding loci (i.e., 37% of 95 loci reported in a previous the involvement of uncharacterized genes in various study1)) have been shown to constitute SNP-to-gene lipid regulatory functions, we used male rats of a eQTLs, with partial overlap between tissues. Sepa- stroke-prone substrain of SHR (SHRSP) for pharma- rately, as an approach to systematically follow up cological intervention with atorvastatin, a lipid-lower- GWAS loci, RNAi-based functional profiling in vitro ing drug, as previously reported8). Briefly, the male has been performed in HeLa cells among 110 genes rats (n =5) were subjected to atorvastatin administra- derived from 43 lipid-associated loci (of which 33 tion (15 mg/kg/day via the gavage method) for four overlap with the list of 95 loci1)), subsequently identi- weeks between 12 and 16 weeks of age. The control fying an additional list of 45 genes from 25 lipid-asso- rats (n =5) were fed normal rat chow throughout the ciated loci, although overlap with eQTL data remains study period, similar to the HFD intervention. While rather limited6). a substantial portion of the predisposition to cardio- vascular disease is assumed to be shared between SHR and SHRSP animals, some features are relatively pro- Aim nounced or unique to each rat strain alone. SHR rats In order to provide evidence for disease-relevant are characterized by prominent hypertension as well as functions in vivo, we designed the present study with a conspicuous response to HFD. SHRSP rats, in con- two principal aims: [1] to investigate functional genes trast, are characterized by severe hypertension and car- at homologous loci identified in human lipid GWAS diovascular complications, including stroke and renal that respond to high-fat, high-cholesterol diet (HFD) dysfunction. Hence, we chose the individual strain to intervention in a rat model of metabolic syndrome; suit the nature of the intervention; that is, SHR for and [2] to examine the degree of overlap between the the dietary intervention and SHRSP for the pharma- list of genes with a differential expression induced by cological intervention, with a particular focus on end- HFD and those detectable using eQTL studies and/or organ protective effects7, 8). RNAi-based functional profiling, thereby integrating The rats were killed under pentobarbital anesthe- biological evidence for GWAS loci at the phenotypic sia (50 mg/kg via intraperitoneal infusion), and the Functional Genes for Lipid Regulation 457
organs were excised and immediately frozen at －70℃ tions. For both analyses, the probes were initially for subsequent RNA extraction. All rats were labora- selected if the fold induction was ≥ 1.3 with a nominal tory animals and treated in compliance with institu- P-value of ＜0.1. Such generous cut-off levels were set tional regulations. in order to avoid excluding probes for the functional All animal experiments were approved by the genes that exhibited relatively modest expression Animal Care and Use Committee of the National changes induced by HFD. In the first analysis, the Center for Global Health and Medicine (NCGM) corresponding probes were subjected to validation via Research Institute (permit number: 23-C-14) and qPCR, as described below. In the second analysis, the conducted in accordance with institutional proce- datasets were used for a pathway analysis with Ingenu- dures. ity iReport (Ingenuity Systems, Inc., CA). In this study, the gene annotation reports (Pathways, Biologi- Tissue Processing and RNA Isolation cal Processes and Disease) were based on insight from One gram each of the liver and retroperitoneal the Ingenuity® Knowledge Base (http://www.ingenu- adipose tissues were homogenized with a 0.5 inch- ity.com/). DAVID (ver. 6.7, http://david.abcc.ncifcrf. diameter generator shaft at a speed of 22,000 rpm for gov/)9) and g:Profiler (http://biit.cs.ut.ee/gprofiler/)10) 60 seconds. Total RNA was extracted using the were also used for functional profiling. RNeasy maxi kit (Qiagen, Valencia, CA). The quality of RNA was assessed using the RNA 6000 Nano Lab- Quantitative PCR Chip on an Agilent 2100 Bioanalyzer (Agilent Tech- The PCR primer sequences for the target genes nologies, Palo Alto, CA). cDNA was then synthesized were designed originally. Information regarding the from one microgram of the DNase I-treated total primer sequences is provided in Supplementary Table RNA using the Omniscript RT (reverse transcriptase) 2. qPCR amplification was performed using the ABI Kit (Qiagen) and subjected to microarray analyses and 7900 HT Sequence Detection System (Life Technolo- real-time quantitative PCR (qPCR) amplification. gies, Carlsbad, CA) with a total volume of 10 μl, including 2 μl of template cDNA plus FastStart Uni- Microarray Analysis versal SYBR Green Master (ROX) (Roche Applied The RNA samples were labeled using the Illu- Science, Penzberg, Upper Bavaria, Germany) and a mina TotalPrep RNA Amplification Kit (Illumina, final concentration of 200 nM each of forward and San Diego, CA). In order to prevent confounding by reverse primer. All samples were analyzed in duplicate extraneous factors, all experiments were performed according to the relative standard curve method, as with a single batch and processed on the same day for supplied by the manufacturer (Life Technologies). The each step. cRNA samples were prepared with a tem- peptidylpropyl isomerase A (Ppia) gene was used as an plate of 750 ng of total RNA and labeled with biotin. endogenous control. Then, 1.65 mg of cRNA per sample was hybridized qPCR was performed for a list of rat genes that using the RatRef-12 Expression BeadChip Kit (Illu- included rat orthologs to those associated with lipid mina) and stained with Streptavidin-Cy3 (GE Health- traits on human GWAS. For 98 genomic loci reported care, Piscataway, NJ). For the HFD intervention, four prior to 20121, 11-13), potential target genes were pre- samples per group (rats treated with and without the pared as follows (Fig.1): [1] 313 genes were initially intervention) were analyzed using a microarray analy- chosen due to their location within linkage disequilib- sis. rium (LD) blocks arbitrarily demarcated with an LD The Illumina expression arrays were preprocessed coefficient r2 of ≥ 0.5 or so by lead SNPs at the indi- using the GenomeStudio Gene Expression Module vidual GWAS loci; [2] 280 genes were left after 33 (of (Illumina). The data analyses were limited to probe 313) genes without rat orthologs were filtered out; [3] sets whose transcripts were detectable (with a detec- 227 genes were tested for expression changes in the tion p-value of ＜0.05) across replicate array profiles rats after 53 (of 280) genes without microarray probes in our dataset. The current microarray data were used were further excluded; [4] a total of 78 genes were for two types of analyses: [1] to screen for differen- subjected to qPCR, including 49 genes that satisfied tially expressed genes among a list of rat genes orthol- the cut-off level (i.e., |fold change |≥ 1.3 and P＜0.1) ogous to those associated with lipid traits on human for screening in the microarray dataset, except for the GWAS (Supplementary Table 1) and [2] to investi- ortholog at HLA, and 29 genes added to the list prin- gate the functional relevance of the differentially cipally due to their functional importance or the need expressed genes based on the experimental genomic to increase coverage (Supplementary Table 2). In this data for biological interactions and functional annota- analysis, 18 of the 29 genes were derived from func- 458 Akiyama et al.
Human genes located at 98 lipid 313 (98 unique loci) loci identified in GWAS
Rat orthologous genes 280 (97 unique loci) 33
Microarray probes available for the rat 227 (91 unique loci) 53 genes
Microarray probes with detectable 154 (74 unique loci) 73 transcripts
Expression changes induced by HFD |fold change|>1.3 and P 0.1 (n=4 per group)
Retroperitoneal Liver adipose tissue 29 genes 254 21 25 genes (18.8% of 154) (16.2% of 154) 29 genes* additionally examined by qPCR (*functional importance Validation by qPCR (n=8 per grou p) or necessity to increase coverage)
Retroperitoneal Liver 21 3 9 adipose tissue
Fig. 1. Study design and summary results for the high-fat, high-cholesterol diet (HFD) inter- vention in the rats. The numbers of genes (and unique loci) that remained at each step are shown at the top and those with a differential expression induced by HFD are sche- matically depicted within the Venn diagrams at the bottom. tional genes previously detected using cis-eQTL and determined according to Welch’s t-test (two-tailed, cell-based RNAi studies1, 6). In addition to the rat unpaired). The values are expressed as the mean± samples analyzed via microarray (n=4 per group; dis- SEM, unless otherwise indicated. covery panel), the remaining samples (n=4 per group; For the differentially expressed genes induced by validation panel) were used for qPCR. As an approach HFD, we set a P-value of ≤ 0.05/98 (loci) ≈ 0.0005 as to clarify the functional relevance, we further used being statistically significant after adjusting for multi- qPCR to examine several selected genes assumed to ple testing (Table 1); we assumed the presence of ≥ 1 interact with three (Stac3, Nduf4l2 and Madd) of the functional (cis-acting) genes per lipid-associated locus uncharacterized genes showing a differential expres- and therefore adopted the number of tested loci for sion induced by HFD, according to BioGRID ver. 3.2 the adjustment. Moreover, we set a nominal P-value of (http://thebiogrid.org/)14): Ppara for Stac3, Dynll1 and ≤ 0.05 as suggestive (Supplementary Table 3), as sup- RGD1310769 (rat homolog to C14orf1) for Nduf4l2 portive data for candidacy has been reported in other and Grk5 for Madd. experimental procedures for some of the genes tested For a total of 36 differentially expressed genes in the current study. (both significant and suggestive) induced by HFD, we Otherwise, a P-value of ≤ 0.05 was deemed to be examined the expression changes induced by atorvas- statistically significant. tatin. Results Statistics The unpaired Student’s t-test was used to assess Phenotype Changes Induced by the Interventions inter-group differences in the physiological parameters The four-week administration of HFD induced and changes in the tissue mRNA levels (in relation to highly significant (P＜0.001) increases in the total the dietary and pharmacological interventions). For cholesterol levels in the SHR rats compared to that the microarray analysis, statistical significance was observed in the rats fed the normal rat chow (Supple- Functional Genes for Lipid Regulation 459 n.s. Coronary artery disease b TC / TC HDL N/A HDL N/A LDL,TG LDL / TCLDL / significant TCLDL / significant LDL / TCLDL / significant HDL / TCHDL / n.s. Lead trait / HDL / TGHDL / n.s. TG / HDLTG n.s. TG / HDLTG significant Other traits Other Human GWAS Human c [6.6] [4.6] [0.6] [13.0] [19.0] [0.03] [148.0] rs4299376 rs7120118 gene (kb)] [distance to rs11613352 [within-gene] [within-gene] [within-gene] P -value Lead SNP 1.1E-06 0.1. See details in the Methods section. In each category, each category, section. In details in the Methods 0.1. See a ＜ 1.3 and P none none none none none none none none none INGENUITY Cancer Disease metastasis 5.7E-14 rs2479409 pelvic cancer 1.9E-05 P -value 1.5E-06 a ＋ none none none none none INGENUITY necrosis 1.9E-25 necrosis 5.6E-12 apoptosis 2.3E-22apoptosis lymphohematopoietic cancer 3.3E-07 2.3E-22 of lipid metabolism disorder 6.9E-08 release of Ca2 release 5E-4) after high-fat-high-cholesterol diet (HFD), are depicted in the table. diet (HFD), are 5E-4) after high-fat-high-cholesterol proliferation of cellsproliferation 1.1E-12 concentration of lipid 3.3E-22 hematological neoplasia 9.2E-08 quantity of leukocytes 4.4E-23 hematological neoplasia 9.2E-08 rs6882076 inflammatory response 1.0E-21 ＜ . 1) 0.044 cell movement 2.1E-07 disease vascular 5.4E-06 0.433 migration of cells 2.4E-07 0.509 apoptosis 5.6E-13 0.0440.118 of cells proliferation 1.1E-12 necrosis disease vascular 5.6E-12 5.4E-06 arteriosclerosis 6.7E-05 P -value Processes 5.2E-087.8E-05 cell movement concentration of lipid 3.3E-22 2.2E-22 occlusion of blood vessel 8.3E-18 of artery disorder 7.6E-18 5.2E-08 concentration of lipid3.3E-06 3.3E-22 fatty acid metabolism 1.0E-20 of artery disorder occlusion of blood vessel 8.3E-18 7.6E-18 1.8E-07 quantity of leukocytes1.0E-05 4.4E-23 concentration of lipid systemic autoimmune syndrome 3.3E-22 3.1E-21 of artery disorder 7.6E-18 5.2E-08 synthesis of lipid 1.0E-23 disease vascular 1.8E-23 rs12678919 a Activation Activation α α none none none none none none none none none none none none none none Pathways /RXR /RXR α α TNFR1 Signaling TNFR1 Hepatic Cholestasis Hepatic FXR/RXR Activation FXR/RXR Activation LXR/RXR Activation LXR/RXR Activation LXR/RXR Activation LXR/RXR Activation LXR/RXR Activation Atherosclerosis Signaling Atherosclerosis PPAR PPAR ( t -test) -value P -value by HFD by Direction Direction change High-fat-high-cholesterol diet (HFD)-induced significant expression changes in the liver and/or adipose tissue for rat genes orthologous changes in the liver to those associated diet (HFD)-induced significant expression High-fat-high-cholesterol with lipid traits in human Expression change by qRT-PCR change by Expression INGENUITY Tissue Fold The corresponding information was drawn from the previous study of human lipid GWAS meta-analysis study of human lipid GWAS the previous information was drawn from The corresponding INGENUITY iReport (INGENUITY Systems, Qiagen) was used to identify functionallly relevant expression changes in DNA microarray data. To perform an annotation enrichment analysis by the Fisher’s exact test, which identifies perform the Fisher’s an annotation enrichment analysis by To data. changes in DNA microarray expression INGENUITY (INGENUITYQiagen) was used to identify functionallly relevant iReport Systems, The distance is from a lead SNP to the transcription start (or end) site of the differentially expressed gene. expressed a lead SNP to the transcription startThe distance is from (or end) site of the differentially A total of 10 genes, which were confirmed to show differential expression (at an adjusted significance level of P (at an adjusted significance level expression differential confirmed to show A total of 10 genes, which were Table 1. Table Rat gene Stac3 Liver 10.35 down 8.3E-05 Abca1 Adipose 2.24 UP 6.0E-07 of RXR Function Inhibition LPS/IL-1 Mediated 0.016 apoptosis 5.6E-13 of artery disorder 5.2E-06 rs1883025 a of |fold change| ≥ adopted cut-off levels genes, we expressed in the differentially significantly overrepresented that are and Diseases Processes, Biological Pathways, c applicable; n.s., not significant. N/A, not total cholesterol; TC, triglycerides; TG, HDL, high-density lipoprotein; lipoprotein; LDL, low-density Abbreviations: top-3 enrichment groups are presented. are top-3 enrichment groups b Abcg8 Liver 8.81 UP 8.8E-06 Abcg5 Liver 6.85 UP 4.1E-06 of RXR Function Inhibition LPS/IL-1 Mediated 6.5E-10 synthesis of lipid 1.0E-23Madd Adipose 1.40 UP disease vascular 1.5E-05 1.8E-23 rs4299376 Pltp Liver 3.20 UP 1.6E-05 of RXR Function Inhibition LPS/IL-1 Mediated 6.5E-10 synthesis of lipid 1.0E-23 disease vascular 1.8E-23 rs6065906 Lpl Liver 3.48 UP 6.4E-08 Nr1h3 Adipose 1.31 UP 7.1E-05 of RXR Function Inhibition LPS/IL-1 Mediated 0.016 apoptosis 5.6E-13 of artery disorder 5.2E-06 rs7120118 Timd4 Liver 3.10 UP 2.0E-05 Pcsk9 Liver 3.23 down 5.3E-05 460 Akiyama et al.
