Cell-Specific Splicing Factors That Optimize Calcium Channel Function

Cell-specific splicing factors that optimize calcium channel function

Summer Elizabeth Allen

B.A., Carleton College, 2005

A DISSERTATION SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY IN THE DEPARTMENT OF NEUROSCIENCE AT BROWN UNIVERSITY

PROVIDENCE, RHODE ISLAND

MAY 2012

This dissertation by Summer Elizabeth Allen is accepted in its present form by the Department of Neuroscience as satisfying the dissertation requirement for the degree of Doctor of Philosophy.

Date ______Dr. Diane Lipscombe, Advisor

Recommended to the Graduate Council

Date ______Dr. Barry Connors, Reader

Date ______Dr. William Fairbrother, Reader

Date ______Dr. Anne Hart, Reader

Date ______Dr. James Eberwine, Outside Reader

Approved by the Graduate Council

Date ______Dr. Peter M. Weber, Dean of the Graduate School

Summer Elizabeth Allen Curriculum vitae Brown University T: 401-863-2615 Box GL-N, Sidney Frank Hall F: 401-863-1074 Department of Neuroscience [email protected] Providence, Rhode Island 02912

EDUCATION

Brown University, Providence, Rhode Island 2005-present Ph.D. Candidate, Department of Neuroscience Dissertation title: Cell-specific splicing factors that optimize calcium channel function Advisor: Diane Lipscombe

Carleton College, Northfield, Minnesota 2001-2005 B.A. in Biology, cum laude

AWARDS AND FELLOWSHIPS

Predoctoral Ruth L. Kirschstein National Research Service Award July 2009-Sept.2011 National Institute of Neurological Diseases and Stroke (F31NS066691) Title: "Finding factors that control cell-specific splicing of a calcium channel"

Charles A. Dana Brain Science Interdisciplinary Fellowship Fall 2007 Brown University Institute for Brain Science

RESEARCH EXPERIENCE

Graduate Student 2005-present Brown University, Providence, Rhode Island Department of Neuroscience Dr. Diane Lipscombe, Advisor Investigating the proteins that regulate calcium channel alternative splicing.

Research Assistant 2000-2004 Oregon Health and Sciences University, Portland, Oregon Department of Neuroscience Dr. M. Susan Smith and Dr. Kevin L. Grove Studied the neuronal circuitry involved in obesity.

PUBLICATIONS

In preparation Allen SE*, Phillips CG*, Raingo J, and Lipscombe D. (In preparation). The neuronal splicing factor Fox-2 controls Gs signaling to the N-type calcium channel. *SEA and CGP contributed equally to this work Published papers Allen SE, Darnell RB, Lipscombe D. 2010. The neuronal splicing factor Nova controls alternative splicing in N-type and P-type CaV2 calcium channels. Channels 4(6):483-9. Glavas MM, Grayson BE, Allen SE, Copp DR, Smith MS, Cowley MA, Grove KL. 2008. Characterization of brainstem peptide YY (PYY) neurons. J Comp Neurol. 10;506(2):194-210. Grayson BE, Allen SE, Billes SK, Williams SM, Smith MS, Grove KL. 2006. Prenatal development of hypothalamic neuropeptide systems in the nonhuman primate. Neuroscience. 28;143(4):975-86. Campbell RE, Smith MS, Grayson BE, Allen SE, ffrench-Mullen JMH, Grove KL. 2003. Y4 regulation of orexin neurons in the lateral hypothalamic area (LHA). J. Neurosci. 23:1487-1497. Grove KL, Allen S, Grayson BE, Smith MS. 2003. Postnatal development of the hypothalamic neuropeptide Y system. Neuroscience 116:393-406. Book chapter Lipscombe D, Allen SE, Gray AC, Marangoudakis S, Raingo J. 2008. Alternative splicing of neuronal CaV2 calcium channels. In: Kaczmarek L and Gribkoff VK (Eds.), Ion Channels. Wiley Publishers. P. 219-250.

CONFERENCE ABSTRACTS

Allen SE, Darnell RB, and Lipscombe D (2010) The neuronal splicing factor Nova-2 controls the expression of CaV2.1 and 2.2 splice isoforms. Society for Neuroscience. Phillips CG, Allen SE, Lipscombe D (2010) The neuronal splicing factor Fox-2 regulates an exon in Cav2.2 that controls the sensitivity of N-type calcium channels to inhibition by Gs proteins. Society for Neuroscience. Allen SE, Phillips CG, Lipscombe D (2010) The splicing factor Fox-2 controls N-type calcium channel activity in sympathetic neurons. Second Annual International Calcium Channel meeting. Phillips CG, Allen SE, Lipscombe D (2009). G protein-coupled receptor inhibition of N- type calcium channel splice-variants. Society for Neuroscience. Allen SE (2009). Finding factors that regulate the splicing of calcium channel exons. Brown-NIH Neuroscience Graduate Retreat at the Marine Biological Laboratory, Woods Hole, MA

iii

Allen SE, Lipscombe D. (2008). Fox proteins regulate the tissue-specific an development- specific alternative splicing of an N-type calcium channel exon. Society for Neuroscience. Allen SE, Xiao XQ, Grove KL, Smith MS. (2005). Neurokinin B (NKB) expression in the arcuate nucleus (ARH) is decreased during lactation. Endocrine Society Abstracts.

TEACHING AND MENTORING

Instructor July 2009 Psychopharmacology: Brain, body, and society Office of Continuing Education, Brown University -Developed and taught 15 hour, one week, pre-college course to 30 upper level high school students. -Designed syllabus, assignments, lectures, sheep brain dissection, and hands on activities; led discussions; wrote feedback to students.

Graduate teaching assistant 2006 Neuroanatomy Department of Neuroscience, Brown University -Prepared for and conducted laboratory sessions, graded exams, and tutored undergraduate and graduate students.

Mentor 2007-present Department of Neuroscience, Brown University -Teach experimental design, laboratory techniques, and data analysis to undergraduate student and graduate students. -Aid students in developing public speaking and writing skills.

Professional development Harriet W. Sheridan Center for Teaching and Learning, Brown University Certificate I: Sheridan Teaching Seminar 2005-2009 Certificate II: Classroom Tools Seminar 2010

UNIVERSITY SERVICE

Graduate Student Representative 2008-2009 Department of Neuroscience, Brown University - Planned graduate student recruitment weekends; served on admissions committee; acted as liaison between students and faculty.