mentary Table 4). On the other hand, significant RGD1310769 and Grk5, respectively (Fig.3). (P=0.0012) and borderline (P=0.07) decreases in the free fatty acid and triglyceride levels, respectively, were Pathway Analysis of the HFD-Induced Genes induced by atorvastatin in the SHRSP rats8). There- Although approximately 30% of the differen- fore, the two types of interventions were considered to tially expressed genes turned out to be genes with induce noticeable biochemical changes at 16 weeks of well-characterized lipid regulatory functions, the age, at which time the tissue mRNA levels were inves- remaining had not yet been characterized. In order to tigated. identify potential mechanisms by which these unchar- acterized genes impact lipid metabolism, we per- Differentially Expressed Genes Induced by the formed a pathway analysis using microarray data sets. HFD For the known functional genes, such as Abcg5, Lpl, Among the 98 lipid-associated loci previously Pcsk9 and Pltp, the gene annotation reports were reported on GWAS1, 11-13), we first selected 313 genes related to lipid homeostasis and/or vascular disease; for the current analysis. Of these 313 genes, we found however, for the uncharacterized genes, we were barely rat orthologs for 280 genes derived from 97 lipid- able to link them to lipid regulatory functions based associated loci. We used microarray data for 154 (of on existing knowledge (Table 1 and Supplementary 227) quality-controlled genes to identify differentially Table 3). expressed genes induced by HFD in the rats and addi- tionally examined six genes without microarray probes Differentially Expressed Genes Induced by Atorvastatin using qPCR. Therefore, a total of 160 genes (51% of For the 33 genes differentially expressed (10 sig- 313 genes) derived from 74 lipid-associated loci were nificant and 23 suggestive) by HFD, we examined the screened (Fig. 1). expression changes induced by atorvastatin. Among Approximately one-fifth of the genes (50 genes, these genes, although statistical significance was sug- including Abcg8 and Myrf) satisfied the cut-off level gestive after adjusting for multiple testing, Stac3 for screening (|fold change| ≥ 1.3 and P＜0.1) and were showed gene expression changes (2.1-fold, P=0.045; subjected to verification with qPCR (except the ortho- Fig.3), similar to several genes known to be involved log at HLA), together with 29 other genes that either in lipid metabolism (Supplementary Fig.1). failed to satisfy the cut-off level or were insufficiently assessed according to the microarray data. Of the 78 Possible Functional Genes Detectable According to genes thus investigated, 10 showed a significant (P＜ Three Analytical Methods 0.0005) differential expression; seven genes were Prior to the current study, two types of analyses known to be involved in lipid metabolism, whereas of lipid-associated GWAS loci—cis-eQTL and cell- there was no prior knowledge regarding the involve- based RNAi studies1, 6) —had identified functional ment of the other genes (Table 1). When we set the genes that may underlie the observed associations. In cut-off value for statistical significance to a more gen- order to integrate our findings with those of previous erous level, 23 additional genes were found to exhibit studies1, 6), we summarized a list of possible functional a suggestive (nominal P ≤ 0.05) differential expression, genes, as shown in Supplementary Table 5 with a of which three genes were known to be involved in schematic demonstration in Fig.4. A total of 121 lipid metabolism (Supplementary Table 3). genes derived from 67 GWAS loci showed some func- In order to assess the locations of these putative tional relevance to lipid associations; 15 of these 121 functional genes at the individual GWAS loci, we genes (12%) were detectable according to two analyti- depicted the combined results for the gene expression cal methods and one gene was detectable using all changes, P-value plots for lipid GWAS, LD plots for three methods. the SNPs and genomic positions of annotated genes in Furthermore, based on the DAVID Bioinformat- the relevant chromosomal regions (Fig.2). At a few ics Resources9), we noted a few KEGG pathways, loci, more than one gene per locus appeared to exhibit including the PPAR signaling pathway, ABC trans- a differential expression (Table 1 and Supplementary porters and glycerolipid metabolism, in which some of Table 3). For example, at the 11p11.2 locus, two the 121 genes were significantly (Fisher’s exact P＜ genes—Nr1h3 and Madd—showed significant expres- 0.05) enriched (Supplementary Table 6). According sion changes induced by HFD. to the g:Profiler toolset10), we also found a signifi- In addition, among the genes assumed to interact cantly enriched network of BioGRID interactions with three uncharacterized genes—Stac3, Nduf4l2 and (Supplementary Fig.2) in which six significant Madd, we found a differential expression for Ppara, (Abca1, Abcg5, Abcg8, Lpl, Pltp and Stac3) and three Functional Genes for Lipid Regulation 461
0 0.6 0.8 1 R2 Sentinel SNP
30 10 25 18 rs6882076 rs11613352 rs6065906 rs7120118 L)] L)] L)]
G)] 15 D D 8 20 D T
20 12 6 15 9 4 10 [P (GLGC_ [P (GLGC_H [P (GLGC_H 10 6 [P (GLGC_H 10 10 10 10 2 5 -log -log -log
3 -log
0 0 0 0 156.2 156.3 156.4 55.8 55.9 56.0 56.1 43.95 44.0 44.04 47.1 47.2 47.3 Chromosome 5 (Mb) Chromosome 12 (Mb) Chromosome 20 (Mb) Chromosome 11 (Mb)
TIMD4 HAVCR1 NDUFA4L2 CTSA PCIF1 PACSIN3 DDB2 NR1H3 MYBPC3 Stac3 SHMT2 R3HDM2 INHBC PLTP ZNF335 ACP2 MADD SPI1
Timd4 Havcr1 Ndufa4l2 R3hdm2 Pltp Zfp335 Ddb2 Nr1h3 4 2 2 4 2 2 2 *p=1.6E- *p=2E-5 *p=0.015 *p=1.6E-5 *p=7.1E-5 3 1.5 1.5 3 5 1.5 1.5 1.5
2 1 1 2 1 1 1 ssion ratio ssion ratio D/chow) No expression 1 0.5 0.5 1 0.5 0.5 0.5 (HF Expre 0 0 0 0 0 0 0 chow HFD chow HFD chow HFD chow HFD chow HFD chow HFD chow HFD chow HFD
Liver Shmt2 Stac3 Inhbc Pcif1 Acp2 Madd 2 2 2 2 2 2 *p=8.3E-5 *p=1.5E-5 1.5 1.5 1.5 1.5 1.5 1.5 ow) ow) n ratio n ratio n ratio n ratio n ratio n ratio how) h h o o o 1 1 1 1 1 1 0.5 0.5 0.5 0.5 0.5 (HFD/c (HFD/c (HFD/c 0.5 Expressi Expressi Expressi 0 0 0 0 0 0 chow HFD chow HFD chow HFD chow HFD chow HFD chow HFD
Liver Liver Adipose tissue
0 0.6 0.8 1 R2 Sentinel SNP
30 50 140 40 rs2479409 rs4299376 rs12678919 rs1883025 120 40 100 30 20 30 80
20 GC_HDL)] LGC_LDL)] LGC_TG)] LGC_LDL)] 60 L 20 10 [P (G [P (G [P (G 40
10 [P (G 10 10 10
10 10 20 -log -log -log -log 0 0 0 0 55.25 55.27 55.29 55.31 43.87 43.92 43.97 19.82 19.87 19.92 19.97 106.5 106.6 106.7 Chromosome 9 (Mb) Chromosome 1 (Mb) Chromosome 2 (Mb) Chromosome 8 (Mb) DYNC2LI1 NYPSNAP3A USP24 ABCG8 PCSK9 ABCG5 LRPPRC LPL ABCA1
Pcsk9 Abcg5 Abcg8 Lpl Abca1 Abca1 2 12 12 4 3
3 o *p=5.3E -5 o *p=4.1E -6 *p=8.8E -6 *p= 6. 4E-8 *p= 0. 0057 *6E*p=6E-7 1.5 9 9 3 2 2 1 6 6 2 1 0.5 3 3 1 1 (HFD/chow) (HFD/chow) (HFD/chow) (HFD/chow) Expression rati Expression Expression rati Expression Expression ratio ratio Expression
0 0 ratio Expression 0 0 0 0 chow HFD chow HFD chow HFD chow HFD chow HFD chow HFD Liver Liver Liver Liver Adipose tissue
Fig.2. Lipid GWAS loci containing significant genes with a differential expression induced by HFD. At each locus, the combined panels of results are shown for P-value plots of lipid associations previously reported in the Global Lipids Genetics Consortium (GLGC) GWAS1) (in the top panel), genomic positions of annotated genes and LD plots for SNPs located in the corresponding chromosomal regions (in the middle panel) and bar graphs for the ratios of the gene expression levels in the HFD group to the normal rat chow group (in the bottom panel); the results for the liver and adipose tissues are colored in green and blue, respectively. 462 Akiyama et al.
Aa)B b) Cc) RGD1310769 Stac3 Ppara Nduf4l2 (C14orf1) Madd Grk5 2 3 2 2 2 2 *** *** * ** *** *** 1.5 1.5 1.5 1.5 1.5 ) ) ) atio atio 2 atio r r r w w w 1 1 1 1 1
1 (HFD/cho (HFD/cho 0.5 (HFD/cho 0.5 0.5 0.5 0.5 Expression Expression Expression
0 0 0 0 0 0 chow HFD chow HFD chow HFD chow HFD chow HFD chow HFD
RGD1310769 Stac3 Ppara Nduf4l2 (C14orf1) Madd Grk5 33 2 3 2 2 2 * n.s. n.s. n.s. n.s. n.s. trol) ontrol) 1.5 ratio 1.5 trol) 1.5 io 1.5 tio t c
2 n 2 n a 2 1 1 1 1 1 1
Expression 0.5 0.5 0.5 0.5 (Atorvastatin/ Expression r Expression ra (Atorvastatin/co (Atorvastatin/co 00 0 0 0 0 0 control Atorvastatin control Atorvastatin control Atorvastatin control Atorvastatin contltrol Atorvas tati n contltrol Atorvas tati n
Fig.3. Gene expression changes induced by the HFD (top) and atorvastatin (bottom) interventions. Bar graphs for the ratios of the gene expression levels (in the intervention group to the control-diet group) are shown for a total of six genes: (A) Stac3 and Ppara, (B) Nduf4l2 and RGD1310769 (rat ortholog to C14orf1) and (C) Madd and Grk5. See the Methods section for details. ＊P＜0.05, ＊＊P＜0.01 and ＊＊＊P＜0.001, statistical differences were evaluated using the unpaired t-test between the intervention and control- diet groups (n=8 each for the HFD intervention and n=4 each for the atorvastatin intervention). n.s., not significant.
HFD-intervention study suggestive (Arhgap1, Mylip and Ubash3b) genes were 33 genes/ 24 loci included as “nodes.”
Discussion 22 In the present study, we identified, via an HFD intervention in rats, seven known (Abca1, Abcg5, 55 Abcg8, Lpl, Nr1h3, Pcsk9 and Pltp) and three novel (Madd, Stac3 and Timd4) genes as potential targets 1 that may underlie lipid associations previously reported in human GWAS1, 11-13). Moreover, 23 43 5 40 other genes were found to be differentially expressed as a result of the HFD intervention, although at a suggestive level of significance, constituting further candidate target genes at lipid GWAS loci. While 33 genes with a differential expression induced by HFD Expression RNAi-based partially overlapped with those detected using two QTL analysis profiling in vitro types of previously reported functional analyses 54 genes/ 35 loci 51 genes/ 26 loci (eQTL and RNAi studies)1, 6), the use of a combina- tion of different experimental approaches to system- Fig.4. atically follow up GWAS loci appears to help increase Overlap of potential functional genes at lipid GWAS loci. The the list of target genes. Venn diagram illustrates the number of genes detected in the HFD The identification of eQTL, in particular, cis- intervention study (this study), eQTL analyses and/or RNAi-based eQTL, is expected to be useful and most commonly functional profiling in vitro. The number of genes detected using 4, two or three approaches is shown in the appropriate segments. applied to predict target genes of GWAS associations 5). However, analyses of eQTL have not yet provided a powerful means of comprehensively capturing target genes. In the case of lipid traits, analyses of cis-eQTL in the liver and adipose tissue (omental and subcuta- Functional Genes for Lipid Regulation 463
neous fat) have allowed researchers to select a single or tor 1 to activate mitogen-activated protein kinase and few potential target genes per locus for a portion of propagate apoptotic signals. Grk5 (G protein-coupled GWAS-identified loci1), although the proportion is receptor kinase 5), which is also reported to interact ＜40% (Fig.4). While the systematic identification of with Madd27), has been demonstrated to exhibit a sig- trans-eQTL is being vigorously explored, the findings nificant increase in its gene expression induced by appear to be mostly limited to peripheral blood sam- HFD (Fig.3), supporting the potential involvement ples at present15). Although eQTL mapping provides a of both Grk5 and Madd in lipid metabolism. The valuable approach to linking the genotype with the Timd4 gene encodes T-cell immunoglobulin and gene expression, a subsequent range of experimental mucin domain-containing protein 4 and likely regu- techniques are required to validate the relationships lates T-cell proliferation as well as play a role in auto- between genes and phenotypes in order to elucidate immunity. At present, the potential involvement of the involved mechanisms. In these respects, the pres- Timd4 in lipid metabolism is supported only by our ent study has been shown to offer a complementary findings of its HFD-induced differential expression, approach for functionally following up GWAS hits. and further investigation is warranted to confirm our The list of potential target genes identified in results. Moreover, of note is the fact that ＞1 target this study demonstrates a proof of concept as well as genes (rat orthologs) can be nominated at a few loci - novel findings. Among 10 significant genes with a dif- Nr1h3 and Madd on 11p11.2, Ndufa4l2 and Stac3 on ferential expression induced by HFD (Table 1), seven 12q13.3 and Abcg5 and Abcg8 on 2p21 (Supplemen- are known to be involved in lipid metabolism, provid- tary Tables 1 and 2; adjusted P-values are significant ing a scientific rationale for the experimental design. except for the Ndufa4l2 expression). These findings For example, mutations in the LPL gene have been are in good agreement with those of a previous reported to cause familial combined hyperlipidemia report28) that validated the presence of multiple causal (MIM#144250)16), while mutations in ABCA1 cause genes at a single GWAS locus associated with blood Tangier disease (MIM#205400) and HDL deficiency, pressure or hypertension. type 2 (MIM#604091)17), those in ABCG5/ABCG8 In order to corroborate the results for the target cause sitosterolemia (MIM#210250)18) and those in genes of lipid associations, we additionally evaluated PCSK9 cause autosomal dominant hypercholesterol- gene expression changes induced by atorvastatin emia (MIM#603776)19). Regarding NR1H3 and (Fig.3 and Supplementary Fig.1). Among 10 signifi- PLTP, although no mutations have been reported to cant genes (Table 1), three known (Abcg5, Abcg8 and support their pathological role in the onset of heredi- Nr1h3) and one novel (Stac3) gene were found to tary dyslipidemia, their functional relevance to lipid show a differential expression induced by atorvastatin metabolism has been demonstrated in knockout in the liver or adipose tissue. Among 23 other sugges- mice20, 21). Furthermore, among 23 unique genes tive genes (Supplementary Table 3), three known showing a suggestive differential expression (Supple- (Hmgcr, Lipg and Mylip) and one novel (Fads1) gene mentary Table 3), functional importance in lipid were similarly found to exhibit a differential expres- metabolism has also been established for HMGCR, sion induced by atorvastatin, indicating that genes LIPG and MYLIP22-24). Hence, the identification of with a suggestive differential expression under condi- these known genes may be considered a proof of con- tions of HFD are worth pursuing. cept in our experiment using the HFD intervention in Of particular note is that Stac3 was found to be a the animal model. novel gene showing a differential expression induced Three of 10 genes with a significant differential by both HFD intervention and atorvastatin treatment. expression—Stac3, Madd and Timd4 (Table 1)—are Stac3 has been identified to be a nutritionally regu- novel targets of lipid associations. The Stac3 gene lated gene with the highest expression in skeletal mus- encodes the SH3 and cysteine-rich domain 3, a com- cle. Although the detailed mechanisms remain unclear, ponent of the excitation-contraction coupling machin- Igf-bp5 and Igf2 are downregulated together with the ery in muscles. Ppara (peroxisome proliferator-acti- suppression of Akt signaling following RNAi knock- vated receptor alpha), which is known to play a role in down of the Stac3 mRNA levels in a C2C12 myo- lipid metabolism and interact with Stac325, 26), has also genic cell line29). In addition, it has been demonstrated been shown to display a significant increase in its gene that, in adult mice, a reduction in the IGF2 expres- expression induced by HFD (Fig.3), supporting the sion is accompanied by increased fat deposition and possible involvement of Stac3 in lipid metabolism. occasional obesity, suggesting that IGF2 affects fat The Madd gene encodes the MAP-kinase activating metabolism30). Hence, further investigation is war- death domain, which interacts with TNF-alpha recep- ranted to elucidate the biological links between Stac3 464 Akiyama et al.
and lipid metabolism. selected the initial list of 313 genes within LD blocks There is partial overlap between genes with a of the lead SNPs at individual loci (Fig.1), and, con- HFD-induced differential expression and those detect- sequently, a substantial proportion of target genes out- able using eQTL studies and/or RNAi-based func- side of the LD block may not have been included. tional profiling (Fig.4). Even if suggestive genes are Third, for a given gene, although its differential included in the list of target genes identified on HFD expression induced by HFD provides a clue regarding intervention studies, only a single gene, Lipg, exhibits its functional relevance to lipid metabolism, the find- overlap across the three approaches. An appreciable ings should be further confirmed using an array of portion (66-76%) of candidate target genes are detect- bioinformatic and molecular experimental approaches. able exclusively by single approaches. This observation Hence, further research is warranted in order to verify suggests that the use of multiple approaches increases causality and clarify the underlying mechanisms. the chance of nominating more target genes of lipid associations when following up GWAS hits. In other Conclusion words, this phenomenon should give researchers a warning against relying on current eQTL analysis data The present data indicate that a total of 33 genes alone. For instance, between the HFD intervention —10 significant and 23 other suggestive genes—with and eQTL studies, only six genes, including Lipg, a differential expression induced by HFD constitute overlapped; all but Pltp are suggestive genes. Several potential targets at 24 lipid GWAS loci. Our experi- known genes, such as Abca1, Abcg5, Abcg8, Lpl, Nr1h3 mental in vivo approach may help to increase the abil- and Pcsk9, can be detected using HFD intervention ity to identify target gene(s) of cis-regulatory variants, studies but not eQTL studies. This discrepancy may when combined with other functional approaches, be due to a number of reasons. First, a cell- or tissue- such as eQTL studies, thus improving understanding specific context is a key determinant of gene regula- of the mechanisms by which GWAS variants act. tion, although collecting large numbers of diverse tis- sues in humans remains challenging, with the excep- Acknowledgments tion of a few easily sampled cell types, such as lym- phocytes31). In the case of lipid traits, trait-relevant tis- This work was supported by a grant-in-aid from sues are generally assumed to be the liver and adipose MEXT/JSPS KAKENHI (Grant Number 26290067), tissue; however, the function of a given target gene grants from the National Center for Global Health may become prominent in other tissues, such as the and Medicine (NCGM) (23S-302 and 26S-111) and small intestine; e.g., NPC1L1 proteins play a critical a grant for Core Research for Evolutional Science and role in the absorption of intestinal cholesterol32). Sec- Technology from the Japan Science Technology ond, the difficulty in post-GWAS fine mapping the Agency. associated loci is an issue of note4). At a given GWAS locus, causal variants often lie within a linkage dis- equilibrium (LD) block, which hampers their precise References localization among a cluster of highly correlated, trait- 1) Teslovich TM, Musunuru K, Smith AV, Edmondson AC, associated variants. In addition, the position of causal Stylianou IM, Koseki M, Pirruccello JP, Ripatti S, Chas- variants has been shown to be distant from their target man DI, Willer CJ, Johansen CT, Fouchier SW, Isaacs A, genes; therefore, they should not be evaluated solely Peloso GM, Barbalic M, Ricketts SL, Bis JC, Aulchenko on the basis of physical proximity3, 4). Third, although YS, Thorleifsson G, Feitosa MF, Chambers J, Orho- Melander M, Melander O, Johnson T, Li X, Guo X, Li M, current eQTL studies mostly focus on cis-acting and Shin Cho Y, Jin Go M, Jin Kim Y, Lee JY, Park T, Kim K, coding RNA, there may be other mechanisms that Sim X, Twee-Hee Ong R, Croteau-Chonka DC, Lange contribute to GWAS associations4); e.g., trans-eQTL, LA, Smith JD, Song K, Hua Zhao J, Yuan X, Luan J, whose effect size is relatively small and difficult to Lamina C, Ziegler A, Zhang W, Zee RY, Wright AF, Wit- detect with a modest sample size33), as well as non- teman JC, Wilson JF, Willemsen G, Wichmann HE, coding RNA and epigenetic changes. Whitfield JB, Waterworth DM, Wareham NJ, Waeber G, In addition to the issues inherent to gene expres- Vollenweider P, Voight BF, Vitart V, Uitterlinden AG, Uda M, Tuomilehto J, Thompson JR, Tanaka T, Surakka sion studies, as mentioned above, there are several I, Stringham HM, Spector TD, Soranzo N, Smit JH, limitations associated with the present study. First, as Sinisalo J, Silander K, Sijbrands EJ, Scuteri A, Scott J, we used an animal model (i.e., rats) for the HFD Schlessinger D, Sanna S, Salomaa V, Saharinen J, Sabatti intervention, inter-species differences in lipid metabo- C, Ruokonen A, Rudan I, Rose LM, Roberts R, Rieder lism must be considered. Second, we arbitrarily M, Psaty BM, Pramstaller PP, Pichler I, Perola M, Pen- Functional Genes for Lipid Regulation 465
ninx BW, Pedersen NL, Pattaro C, Parker AN, Pare G, K, Swift AJ, Tiret L, Uitterlinden AG, van Pelt LJ, Vedan- Oostra BA, O’Donnell CJ, Nieminen MS, Nickerson tam S, Wainwright N, Wijmenga C, Wild SH, Willemsen DA, Montgomery GW, Meitinger T, McPherson R, G, Wilsgaard T, Wilson JF, Young EH, Zhao JH, Adair McCarthy MI, McArdle W, Masson D, Martin NG, Mar- LS, Arveiler D, Assimes TL, Bandinelli S, Bennett F, roni F, Mangino M, Magnusson PK, Lucas G, Luben R, Bochud M, Boehm BO, Boomsma DI, Borecki IB, Born- Loos RJ, Lokki ML, Lettre G, Langenberg C, Launer LJ, stein SR, Bovet P, Burnier M, Campbell H, Chakravarti Lakatta EG, Laaksonen R, Kyvik KO, Kronenberg F, A, Chambers JC, Chen YD, Collins FS, Cooper RS, König IR, Khaw KT, Kaprio J, Kaplan LM, Johansson A, Danesh J, Dedoussis G, de Faire U, Feranil AB, Ferrières Jarvelin MR, Janssens AC, Ingelsson E, Igl W, Kees Hov- J, Ferrucci L, Freimer NB, Gieger C, Groop LC, Gudna- ingh G, Hottenga JJ, Hofman A, Hicks AA, Hengsten- son V, Gyllensten U, Hamsten A, Harris TB, Hingorani berg C, Heid IM, Hayward C, Havulinna AS, Hastie A, Hirschhorn JN, Hofman A, Hovingh GK, Hsiung CA, ND, Harris TB, Haritunians T, Hall AS, Gyllensten U, Humphries SE, Hunt SC, Hveem K, Iribarren C, Järvelin Guiducci C, Groop LC, Gonzalez E, Gieger C, Freimer MR, Jula A, Kähönen M, Kaprio J, Kesäniemi A, Kivi- NB, Ferrucci L, Erdmann J, Elliott P, Ejebe KG, Döring maki M, Kooner JS, Koudstaal PJ, Krauss RM, Kuh D, A, Dominiczak AF, Demissie S, Deloukas P, de Geus EJ, Kuusisto J, Kyvik KO, Laakso M, Lakka TA, Lind L, de Faire U, Crawford G, Collins FS, Chen YD, Caulfield Lindgren CM, Martin NG, März W, McCarthy MI, MJ, Campbell H, Burtt NP, Bonnycastle LL, Boomsma McKenzie CA, Meneton P, Metspalu A, Moilanen L, DI, Boekholdt SM, Bergman RN, Barroso I, Bandinelli S, Morris AD, Munroe PB, Njølstad I, Pedersen NL, Power Ballantyne CM, Assimes TL, Quertermous T, Altshuler D, C, Pramstaller PP, Price JF, Psaty BM, Quertermous T, Seielstad M, Wong TY, Tai ES, Feranil AB, Kuzawa CW, Rauramaa R, Saleheen D, Salomaa V, Sanghera DK, Sara- Adair LS, Taylor HA Jr, Borecki IB, Gabriel SB, Wilson mies J, Schwarz PE, Sheu WH, Shuldiner AR, Siegbahn JG, Holm H, Thorsteinsdottir U, Gudnason V, Krauss A, Spector TD, Stefansson K, Strachan DP, Tayo BO, RM, Mohlke KL, Ordovas JM, Munroe PB, Kooner JS, Tremoli E, Tuomilehto J, Uusitupa M, van Duijn CM, Tall AR, Hegele RA, Kastelein JJ, Schadt EE, Rotter JI, Vollenweider P, Wallentin L, Wareham NJ, Whitfield JB, Boerwinkle E, Strachan DP, Mooser V, Stefansson K, Wolffenbuttel BH, Ordovas JM, Boerwinkle E, Palmer Reilly MP, Samani NJ, Schunkert H, Cupples LA, CN, Thorsteinsdottir U, Chasman DI, Rotter JI, Franks Sandhu MS, Ridker PM, Rader DJ, van Duijn CM, Pel- PW, Ripatti S, Cupples LA, Sandhu MS, Rich SS, tonen L, Abecasis GR, Boehnke M, Kathiresan S: Biologi- Boehnke M, Deloukas P, Kathiresan S, Mohlke KL, cal, clinical and population relevance of 95 loci for blood Ingelsson E, Abecasis GR: Discovery and refinement of lipids. Nature, 2010; 466: 707-713 loci associated with lipid levels. Nat Genet, 2013; 45: 2) Global Lipids Genetics Consortium, Willer CJ, Schmidt 1274-1283 EM, Sengupta S, Peloso GM, Gustafsson S, Kanoni S, 3) Maurano MT, Humbert R, Rynes E, Thurman RE, Hau- Ganna A, Chen J, Buchkovich ML, Mora S, Beckmann gen E, Wang H, Reynolds AP, Sandstrom R, Qu H, JS, Bragg-Gresham JL, Chang HY, Demirkan A, Den Brody J, Shafer A, Neri F, Lee K, Kutyavin T, Stehling- Hertog HM, Do R, Donnelly LA, Ehret GB, Esko T, Sun S, Johnson AK, Canfield TK, Giste E, Diegel M, Feitosa MF, Ferreira T, Fischer K, Fontanillas P, Fraser Bates D, Hansen RS, Neph S, Sabo PJ, Heimfeld S, Rau- RM, Freitag DF, Gurdasani D, Heikkilä K, Hyppönen E, bitschek A, Ziegler S, Cotsapas C, Sotoodehnia N, Glass I, Isaacs A, Jackson AU, Johansson A, Johnson T, Kaakinen Sunyaev SR, Kaul R, Stamatoyannopoulos JA: Systematic M, Kettunen J, Kleber ME, Li X, Luan J, Lyytikäinen LP, localization of common disease-associated variation in Magnusson PK, Mangino M, Mihailov E, Montasser ME, regulatory DNA. Science, 2012; 337: 1190-1195 Müller-Nurasyid M, Nolte IM, O’Connell JR, Palmer 4) Edwards SL, Beesley J, French JD, Dunning AM: Beyond CD, Perola M, Petersen AK, Sanna S, Saxena R, Service GWASs: illuminating the dark road from association to SK, Shah S, Shungin D, Sidore C, Song C, Strawbridge function. Am J Hum Genet, 2013; 93: 779-797 RJ, Surakka I, Tanaka T, Teslovich TM, Thorleifsson G, 5) Mackay TF, Stone EA, Ayroles JF: The genetics of quanti- Van den Herik EG, Voight BF, Volcik KA, Waite LL, tative traits: challenges and prospects. Nat Rev Genet, Wong A, Wu Y, Zhang W, Absher D, Asiki G, Barroso I, 2009; 10: 565-577 Been LF, Bolton JL, Bonnycastle LL, Brambilla P, Burnett 6) Blattmann P, Schuberth C, Pepperkok R, Runz H: RNAi- MS, Cesana G, Dimitriou M, Doney AS, Döring A, based functional profiling of loci from blood lipid Elliott P, Epstein SE, Eyjolfsson GI, Gigante B, Goodarzi genome-wide association studies identifies genes with MO, Grallert H, Gravito ML, Groves CJ, Hallmans G, cholesterol-regulatory function. PLoS Genet, 2013; 9: Hartikainen AL, Hayward C, Hernandez D, Hicks AA, e1003338 Holm H, Hung YJ, Illig T, Jones MR, Kaleebu P, 7) Ochiai Y, Liang YQ, Serizawa M, Kato N: Dynamic Kastelein JJ, Khaw KT, Kim E, Klopp N, Komulainen P, changes of the renin-angiotensin and associated systems Kumari M, Langenberg C, Lehtimäki T, Lin SY, Lind- in the rat after pharmacological and dietary interventions ström J, Loos RJ, Mach F, McArdle WL, Meisinger C, in vivo. Physiol Genomics, 2008; 35: 330-340 Mitchell BD, Müller G, Nagaraja R, Narisu N, Nieminen 8) Kato N, Liang YQ, Ochiai Y, Jesmin S: Systemic evalua- TV, Nsubuga RN, Olafsson I, Ong KK, Palotie A, Papa- tion of gene expression changes in major target organs markou T, Pomilla C, Pouta A, Rader DJ, Reilly MP, Rid- induced by atorvastatin. Eur J Pharmacol, 2008; 584: ker PM, Rivadeneira F, Rudan I, Ruokonen A, Samani N, 376-389 Scharnagl H, Seeley J, Silander K, Stancáková A, Stirrups 9) Huang da W, Sherman BT, Lempicki RA: Systematic and 466 Akiyama et al.