PROFESSIONAL AFFILIATIONS

Society for Neuroscience 2005-present

PREFACE

Virtually all mammalian genes are alternatively spliced. The variation in protein isoforms caused by this alternative splicing is particularly prominent in the nervous system where the splicing of neuronal genes plays vital roles in axonal guidance, synapse differentiation, receptor modulation, and the regulation of neurotransmitter release. Cell-specific alternative splicing in voltage-gated calcium channels exemplifies how RNA processing can have dramatic effects on neuronal function. Calcium entry through presynaptic CaV2 channels initiates the intracellular cascade that triggers synaptic vesicle fusion and transmitter release, essential processes for neuronal communication. Tissue-specific splice isoforms of these channels have distinct basic biophysical properties and unique responses to G protein-coupled receptors. In my dissertation work I studied the factors that regulate tissue-specific splicing of CaV2 channels. Following introductory Chapter 1, in Chapter 2 I detail my discovery of a previously unreported alternative exon 24a in CaV2.1 mRNA. I also show that the neuronal-specific RNA-binding protein Nova-2 regulates inclusion of extracellular exons

24a and 31a in CaV2.1 and CaV2.2. In Chapter 3, I present our work exploring the function and regulation of alternative CaV2.2 exon 18a. Previous work from our lab showed that inclusion of this exon is developmentally regulated and depends on neuronal-cell type. In this thesis, I demonstrate that the splicing factor Fox-2 represses inclusion of CaV2.2 e18a. I also present work done in collaboration with Cecilia Phillips showing that inclusion of e18a in sympathetic neurons renders CaV2.2 channels uniquely susceptible to Gs-mediated voltage-independent inhibition. The studies presented in

Chapter 3 are unique because they show how a specific alternative exon regulated by a cell-specific splicing factor protein controls a fundamental neuronal process. In Chapter

4, I present my attempts to identify the factors that regulate the splicing of mutually exclusive exons 37a and 37b in CaV2.2. Splicing of these exons is both tissue-specific and functionally important. Inclusion of exon 37a in CaV2.2 channels in neurons of dorsal root ganglia allows Gi/o coupled-receptor agonists to inhibit CaV2.2 channels in a voltage- independent manner. Although I have yet to identify the splicing factors involved, I present evidence from minigene studies that suggests a model that includes a repressor of exon 37a and an enhancer of exon 37b. Bioinformatic analyses suggest that hnRNP-

A/B and hnRNP-F may regulate inclusion of these exons. In the discussion chapter I examine how studies such as mine can provide important insight into cell-specific optimization of protein function. I also discuss models of splicing regulation and exciting avenues for future research.

ACKNOWLEDGMENTS

First and foremost, I would like to acknowledge my advisor, Diane Lipscombe. Diane has been an amazing mentor. She is able to tailor her mentorship style to fit each particular mentee. For me that’s meant that she has given me freedom to explore new ideas and techniques while offering guidance and encouragement when needed. She’s helped me improve the planning and analysis of experiments and encouraged the development of my writing and public speaking skills. She has been incredibly generous with her time and other resources. I know she will always be a sounding board for me and supportive of my career. Diane is an extraordinarily talented scientist and teacher. She is intelligent, savvy, and fun to work with. I will miss her terribly when I move on from the lab!

Next, I would like to thank everyone who has worked in the Lipscombe lab with me, including Sylvia Denome, Jesica Raingo, Spiro Marangoudakis, Cecilia Phillips, Arturo Andrade, Yu-Qiu (Rachel) Jiang, Thomas Helton, Kiauntee Murray, Kristin Webster, and Valerie Yorgan. I would like especially to thank Sylvia who taught me cloning and many other molecular techniques. I would have been lost without her! I must also give a gigantic thanks to my lab ‘sister,’ Ceci. She has truly enriched my grad school experience. We’ve shared so much—frustrations and successes, professional and personal—over the past five years. She is a terrific neurobiologist, writer, editor, teacher, and friend. Arturo has been a great cubicle buddy and has been very helpful in troubleshooting experiments. Spiro, Kiauntee, Kristin, and Val have always lent helping hands when I needed them and have made working in the lab a fun experience.

I would like to thank my committee: Barry Connors, Will Fairbrother, Anne Hart, and James Eberwine (U. Penn.) for giving support, advice, and flexibility.

I would like to thank Tanya Sanders from the Hawrot lab for teaching me how to culture and inject sympathetic cervical ganglia neurons.

I would like to thank Doug Black (UCLA) and members of his lab who have offered their expertise and help with the Fox project. Robert Darnell (Rockefeller) generously supplied us with the data from his HITS-CLIP map as well as the Nova-2 knockout mice and provided helpful discussions about Nova and splicing regulation.

The Brown neuroscience department is an incredible place to be a graduate student. I have learned so much from its faculty, staff, postdocs, grad students, and undergraduate students. I also wholeheartedly appreciate the collegial and collaborative atmosphere, which makes for a great environment to do science. I have learned so much from my fellow graduate students. I would like to especially thank Julia Najera who has been a great friend from our first year (so many years ago) to now. My brain, heart, and stomach have all benefited greatly from visits with her! Knitting (and

vii non-knitting) nights with Ceci, Heida Sigurdardottir, and Kristin Kerr Scaplen have also helped keep me sane.

I would like to thank Drs. Kevin Grove and M. Susan Smith and the members of their lab at Oregon Health and Sciences University. They welcomed me into their lab when I was just 17 and filled me with a love of neuroscience and the scientific process.

I give a very hearty thanks to my family: Mom, Dad, Marc, Matthew, and Sarah. My dad, being a fellow scientist, instilled me with a love of science at an early age. I still remember him explaining the Pythagorean theorem to me as a bedtime story. To this day, his love of science is infectious. My mom, a former librarian, also fostered my inquisitiveness and love of reading. She gave me the gift of learning how to learn. She has also been a huge emotional support during grad school. My siblings, Marc, Matthew, and Sarah, have been very supportive these past six years and have taught me not to take myself too seriously. The love and support of my family have helped me weather the ups and downs of graduate school.

I would also like to thank my in laws, John and Susy Greene, who have been so supportive during grad school and who didn’t bat an eye when I said I needed to go into lab during their visits to feed some cells or check for mouse pups! Max’s grandparents Gail and Don Greene and Royce Lockart have also been very encouraging.

I thank my daughter Madeline Clover. She gives me a new appreciation for biology and neuroscience every day. She puts failed experiments into perspective, and her smile lights up my whole world.