integrative analysis of large gene lists using DAVID bioin- 18) Lee MH, Lu K, Patel SB: Genetic basis of sitosterolemia. formatics resources. Nat Protoc, 2009; 4: 44-57 Curr Opin Lipidol, 2001; 12: 141-149 10) Reimand J, Kull M, Peterson H, Hansen J, Vilo J: 19) Abifadel M, Rabès JP, Devillers M, Munnich A, Erlich D, g:Profiler -- a web-based toolset for functional profiling of Junien C, Varret M, Boileau C: Mutations and polymor- gene lists from large-scale experiments. Nucleic Acids Res, phisms in the proprotein convertase subtilisin kexin 9 2007; 35(Web Server issue): W193-W200 (PCSK9) gene in cholesterol metabolism and disease. 11) Willer CJ, Sanna S, Jackson AU, Scuteri A, Bonnycastle Hum Mutat, 2009; 30: 520-529 LL, Clarke R, Heath SC, Timpson NJ, Najjar SS, String- 20) Peet DJ, Turley SD, Ma W, Janowski BA, Lobaccaro JM, ham HM, Strait J, Duren WL, Maschio A, Busonero F, Hammer RE, Mangelsdorf DJ: Cholesterol and bile acid Mulas A, Albai G, Swift AJ, Morken MA, Narisu N, Ben- metabolism are impaired in mice lacking the nuclear oxy- nett D, Parish S, Shen H, Galan P, Meneton P, Hercberg sterol receptor LXR alpha. Cell, 1998; 93: 693-704 S, Zelenika D, Chen WM, Li Y, Scott LJ, Scheet PA, 21) Jiang XC, Bruce C, Mar J, Lin M, Ji Y, Francone OL, Tall Sundvall J, Watanabe RM, Nagaraja R, Ebrahim S, Law- AR: Targeted mutation of plasma phospholipid transfer lor DA, Ben-Shlomo Y, Davey-Smith G, Shuldiner AR, protein gene markedly reduces high-density lipoprotein Collins R, Bergman RN, Uda M, Tuomilehto J, Cao A, levels. J Clin Invest, 1999; 103: 907-914 Collins FS, Lakatta E, Lathrop GM, Boehnke M, Schless- 22) Sharpe LJ, Brown AJ: Controlling cholesterol synthesis inger D, Mohlke KL, Abecasis GR: Newly identified loci beyond 3-hydroxy-3-methylglutaryl-CoA reductase that influence lipid concentrations and risk of coronary (HMGCR). J Biol Chem, 2013; 288: 18707-18715 artery disease. Nat Genet, 2008; 40: 161-169 23) Jaye M, Lynch KJ, Krawiec J, Marchadier D, Maugeais C, 12) Sabatti C, Service SK, Hartikainen AL, Pouta A, Ripatti S, Doan K, South V, Amin D, Perrone M, Rader DJ: A Brodsky J, Jones CG, Zaitlen NA, Varilo T, Kaakinen M, novel endothelial-derived lipase that modulates HDL Sovio U, Ruokonen A, Laitinen J, Jakkula E, Coin L, metabolism. Nat Genet, 1999; 21: 424-428 Hoggart C, Collins A, Turunen H, Gabriel S, Elliot P, 24) Zelcer N, Hong C, Boyadjian R, Tontonoz P: LXR regu- McCarthy MI, Daly MJ, Järvelin MR, Freimer NB, Pel- lates cholesterol uptake through Idol-dependent ubiqui- tonen L: Genome-wide association analysis of metabolic tination of the LDL receptor. Science, 2009; 325: 100- traits in a birth cohort from a founder population. Nat 104 Genet, 2009; 41: 35-46 25) Pyper SR, Viswakarma N, Yu S, Reddy JK: PPARalpha: 13) Kathiresan S, Willer CJ, Peloso GM, Demissie S, Musun- energy combustion, hypolipidemia, inflammation and uru K, Schadt EE, Kaplan L, Bennett D, Li Y, Tanaka T, cancer. Nucl Recept Signal, 2010; 8: e002 Voight BF, Bonnycastle LL, Jackson AU, Crawford G, 26) Rual JF, Venkatesan K, Hao T, Hirozane-Kishikawa T, Surti A, Guiducci C, Burtt NP, Parish S, Clarke R, Zele- Dricot A, Li N, Berriz GF, Gibbons FD, Dreze M, Ayivi- nika D, Kubalanza KA, Morken MA, Scott LJ, Stringham Guedehoussou N, Klitgord N, Simon C, Boxem M, Mil- HM, Galan P, Swift AJ, Kuusisto J, Bergman RN, Sund- stein S, Rosenberg J, Goldberg DS, Zhang LV, Wong SL, vall J, Laakso M, Ferrucci L, Scheet P, Sanna S, Uda M, Franklin G, Li S, Albala JS, Lim J, Fraughton C, Llamo- Yang Q, Lunetta KL, Dupuis J, de Bakker PI, O’Donnell sas E, Cevik S, Bex C, Lamesch P, Sikorski RS, Vanden- CJ, Chambers JC, Kooner JS, Hercberg S, Meneton P, haute J, Zoghbi HY, Smolyar A, Bosak S, Sequerra R, Lakatta EG, Scuteri A, Schlessinger D, Tuomilehto J, Doucette-Stamm L, Cusick ME, Hill DE, Roth FP, Vidal Collins FS, Groop L, Altshuler D, Collins R, Lathrop M: Towards a proteome-scale map of the human protein- GM, Melander O, Salomaa V, Peltonen L, Orho- protein interaction network. Nature, 2005; 437: 1173- Melander M, Ordovas JM, Boehnke M, Abecasis GR, 1178 Mohlke KL, Cupples LA: Common variants at 30 loci 27) Wu Z, Chen Y, Yang T, Gao Q, Yuan M, Ma L: Targeted contribute to polygenic dyslipidemia. Nat Genet, 2009; ubiquitination and degradation of G-protein-coupled 41: 56-65 receptor kinase 5 by the DDB1-CUL4 ubiquitin ligase 14) Stark C, Breitkreutz BJ, Reguly T, Boucher L, Breitkreutz complex. PLoS One, 2012; 7: e43997 A, Tyers M: BioGRID: a general repository for interaction 28) Flister MJ, Tsaih SW, O’Meara CC, Endres B, Hoffman datasets. Nucleic Acids Res, 2006; 34 (Database issue): MJ, Geurts AM, Dwinell MR, Lazar J, Jacob HJ, Moreno D535-D539 C: Identifying multiple causative genes at a single GWAS 15) Narahara M, Higasa K, Nakamura S, Tabara Y, Kawagu- locus. Genome Res, 2013; 23: 1996-2002 chi T, Ishii M, Matsubara K, Matsuda F, Yamada R: 29) Bower NI, de la Serrana DG, Cole NJ, Hollway GE, Lee Large-scale East-Asian eQTL mapping reveals novel can- HT, Assinder S, Johnston IA: Stac3 is required for myo- didate genes for LD mapping and the genomic landscape tube formation and myogenic differentiation in vertebrate of transcriptional effects of sequence variants. PLoS One, skeletal muscle. J Biol Chem, 2012; 287: 43936-43949 2014; 9: e100924 30) Jones BK, Levorse J, Tilghman SM: Deletion of a nucle- 16) Suviolahti E, Lilja HE, Pajukanta P: Unraveling the com- ase-sensitive region between the Igf2 and H19 genes leads plex genetics of familial combined hyperlipidemia. Ann to Igf2 misregulation and increased adiposity. Hum Mol Med, 2006; 38: 337-351 Genet, 2001; 10: 807-814 17) Brunham LR, Singaraja RR, Hayden MR: Variations on a 31) GTEx Consortium: The Genotype-Tissue Expression gene: rare and common variants in ABCA1 and their (GTEx) project. Nat Genet, 2013; 45: 580-585 impact on HDL cholesterol levels and atherosclerosis. 32) Altmann SW, Davis HR Jr, Zhu LJ, Yao X, Hoos LM, Annu Rev Nutr, 2006; 26: 105-129 Tetzloff G, Iyer SP, Maguire M, Golovko A, Zeng M, Functional Genes for Lipid Regulation 467
Wang L, Murgolo N, Graziano MP: Niemann-Pick C1 Nauck M, Radke D, Völker U, Perola M, Salomaa V, Like 1 protein is critical for intestinal cholesterol absorp- Brody J, Suchy-Dicey A, Gharib SA, Enquobahrie DA, tion. Science, 2004; 303: 1201-1204 Lumley T, Montgomery GW, Makino S, Prokisch H, 33) Westra HJ, Peters MJ, Esko T, Yaghootkar H, Schurmann Herder C, Roden M, Grallert H, Meitinger T, Strauch K, C, Kettunen J, Christiansen MW, Fairfax BP, Schramm K, Li Y, Jansen RC, Visscher PM, Knight JC, Psaty BM, Powell JE, Zhernakova A, Zhernakova DV, Veldink JH, Ripatti S, Teumer A, Frayling TM, Metspalu A, van Van den Berg LH, Karjalainen J, Withoff S, Uitterlinden Meurs JB, Franke L: Systematic identification of trans AG, Hofman A, Rivadeneira F, ‘t Hoen PA, Reinmaa E, eQTLs as putative drivers of known disease associations. Fischer K, Nelis M, Milani L, Melzer D, Ferrucci L, Sin- Nat Genet, 2013; 45: 1238-1243 gleton AB, Hernandez DG, Nalls MA, Homuth G, 468 Akiyama et al. ------n.s. n.s. n.s. by qPCR by N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A 0.195 0.464 0.239 0.780 0.446 0.343 0.096 0.230 0.156 0.053 0.957 0.119 0.017 0.496 0.046 0.746 0.153 0.392 0.183 P , t -test Replication up up up up up up up up up up up up up N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A down down down down down down by HFD by Direction Direction N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A Fold Fold 1.100 1.025 1.299 1.014 1.058 1.121 1.119 1.092 1.107 1.271 1.004 1.385 1.194 2.132 1.251 1.015 1.119 1.048 1.174 change ------n.s. by qPCR by significant significant significant N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A 0.275 0.682 0.434 0.295 0.230 0.005 0.284 0.607 0.377 0.448 0.224 0.842 0.412 0.074 0.571 0.380 P , t -test Replication 4.1E-06 8.8E-06 Liver adipose Retroperitoneal up up up up up N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A down down down down down down down down down down down down down by HFD by Direction Direction N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A Fold Fold 1.058 1.490 6.851 8.808 1.067 1.034 1.034 1.045 1.114 1.078 1.084 1.198 1.176 1.147 1.034 1.291 1.195 1.082 change a N/A N/A N/A N/A N/A N/A N/A N/A - N/A N/A N/A - N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A probe ID probe ILMN_Array ILMN_1373400 ILMN_1353162 ILMN_1650041 ILMN_1355116 ILMN_1361435 ILMN_1363186 ILMN_1358631 ILMN_1374644 ILMN_1352197 ILMN_1364080 ILMN_1356114 ILMN_1530392 ILMN_1372583 ILMN_1358053 ILMN_1650395 ILMN_1355763 ILMN_1367637 ILMN_1357754 ILMN_1351052 ILMN_1375915 ILMN_1376269 ILMN_1362843 ILMN_1369837 ILMN_1650034 ILMN_1650440 ILMN_1358815 ILMN_1351234 ILMN_1360680 ILMN_1371504 ILMN_1375074 ILMN_1373006 ILMN_1355230 ILMN_1362429 a bcg8 bcg5 Rat phb1 if2b4 Irs1 Hlx Rhd Aff1 N/A N/A N/A N/A Glul Raf1 Pccb Gckr Msl2 Usp1 Psrc1 Sort1 Sypl2 Klhl8 gene Tsen2 Snx17 Ift172 A A Fndc5 Macf1 Celsr2 Psma5 E Mosc1 Nyap2 E Dock7 Gtf3c2 Mkrn2 Ppm1g Pabpc4 Mpv17 Zranb3 Zfp648 Znf513 Mybphl Krtcap3 Angptl3 Ppp2r3a Tmem57 Tmem50a LOC498330 RB3GP_RAT RGD1566400 0 0 0 0 0 LOC100360066 N/A N/A N/A0 N/AGalnt20 -0 Apob ILMN_1355124up0 1.073 N/A ILMN_290738 0.777 - Apob N/A N/Adown 1.121 N/A N/A ILMN_290738 0.452 - N/A N/A - N/A - N/A N/A - N/A N/A N/A N/A - N/A4 0 - 0 Slc39a80 Arl15 ILMN_1376355down 1.039 n.s. 0.625 ILMN_1354353 1.281 downup 1.054 0.163 - 0.793 - 1.325 down 0.231 - 0 0 4 0 7 0 28 87 13 18 64 66 98 52 56 79 54 33 75 17 34 12 43 60 37 ＊ 119 118 138 131 151 185 131 127 217 120 183 138 495 582 126 191 108 (kbp) Distance Distance from SNP from gene IRS1 AFF1 RHD YSK4 USP1 RAF1 HLX1 PCCB GLUL SYPL2 EphB1 RHCE GCKR PSRC1 SNX17 TSEN2 Human Human NYAP2 IFT172 SORT1 EIF2B4 PSMA5 NRBP1 KLHL8 MPV17 ABCG5 ABCG8 BMP8A MACF1 PPM1G FNDC4 C4orf36 MOSC1 DOCK7 ZNF513 ZNF648 CELSR2 PABPC4 MSL2L1 MKRN2 GTF3C2 ZRANB3 PPP2R3A MYBPHL TMEM57 KRTCAP3 CCDC121 ANGPTL3 TMEM50A RAB3GAP1
2.E-08 4.E-11 4.E-10 9.E-43 3.E-10 4.E-09 3.E-08 9.E-12 3.E-09 2.E-47 GWAS GWAS p -value 1.E-170 6.E-133
1.25 1.22 0.48 4.94 1.18 3.E-085.65 EVI5 0.47 1.39 6.E-13 0.61 4.E-211.36 GALNT2 5.E-145.99 IRF2BP2 1.E-458.76 APOB 113 Irf2bp2 2.01 2.E-10 COBLL11.42 Cobll1 28 2.22 ILMN_1351993up2.25 1.051 0.808 -0.84 7.E-110.49up 1.011 SLC39A8 5.E-08 0.862 - ARL15 0.46 2.75 allele － － － － － － － － － － － － － － － － for minor Effect size
T/A [0.492] C/A [0.267] T/C [0.300] C/T [0.400] A/G [0.242] A/G [0.342] T/G [0.300] T/G [0.358] T/G [0.400] T/G [0.233] T/G [0.258] T/G [0.325] G/C [0.217] freq. in CEU] freq. allele [minor Major allele/ minor Major
TC TC TC TC TG TG TG TG trait LDL LDL HDL HDL HDL
IRS1 RAF1 GCKR KLHL8 MOSC1 DOCK7 CELSR2 ZNF648 PABPC4 RAB3GAP1 Index gene nameIndex Lead ABCG5-ABCG8 PPP2R3A/PCCB RHCE/TMEM57 Gene expression levels of rat orthologs for human genes linked to the known SNP associated with blood lipid levels of rat orthologs levels for human genes linked to the known expression Gene
(hg19) Position Position 40028180 25775733 27730940 88030261 12628920 63025942 44072576 109818306 227100698 135926622 135837906 165513091 COBLL1 TG T/C [0.442] 220973563 182168885
chr1 chr1 chr1 chr2 chr2 chr3 chr2 chr2 chr1 chr4 chr3 chr1 chr2 chr1 some Chromo- rs10195252 rs4660293 rs12027135 rs1042034 chr2 21225281 APOB TG T/C [0.192] rs629301 rs514230rs1367117 chr1rs1260326 234858597 chr2 21263900 IRF2BP2 TC APOB T/A [0.492] LDL G/A [0.267] 4.05 4.E-114 APOB rs2972146 rs6450176 chr5 53298025 ARL15 HDL G/A [0.233] Sapplementary Table 1. Sapplementary Table SNP rs645040 rs13107325 chr4 103188709 SLC39A8 HDL C/T [0.117] rs7570971 rs2642442 rs4846914 chr1 230295691 GALNT2 HDL A/G [0.417] rs442177 rs2290159 rs2479409rs2131925 chr1 55504650 PCSK9 LDL A/G [0.300] 2.01 2.E-28 PCSK9 1 Pcsk9 ILMN_1370891 3.229 down 5.3E-05 significant N/A N/A N/A - rs7515577 chr1 93009438 EVI5 TC A/C [0.175] rs4299376 rs1689800 Functional Genes for Lipid Regulation 469 ------n.s. n.s. n.s. n.s. significant significant significant ND ND N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A 0.095 0.097 0.024 0.308 0.073 0.826 0.208 0.152 0.013 0.366 0.028 0.287 0.034 0.581 up up up up up up up up up ND ND N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A down down down down down ND ND N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A 1.209 1.299 8.365 1.063 1.162 1.023 1.142 1.762 1.441 1.048 1.172 1.114 1.312 1.069 ------n.s. n.s. n.s. significant significant significant ND ND N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A 0.937 0.565 0.052 0.022 0.008 0.005 0.448 0.980 0.706 0.336 0.367 0.585 0.845 0.106 2.0E-05 wn wn up up up up up up up ND ND N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A down down down do down down do down ND ND N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A 1.437 3.034 1.069 1.111 1.011 1.051 2.128 1.211 1.172 1.056 1.029 1.003 1.086 3.101 1.136 N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A - N/A N/A N/A - N/A N/A N/A N/A - N/A N/A N/A - N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A ILMN_1354291 ILMN_1351282 ILMN_1362739 ILMN_1367394 ILMN_1376532 ILMN_1350639 ILMN_1374365 ILMN_1364042 ILMN_1355653 ILMN_1370739 ILMN_1372999 ILMN_1363225 ILMN_1376899 ILMN_1364225 ILMN_1373568 ILMN_1363726 ILMN_1350178 ILMN_1355213 ILMN_1352221 ILMN_1368247 ILMN_1368485 ILMN_1353561 ILMN_1353209 ILMN_1365284 ILMN_1350269 ILMN_1372308 ILMN_1353773 ILMN_1369793 Frk Sp4 Hfe Plec Polk N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A Sox7 Tnks Snrpc Grina Bcl7b Pinx1 Ogdh Mlxip Baz1b Sdcbp Nsmaf Timd4 Ddx56 Tmed4 Hmgcr Havcr1 Npc1l1 Nt5dc1 Cyp7a1 Ubxn2b Dnah11 Ppp1r3b Hist1h1t Hist1h1a Col4a3bp Hist1h2aa Hist1h2bb LOC294154 RGD1307264 LOC100362108 0 0 0 8 0 0 0 RT1-DA ILMN_1376935 2.611 up 1.8E-04 - 1.139 up 0.022 - 2 Mylip ILMN_1374414 N/A N/A N/A -0 N/A up 1.519 8.0E-04 significant 0 Slc22a1 ILMN_1353689down 1.062 0.488 - N/A0 Tyw1 N/A0 N/A ILMN_1358290 1.133 down - 0.320 - 1.102 down 0.755 n.s. 0 Trps1 ILMN_1349929 N/A0 Ttc39b N/A0 Abca1 ILMN_1350423 N/A ILMN_1650701 N/Aup 1.509 -significant N/Aup 0.006 2.244 N/A N/A 6.0E-07 significant N/A - N/A N/A - N/A N/A - 2 0 0 0 19 53 26 49 67 40 71 21 14 77 25 15 Klf14 11 25 46 40 Trib1 ILMN_1374608up 4.423 significantup 0.014 1.368 n.s. 0.179 96 19 Lpl ILMN_1357053up 3.477 6.4E-08 significantdown 1.183 - 0.160 38 Btnl2 ILMN_1374534 N/A N/A N/A - N/A N/A N/A - 75 36 14 59 31 49 31 72 71 11 14 Nat1 ILMN_1372765 1.033 down 0.886 - 1.032 up 0.881 n.s. 151 107 127 109 175 230 173 207 100892 － SP4 FRK HFE TBL2 SOX7 POLK TNKS PINX1 PLEC1 BCL7B BAZ1B SDCBP OGDH GRINA SNRPC TIMD4 DDX56 PARP10 NSMAF TMED4 CYP7A1 MLXIPL NPC1L1 HMGCR C6orf106 HAVCR1 UBXN2B PPP1R3B NT5DC1 DNAH11 COL10A1 NUDCD3 HIST1H1A HIST1H1T HIST1H4C HIST1H1C COL4A3BP UHRF1BP1 LOC644907 HIST1H2BB HIST1H2AB HIST1H2BC HIST1H2AC HIST1H3A/3B/3C HIST1H4A/4B
9.E-10 3.E-11 9.E-47 4.E-13 2.E-12 1.E-08 7.E-28 6.E-10 4.E-09 2.E-10 6.E-58 6.E-25
1.43 2.01 2.84 1.4 1.23 2.01 1.98 1.43 1.E-112.22 MYLIP 2.99 2.E-150.49 HLA-B 1.18 0.39 3.E-08 CITED20.56 2.E-17 SLC22A1 134 Cited2 ILMN_1352067up 1.417 7.91 0.249 n.s. 1.E-099.32 TYW1B up 1.251 0.066 n.s. 1.21 0.44 6.E-115.64 3.E-55 TRPS1 TRIB1 0.65 3.E-120.94 TTC39B 2.E-33 ABCA1 13.64 2.E-115 LPL － － － － － － － － － － － － － － － －
A/T [0.333] C/T [0.333] T/C [0.183] T/C [0.417] C/T [0.325] C/T [0.117] G/A [0.042] G/A [0.075] A/G [0.450] G/A [0.108] G/C [0.275] G/C [0.400]
TC TC TC TC TC TC TG TG LDL LDL HDL HDL
FRK HFE PINX1 PLEC1 TIMD4 CYP7A1 MLXIPL NPC1L1 HMGCR C6orf106 PPP1R3B DNAH11
9183358 44579180 10683929 34552797 26093141 21607352 72982874 74656539 59388565 32412435 HLA-DRB5 TC G/A [0.158] 2.31 4.E-19 BTNL2 156390297 145043543 116312893
chr7 chr8 chr5 chr8 chr6 chr6 chr7 chr7 chr8 chr5 chr8 chr6 chr6 rs581080 chr9 15305378 TTC39B HDL C/G [0.192] rs2293889 chr8 116599199 TRPS1 HDL G/T [0.325] rs2072183 rs9987289 rs4731702 chr7 130433384 KLF14 HDL C/T [0.450] 0.59 1.E-15 KLF14 rs6882076 rs11776767 rs3757354 chr6 16127407 MYLIP LDL C/T [0.217] rs3177928rs2814944 chr6 32412435 HLA TC G/A [0.158] 2.31 4.E-19 HLA-DRA rs1800562 rs1084651rs1564348rs12670798 chr6 chr6 161089817 SLC22A1/LPAL2/PLG HDL 160578860 SLC22A1/LPAL2/PLG LDL G/A [0.142] T/C [0.208] 1.95 3.E-08rs17145738 LPA 2 N/A N/A N/Ars2954029 N/Ars11136341 chr8 N/A 126490972rs1883025 - TRIB1 chr9 N/A 107664301 TG N/A A/T [0.383] ABCA1 N/A HDL - C/T [0.200] rs9686661rs12916 chr5 55861786 MAP3K1 TG C/T [0.192] 2.57 1.E-10 MAP3K1 249 Map3k1 ILMN_1369633 N/A N/A N/A - 1.118 up 0.522 - rs2081687 rs2247056 chr6 31265490 HLA TG C/T [0.392] rs13238203 chr7 72129667 TYW1B TG C/T [0.025] rs3177928 rs9488822 rs605066 chr6 139829666 CITED2 HDL T/C [0.442] rs1495741rs12678919 chr8 chr8 18272881 19844222 NAT2 LPL TG TG A/G [0.250] A/G [0.133] 2.85 5.E-14 NAT2 470 Akiyama et al. ------n.s. n.s. n.s. n.s. n.s. n.s. significant significant significant significant N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A 0.710 0.011 0.063 0.189 0.015 0.959 0.792 0.244 0.001 0.142 0.008 0.148 0.927 0.316 0.338 0.332 0.291 0.011 0.855 0.362 0.619 0.002 0.528 0.019 0.264 0.572 0.536 wn wn up up up up up up up up up up up up up up up N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A down down down down down do down down do down down down N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A 1.034 1.277 1.197 1.076 1.260 1.005 1.022 1.077 1.216 1.533 1.606 1.752 1.223 1.317 1.255 1.013 1.108 1.112 1.105 1.108 1.654 1.013 1.053 1.070 1.088 1.026 1.056 ------n.s. n.s. n.s. n.s. n.s. n.s. n.s. significant significant significant significant significant significant significant significant ND N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A 0.011 0.882 0.639 0.007 0.501 0.527 0.106 0.040 0.021 0.558 0.110 0.329 0.005 0.180 0.016 0.042 0.799 0.019 0.012 0.002 0.595 0.437 0.015 0.665 0.051 0.317 0.055 0.060 0.283 0.523 0.363 8.3E-05 wn wn up up up up up up up up up up up ND N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A do down down down down down down down down down down down down down down down down do down down down ND N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A 2.651 1.498 1.031 4.732 3.785 1.783 1.099 1.467 1.207 1.220 1.150 4.326 1.041 1.106 1.155 1.080 1.066 1.079 2.561 1.057 1.216 1.048 1.185 1.192 1.237 1.127 1.116 1.077 1.091 1.660 1.288 10.352 N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A ILMN_1355235 ILMN_1370220 ILMN_1353164 ILMN_1355491 ILMN_1359970 ILMN_1372345 ILMN_1360016 ILMN_1376666 ILMN_1359027 ILMN_1369636 ILMN_1356167 ILMN_1374973 ILMN_1364978 ILMN_1367597 ILMN_1374733 ILMN_1357109 ILMN_1369548 ILMN_1357076 ILMN_1650726 ILMN_1357522 ILMN_1361576 ILMN_1374319 ILMN_1368671 ILMN_1353485 ILMN_1367683 ILMN_1375145 ILMN_1371229 ILMN_1349323 ILMN_1369919 ILMN_1356203 ILMN_1369934 ILMN_1359395 ILMN_1374439 ILMN_1359313 ILMN_1366914 ILMN_1373749 ILMN_1349112 F2 N/A N/A N/A N/A N/A N/A Oasl Mvk Lrp4 Lrp1 Adm Fen1 Myrf Stac3 Fads1 Fads2 Fads3 Inhbc Uevld Atg13 Atxn2 Exoc6 Aldh2 Cbln3 Sbno1 Apoa1 Apoa4 Apoa5 Hnf1a Shmt2 Ckap5 Bud13 Ube3b Khnyn Nxph4 Kctd10 Acad10 Ampd3 Zfp259 Ccdc92 Rab3il1 Spty2d1 Arhgap1 R3hdm2 Cyp26c1 Cyp26a1 Cdk2ap1 Ndufa4l2 Tmem116 Mapkapk5 Mphosph9 RGD1563482 RGD1311899 RGD1309540 LOC100362202 LOC100912447 0 5 0 0 4 Abo ILMN_1375823 N/A N/A N/A - N/A N/A N/A - 0 0 Jmjd1c0 ILMN_1354357up 1.034 0.761 -up 1.061 0.483 - 8 3 0 0 5 0 2 0 0 4 St3gal40 Ubash3b ILMN_1361562 ILMN_1357039up 1.117 1.915 0.241 - updown 0.025 1.044 significant 0.741 - 1.097 down 0.348 - 26 71 14 95 10 54 40 90 24 41 21 47 22 16 36 88 51 35 60 83 12 15 58 43 11 52 11 20 23 11 26 85 48 Pde3a ILMN_1357976 N/A N/A N/A - N/A N/A N/A - 102 135 185 158 172 164 148 132 208 183 297 F2 LRP1 LRP4 MVK FEN1 BRAP OASL Ckap5 MYRF FADS2 FADS3 STAC3 SH2B3 ATG13 Znf408 UBE3B APOA4 APOA5 BUD13 ATXN2 APOC3 SBNO1 EXOC6 HNF1A ALDH2 NXPH4 UEVLD AMPD3 SHMT2 ZNF664 ZNF259 KHNYN RAB3IL1 KCTD10 C11orf49 NYNRIN CYP26A1 CYP26C1 R3HDM2 CDK2AP1 TMEM258 TMEM116 NDUFA4L2 MAPKAPK5 MPHOSPH9
2.E-08
2.38 3.E-122.28 JMJD1C 0.41 5.E-081.04 ADM 3.E-08 SPTY2D1 2.7 4.E-10 INHBC 0.44 7.E-15 MMAB 0.96 7.E-12 ACAD10 － － － － － － －
G/A [0.433]
TG TG C/G [0.108] 16.95 7.E-240 APOA1 HDL T/C [0.050] 0.78 3.E-18 ARHGAP1
CYP26A1 ARHGAP1/ZNF408/F2/CKAP5 BUD13/ZNF259/APOA5/APOA4
94839642
chr9 136155000 ABO LDL C/T [0.233] 2.24 6.E-13 ABO chr10 rs174546 chr11 61569830 FADS1-2-3 TG C/T [0.367] 3.82 5.E-24 FADS1 rs1169288 chr12 121416650 HNF1A TC A/C [0.283] 1.42 1.E-14 C12orf43 rs4759375 chr12 123796238 SBNO1 HDL C/T [0.075] 0.86 7.E-09 C12orf65 rs964184 chr11 116648917 rs10761731 chr10 65027610 JMJD1C TG A/T [0.458] rs2068888 rs7134594 chr12 110000193 UBE3B/MMAB HDL T/C [0.500] rs9411489/rs635634 rs10128711 chr11 18632984 SPTY2D1 TC C/T [0.317] rs4765127 chr12 124460167 ZNF664 HDL G/T [0.392] 0.44 3.E-10 CCDC92 rs838880rs8017377 chr12 chr14 125261593 24883887 CBLN3/KHNYN SCARB1 LDL HDL G/A [0.483] T/C [0.300] 1.14 0.61 5.E-11 3.E-14 CBLN3 SCARB1 1 Scarb1 ILMN_1359178 1.127 down 0.442 - 1.281 up 0.011 n.s. rs3136441 chr11 46743247 rs2255141rs2923084 chr10 113933886 chr11 10388782 GPAM AMPD3 TC HDL G/A [0.300] A/G [0.150] 1.14 2.E-10 GPAM 0 Gpam ILMN_1363492 2.266 up 0.056 n.s. 1.001 down 0.994 - rs7941030rs11220462rs7134375 chr11 chr11rs11613352 122522375 126243952 chr12 UBASH3B chr12 20473758 ST3GAL4 57792580 TC[0.158] PDE3A LDL T/C [0.383] LRP1 G/A 1.95 HDL 1.E-15 0.97 ST3GAL4 C/A [0.417] TG 2.E-10 UBASH3B C/T [0.275] 0.4 4.E-08 PDE3A rs11065987 chr12 112072424 BRAP TC A/G [0.342] Functional Genes for Lipid Regulation 471 ------n.s. n.s. n.s. n.s. n.s. ND N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A 0.076 0.208 0.047 0.066 0.358 0.029 0.185 0.815 0.448 0.248 0.301 0.048 0.076 0.510 0.347 0.003 0.929 0.622 0.740 0.218 0.485 0.092 0.446 0.505 0.518 0.500 0.225 0.597 0.462 0.490 0.226 0.464 up up up up up up up up up up up up up up up up up up up up up up up ND N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A down down down down down down down down down ND N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A 1.145 3.458 1.185 1.211 1.071 1.180 1.170 1.028 1.111 1.237 1.140 1.186 1.137 1.084 1.089 1.233 1.015 1.069 1.024 1.085 1.056 1.213 1.076 1.068 1.092 1.086 1.087 1.058 1.040 1.051 1.151 1.084 ------n.s. n.s. n.s. n.s. significant ND N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A 0.326 0.320 0.391 0.468 0.804 0.298 0.166 0.561 0.367 0.789 0.014 0.174 0.110 0.573 0.655 0.160 0.514 0.080 0.029 0.373 0.542 0.890 0.072 0.857 0.272 0.926 0.030 0.921 0.169 0.084 wn wn wn up up up up up up up up up up ND N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A down down down down down do down down down down down down do down down do down down down down ND N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A 1.152 5.479 1.114 1.047 1.019 1.212 1.033 1.090 1.010 1.238 1.081 1.204 1.116 1.095 1.135 1.068 1.133 1.031 1.012 1.119 1.226 1.031 1.089 1.120 1.060 1.217 1.044 1.167 1.218 1.279 N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A - N/A N/A N/A - N/A N/A N/A N/A N/A ILMN_1376775 ILMN_1366449 ILMN_1351450 ILMN_1367250 ILMN_1357838 ILMN_1362479 ILMN_1372045 ILMN_1358410 ILMN_1365415 ILMN_1360868 ILMN_1363128 ILMN_1373557 ILMN_1355605 ILMN_1356536 ILMN_1354163 ILMN_1376991 ILMN_1349728 ILMN_1651184 ILMN_1368825 ILMN_1650324 ILMN_1362450 ILMN_1372530 ILMN_1350020 ILMN_1355110 ILMN_1354875 ILMN_1352081 ILMN_2039038 ILMN_1649917 ILMN_1374615 ILMN_1373492 ILMN_1364406 ILMN_1372958 ILMN_1367485 ILMN_1357040 ILMN_2039175 ILMN_1357987 ILMN_1367035 ILMN_1353054 ILMN_1354892 ILMN_1376389 ILMN_1352950 ILMN_1373510 ILMN_1358888 ILMN_1359594 ILMN_1351843 ILMN_1349233 (ILMN_1353858) Hp tgb3 Acd Ctrl Lcat Stx4 N/A N/A N/A N/A Ctf1 Kat8 Tcap Edc4 Prss8 Rltpr I Ganc Srcap Bcl7c Lactb Stx1b Orai3 Med1 Pskh1 Nutf2 Nrn1l Erbb2 Cenpt Prmt7 Tpm1 Rnf40 Bckdk Perld1 Phkg2 Prss36 Prss53 Stard3 Gfod2 Rab8b Enkd1 Capn3 Pard6a Cdk12 Nfatc3 Kpnb1 Dhx38 Fbxl19 Fbxl20 Dhodh Txnl4b Vkorc1 Zfp646 Npepps Thap11 Psmb10 Pmfbp1 Hsd3b7 Tbkbp1 Ppp1r1b Neurod2 Tsnaxip1 Ranbp10 LOC691909 OC100362422 RGD1561415 F1LQT6_RAT L 4 0 0 0 Cmip ILMN_1365837down 1.126 0.589 -up 1.174 0.153 - 0 8 3 N/A 0 8 0 13 17 78 42 50 85 49 20 45 11 38 21 31 17 49 39 85 50 14 11 21 35 47 35 10 46 23 37 87 50 66 201 145 210 150 232 176 224 132 166 126 184 120 167 123 253 302 183 348 233 225 227 175 191 231 417 237 50827 － HPR STX4 KAT8 CTF1 LCAT TCAP CTRL EDC4 TPM1 PRSS8 NM1L MED1 ITGB3 GANC ORAI3 PNMT STX1B ERBB2 RLTPR RNF40 SRCAP RAB8B PSKH1 BCL7C KPNB1 PRSS36 PRSS53 NUTF2 ZFP106 PHKG2 DHX38 RSP27L PRMT7 CENPT ENKD1 FBXL19 FBXL20 GFOD2 ZNF629 ZNF646 NPEPPS PSMB10 TBKBP1 PERLD1 STARD3 SETD1A THAP11 PMFBP1 NFATC3 HSD3B7 PARD6A TXNL4B C16orf93 C16orf86 PPP1R1B VKORC1 RANBP10 TSNAXIP1 NEUROD2 0.39 9.E-09 LACTB 2.13 3.E-08 BCKDK 0.45 2.E-110.48 1.E-13 CMIP CDK12 － － － － 72108093 HP/TXNL4B/DHX38 TC G/A [0.208] 2.34 3.E-24 DHODH 56993324 CETP HDL C/A [0.367] 3.39 0.E+00 CETP chr16 chr16 rs11649653 chr16 30918487 BCL7C/TMEM142C TG C/G [0.392] rs2925979 chr16 81534790 CMIP HDL C/T [0.283] rs2000999 rs11869286 chr17 37813856 NEUROD2/GRB7 HDL C/G [0.300] rs2412710 chr15 42683787 CAPN3 TG G/A [0.008] 7 2.E-08 CAPN3 rs16942887 chr16 67928042 EDC4/NRN1L/PSKH1 HDL G/A [0.100] 1.27 8.E-33 ACD rs2929282rs1532085rs2652834 chr15 chr15 44245931 chr15 58683366 63396867 FRMD5 TPM1/RSP27L LIPC TG HDL G/A [0.192] HDL A/T [0.017] G/A [0.367] 5.13 2.E-11 1.45 FRMD5 3.E-96 LIPC 0 41 Frmd5 Lipc ILMN_1650133 N/A ILMN_1367184 N/A 1.259 down N/A 0.001 - n.s. N/A N/A N/A N/A N/A N/A - - rs7206971 chr17 45425115 ITGB3/C17orf57 LDL G/A [0.475] 0.78 2.E-08 C17orf57 rs3764261 472 Akiyama et al. ------n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. significant significant significant ND N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A 0.534 0.456 0.512 0.510 0.044 0.044 0.002 0.927 0.306 0.299 0.167 0.070 0.977 0.096 0.093 0.054 0.735 0.146 0.567 0.063 0.111 0.472 0.724 0.056 0.498 0.382 0.408 0.317 0.937 0.008 0.238 0.089 1.5E-05 7.1E-05 wn up up up up up up up up up up up up up up up up up up up ND N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A down down down down down down do down down down down down down down down ND N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A 1.042 1.163 1.107 1.166 1.164 1.164 1.107 1.003 1.110 1.062 1.028 1.193 1.080 1.416 1.112 1.021 1.224 1.040 1.197 1.210 1.404 1.309 1.008 1.196 1.101 1.225 1.138 1.208 1.238 1.010 1.147 1.194 1.184 1.080 ------n.s. n.s. n.s. n.s. n.s. n.s. n.s. significant significant significant N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A 0.651 0.753 0.123 0.660 0.393 0.686 0.116 0.201 0.654 0.912 0.411 0.997 0.807 0.568 0.963 0.160 0.422 0.015 0.466 0.045 0.977 0.232 0.752 0.795 0.976 0.534 0.028 0.051 0.024 1.5E-03 1.5E-03 1.6E-05 up up up up up up up up up up up up up up up up up N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A down down down down down down down down down down down down down down down N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A 1.780 1.082 1.029 1.047 1.066 1.096 1.359 1.321 1.321 1.361 3.200 1.137 1.191 1.106 1.034 1.008 1.048 1.038 1.075 1.003 1.058 1.479 1.127 1.158 1.000 1.017 1.122 1.002 1.049 1.192 1.003 1.046 N/A N/A N/A N/A N/A N/A N/A ILMN_1360466 ILMN_1363364 ILMN_1368112 ILMN_1349123 ILMN_1365276 ILMN_1367529 ILMN_1375236 ILMN_1373483 ILMN_1374944 ILMN_1376928 ILMN_1369953 ILMN_1361441 ILMN_1375216 ILMN_1356226 ILMN_1371285 ILMN_1366781 ILMN_1351197 ILMN_1356874 ILMN_1368055 ILMN_1375706 ILMN_1376697 ILMN_1363477 ILMN_1354153 ILMN_1368956 ILMN_1359938 ILMN_1358223 ILMN_1376609 ILMN_1375793 ILMN_1650029 ILMN_1372006 ILMN_1358838 ILMN_1352080 ILMN_1374098 ILMN_1350677 ILMN_1350304 ILMN_1373097 ILMN_1361225 ILMN_2040171 ILMN_1352960 ILMN_1374963 ILMN_1367597 ILMN_1368771 ILMN_1373958 ILMN_1352599 ILMN_1367498 (ILMN_1351630) Pltp N/A N/A N/A N/A N/A Fut2 Maff Nfs1 Rxrb Xkr6 Pcif1 Apoe Acp2 Top1 Pvrl2 Zhx3 Ncan Plcg1 Tssk6 Cilp2 Ddb2 