Most of all, I must thank my beloved and amazing husband, Max. It is difficult to put into words how much his love and support mean to me. He has offered me tremendous encouragement and support from applying to graduate school all the way up to my defense date. He has read and edited countless conference abstracts, grant applications, paper manuscripts, and dissertation chapters and has listened to many, many practice talks. He has offered consolation over experiment frustrations and has helped me celebrate my successes. He knows way more about alternative splicing and calcium channels than any attorney ever should! Furthermore, he is a fantastic father and spouse. His being an equal partner in our life together has allowed me to pursue my passions. I can’t possibly thank him enough.

viii

Dedicated to Max and Madeline, you are my sunshine

TABLE OF CONTENTS

CHAPTER 1: Introduction ...... 1

CHAPTER 2: The neuronal splicing factor Nova controls alternative splicing in N-type and P-type CaV2 calcium channels ...... 44

Abstract ...... 45

Introduction ...... 46

Results ...... 51

Discussion...... 56 Figures and figure legends ...... 58

CHAPTER 3: The neuronal splicing factor Fox-2 controls Gs protein inhibition of CaV2.2 calcium channels ...... 66

Abstract ...... 67

Introduction ...... 68

Results ...... 70

Discussion...... 78

Materials and methods ...... 84 Figures and figure legends ...... 90

CHAPTER 4: Finding factors that regulate CaV2.2 e37a and e37b alternative splicing.. 103

Abstract ...... 104

Introduction ...... 105

Results ...... 107

Discussion...... 116

Materials and methods ...... 119 Figures and figure legends ...... 123

CHAPTER 5: Discussion ...... 137

Examining the regulation of alternative splicing: splicing maps and single gene analysis ...... 138

Splicing factors work in concert with other regulators to control alternative exon inclusion ...... 142

Future directions ...... 147

REFERENCES ...... 154

LIST OF FIGURES

1-1 Voltage-gated calcium channels contain multiple protein subunits 37

1-2 Types of alternative splicing. 38

1-3 CaV2.2 channels contain multiple sites of alternative splicing. 40

1-4 The spliceosome assembly and the splicing reaction. 41

1-5 Trans factors can bind to cis elements to regulate the splicing of alternative exons. 43

2-1 Nova acts as a splicing repressor or enhancer depending on its binding site relative to the target exon. 58

2-2 Nova binding motifs are located in the intron downstream of e24a of 59 CaV2.2.

2-3 Alternatively spliced exons in the CaV2 genes. 60

2-4 Alternative exons e31a of CaV2.1 and CaV2.2 are repressed in brain by 61 Nova-2.

2-5 Alternative exon 24a of CaV2.1 is enhanced in brain by Nova-2. 63

2-6 Cellular control of alternative splicing likely involves the net contribution of more than one splicing factor. 65

3-1 The splicing factor Fox-2 represses e18a inclusion. 90

3-2 Inclusion of e18a renders CaV2.2 susceptible to G protein-mediated voltage-independent inhibition. 92

3-3 e18a-mediated voltage-independent inhibition is mediated by Gs and

G. 94

3-4 Coexpression of 2a does not affect e18a-mediated voltage- independent inhibition. 96

xii

3-5 Calcium currents from SCG neurons injected with Fox-2 siRNA and uninjected cells are inhibited by the Gs agonist VIP. 98

3-6 Fox-2 siRNA injection in SCG neurons switches the voltage-dependence of VIP inhibition of the N-type current to mostly voltage independent inhibition. 100

3-7 Models of GPCR inhibition of CaV2.2 channels. 102

4-1 Regulation of CaV2.2 e37a and e37b splicing. 123

4-2 Nova-2 does not regulate e37a and e37b splicing, at least not alone. 125

4-3 Splice products from wildtype and mutant CaV2.2 37a/b minigenes transfected into tsA cells show that splicing of e37a is repressed in these cells. 128

4-4 Bioinformatics tools predict exonic splicing regulators in CaV2.2 e37a 131 and e37b.

4-5 Potential intronic splicing factor binding sites as predicted by SFMap. 133

5-1 Predicted hairpin secondary structures in Cacna1b exons 36 and 37b. 153

xiii

CHAPTER 1

Introduction

Alternative splicing in the nervous system

Alternative splicing—the process by which a single gene can code for several protein isoforms—is increasingly recognized as the basis of the proteomic diversity needed for complex mammalian functions. It is now predicted that upwards of 94% of multiexon genes within the human genome are alternatively spliced (Wang et al 2008). This prevalence may explain the large evolutionary expansion of the eukaryotic proteome that occurred independent of a large increase in gene number (Nilsen & Graveley 2010).

Such proteomic diversity is required for the formation, maintenance, and proper functioning of neural networks (Loya et al 2010). Alternative splicing of neuronal genes plays vital roles in axonal guidance, synapse differentiation, receptor modulation, and regulation of neurotransmitter release. Alternative splicing affects these processes through two different means: (1 ) by facilitating nonsense-mediated decay of transcripts that are not needed in a particular cellular situation and (2) by creating peptide modules that are included or excluded in different neuronal cell types, at different points in development, or in response to neural activity (Grabowski & Black 2001).

The alternative splicing of voltage-gated calcium channels is a particularly strong example for how alternative splicing can have dramatic effects on neuronal functioning.

Calcium entry through these channels initiates the intracellular cascade that triggers synaptic vesicle fusion and transmitter release, essential processes for neuronal communication. Optimization of channel structure and function through alternative splicing allows for uniquely tuned channel properties in different neuronal cell-types.

Alternative splicing can tune the basic biophysical properties of a channel, such as activation and inactivation kinetics, and can also determine the response of channels to inhibition by G protein-coupled receptor agonists such as opiates and GABA (Andrade et al 2010; Lin et al 1999; Pan & Lipscombe 2000; Raingo et al 2007; Thaler et al 2004).

Ultimately, alternative splicing is one way that a cell can control how much calcium enters the neuron and, if channels are presynaptic, neurotransmitter release.

Structure of voltage-gated calcium channels

A voltage-gated calcium channel is composed of several protein subunits. The α1 subunit contains the ion pore, the voltage-sensor, and sites of drug and toxin binding.

Two accessory subunit proteins, β and α2δ, associate with the α1 subunit (Fig. 1-1).

These auxiliary subunits can aid in channel trafficking, modulate channel biophysical properties, and provide sites for biochemical regulation of the channel (Arikkath &

Campbell 2003). Some channels contain a third γ accessory subunit, which can also alter biophysical properties of the channel. My thesis predominantly focuses on the α1 subunit.

Ten genes encode for the α1 subunits that underlie different calcium channels and currents: Cacna1a (CaV2.1, P/Q-type currents), Cacna1b (CaV2.2, N-type current),

Cacna1c (CaV1.2, L-type current), Cacna1d (CaV1.3, L-type current), Cacna1e (CaV2.3, R- type current), Cacna1f (CaV1.4, L-type current), Cacna1g (CaV3.1, T-type current),

Cacna1h (CaV3.2, T-type current), Cacna1I (CaV3.3, T-type current). My work focuses on

CaV2.2 protein splice isoforms. Throughout the nervous system, these isoforms underlie

N-type calcium currents that initiate synaptic vesicle fusion at presynaptic nerve terminals.

CaV2.2 calcium channels control neurotransmitter release and are inhibited by G proteins

In 1967, Katz and Miledi discovered that neurotransmitter release depends critically on calcium entry through voltage-gated calcium channels (Katz 1969; Katz & Miledi 1967).