Mau2 Spag4 Madd Ring1 Sugp1 Fer1l4 Apoc4 Ergic3 Nr1h3 Dock6 Rasip1 Pla2g6 Lilrb3l Tm6sf2 Rbm12 Zfp335 Hapln4 Slc39a7 Rab11b Mamstr Cep250 Angptl4 Gatad2a Col11a2 Baiap2l2 Ndufa13 Ndufa13 Tomm40 Hsd17b8 RGD1309540 LOC100361444 2 8 0 0 Abca8b0 0 Pgs1 ILMN_1359857up 1.001 ILMN_2040197down0 0.990 - 1.177 0.228 -0 down Ldlr1 1.161 up1 0.050 - 1.120 ILMN_1369382 0.284 - up 1.100 0.733 n.s.up 1.171 0.579 n.s. 7 0 0 0 Hnf4a ILMN_1354435down 1.173 Ube2l30 - 0.535 ILMN_1355963down0 1.075 N/A 0.071 -0 N/Aup 1.135 N/A 0.272 - - 0 9 0 0 Apoc1 ILMN_1371556 N/A N/A N/A - N/A N/A N/A - 5 0 7 8 31 22 10 17 42 Lipg ILMN_165114722 upsignificant 1.992 0.002 N/A59 N/A N/A - 53 61 84 51 94 39 52 63 89 34 24 24 13 23 28 32 17 25 16 26 32 104 134 241 217 219 217 232 102 PLTP NFS1 XKR6 TOP1 RXRB APOE ZHX3 MAFF DDB2 MAU2 TSSK6 SPAG4 NCAN PVRL2 RING1 SUGP1 MADD CPNE1 RASIP1 RBM12 LILRB2 LILRB5 NR1H3 FER1L4 YJEFN3 DOCK6 ZNF335 ERGIC3 RAB11B PLA2G6 TM6SF2 C11orf49 HAPLN4 SLC39A7 TSPAN16 HSD17B8 MAMSTR TOMM40 GATAD2A NDUFA13 0.42 2.E-100.39 8.E-091.31 ABCA8 3.E-490.42 PGS1 7.E-090.45 LIPG 3.E-08 MC4R ANGPTL4 6.99 4.E-1170.64 LDLR 3.E-09 190 Mc4r C19orf80 4.74 3.E-38 ILMN_1363931 CILP2 N/A N/A N/A -5.5 1.E-30 N/A APOC4 N/A N/A - 1.19 4.E-10 CEP250 1.38 6.E-11 MAFB1.88 1.E-150.93 223 Mafb 2.E-22 HNF4A PCIF1 0.46 ILMN_1361027 1.E-081.54up 1.028 UBE2L3 4.E-08 BAIAP2L2 0.04 0.912 n.s. 3.E-08down C8orf15 1.205 0.100 n.s. － － － － － － － － － － － － － － － － TC T/C [0.075] TC A/G [0.458] 1.27 2.E-10TC FUT2 C/T [0.108] HAPLN4/TM6SF2/SF4/SUGP1 FUT2/MAMSTR/RASIP1 CEP250/SPAG4/CPNE1 45422946 APOE LDL A/G [0.183] 7.14 9.E-147 APOC1 chr19 N/A is shown in the “Rat gene” column for the genes without rat homologs and in the “ILMN_Array probe ID” for those without the corresponding microarray probe(s). microarray corresponding ID” for those without the column for the genes without rat homologs and in “ILMN_Array probe in the “Rat gene” N/A is shown rs1800961 chr20 43042364 HNF4A HDL C/T [0.050] rs6511720 chr19 11202306 LDLR LDL G/T [0.092] rs4129767rs7241918rs12967135 chr17rs7255436 chr18 76403984 chr18 47160953 57849023 chr19rs737337 PGS1 8433196 LIPG MC4R chr19 HDL ANGPTL4 HDL 11347493 A/G [0.467] HDL HDL T/G [0.192] G/A [0.283] DOCK6 A/C [0.375] HDL T/C [0.050] rs6029526 chr20 39672618rs6065906 chr20 TOP1 44554015rs5756931 LDL chr22 PLTP T/A [0.458] 38546033 BAIAP2L2/MAFF 1.39 HDL TG 4.E-19 T/C [0.142] PLCG1 T/C [0.392] rs2254287 chr6 33143948 COL11A2 LDL G/C [0.383] 1.91 5.E-08 COL11A2 rs4148008 chr17 66875294 ABCA8 HDL C/G [0.283] a rs10401969 chr19 19407718 rs2902940 chr20 39091487 MAFB TC A/G [0.292] rs439401 chr19 45414451 APOE TG C/T [0.375] rs492602 chr19 49206417 rs7120118 chr11 47286290 NR1H3 HDL G/A [0.233] 0.04 4.E-08 ACP2 rs4420638 rs181362 chr22 21932068 UBE2L3 HDL C/T [0.142] Abbreviations: N/A, not available; n.s., not significant. N/A, not available; Abbreviations: rs7819412 chr8 11045161 XKR6 TG A/G [0.492] rs386000 chr19 54792761 LILRA3 HDL G/C [0.167] 0.83 4.E-16 LILRA3 rs2277862 chr20 34152782 Functional Genes for Lipid Regulation 473 GGTC GGTC GGTACAAC GGTACAAC NA ATACC TGGAATGTCACACAGCCTTG TGGAATGTCACACAGCCTTG ATACC GATCG TGCCAATGACGATGAGGTAG CACAGC ATGTAGTCCTGCCTCTGCTTTC CCTCCTTGC CCAACTAGCATACCCAGGATTG CCAACTAGCATACCCAGGATTG CCTCCTTGC CAGACACACAACC AAAGGGCTCTCCCTGTTGC AAAGGGCTCTCCCTGTTGC CAGACACACAACC CTCTTCGCTGGTAGG GATGTCATTCTCSCGGATGG GACACAACTTGCAC AGCTCCCCAGACTTCTTCAG AGCTCCCCAGACTTCTTCAG GACACAACTTGCAC CAAGTATGAGTCCAAGC TCCTTTTCCTCCTCCATGTG TCCTTTTCCTCCTCCATGTG CAAGTATGAGTCCAAGC TCCTTTTCCTCCTCCATGTG CAAGTATGAGTCCAAGC GGCACCAAGTTCCAC TTCTGGGTGTGGCTTTTAGC TTCTGGGTGTGGCTTTTAGC GGCACCAAGTTCCAC Forward primer seq. (5’-to-3’)Forward primer seq. (5’-to-3’) Reverse a -- ATGACCCCATTGAAGACTGG CACCTTTCATTCGGGAAGAG - TACGCTGAGAGTGCCACATAC AAAGTG TGCCCTGAGGTAGG - NA - - CAGCCACAACCATTCACATC TGGAGTCAGAACTCTGGTACAAC - CAGCCACAACCATTCACATC TGGAGTCAGAACTCT AAACCCTGTTGGAGCATGAC TTGGAG GGGTTTGGTTGATG ATGCCAGCATCAACTTCCAG AAAGGAGGATTGCTGA - AGGCTGGCAAGAAAAGGAAG CCTCAAC AGTTCAAACTCCG -- - ATCAGTGTCGGCAGTATTGG ACCCAGGTGTTTCCCTTCTG - ATCAGTGTCGGCAGTATTGG ACCCAGGTGTTTCCCTTCTG - GGGTGGCTCTGAAGACTTTTG TCCTCCTTG CGGGATTAAAC - CTCCATCTTGAGGACGGTTC CGCTTTC GTCTTTGCTTTCC CATTTTCAGCACCTCACACC AACGGAGAAAGATGCCCTTCAG TATCGGCCCACAACAATG -CTTTG GCAACCTCAAGAAGG - TGTCGGAAGAGATGCAACAG TACTTCTTGTC AGGTGGGGTTG GGGGACCTTTTGTCATGAAG AAC TCCACCTTTTCAGACGG - TGCCAAGACACAACTTGCAC AGCTCCCCAGACTTCTTCAG -- GATGTCACCAGACTTCTTCAGG TGCCAAGCATGGTCTACACTAC GCTGGTGACTTTGAACTTGCATGTTGG GATGGCATCTGTG - - GGGACCTTAACTGTGCCAAG GCTGCTG ATCCCCTTTTTAC - ATTTCAGAATCCCCCTCAGC GCAAATTGGATGCAGAGAGC ATGCAC CGGACATTCTTCTC ACAAGGTACAGGCCACAGATG -- GAGCCGATAAGCAGAACCAC TGGCATCCAGGTAGTCTCAG GAGCCGATAAGCAGAACCAC - TGGCATCCAGGTAGTCTCAG - CCCCTCTATGTGCTGCTGAG CAGTC ATGGTCTGCCATTTC AGTGGCAAAGCGAGAATACC TGGAATGTCACACAGCCTTG ------qPCR P value quantity Ave. Atorvastatin ------Fold change Fold (Ator/ control) (Ator/ a P value quantity Ave. Combined sample change (HFD/ control) qPCR P value Fold HFD change (HFD/ control) P value Fold change (HFD/ control) Results for quantitative PCR of selected genes to test high-fat-high-cholesterol diet (HFD)-induced effects PCR of selected genes to test high-fat-high-cholesterol for quantitative Results P value Fold Microarray Screening sampleScreening sample Screening sample Validation Fold Fold change (HFD/ control) type dipose N/A N/A0.540854125 0.437 0.682 0.513706303 0.469 0.495669603 7.5784E-05 Liver0.379458744Liver 0.552 Liver 1.243 0.0871718030.884344089 0.958 2.611 0.000178384 1.485 0.001668498 4.043 0.020170763 N/A 1.562 2.266 0.056144839 0.000711469 0.004585937 1.522 N/A 8.83425E-08Liver 0.002697703 0.622 0.00456158 - 1.0189803210.002594198 N/A 0.558 0.868389267 0.003601495 1.073 0.559219119 TATGCGGTGGTTACAACTGG AAGGGCTGTTCCAC CAAAGA N/A 0.837 0.284113895 0.002160695 N/A - N/A N/A Liver 0.760 0.05725403 NDLiver0.028929279 0.656 ND0.019219693 0.679 1.007 0.9183294 NDLiver 0.839 0.0452235530.004329722 0.839 0.0020755980.132606718 ND 0.862 0.870 0.035527999Liver - 0.001403165 0.866 0.006742782 ND 0.499 2.7060021870.048970797 0.574 ND 0.824 0.345151698Liver - 0.668 0.042064306 1.355 0.019233287 0.392646259 1.371 0.217800592 ND 1.209217975 10.387 0.116171803 0.000609036 0.34436832 TGCCAA 4.732 0.01858133 0.000290616 1.312295688 0.629312324 8.01394E-05 AACATCT Liver0.098950904 1.395 0.10752507 1.553 8.090 0.000197991 5.479 0.02859439 0.000712901 0.786679659 0.096680094 0.001185142 AGATCCGA Liver0.000366821 0.201 0.011950569 0.333 0.471 0.288885319Liver 0.377 0.016456903 N/A 0.133022483 1.236501818 N/A 0.152066167 0.146313082 GGCAT 0.319145829 0.937 0.992 0.945606167 0.970 0.799067976 0.005719105 - Liver0.009020544 0.717 0.028312903 0.682 0.825 0.253276342Liver 0.753 0.009020544 N/A 0.050591903 N/A 1.119040997 0.323105345 0.0618226850.221249691 TGTGGACATT 1.649 0.674 0.548074421 1.035 0.922804985 0.081512886 - Tissue Tissue A Adipose0.013210896 0.622 0.129252561 0.756 0.769 0.230876195 0.762 0.033763696 0.002620965 1.31935431 0.261222135 0.001242193 TCTGGACAGTTAGATGGCTGTG TCTTTTGGAATCCTG GTGTGG Adipose N/A N/AAdipose N/A0.855214449 1.023 N/A 0.690 0.005676705 0.836 0.0632048240.055814949 0.001601805 0.397 1.317 0.340940503 0.799 0.379110023 - 0.056173205 - Adipose0.025666579 2.250 0.007692231 1.308 1.957 0.010491724 1.654 0.01134781 0.005918638 1.056400546 0.700861146 0.014480932 AGCGTTTGACTCGAATGTGG TTGATGAGAAGACAG GGCTCG Supplementary Table 2. Supplementary Table Gene GPAM GRK5 HLA HMGCRHNF1AHNF1A LiverINHBC0.053322453 Adipose 0.226 IRS1 N/A0.014472918KLHL8 0.350 Liver0.244421421 Liver 0.790 0.316 0.069361518 N/A0.0405790170.951821177 0.514 1.008 0.330 0.0045475920.293661312 Liver 0.909 0.001122183 1.794 0.010070590.6120471 0.668 0.028065095 1.457 0.964 0.873071006 1.3129266580.003317017 1.467 0.110412951 1.433 0.041491436 0.938 0.595372616 1.173 0.748068706 0.006058308 0.000884323 1.534 0.025388618 0.023791827 TCAGTCCAGTATGTCAGGATGC AGTTGTCCTTGATGG TGGTG 0.652 0.5277478 1.490 0.004716057 0.001311255 4.72095E-05 - - 1.115220438 0.397130967 0.004172293 - TCTCGGATCTGGCTAGTTAAGC TACCTCAACACAGTGG ATGCC FRK GCKR FER1L4 Liver0.043973066 0.760 0.150423439 1.172 1.080 0.847726801 1.122 0.567989007 8.17985E-06 - CTRL CYP26A1CYP7A1DDB2 LiverDDX560.146590117 0.609 DOCK6 Liver0.0046083320.317460691 4.238 DOCK6 1.486 AdiposeDYNLL10.813334765 1.089 0.807 0.3600640740.018731403 1.316 AdiposeF2 0.027966011 1.326 0.486993383 3.227 0.017396235 1.660 0.054843292 1.043 FADS1 Liver0.269412203 Adipose 0.007506445 1.063 0.016940115 2.128 0.0516485980.012012837 1.304 0.022640271 1.358 0.747 0.165659335 1.260 0.0459997090.141357430.020022741 1.234 1.204 1.172 0.02840792FADS2 Adipose 1.164 0.043953642 0.01433686 0.007865805 - 0.802 0.051573621 0.683 1.416 0.004779761 0.019829280.052086056 0.597 - 0.975 0.743082794 1.321 0.001452879 0.251124728 0.780174626FBXL20 0.004219912 0.550 0.01817981 0.053815667FEN1 0.031571069 1.014563033 0.571 0.00142497 TGTT 0.848698812 Adipose - 0.0117040080.009712789 0.006112049 1.363 TTCTGGGTGTGGCTTTTAGC CACCAAGTTCCAC TGTTGG 0.595612428 6.762549171 0.947 0.002107167 1.281 0.02554947 0.004401848 GGCAT 1.233 0.002987091 0.010101525 - CTF1 CTRL Adipose 0.762 0.039746338 ND ND NDFADS1 FADS2 NDFADS3FADS3 Adipose ND N/A Adipose N/A N/A ND N/A0.497504729 1.163 ND 1.295 0.1737847780.1627103 1.225 1.223 0.14233182 0.01491704 1.415 0.054516233 1.317 0.008138735 0.136421941 0.893289536 0.351845139 0.08445482 GATGTCACCAGACTTCTTCAGG ACTAC TGCCAAGCATGGTCTAC ARHGAP1ATG13 RGD1309540 Liver(C11orf49) 1.311 5.23197E-05 RGD1310769 Adipose0.004061363 1.706 (C14orf1) 0.100783761 1.694 0.050605249LOC100361444 1.315 7.392 3.08648E-06(C19orf80) 1.235 0.131714166 LOC100361444 4.326 0.011046458(C19orf80) 1.277 0.01092577 0.004705962CEP250 0.014829907 0.950458293CITED2 0.741091755COL4A3BP 0.005240587 AdiposeCOL4A3BPATCTTGATGACGACCAG TCG - N/A Adipose Liver TGGTAAGAGTGGGCAGATACC N/A 0.628 Liver 0.0895614 N/A N/A N/A0.558624982 1.114 0.033313871 1.549 1.574 0.139320024 N/A0.138652167 1.158 1.290 0.034839308 1.417 0.248705437 0.012324476 1.166 0.3032079250.123334681 1.416 0.002021481 1.188 0.000863654 1.162 0.07305992 1.774 0.04268127 0.008003311 0.977441886 - 1.437 0.00777233 0.850699135 0.00222693 0.007919765 GAATTCATCCCCAA - 0.903917913 0.389123265 0.016162748 AGTGGCAAAGCGAGA ABCA1ABCA1ABCG5 AdiposeABCG8 2.335 0.000427954ADM Liver 2.008 0.0005736ANGPTL4 Liver 1.289 0.000545435 Liver 6.459 9.42113E-05 1.215 0.054031049 2.536 0.004323091 Liver N/A0.000990501 5.846 1.785 0.49222688 1.17253E-05 0.654 2.244 5.95456E-07 7.813 3.2764E-06 N/A 0.012232634 1.509 0.193880167 0.005681146 0.434 0.034106985 6.851 4.12948E-06 0.931993946 0.683 0.490955945 5.880 0.000105108 0.555556604 0.023653056 1.008881527 0.562 0.123469623 0.009027578 0.956818841 13.474 CCACCACTGTCTGGTTTTTG AAAAAGCGACTCCAC AGAGC 0.000877826 0.041307918 1.888787344 0.038670509 CCACCACTGTCTGGTTTTTG AAAAAGCGACTCCAC AGAGC 0.013103084 8.808 8.78693E-06 0.026312279 CTGGGCAGGTTTTCTCAATG GCCTGAACTTCACTTG TCTATG 0.004831201 - 2.204238321 0.027444557 0.005767237 CATTTACACCACGCA 474 Akiyama et al. TCCTC CCTTG CCTTG TCTTG GATCG AGAATC GAGAAG TGAGTAG GACCTTG GACCTTG AGCCTAGC AGCCTAGC CCCAATG CCCAATG CTTGAAGG CTTGAAGG ATCTCTGG ATCTCTGG GGTTCAGG GGTTCAGG TCTTCACC TCTTCACC G TGGACATCAGGACTTCTTGG TG TCACACAGGCGGTAGAAGTG TCACACAGGCGGTAGAAGTG TG GATGCCTTTGTTG TTTGGCAAAGTGGAGGTCAG TTTGGCAAAGTGGAGGTCAG GATGCCTTTGTTG TCGAGGAAAAGTCG TCTTCATCATCCCTCCCTTG TCTTCATCATCCCTCCCTTG TCGAGGAAAAGTCG TTCGTCTTCTCCACAG GACAATGCGTCATCTTCACC GACAATGCGTCATCTTCACC TTCGTCTTCTCCACAG TTTGCTGGAGCCATTG AACAGCAGGTTGCTCAGAAG CCTTCGAGGAAAAGTCG TCTTCATCATCCCTCCCTTG TCTTCATCATCCCTCCCTTG CCTTCGAGGAAAAGTCG - ACCAGCAGCCATTTGAAGAC- ATTGACCCGAGTCCT - GGCATCATCCAAGAACTGAG TGTTGAGCCCTTTGTCTTCC - - TCCCCTCCATAGTCAAGAGC TTTGGGGGAGAT TTTGAGCTCACCCATAGAGC GACGCCATACTTTGATGCTGTCCAGAAG TGCACAGTTTCC TGGAGGCACAAGAA -- CCAAGGCCAACTTCCTCTTC - TATTCTTGCGGT GGAAATTCGTCTTCTCCACAG GACAATGCGTCA - TGAAGCTTTGCAGGTGGAC AGTCCTGTG AAGGAGAGAACCA CAGAGCAGGAAGGGACAATGGAAACTGG ACAATCTGGCAG --- AAACCGAGGCAAGAGACAAG CCGAATCATCCACAAGCTG TGTGAAG ACATGGCAAGCTGTG - TGTGCGTTACATCCAGCAAG CTCCTCCTCTG ACCTTTTCAG CAAGCTTGGCTAGTGACATCC - TAACTCGGGTCTGGGTTCTG- AGACCTTGCAAACGGATGAC - GGATCACGACACCATCATTG TTCCTCTCTGCATGTTCCTG CAATGGGCTGCTT AGCATGTCGTTC - TCCAAGCTGATGATGACGAG GGCCCCAGTTGCTT GGCTTCATTGTGCTCAAGTC AATTC CGCAGGTAAAAGGCA - GGTATTTGCTGGAGCCATTGCTCAGAAG AACAGCAGGTTG - TCTTGTCTGCCTTTGAGCAC GGCCTTGTAGTGCATT -- TCCAGCAGAAACATCACCTG GTTTCTCGCACTT TCCAGCAGAAACATCACCTG GTTTCTCGCACTTGA -- AGAGACTTCCTTCCCCAAGC TTCCTG CCAAGTCCAGTTTG - TCGCTGGCTAGTTTCTCCTC TCTTCTTCTTCCGCCTCAAC TCGCTGGCTAGTTTCTCCTC TCTTCTTCTTCCGCCTCAAC - GCTAAGCTCAAAGCCTCCAG- CTGGTGGGTATTCAT AAGATGGTGGTGGACTGTTG AGCATGATGTCTG -- - AAGCAAAGACCCTTGCTACG CTCAGGTCATCAT AGGACGAGATCCACATTTGC ATCC CTGTTCATGCCACATC AAGACCATCTGGGTCAAAGC AAGAC CAGGTCACATTTCACG ------LiverLiver 2.845 0.002169291Liver N/A 3.047 0.005128858 N/A 3.326 0.000580434 N/A N/A 3.200 1.64734E-05 0.1447903190.342564404 0.862 1.643 0.002899466 1.117119764 1.002 0.981682003 0.247160101 3.235 0.018376233 0.935 0.447792984 0.093379618 