It was later determined that entry of calcium through the CaV2 family of calcium channels, specifically, regulates the release of most neurotransmitters. For example, administration of conotoxin, a neurotoxic peptide derived from fish-hunting cone snails, specifically blocks CaV2.2 channels and was shown to inhibit norepinephrine release from sympathetic neurons (Hirning et al 1988; Olivera et al 1985). Similarly, - conotoxin GVIA blocks the nicotine-invoked release of tritium labeled dopamine from the striatum (Harsing et al 1992) as well as the release of substance P from dorsal root neurons (Holz et al 1988). A different neurotoxin, -agatoxin IVA, selectively inhibits

CaV2.1 channels, which are also expressed presynaptically, and thus inhibits transmitter release at many central synapses (Turner et al 1992; Turner et al 1995).

CaV2.2 channels control neurotransmitter release, and they are also inhibited by neurotransmitters and hormones that signal through G protein-coupled receptors. For example, norepinephrine can regulate its own release by feeding back on the neuron

4 and inhibiting CaV2.2 calcium channels via 2 adrenergic receptor activation (Lipscombe et al 1989). Norepinephrine reduces the probability of calcium channel opening. CaV2.2 channels are also inhibited by LHRH (luteinizing hormone-releasing hormone), GABA

(gamma-aminobutryic acid), and glutamate, as well as several other hormones and neurotransmitters that all work via their respective G protein-coupled receptors (Kuo &

Bean 1993). Such G protein modulation of CaV2.2 calcium channels is a common mechanism for regulating calcium influx and neurotransmitter release (Dunlap et al

1995; Holz et al 1989; Ikeda & Dunlap 2007; Taddese et al 1995).

Inhibition of CaV2.2 channels by G proteins can take two functionally different forms: voltage-dependent and voltage-independent inhibition. These forms of inhibition differ in several ways. Voltage-dependent inhibition is membrane-delimited, is relieved by strong depolarizations, and depends on the direct binding of the Gβγ subunit of the G protein complex to the channel (Bean 1989; Herlitze et al 1996; Ikeda 1996). In contrast, voltage-independent inhibition requires a diffusible messenger, is not sensitive to depolarization, and is mediated through Gα proteins. Each of the Gα protein families

(Gs, Gi/o, Gq/11) inhibits CaV2.2 channels through a different signaling cascade (Delmas et al 2005; Diverse-Pierluissi et al 1997; Strock & Diverse-Pierluissi 2004). Voltage- independent inhibition is seen in sensory and sympathetic neurons, among others, and allows the channel to be inhibited by neurotransmitters and other types of G proteins, even in periods of intense neuronal activity (Kammermeier & Ikeda 1999; Luebke &

Dunlap 1994). Work by our lab has shown that tissue-specificity of channel inhibition

5 can be due to tissue-specific alternative splicing of the CaV2.2 channel. For example, nociceptors within the dorsal root ganglia contain alternative exon 37a which makes the channel susceptible to voltage-independent inhibition by Gi/o protein-coupled receptor agonists, such as morphine (Andrade et al 2010; Raingo et al 2007). Most other neurons lack this alternative exon and the corresponding inhibitory pathway (Bell et al 2004)

(discussed in more detail below).

The structure of CaV2.2 contains splicing “hot spots”

CaV2.2 subunits are large proteins that have strict structural requirements. However, there are regions of the channel that can accommodate variations. These regions are modified by alternative exons that are expressed in specific regions and during specific developmental stages. CaV2.2 proteins contain intracellular N- and C-termini tails as well as four homologous structural domains (I-IV) (Fig. 1-3). Each domain consists of six transmembrane segments (S1-S6). The first four transmembrane segments create voltage-sensing domains, and the S5 and S6 segments create the calcium selective ion pore (Bell et al 2004; Van Petegem & Minor 2006). The intracellular loop between domains I and II (I-II loop) contains binding sites for the β subunit as well as for calmodulin, a calcium-binding protein that is sometimes considered as a subunit of the channel complex (Halling et al 2006)(Fig. 1-1). Proteins involved in calcium-dependent synaptic vesicle fusion, such as synaptotagmin, syntaxin1A, and SNAP-25, bind to the II-

III intracellular loop (Rettig et al 1996; Sheng et al 1996; Sheng et al 1994). As will be discussed later in this introduction, the C- and N-termini and intracellular and

6 extracellular loops between segments and domains of CaVα1 subunits are hotspots for alternative exons; these channel components contain malleable sites of interaction with other synaptic proteins that define channel function.

Types of alternative splicing

Cells use seven different types of alternative exons and splice sites (the junctions between exons and introns) to create protein splice isoforms (Fig. 1-2), and each form of alternative splicing has been shown in genes that code for voltage-gated calcium channel subunits. Most forms of alternative splicing create or interrupt a functional amino acid sequence within the protein or induce a frameshift which causes nonsense- mediated decay and transcript degradation (Lewis et al 2003). Alternative cassette exons (Fig. 1-2A) are either included or skipped during splicing. With mutually exclusive exons (Fig. 1-2B), the spliceosome must choose which of two or more mutually exclusive exons to include during pre-mRNA processing. An exon can also have more than one 3’ or 5’ splice site (Fig. 1-2C, D). Sometimes the spliceosome does not remove an intron during splicing (Fig. 1-2E). As with the previously mentioned forms of alternative splicing, these retained introns can result in nonsense-mediated decay or the addition of amino acids, but they can also contain sequences that target transcripts for another part of the cell where they can be locally spliced and/or translated (Bell et al 2010; Buckley et al 2011; Glanzer et al 2005). Finally, alternative promoter and poly(A) sites can add variation to the beginning and ending of proteins, respectively (Fig. 1-2F,G).

Alternative splicing in Cacna1b

The Lipscombe lab and others have identified several alternatively spliced exons within

Cacna1b, the gene that encodes for CaV2.2 (Bell et al 2004; Cahill et al 2000; Kaneko et al 2002; Lin et al 2004; Lin et al 1997; Lin et al 1999; Pan & Lipscombe 2000) (Fig. 1-3).

At least nine of the approximately 50 exons within the CaV2.2 gene are alternatively spliced. There is no evidence of alternative splicing within the transmembrane segments of any of the domains in CaV2.2. Instead, the alternatively spliced exons are concentrated in the intracellular and extracellular loops as well as the C-terminus of the channel. Below is a brief review of some of the important alternatively spliced exons within CaV2.2.

E18a (II-III intracellular loop)

The intracellular loop between domains II and III sometimes contains the alternatively spliced cassette exon 18a (e18a) between exons 18 and 19 (Coppola et al 1994;

Ghasemzadeh et al 1999; Pan & Lipscombe 2000). When this exon is included, it adds

21 amino acids to the loop. The nucleotide sequence encoding this exon is highly conserved across at least seven mammalian species (Gray et al 2007). In fact, the conservation of this exon is higher than the average conservation of intracellular constitutively expressed exons in the channel.