CGGAGT 0.004114778 2.220 6.9779E-05 0.004852301 - 1.246838606 0.207231964 0.010389956 CCTCCTGCAACTTCTCAATG TATG CCCAAGTTTGACTTCGC Liver0.165258624 1.637 0.244927432 1.454 8.577 0.000324404 4.423 0.013878231 0.008028996 1.250747059 0.351089039 0.026594818 GGAAA Liver 0.112 0.000959712 0.078 0.018810903 0.109 0.001222125 0.097 8.30673E-05 0.113113777 2.073768349 0.044928532 0.11211024AGATCACTCTCTCAAG TTGGGC AAATCTCCTCCAGGAAGTCG Liver 2.380 0.010891814 3.134 0.006251099Liver0.363260996 3.905 0.719 0.000655471Liver0.259423731 0.765 3.477 6.43964E-08 N/A 0.003230109 1.209 0.534657742 1.028 0.912100815 1.181686577 N/A 0.039162134 0.273767469 0.007529169 TCTCTTGTTGGTTTGTCCAGTG GCTGCAGTGTTTG AAAGGAC 0.028219485 1.673 - Liver 9.966 0.0001506530.057250689 0.647 4.325 0.003192069Liver0.166260589 0.822 0.004724997 0.254 0.000295681 1.100 0.267460375 0.927155624 0.363 0.027143941 0.663926742 0.955 0.541592217 0.00777232 0.012372254 0.269 0.000187292 AGTGGCCAGTAACCATCC 0.310 5.29618E-05 0.000954291 - 1.323531749 0.111058266 0.000243839 AGAACGTTGCATCCAGTCAG AAGGAGCATGGCATC AAATC Liver0.023907991Liver 0.621 Liver 0.777 0.003992880.152597047 0.606 N/A0.014445421 0.704 1.767 0.22938417 0.890 0.092773028 1.100 0.733487496 N/A 0.021826341 0.794 0.000836153 0.3576657630.168711677 1.265 3.055 0.004545993 - - 1.992 0.002474131 5.39767E-05 2.635716542 0.010324168 4.3341E-05 GTGGCATTTTGCGTTCAA Adipose0.010438888 0.511 0.305353544 0.804 0.503 0.032637287 0.623 0.018701527 0.000148945 1.316176503 0.155298632 0.000170619GACTGTTGCTATGACGAC ACAG GTTCATAAGGGTTCACCCAGAG The average quantity is arbitrarily defined for reference/control rats as a ratio of mRNA expression level of tested gene to Ppia . level rats as a ratio of mRNA expression quantity is arbitrarily defined for reference/control The average PLCG1PLEC1PLTP POLK LiverPPARA Adipose0.004041488 0.737 0.096835033 1.299 PPP1R3B0.529464298 0.953 0.116862357 9.901 PSMB10 0.988 0.742955139PVRL2 6.410 0.118970734 Adipose0.007618902 2.160 0.972 0.650928585 8.365 0.023943863 Adipose 0.0218846770.6387962210.007459802 0.838 0.760 0.000778659 Adipose0.722628196 1.033 0.043245771 3.059 0.097114529 1.321 0.805384710.08340755 0.753 0.008327245 1.283 1.762 0.1516149 - 0.52403994 0.880 0.075592438 4.29827E-05 0.000229791 0.816 0.034124686AGGAGGCGAAGTTAC CAAGC 0.016357671 1.003 0.976530432 CAGCAAGCTGTCCTTCTCAG 0.005802535 - - - TRIB1TRIB1 UBASH3B Adipose0.231812816 1.443 ZNF513 1.100 0.63533407 Liver ND, not detectable. N/A, not available; Abbreviations: qPCR. gene, Ppia , by is less than 2E-6 per endogenous control is defined to be ND when its level The gene expression 0.005946295 1.339 Adipose 1.593 0.206105945a 0.009929934 0.761 0.041755193 1.402 1.368 0.1789832310.206833188 1.181 0.008357924 2.117 0.000382001 1.054 0.553993495 1.915 0.024603134 0.002366996 1.119 0.153476244 - 0.010267156 0.908101067 0.401266104 0.001746124ACTTCGTGCAAATGGTC AGG - ATTCCGGTTTCTCCCAGTTC TOMM40 Adipose 1.384 0.003265138TYW1B 1.034 0.450053519 1.187 Adipose 0.162625820.022911232 1.239 0.063957776 1.110 2.582 0.096037501 0.026586265 0.325 0.001348867 0.907 0.755172896 0.000140323 - - R3HDM2RAB3GAP1RAB3IL1 Liver AdiposeRAB3IL10.095484256 1.271 0.000400454 0.442 RBM12 Adipose0.154948146 1.223 0.574576024 0.954 SCARB1 N/A Liver 0.993 0.931295981SETD1A 1.083 0.267979491 AdiposeSLC39A8 N/A 1.100 0.194906737 N/A 1.057 0.665468212 Adipose N/ASPAG40.057229725 0.010777013 1.430 0.06069733 AdiposeSTAC3 0.002447649 N/A 1.379 0.003895385 1.605 0.68429853 N/A Liver 0.961 STARD30.624561211 1.044 0.075915374 1.020 0.803111728 0.696 TIMD4 Adipose - 0.009178942 1.277 0.2053163120.06153459 1.652 0.623 1.134 0.314891720.907317132TIMD4 1.008 0.377617455 1.281 0.010744833 1.268 1.108 0.315758819 Liver 1.875 0.000564633 0.070501861TM6SF20.334877352 1.148 0.918 0.593878446 1.087 0.225212774 1.314 0.154257009 0.0101734450.04076596 Adipose 0.876 TM6SF2 0.012437115 1.783 0.0019646790.026508579 0.968391028 0.647 0.574 0.061790482 0.963 0.624628647 1.287 0.131975498 0.001449379 Liver0.46848646 0.775782128 0.946 0.0358132160.015021724 Adipose 0.637 0.001844585 0.816 0.1669929380.093963221 0.050353915 0.719 2.653 0.000287645 AGAAGTGGGGTGTAGGGACTG CAAGAAGCCAAGCTGTAG TG 1.086536595 0.000900537 - Liver 0.766 0.273860253 0.996 0.9455830050.285635718 - 0.339535806 1.147 3.003 0.0057838330.027228492 1.271 0.002113036 0.694 0.013468734 0.970 0.514172492 CAAGCTTGGCTAGTGACATCC AGCAAG - TGTGCGTTACATCC 0.661 0.024357717 - 0.037171268 3.231 1.531 0.003216757 0.012410089 0.00286492 - 0.837 0.237906635 1.510 0.032118942 1.085153783 0.006345394 3.101 1.97452E-05 0.655936301 1.479 0.027829479 0.006960603 0.004353079 - 0.045995515 TCT 1.139951611 - 0.953411848 0.464035642 0.406727545 0.004016391 TCTCCT 0.083828675 GGTA PCIF1 Adipose0.068106913 1.372 0.1449864 1.165 1.060 0.23307641 1.112 0.053662574 0.006781445 - LPL MADDMAFBMAFB AdiposeMYLIP 1.552 0.020526758MYRF Adipose0.173771166 0.809 1.506 0.001565853NAT20.052734792NDUFA4L2 Adipose 0.717 1.307 0.002445123 0.00969497 1.681 NPC1L1 0.957 0.8054841940.008548142 1.478 LiverNPC1L1 Adipose 1.404 1.53246E-05 0.830 0.0995234090.070083172 0.759 NR1H3 1.569 0.042782724 N/A 0.004873107 0.023908317 Adipose0.621872821OASL 1.211 N/A 1.519 0.000802864 1.036571045 LiverORAI3 N/A 0.011709925 0.868 0.57432738 0.656106826 Adipose N/A N/A 0.006722332 1.374 0.011403981 - 1.719787919TGAGCCACAAGTACAAG AGTGG PCSK9 1.032 0.881395501 TTCGGAGGTCTTCTTCACTG 0.016463179 0.763 0.301179927 1.404 0.001124798 0.000122582PLA2G6 N/A 0.011989724 ATGTTCCACACGTGATCTGC TGAAGGAAGCCATGCTG AAC N/A 0.261 1.216 1.93199E-05 0.012545961 0.390 1.309 N/A 0.014741297 Liver 7.13776E-05 - N/A 0.000125088 0.0587853170.065194698 1.266 N/A0.103289632 1.091 1.527127213 0.744574504 N/A 0.211105002 0.010533484 1.284 0.005202371 8.83576E-05 0.108283844 CACCAGCTTCATTAGCATCC TTGTAGTCGGTGGAAACAGC ACCCAGAGC GACAGAAAGAACA ATGCCTATGTCTCCATC TGC N/A 1.191 0.015354931 N/A 0.007566597 N/A ND - ND ND ND ND ND LDLR LIPC LIPG KPNB1 Adipose0.064711271 0.728 0.03491555 1.207 0.904 0.350466518 1.051 0.490257024 0.032944603 - Functional Genes for Lipid Regulation 475 n.s. n.s. n.s. n.s. n.s. n.s. artery disease Coronary b Lead trait / Other traits Other TG / HDL, TC, LDL TC, / HDL, TG LDL TC, / HDL, TG LDL TC, / HDL, TG LDL TC, / HDL, TG LDL TC, / HDL, TG LDL TC, / HDL, TG c Human GWAS Human Lead SNP [distance to gene (kb)] rs1883025 [within-gene]TC HDL / n.s. rs2923084 [59.9]rs3136441 [21.1] HDLrs2277862 [53.0] HDL n.s. n.s. TC n.s. rs12916 [18.5]rs11649653 [3.6] / LDL TC n.s. TG n.s. rs737337 [1.3] HDL n.s. rs12916 [within-gene]rs442177 [52] / LDL TC significant rs7241918 [41.7]rs3757354 [1.9] TGTC HDL / rs174546 [13.8] n.s. n.s. TC LDL / n.s. rs174546 [within-gene] rs174546 [26.0] rs174546 [within-gene] rs174546 [71.2] rs174546 [5.1] P -value 5.2E-06 5.4E-06 1.9E-05 5.2E-06 5.3E-06 5.4E-06 3.1E-08 9.2E-08 3.3E-07 1.1E-09 2.4E-07 3.8E-07 1.7E-17 7.5E-09 6.9E-08 1.8E-23 3.1E-21 7.6E-18 1.8E-23 7.6E-18 8.3E-18 1.7E-17 6.2E-16 2.2E-13 5.2E-06 5.3E-06 5.4E-06 1.6E-11 5.5E-09 3.3E-08 5.0E-05 rs9488822 [within-gene] / LDL TC n.s. a INGENUITY Disease disorder of arterydisorder disease vascular pelvic cancer disorder of arterydisorder psoriasis disease vascular abnormal bone density hematological neoplasia lymphohematopoietic cancer none none none cancer or ovarian breast mammary tumor cancer breast triple-negative glucose metabolism disorder of tumor growth insulin resistance none none none vascular disease vascular systemic autoimmune syndrome of arterydisorder none none none none none none none none none none none none vascular disease vascular of arterydisorder occlusion of blood vessel glucose metabolism disorder reaction hypersensitive diabetes mellitus disorder of arterydisorder psoriasis disease vascular none none none psoriasis genital tumor of tumor cells proliferation metastasis none none 0.0002 P -value 5.6E-13 2.1E-07 2.4E-07 5.6E-13 1.1E-12 1.1E-12 1.9E-25 3.4E-24 1.5E-23 3.4E-24 2.2E-22 3.3E-22 1.9E-25 2.3E-22 3.3E-22 1.0E-23 2.3E-22 3.3E-22 1.0E-23 1.5E-21 1.0E-20 1.0E-23 3.3E-22 1.5E-21 1.1E-12 2.7E-05 1.9E-25 4.4E-23 2.3E-22 1.1E-12 2.1E-07 2.4E-07 a INGENUITY Processes apoptosis cell movement migration of cells apoptosis of cells proliferation morphology of vessel necrosis migration of cells of leukocytes cell movement none none none migration of cells cell movement concentration of lipid necrosis apoptosis concentration of lipid none none none synthesis of lipid apoptosis concentration of lipid none none none none none none none none none none none none metabolism of membrane lipid derivative synthesis of lipid of cells proliferation fatty acid metabolism of cells proliferation synthesis of lipid synthesis of lipid concentration of lipid of cells proliferation none none none quantity of leukocytes apoptosis of cells proliferation cell movement migration of cells 0.0157 0.0442 0.4331 0.0013 0.0091 0.0044 0.0289 0.0002 0.0007 0.0101 0.0697 0.1682 0.0007 0.0101 0.0217 necrosis 0.0816 0.3023 0.4616 P -value 8.8.E-07 5.2.E-14 5.2.E-08 a (Animals) (Animals) (Animals) INGENUITY Ⅱ Ⅱ Ⅱ Pathways (Animals) (Animals) (Animals) Ⅱ Ⅱ Ⅱ Activation α /RXR α -linolenate Biosynthesis -linolenate Biosynthesis -linolenate Biosynthesis -linolenate Biosynthesis none none RhoA Signaling in Neurons Signaling Semaphorin none none none none Role of NFAT in Cardiac Hypertrophy in Cardiac of NFAT Role none none none none none none none none none none none none none none Superpathway of Geranylgeranyldiphosphate Biosynthesis I (via Mevalonate) Biosynthesis of Geranylgeranyldiphosphate Superpathway Oleate Biosynthesis Biosynthesis Oleate Biosynthesis Oleate Biosynthesis Oleate none none none none in Cancer Factor Tissue of Role Kinase Signaling Tec LXR/RXR Activation LXR/RXR Activation PPAR γ γ γ High-fat-high-cholesterol diet (HFD)-induced suggestive expression changes in the liver and/or adipose tissue for rat genes orthologous changes in the liver to expression diet (HFD)-induced suggestive High-fat-high-cholesterol those associated with lipid traits in humans P , t -test by HFD by Direction Direction change Tissue Fold Adm Adipose 1.65 upnone 0.011 Arhgap1 Liver 4.33 Cep250 Adipose up 1.42 upCol4a3bp 0.011 none 0.002 Liver Signaling Leukocyte Extravasation 1.44 up 7.8E-03 none Ctf1 LiverDock6Signaling 5.48 up LiverERK5 0.029 1.32 upnone 0.001 Fads1 Liver 2.65 down 0.016 Supplementary Table 3. Supplementary Table Rat gene qRT-PCR change by Expression Klhl8 LiverLipg 1.49 upnone 0.005 LiverMylip 1.99 up Adiposenone 0.002 1.52 upMyrfnone 0.001 Liver 3.78 upnone 0.012 Fads1 Adipose 1.75 downFads2 0.001 LiverFads3 1.50 down 0.042 Adipose 1.32 upFen1none 0.008 LiverFrk 4.73 up Adipose 1.31 0.019 down in Eukaryotes Repair Mismatch 0.034 in Neurons Signaling Reelin Hmgcr Liver 3.03 down 0.005 Biosynthesis of Cholesterol Superpathway Abca1 Liver 1.51 up 0.006 of RXR Function Inhibition LPS/IL-1 Mediated 476 Akiyama et al. n.s. significant ＊ 5 = n TG / HDL, TC, LDL TC, / HDL, TG TG / TC, LDL, HDL TC, / TG Atorvastatin 227 (6) 265 (3) 49.4 (1.5) 17.6 (1.8) 1.01 (0.05) 121.9 (5.2) After Intervention (16 wk) SHRSP rs11613352 [158.1] / HDL TG n.s. rs6882076 [0.03]rs10401969 [23.6]TG / LDL, TC n.s. rs2954029 [40.3] LDLTG, / TC significant rs7941030 [4.0] / HDL TC n.s. rs1169288 [41.4] / LDL TC significant rs11136341 [within-gene]TC LDL / rs174546 [94.9] n.s. 5 0.0001 0.0005 = 5.25729E-06 n 16 wk Normal rat chow Normal 226 (10) 262 (7) 51.1 (0.8) 23.0 (1.8) 1.33 (0.04) 121.5 (2.6) none none none psoriasis glucose metabolism disorder systemic autoimmune syndrome none none none none none none none none none none none none none none none none none none 0.0004 0.0007 0.0021 ＊＊＊ 5.61059E-13 1.10112E-12 3.47846E-06 4.30613E-08 1.0284E-06 4.30613E-08 ~17 ＊＊＊ ＊ ＊ ＊＊＊ ＊ = n (HFD) 1.3 (0.04) 14.6 (1.5) 293.5 (5.1) 113.8 (1.6) 144.5 (8.1) 172.3 (2.7) After Intervention (16 wk) SHR degranulation of phagocytes degranulation of mast cells degranulation of phagocytes none none none metabolism of nucleic acid component or derivative metabolism of nucleotide antiviral response none none none none none none none none none none none none apoptosis of cells proliferation quantity of leukocytes 0.1. See details in the Methods section. In each category, top-3 enrichment groups are presented. are top-3 enrichment groups each category, section. In details in the Methods 0.1. See a ＜ ~59 = 16 wk n 1,11-13 ≥ 1.3 and P 0.5 (0.1) 41.0 (0.9) 10.1 (0.8) Normal rat chowNormal diet High-fat-high-cholesterol 196.4 (1.7) 310.9 (2.5) 133.8 (6.2) none none none none none none none none none none none none none none none none ) are overlapped with the gene list in Table 1, where the type of tissue is different between the tables. between the type of tissue is different 1, where Table with the gene list in overlapped ) are and Timd4 genes ( Abca1 Two depicted in the table. and/or adipose tissues after HFD are in the liver expression 0.05) of differential ＜ test, normal rat chow vs. HFD (in SHR); normal rat chow vs. atorvastatin vs. HFD (in SHR); normal rat chow SHRSP). t test, normal