Inclusion of e18a changes the biophysical properties of the channel. For example, channels that include e18a have steady-state inactivation curves shifted to more depolarized potentials compared to channels lacking this exon (18a) (Pan & Lipscombe

2000). Interestingly, this change in inactivation is dependent on which β subunit is expressed with CaV2.2. The differences in voltage-dependent inactivation between channels containing and lacking e18a are most prominent in the presence of the β1b or

β4 rather than β2a or β3 subunits (Pan & Lipscombe 2000). The inclusion of e18a within the channel protein also protects the channel from cumulative inactivation induced by action potential trains (Thaler et al 2004). Recent work I performed in collaboration with Cecilia Phillips and Dr. Jesica Raingo showed that e18a inclusion mediates another important channel property: voltage-independent inhibition by Gs-coupled receptors

(see chapter 3).

The prevalence of e18a-containing channels depends on tissue and developmental stage

(Gray et al 2007). In rat sympathetic ganglia, greater than 80% of CaV2.2 mRNAs include e18a (Pan & Lipscombe 2000). Expression is much lower in the neocortex, where less than 20% of transcripts contain e18a. Work by Ghasemzadeh’s group using in situ hybridization and RT-PCR showed that e18a is preferentially expressed in brain regions containing high levels of monoaminergic neurons (Ghasemzadeh et al 1999). In rat, mouse, and human, the number of channels containing e18a is very low at early developmental stages and increases during development, reaching its highest level at adulthood (Gray et al 2007). Until recently we knew nothing about the proteins that

9 regulate the tissue and development specific splicing of e18a. In Chapter 3 I show that

Fox proteins regulate the inclusion of e18a in F11 cells and sympathetic neurons of the superior cervical ganglia (SCG).

Exon 24a (IIIS3-S4 extracellular loop)

Members of our lab identified the alternatively spliced cassette exon 24a in Cacna1b

(Lin 1997). This exon encodes for only four amino acids—SerPheMetGly (Lin et al 1997;

Lin et al 1999)—and is located in the extracellular loop between the third and fourth segments of domain III (Fig. 1-3). It is one of only two extracellular alternative exons within in CaV2.2 (the other is e31a in domain IV). Expression of e24a is higher in the rat brain than in the peripheral nervous system. While the functional role of this exon has not been discovered, work from our lab shows that its presence (or absence) does not alter channel kinetics (Lin et al 1999). Darnell and colleagues validated that this exon is upregulated by the neuronal-specific splicing factor Nova (Ule et al 2006); this splicing regulation is even conserved in zebrafish and chicken (Jelen et al 2007).

Due to a large cluster of Nova-2 binding sites located between exons 24 and 25 in the

Cacna1a gene (Robert Darnell, personal communication), I hypothesized that there may be an analogous exon in CaV2.1 regulated by a Nova protein. Using RT-PCR and cloning,

I found a 12 nucleotide exon that codes for the amino acids SerSerThrArg. Like CaV2.2 e24a, inclusion of this exon is enhanced by Nova (see Chapter 2). Because both CaV2.1 and 2.2 e24a are located extracellularly, they may play a role in synapse stabilization by

10 interacting with extracellular proteins. Further work must be done to elucidate both the specific expression patterns and function of channels containing these exons in the nervous system.

E31a (IVS3-S4 extracellular loop)

Exon 31a maps to the extracellular loop between segments 3 and 4 in the IV domain (Fig.

1-3). E31a encodes for only two amino acids, GluThr. CaV2.2 channels containing e31a are found almost exclusively in peripheral ganglia, such as dorsal root ganglia and superior cervical ganglia, and approximately 90% of channel mRNAS in these ganglia include e31a (Lin et al 1999).

CaV2.1 also contains an alternatively spliced exon 31a. It also encodes two amino acids, but they are different from CaV2.2 e31a: AsnPro. CaV2.1 channels containing e31a are similarly expressed in dorsal root ganglia and superior cervical ganglia, as well as in hippocampus and cerebellum (at lower levels) (Lin et al 1999).

Inclusion of e31a in CaV2.1 decreases the affinity of ω-agatoxin IVA to the channel 11- fold (Bourinet et al 1999; Hans et al 1999). Inclusion of e31a in either channel slows channel activation and deactivation kinetics (Lin et al 1999). Analysis of gating currents from CaV2.2 channels containing e31a show that these changes in kinetics are due to direct effects on the putative S4 voltage sensor (Lin et al 2004). Interestingly, alternative splicing in the IV S3-34 linker is conserved in many CaVαs and across many species,

11 including humans and Drosophila (Lipscombe et al 2002). Besides altering channel kinetics, these exons may, like e24a, play an additional role in the peripheral nervous system, either by creating or destroying binding to extracellular proteins that are important for synapse stabilization. In Chapter 2, I show that inclusion of both e31a exons is repressed by Nova-2.

Exons 37a and 37b (C-terminus)

The C-terminus of a CaV2.2 channel contains either exon 37a or 37b since these exons are mutually exclusive. Each exon is 97 nucleotides long, and the amino acids encoded by the two exons differ by only 14 amino acids.

Splicing of exons 37a and 37b is tissue-specific. CaV2.2 mRNAs containing e37b are present in neurons throughout the nervous system, whereas mRNAs containing e37a are enriched in a subset of dorsal root ganglia (DRG) neurons (Bell et al 2004). Within

DRG, sixty percent of capsaicin-responding (nociceptive) cells express e37a-containing

CaV2.2 channels, suggesting that these channels are important for signaling in the pain pathway. Supporting this idea, DRG neurons that express e37a-containing channels also express the nociceptive markers VR1 and Nav1.8, and siRNA knockdown of these channels reduces thermal nociception in a rat model of neuropathic pain (Altier et al

2007; Bell et al 2004).

Work by our lab showed that inclusion of e37a increases the expression of functional

CaV2.2 channels and increases the open time of these channels (Castiglioni et al 2006).

E37a also renders the channel susceptible to voltage-independent inhibition by Gi/o proteins (Raingo et al 2007); channels containing e37b undergo only voltage-dependent inhibition by Gi/o. The voltage-independent inhibition of channels containing e37a is mediated by Gi and Go protein-coupled receptors, such as the µ-opioid and GABAB receptors, and requires tyrosine kinase (Raingo et al 2007). Our lab recently generated exon-targeted mice where either e37a or e37b is included in all CaV2.2 channels

(Andrade et al 2010). Mice lacking e37a have normal basal responses to thermal stimuli but reduced analgesia in response to spinal morphine. Nothing is known about the proteins that regulate the inclusion of e37a in nociceptors and the exclusion of this exon in the rest of the nervous system. Chapter 4 of this thesis is devoted to exploring methods for identifying potential regulators of this very important splice site.

The functional importance of alternative exons in the Cacna1b gene and their tissue specific expression drives my interest in identifying the tissue-specific splicing factors that control their inclusion.

The mechanism of splicing

In order to understand how alternatively spliced exons are selected according to cell- type, it is important to first understand the mechanism of constitutive splicing. Splicing, the removal of introns and joining of exons in pre-mRNA to form mRNA, usually occurs in the nucleus either during or after the transcription of genomic DNA into pre-mRNA.

Splicing is mediated by the spliceosome, a complex made up of several small nuclear ribonucleoproteins (snRNPs) and at least 100 other proteins. The spliceosome mediates the splicing of both constitutive and alternative exons by recognizing and binding to splice sites and by catalyzing the reactions that join exons together and remove introns

(Kramer 1996; Ladd & Cooper 2002) (Fig. 1-4A). The 5’ splice site is located at the 5’ end of an intron at the exon/intron boundary and generally conforms to the consensus sequence AG|GURAGU (|=exon/intron boundary, R=purine). The 3’ splice site is located at the 3’ end of an intron, also at the exon/intron boundary. The consensus sequence for this splice site is YAG| (Y=pyrimidine) and is usually preceded by a stretch of intronic pyrimidine residues. The branch point is another sequence generally required for splicing and is located 18 to 40 nucleotides upstream of the 3’ splice site. The consensus sequence for the branch point is YNCURAY (N=any nucleotide; A=the site of actual branch formation). Components of the spliceosome bind to these splice sites and mediate the two catalytic steps necessary to remove introns and ligate exons. The snRNPs U1, U2, U4, U5, and U6, along with their associated proteins (including SF1,

U2AF65, and U2AF35), mediate these catalytic steps by changing the structure of the pre-mRNA (see legend of Fig. 1-4 for a description of the splicing reactions). There is a second spliceosome, the U12 minor spliceosome, that regulates the splicing of a small subset of exons; it recognizes different splice site sequences and includes different proteins from the major spliceosome (Will & Luhrmann 2005).

While association with a spliceosome is required for the splicing of all exons, other factors influence the splicing efficiency of any single exon. This is particularly true in the case of alternative splicing—where there is more than one potential 3’ or 5’ splice site for the spliceosome to recognize.

Regulation of alternative splicing

Many short motif sequences within the pre-mRNA that are not specific splice sites can strongly affect spliceosome assembly (Black 2003). These regulatory elements are called cis elements and many bind regulatory proteins. There are four functionally defined types of cis elements: exonic splicing enhancers (ESEs), exonic splicing suppressors (ESSs), intronic splicing enhancers (ISEs), and intronic splicing suppressors

(ISSs) (Fig. 1-5). The same sequence can act as an enhancer or a suppressor sequence depending on its location relative to an exon. For example, the same sequence can act as an ESE for one alternative exon and an ISS for another.

Splicing Factors

Whether splicing of a pre-mRNA results in the inclusion or exclusion of a particular alternative exon depends on the presence, absence, and/or ratios of specific splicing factors that associate with cis elements to promote specific splicing patterns (Maniatis &

Tasic 2002; Smith & Valcarcel 2000). In turn, the cellular levels of these splicing factors depend on features such as cell type, developmental stage, and neuronal activity (Black

2003). Splicing factors include both enhancer and repressor proteins; some splicing factors can act as either an enhancer or a repressor depending on the location of their binding on the pre-mRNA relative to the alternative exon. Splicing enhancers can recruit the spliceosome to the site of a particular alternative exon, ensuring that this exon is included. In contrast, splicing repressors can occlude a particular alternative exon from the spliceosome, causing this exon to be skipped. These splicing factors work in concert with components of the spliceosome to set the desired levels of specific mRNA splice isoforms to support cellular function (Black 2003; Maniatis & Tasic 2002; Smith &

Valcarcel 2000). Some splicing factors are cell- and/or tissue-specific. Expression of these splicing factors can regulate the ratio of included to skipped alternative exons and can result in the expression of protein isoforms unique to specific cells or tissues. The nervous system is especially enriched with tissue and cell-type specific splicing factors.

Several RNA binding proteins involved in alternative splicing of neuronal pre-mRNAs are known including Nova-1/2, Fox, Hu/elav family of proteins, CELF, neural PTB, KSRP (KH- type splicing regulatory protein), and NAPOR (neuroblastoma apoptosis-related RNA- binding protein) (Jensen et al 2000a; Jin et al 2003; Ladd et al 2001; Lisbin et al 2001;

Min et al 1997; Polydorides et al 2000; Zhang et al 2002). Descriptions of some splicing factor families are given below.

Splicing factor families

SR proteins

The SR protein family is one large class of trans factors that can enhance the inclusion of both constitutive and alternative exons, usually by binding to ESEs (Graveley 2000). This family includes the proteins ASF/SF2, SC35, SRp20, SRp30c, SRp55, and many others. All

SR proteins share two domains: an RNA-binding domain and an arginine and serine residue rich 'RS' domain. The RNA-binding domain recognizes the ESE present in the exon and the RS domain activates splicing. An example of an ESE for one specific SR protein is the consensus sequence (GAR)n, which binds the trans factors ASF/SF2 and

Tra2 (Liu et al 1998).

There are two hypotheses for how SR proteins enhance inclusion of constitutive and alternative exons. In the first model, the ‘recruitment/exon definition’ model, SR proteins recruit the U1 snRNP to the 5’ splice site (Reed 1996) and U2AF65 and 35 to a weak 3’ splice site (Graveley et al 2001) and stabilize these interactions. In the second model, the ‘inhibitor’ model, SR proteins enhance exon inclusion by preventing hnRNP proteins from binding to ESS elements (Zhu et al 2001). For example, SF2/ASF and hnRNP-A1 play antagonistic roles in the recognition of the neuronal-specific exon N1 in the c-src gene (Rooke et al 2003). It has been hypothesized that the relative amounts of

SR and hnRNP proteins may be responsible for the regulation of several tissue-specific alternatively spliced exons, and this has already been shown to be the case for a subset

17 of the complex and highly regulated mutually exclusive exons within the Drosophila

DSCAM (Down Syndrome cell adhesion molecule) gene (Olson et al 2007). Additionally, there are several other less popular models for how SR proteins enhance exon inclusion

(Long & Caceres 2009).

SR proteins can also promote the skipping of an alternative exon by binding to a flanking constitutive exon. This mechanism has been shown for an exon in the CaMKIIδ gene during heart remodeling (Han et al 2011). Additionally, SR proteins are important modulators of post-translational cellular activities such as mRNA translation, nonsense- mediated decay, and mRNA nuclear export (Long & Caceres 2009).

hnRNP proteins

The hnRNP (heterogeneous nuclear ribonucleoprotein) protein family contains at least

20 proteins, many of which are known splicing factors. When researchers examined the effect of knocking down hnRNP proteins on the splicing of alternative exons within different human cell lines, they found that all hnRNP proteins tested affected the splicing of at least one alternative exon (Venables et al 2008). In contrast to SR proteins, many hnRNP proteins work predominantly as splicing repressors. For example, hnRNP-

A1 binding to ESSs suppresses inclusion of alternative exons within both the HIV and

FGFR2 genes (Caputi et al 1999; Del Gatto-Konczak et al 1999). Proposed mechanisms for repression via hnRNP proteins include interference of spliceosome assembly, blocking of exon definition, and blocking of SR protein binding to nearby ESEs (Black