rat chow 0.001 by Physiological and biochemical parameters after interventionPhysiological diet in comparison with the control ＜ P b ＊＊＊ 0.01, 7, 8 ＜ P ＊＊ 0.05, ＜ As for blood pressure after HFD intervention in SHR, 17 rats were used for the measurements. after HFD intervention in SHR, 17 rats were As for blood pressure P Blood pressure and body weight were measured for 59 rats in SHR. measured were and body weight pressure Blood The corresponding information was drawn from the previous study of human lipid GWAS meta-analysis. study of human lipid GWAS the previous information was drawn from The corresponding INGENUITY iReport (INGENUITY Systems, Qiagen) was used to identify functionallly relevant expression changes in DNA microarray data. To perform an annotation enrichment analysis by the Fisher’s exact test, which identifies Pathways, Biological Processes, and Diseases that are that are and Diseases Processes, Biological exact test, which identifies Pathways, perform the Fisher’s an annotation enrichment analysis by To data. changes in DNA microarray expression INGENUITY (INGENUITYQiagen) was used to identify functionallly relevant iReport Systems, The distance is from a lead SNP to the transcription start (or end) site of the differentially expressed gene. expressed a lead SNP to the transcription startThe distance is from (or end) site of the differentially Ubash3b Liver 1.92 upnone 0.025 b Intervention Ndufa4l2 Liver 2.56 downnone 0.015 c 4. Supplementary Table Strain (Bw), g Body weight plasma glucose, mg/dl Fasting mg/dl cholesterol, Total mg/dl Triglyceride, fatty acid, mEq/l Free for HFD and atorvastatin the the means (SE). Data from interventions derived are are Values (16-hr) fasting state. of the rat in overnight the tail vein drawn from samples were Blood studies. previous a b Oasl Adipose 1.61 downnone 0.019 TM6SF2 Liver 1.48 upTrib1none 0.028 Liver 4.42 upnone 0.014 ( P level a suggestive A total of 25 genes showing Plec1 Adipose 8.36 upnone 0.024 Rab3il1 Liver 1.78 upnone 0.002 Timd4 Adipose 1.44 downnone 0.013 Blood pressure, mmHg pressure, Blood a of |fold change| adopted cut-off levels genes, we expressed in the differentially significantly overrepresented Physiological and metabolic phenotypes Physiological ＊ Functional Genes for Lipid Regulation 477 n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A suggestive increase in liver increase suggestive suggestive increase in liver increase suggestive suggestive increase in liver increase suggestive suggestive decrease in liver decrease suggestive significant in increase liver significant in increase significant increase in liver significant increase in liver significant increase significant decrease in liver significant decrease ease in liver/ suggestive decrease in adipose decrease suggestive ease in liver/ suggestive increase in adipose increase suggestive suggestive increase in adipose increase suggestive suggestive decrease in adipose decrease suggestive significant incr ↑ ee chol. ↑ ↑ ↑ ↑ ↑ ↑ ↑ ↑ ↑ ↑ ↑ ↑ ↑ ↑ ↑ ↑ ↑ ↑ / fr n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. ↑ N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A ee chol. ee chol. ee chol. ee chol. free chol. free free chol. free fr fr free chol. free free chol. free free chol. free free chol. free chol. free fr free chol. free chol. free free chol. free free chol. free chol. free free chol. free free chol. free fr LDL-uptake siRN/A knockdown in Hela cells in Hela siRN/A knockdown diet intervention in rats High-fat-high-cholesterol
－ － ＋ － － ＋ ＋ ＋ ＋ ＋ ＋ ＋ － of major allele Expression effect Expression fat n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A 2E-10 6E-13 7E-13 3.0E-18 2.0E-08 6.0E-80 1.0E-17 1.0E-41 2.0E-29 1.0E-99 2.0E-18 8.0E-54 0.000000002 Subcutaneous
－ － ＋ － ＋ ＋ ＋ ＋ ＋ － ＋ ＋ ＋ － － ＋ of major allele Expression effect Expression fat n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. N/A N/A N/A N/A N/A N/A N/A N/A N/A 6.0E-33 1.0E-08 2.0E-11 9.0E-13 1.0E-15 7.0E-12 3.0E-91 2.0E-37 3.0E-55 5.0E-10 2.0E-29 3.0E-25 2.0E-65 1.0E-13 2.0E-08 Omental Omental 3.0E-115
＋ ＋ － ＋ － － － － － － － － － － － ＋ ＋ of major allele n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. N/A N/A N/A N/A N/A N/A Liver effect Expression 4.0E-12 2.0E-13 7.0E-44 1.0E-13 1.0E-22 5.0E-94 9.0E-17 1.0E-23 7.0E-54 4.0E-08 4.0E-08 2.0E-271 2.0E-300 2.0E-145 Gene expression] [SNP] to [Gene to intervention)] (response to [Phenotype [Gene] SELP RHD SARS TBL2 APOB SYPL2 PSRC1 BAZ1B SORT1 PSMA5 ABCG8 TIMD4 DOCK7 MLXIPL NT5DC1 MYBPHL TMEM57 LDLRAP1 DNAJC30 TMEM50A COL4A3BP HLA-DRB1 HLA-DRB5 HLA-DQA1 HLA-DQA2 A list of candidate causative genes at lipid-associated loci previously reported in GWAS, detected by cis-eQTL, cell-based RNAi and/or in cis-eQTL, detected by in GWAS, reported genes at lipid-associated loci previously A list of candidate causative study in the rats vivo 21225281 21263900 (NCBI_37) chr2 chr2 lead SNP Chr Position rs1367117 45 rs2131925 chr1 rs629301 63025942 chr1 109818306 ANGPTL3 CELSR2 3 rs2479409 chr1 55504650 PCSK9 1 rs12027135 chr12 25775733 rs4660293 chr1 RHCE 40028180 OXCT2 6 rs3917820 chr1 169564745 F5 9 rs4299376 chr2 44072576 ABCG5 78 rs1042034 rs1260326 chr2 27730940 IFT172 7.0E-32 21 rs1564348 chr6 160578860 SLC22A3 N/A 18 rs3177928 chr6 32412435 HLA-DQB1 17 rs3757354 chr6 16127407 MYLIP Supplementary Table 5. Supplementary Table Locus order 20 rs948882222 chr6 rs17145738 116312893 chr7 72982874 FRK BCL7B 19 rs2814944 chr6 34552797 UHRF1BP1 n.s. 2324 rs9987289 rs7819412 chr8 chr8 9183358 11045161 PPP1R3B MTMR9 1.0E-14 N/A 252627 rs12678919 rs2954029 chr8 rs11136341 chr8 19844222 chr8 126490972 145043543 LPL TRIB1 PLEC1 10 rs10195252 chr2 165513091 GRB14 11 rs2972146 chr2 227100698 IRS1 121314 rs442177 rs13107325 rs12695382 chr4 chr4 chr4 88030261 103188709 118948171 SLC39A8 KLHL8 B4GALT4 3.0E-19 N/A 16 rs6882076 chr5 156390297 HAVCR1 15 rs12916 chr5 74656539 HMGCR 478 Akiyama et al. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A suggestive increase in liver increase suggestive suggestive increase in liver increase suggestive in liver increase suggestive in liver increase suggestive suggestive increase in liver increase suggestive suggestive increase in liver increase suggestive suggestive increase in liver increase suggestive suggestive decrease in liver decrease suggestive suggestive decrease in liver decrease suggestive significant decrease in liver significant decrease suggestive increase in adipose increase suggestive suggestive decrease in adipose decrease suggestive significant increase in adipose significant increase in adipose significant increase suggestive decrease in liver and adipose in liver decrease suggestive ↑ ↑ ↓ ↓ ↑ ↑ ↑ ↑ ↑ ↑ ↑ ↑ ↑ ↑ ↑ ↑ ↑ ↑ ↑ ↑ ↑ ↑ ↑ ↑ ↑ ↑ ↑ ↑ ↑ /free chol. /free /free chol. /free /free chol. /free /free chol. /free /free chol. /free /free chol. /free ↑ ↓ ↓ ↓ ↑ ↑ n.s. n.s. n.s. n.s. n.s. n.s. N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A free chol. free chol. free chol. free chol. free free chol. free free chol. free chol. free chol. free free chol. free free chol. free chol. free free chol. free free chol. free free chol. free free chol. free free chol. free free chol. free free chol. free free chol. free free chol. free free chol. free LDL-uptake LDL-uptake LDL-uptake LDL-uptake LDL-uptake LDL-uptake
＋ ＋ ＋ n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. N/A in liver increase suggestive n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A 4.0E-53 3.0E-11 3.0E-08 ＋ － － ＋ ＋ ＋ － － ＋ n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. chol. free n.s. n.s. n.s. n.s. n.s. n.s. n.s.n.s. n.s. n.s. N/A N/A n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. N/A n.s. N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A 2.0E-11 2.0E-08 1.0E-08 4.0E-10 5.0E-09 1.0E-10 3.0E-18 1.0E-72
－ － － ＋ ＋ ＋ － ＋ ＋ － ＋ ＋ － － － n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. N/A N/A N/A N/A N/A N/A N/A N/A N/A 5.0E-08 7.0E-23 5.0E-18 3.0E-15 9.0E-24 7.0E-47 ＊ ＊ ＊ ＊ ＊ LIPC RELB FEN1 OASL MYRF TSSK6 PBX4 NCAN STAC3 FADS2 FADS3 POP4 SUGP1 APOA4 NPC1 CRKRS APOC3 NR1H3 PRMT7 YJEFN3 GSDM1 ZNF14 TM6SF2 NFATC3 RAB3IL1 HAPLN4 CLPTM1 VKORC1 ENSG00000213993 19000001-25000000 chr12 121416650 C12orf43 chr17 45425115 TBKBP1 6.0E-10 rs1169288 rs7206971 28 rs581080 chr9 15305378 TTC39B 2.0E-15 424344 rs8017377 rs292928245 chr14 rs1532085 chr15 24883887 chr15 rs2652834 44245931 58683366 NYNRIN chr15 CKMT1A 63396867 ALDH1A2 3.0E-46 8E-28 LACTB 52 rs7229921 chr18 12283547 CIDEA 293031 rs188302532 rs2923084 chr933 rs10128711 chr11 rs3136441 107664301 chr11 10388782 rs7120118 chr11 18632984 ABCA1 chr11 46743247 ADM SPTY2D1 47286290 ARHGAP1 n.s. 1.0E-16 MADD n.s. n.s. n.s.41 n.s. 1.0E-09 n.s. n.s. n.s. N/A in liver increase in adipose/ suggestive significant increase in adipose increase suggestive 34 rs7395662 chr11 4851889336 FOLH1 rs964184 chr11 N/A 116648917 APOA1 N/A N/A LDL-uptake 59 rs4420638 chr19 45422946 CBLC 48 rs169428874950 chr16 rs9891572 67928042 rs11869286 chr17 chr17 ACD 2428508 37813856 PAFAH1B1 PERLD1 N/A 47 rs3764261 chr16 56993324 CETP 46 rs11649653 chr16 30918487 CTF1 5758 rs737337 rs10401969 chr19 chr19 11347493 19407718 DOCK6 MAU2 5556 rs7255436 rs6511720 chr19 chr19 8433196 11202306 ANGPTL4 LDLR 4.0E-08 53 rs7241918 chr18 47160953 LIPG 4.0E-10 54 18q11.2 chr18 40 rs7134594 chr12 110000193 MMAB 2.0E-44 373839 rs7941030 rs11220462 chr11 rs11613352 chr11 122522375 chr12 126243952 57792580 UBASH3B ST3GAL4 NDUFA4L2 n.s. 2.0E-22 n.s. n.s. N/A in liver increase suggestive 35 rs174546 chr11 61569830 FADS1 51 Functional Genes for Lipid Regulation 479 6.40E-04 6.80E-01 5.50E-01 Benjamini n.s. n.s. n.s. n.s. N/A suggestive increase in adipose increase suggestive P _Value 1.30E-05 4.60E-02 4.80E-02 ↑ ↑ ↑ N/A N/A N/A － ＋ ＋ 6.0E-31 1.0E-47 2.0E-08 － ＋ ＋ n.s.n.s.n.s. n.s. n.s. n.s. N/A n.s. N/A n.s. liver significant in increase n.s. n.s. n.s. n.s. N/A 8.0E-37 1.0E-73 2.0E-11 ＋ ＋ － ＋ － ＋ LPL, APOA1, APOC3, FADS2, PLTP, ANGPTL4, NR1H3 PLTP, APOC3, FADS2, LPL, APOA1, ABCG8, ABCG5, ABCA1 LPL, LIPG, LIPC n.s. 3.0E-08 7.0E-41 7 3 3 Count Genes but not a candidate in the present study. ENSG00000213993 is no longer in the database. study. but not a candidate in the present 6 CPNE1 ERGIC3 Pathways enriched among the candidate causative genes for lipid association enriched among the candidate causative Pathways 6263 rs386000 rs6511720 chr19 chr1966 54792761 1120230667 n.s., not significant. N/A, not available; Abbreviations: rs6065906 LILRA3 study to in Blattman’s Asterisk indicates the gene which is refered SPC24 rs181362 chr20 9.0E-12 chr22 44554015 N/A 21932068 PLTP UBE2L3 3.0E-18 6.0E-13 signaling pathway PPAR ABC transporters N/A metabolism Glycerolipid N/A chol. free 61 rs439401 chr1965 45414451 rs1800961 APOE chr20 43042364 n.s. HNF4A n.s. n.s. n.s. n.s. n.s. chol. free chol. free 60 rs4420638 chr19 45422946 APOC4 4.0E-09 6. Supplementary Table KEGG_PATHWAY also shown. method are the Benjamini-Hochberg by The q-values exact test. Fisher’s calculated by are P values HLA not included. bioinformatic database is used for detecting the enriched pathways, where are genes The functional annotation tool in the DAVID 64 rs2277862 chr20 34152782 CEP250 480 Akiyama et al.
Aa) Bb)
Abcg5 Abcg8 Hmgcr Lipg Mylip Fads1 Nr1h3 10 12 2 3 2 2 2 8 *** 10 *** ** ** *** ** *** 1.5 1.5 ratio 1.5 sue] 1.5 ratio
8 s 6 2 6 1 1 1 1 4 [Liver] 4 1 0.5 0.5 0.5 0.5 2 2 [Adipose ti Expression Expression 0 0 0 0 0 0 0 chow HFD chow HFD chow HFD chow HFD chow HFD chow HFD chow HFD
Abcg5g Abcg8g Hmgcrg Lipgpg Mylipyp Fads1 Nr1h3 3 4 2 3 3 10 2 * * * * * 8 ** * 3 * 1.5 2 1.5 2 2 6 2 1 1 se tissue] [Liver] ssion ratio ession ratio
o 4 r 1 1 1 e 1 0.5 0.5
Exp 2 [Adip Expr 0 0 0 0 0 0 0 cont. ator. cont.ator. cont. ator. cont. ator. cont. ator. cont. ator. cont. ator.
Supplementary Fig.1. Gene expression changes induced by the HFD (top) and atorvastatin (bottom) interventions for a selected list of genes. Bar graphs for the ratios of the gene expression levels (in the intervention group to the control-diet group) are shown for a total of seven genes: (A) five known genes in the liver and (B) Fads1 and Nr1h3 in the adipose tissue. See the Methods section for details. ＊P＜0.05, ＊＊P＜0.01 and ＊＊＊P＜0.001, statistical differences were evaluated using the unpaired t-test between the intervention and control- diet groups (n=8 each for the HFD intervention and n=4 each for the atorvastatin intervention). n.s., not significant.
Fig. S2
ARHGAP1 UBE2L3
POP4
UBASH3B MTMR9 PSMA5
ABCA1 CBLC MYLIP HNF4A APOA1
APOC3
PLTP
TBKBP1 APOE PAFAH1B1 ABCG5 LPL COL4A3BP
APOB ABCG8 LIPC SUGP1
F5
OXCT2
STAC3
RAB3IL1
Supplementary Fig.2. A significantly enriched network of BioGRID protein-protein interactions provided by the g:Profiler toolset10). A list of 121 genes (in Supplementary Table 6) were input as query genes: six significant (Abca1, Abcg5, Abcg8, Lpl, Pltp and Stac3; colored in red) and three suggestive (Arhgap1, Mylip and Ubash3b; colored in blue) genes were found to constitute “nodes.”