2003). Supporting this last mechanism is evidence from a crosslinking study using hnRNP-A1 and HIV Tat exon 3 that showed that hnRNP-A1 binds to an ESS (as expected) and to exonic RNA in the region near SR protein binding sites (Zhu et al 2001). When the ESS was removed, both interactions were lost. This finding suggests that hnRNP-A1 can bind both to specific ESSs and to non-specific sites. It should be noted that, in many exons, ESE and ESS sequences are clustered near each other, allowing for complex interactions between regulatory proteins. This may help explain why a particular hnRNP protein can regulate the splicing of a particular alternative exon in one cell line and not in another (Venables et al 2008).

hnRNP-1, which is more commonly referred to as polypyrimidine tract binding protein

(PTB), suppresses the inclusion of alternative exons by binding to the consensus sequence UUCU within the polypyrimidine tract (Perez et al 1997; Singh et al 1995). PTB and its neuronally expressed paralog nPTB play important roles in cellular differentiation by regulating tissue-specific splicing of several genes (Fairbrother & Lipscombe 2008).

Neuronal nPTB is a less efficient splicing repressor. Interestingly, PTB regulates the expression of nPTB, by repressing inclusion of exon 10 in non-neuronal cells. The repression of this exon initiates nonsense-mediated decay of nPTB transcripts, preventing nPTB from being expressed in non-neuronal cells (Coutinho-Mansfield et al

2007). Neurons, in turn, express the miR-124 microRNA, which binds to the 3’UTR of

PTB, preventing PTB from being expressed (and thus preventing repression of nPTB exon

10) (Makeyev et al 2007). This explains why an RNAi-mediated decrease in PTB

19 expression in non-neuronal cells results in neuronal-specific splicing of several genes important for neuronal differentiation during development (Boutz et al 2007b; Makeyev et al 2007). Although PTB and nPTB share a number of splicing targets, their splicing efficiency for specific targets varies and may help explain why the switch from PTB to nPTB expression during neurogenesis is so important (Spellman et al 2007).

Fox proteins

The Fox family of splicing factors includes three proteins: Fox-1 (RbFox1, A2BP1), Fox-2

(RbFox2, RBM9), and Fox-3 (RbFox3, NeuN, HRNBP3), which are vertebrate homologues of the Feminizing locus on X (FOX1) Caenorhabditis elegans protein (Hodgkin et al 1994;

Kim et al 2009; Skipper et al 1999). Fox-1 and Fox-2 contain identical RNA recognition motifs (RRMs) (Underwood et al 2005), and the Fox-3 RRM differs only slightly (Kim et al

2009). Fox proteins bind to the consensus sequence (U)GCAUG (Jin et al 2003), a motif that was earlier predicted to be important for splicing regulation due to its conservation near tissue-specific alternative exons (Denisov & Gelfand 2003; Minovitsky et al 2005).

Fox proteins can act as splicing enhancers or repressors depending on the location of the binding motif relative to the exon (Underwood et al 2005; Zhang et al 2008a): when

Fox binds downstream of an exon, splicing is enhanced, but when it binds upstream of the exon, Fox represses exon inclusion. In Chapter 3 I show that Fox-2 represses an alternative exon in CaV2.2 that has a Fox binding site immediately upstream.

While all three Fox proteins are highly expressed in brain, their expression in other tissues and in different subtypes of neurons varies. Fox-3 expression is limited to neurons (Kim et al 2009), whereas both Fox-1 and Fox-2 are expressed in neurons, heart, and muscle (Underwood et al 2005). Fox-2 is additionally expressed in embryonic stem cells and hematopoetic cells (Ponthier et al 2006; Yeo et al 2009). Within the brain, expression of the different Fox proteins varies by cell type, suggesting precise cell- specific control over alternative exon expression. For example, in the hippocampal dentate gyrus Fox-3 is limited to the granular cell layer, Fox-1 is uniformly expressed in the granular layer and the subgranular zone, and Fox-2 is expressed at higher levels in the subgranular zone than in the granular cell layer (Kim et al 2010). In the cerebellum,

Fox-3 is limited to the internal granular layer; Fox-1 and Fox-2 are both weakly expressed in these cells and more strongly expressed in Purkinje cells and interneurons within the molecular layer. Fox-2 is also expressed in the external germinal layer and migrating granular cells, suggesting that it is important for regulating splicing in developing neurons (Kim et al 2010). Further adding to the diversity of Fox proteins is the observation that these proteins have multiple promoters and are themselves extensively alternatively spliced in a tissue-dependent manner (Damianov & Black 2010;

Lee et al 2009; Nakahata & Kawamoto 2005). Additionally, Fox proteins can regulate their own splicing and the splicing of other Fox proteins. This can result in dominant negative isoforms which lack the RRM, resulting in the repression of Fox-dependent splicing (Damianov & Black 2010; Dredge & Jensen 2011).

There is also evidence for activity-dependent regulation of splicing. Depolarization modifies the splicing of Fox-1 which results in the relocation of Fox from the cytoplasm to the nucleus (Lee et al 2009). The increase in this splicing-active nuclear Fox isoform then increases the splicing of important target proteins, including the NMDA receptor 1.

This change in splicing may help cells adapt to chronic stimulation and suggests that the

Fox proteins play an important role in the dynamic regulation of neuronal proteins.

Because Fox proteins regulate the splicing of entire gene networks, mutations in these proteins can have dramatic effects. In fact, Fox-1 mutations, copy number variations, and aberrant splicing have been implicated in several conditions, including mental retardation and epilepsy (Bhalla et al 2004), autism (Martin et al 2007; Sebat et al 2007), glioblastoma (Cheung et al 2008), and ADHD (Elia et al 2010). Decreases in Fox-2 regulation of alternative exons are found in both breast and ovarian cancer (Venables et al 2009).

Along those lines, mice that have Fox-1 deleted in the nervous system show increased susceptibility to spontaneous and kainic acid-induced seizures and increased excitability in the dentate gyrus (Gehman et al 2011). This is likely due to the regulation of the splicing of many proteins known to be important for mediating synaptic transmission and membrane excitation, including members of the SNARE complex, various ion channels, and synapse assembly proteins. For example, splicing of CaV1.1 and CaV1.3 was significantly altered in these mice. Interestingly, the splicing of CaV1.3 was more

22 responsive to the loss of Fox-1 than Fox-2 and is very weakly regulated by Fox-3, again demonstrating the specificity of splicing factor function, even amongst closely related factors in the same family (Dredge & Jensen 2011).

Other experiments have shown additional calcium channel exons that are regulated by

Fox proteins. For instance, knockdown of Fox proteins in tissue culture increased the inclusion of exon 9* and decreased inclusion of exon 33 in CaV1.2; the opposite effect was seen with overexpression of both Fox-1 and Fox-2 (Tang et al 2009). Expression of these exons is developmentally regulated, and changes in their inclusion in developing mouse cortex correspond to increased Fox protein expression. In Chapter 3, I show that

Fox-2 represses the inclusion of e18a in CaV2.2 in both F11 cells and SCG neurons; inclusion of this exon is also developmentally regulated.

Nova proteins

Nova proteins were originally discovered as the target antigens in the autoimmune neurological disorder paraneoplastic opsoclonus myoclonus ataxia (POMA)

(Buckanovich et al 1993) and were the first neuron-specific splicing factors identified

(Yang et al 1998). There are two genes that encode for Nova proteins—Nova1 and

Nova2—although there is some evidence that there are other members of the family that have yet to be identified (Fletcher et al 1997). Expression of Nova-1 is limited to subcortical CNS structures in developing and adult mice. Nova-2, however, is expressed widely across the CNS and is particularly enriched in cortex, olfactory bulb, thalamus,

23 inferior colliculus, inferior olive, and the internal and external granule cell layers of the cerebellum (Yang et al 1998). Like other splicing factors, Nova proteins bind to a particular consensus sequence on the pre-mRNA; generally, these consensus sites are found near the regulated alternative exon. Nova proteins bind to clusters of YCAY motifs (Yang et al 1998), and this binding depends on the third KH domain of the protein

(Jensen et al 2000a).

Nova-1 knockout mice express brain mRNA transcripts with altered splicing patterns; transcripts with altered splicing include two inhibitory receptors, glycine alpha 2 and

GABAA (Jensen et al 2000a). These mice suffer from weakness and tremulousness due to motor neuron atrophy and die within 2-3 weeks of birth. Because this phenotype is similar to that seen in POMA patients, Nova-regulated changes in splicing of inhibitory synaptic proteins are thought to underlie the pathology seen in these patients (Jensen et al 2000a).

In order to determine which genes contain Nova-regulated alternative exons, Darnell and colleagues developed a new method called CLIP (crosslinking immunoprecipitation).

This technique uses covalent UV-crosslinking between RNA-binding proteins and pre- mRNA as well as stringent immunoprecipitation to isolate the specific short (60-100 nucelotide) RNA sequences that are bound to Nova-2 in mouse brain (Ule et al 2003).

Using this technique, they determined that when Nova binds directly to a YCAY cluster within an alternative exon, it can repress inclusion of this exon in brain by blocking U1

24 snRNP binding (Ule et al 2006). A microarray study confirmed these results and also allowed the mapping of functional connections between different proteins that are regulated by Nova. The majority of Nova-regulated exons are found in proteins with important synaptic functions such as neurotransmitter receptors, cation channels, adhesion and scaffold proteins, and axon guidance proteins (Ule et al 2005b).

Amazingly, 74% of these proteins are known to interact with each other, suggesting concerted regulation of synaptic function by Nova (Ule et al 2005b).

To further identify the extensive network of proteins regulated by Nova, the CLIP technique was combined with next generation sequencing technology to expand the screen (Licatalosi et al 2008). Using this new technique, HITS-CLIP (high throughput sequencing-CLIP), 168,632 Nova-2 binding sites were mapped to the UCSC genome browser. 92% of the tags bound to Nova-2 only, and those remaining bound to either

Nova-1 or Nova-2. These sites were highly reproducible across animals and litters. After analyzing the tags that mapped to 71 Nova-regulated exons, a Nova splicing map was refined. When Nova binding was associated with exon inclusion, over 91% of the tags were located within 500 nt of either the alternative 5’ or constitutive 3’ splice site

(Licatalosi et al 2008). On the other hand, when Nova binding was associated with exon exclusion, 74% of the Nova binding occurred within 500 nt of the constitutive 5’ splice donor site or surrounding the alternative exon. Thus, these observations strengthened the idea that, like Fox splicing factors, the location of Nova binding on the pre-mRNA

25 transcript relative to an alternative exon determines whether Nova will act to enhance or repress the inclusion of the exon during splicing.

Several alternative calcium channel exons are regulated by Nova proteins, including exons 31a in CaV2.1 and 2.2, exon 24a of CaV2.2, and an exon that I discovered: exon 24a in CaV2.1 (Allen et al 2010; Ule et al 2006)(Chapter 2). There are further questions to address about the regulation of channel genes by Nova. For example, does Nova regulate trafficking of channel mRNAs by binding to 3’UTRs or other regions of the channel? Both Cacna1a and Cacna1e have Nova binding tag clusters that line up with their 3’UTRs (R. Darnell, personal communication); do exons that are regulated by Nova share similar or complementary functions? A recent study by the Darnell group showed that Nova-regulated exons contain phosphorylation sites much more frequently when compared to all alternative exons (Zhang et al 2010). Are calcium channel exons that are regulated by Nova also more likely to be phosphorylated?

Alternative exons can be controlled by multiple splicing factors.

UV-crosslinking of Fox-2 to human embryonic stem cell pre-mRNA identified many calcium channel exons that may be regulated by Fox-2 (Yeo et al 2009). This genome- wide screen identified Fox-2 binding sites within several calcium channel α1 subunit genes (Cacna1s, c, g, a, I, and d). The only binding site identified within a member of the CaV2 family was in between two constitutive exons in Cacan1a (CaV2.1). This is the site of a newly identified alternative exon 24a, which we showed is regulated by Nova-2

(Allen et al 2010) (Chapter 2). Importantly, Fox and Nova proteins have an overlapping network of synaptic protein targets (Zhang et al 2010), and loss of Fox-2 results in reduced expression of Nova-1. It will be interesting to see if CaV2.1 e24a inclusion is also regulated by a Fox protein.

The combinatorial control of alternative exons by more than one splicing factor is quite common. Several studies have shown that the splicing of particular alternative exons is regulated by the coordination of a Fox protein with one or more other splicing factors.

For example, a complex containing Fox-2, hnRNP-H, and hnRNP-F represses inclusion of exon IIIc in the fibroblast growth receptor 2 gene, and this complex blocks binding of the enhancer splicing factor ASF/SF2 to the exon (Mauger et al 2008). In C. elegans, FOX1 and SUP12 co-regulate the tissue-specific expression of the fibroblast growth factor gene egl-15, which determines the ligand specificity of the receptor (Kuroyanagi et al

2007). Neuronal-specific splicing of the N30 exon in the nonmuscle myosin heavy chain

II-B gene is regulated by Fox-3 and also requires the interaction of Fox-3 with PTB- associated splicing factor (PSF) (Kim et al 2010).

Methods for identifying alternative splice sites and regulatory splicing factors

Studies of the functional importance and cellular control of alternative splicing in neural genes are in their infancy. This is in part because it can be difficult to identify alternative exons within genes. In the past, in order to identify a site of alternative splicing, a researcher had to either search for such a site in an EST (expressed sequence tag)

27 database or use targeted RT-PCR, cloning, and sequencing. Now, next generation sequencing technology is making it easier to discover sites of alternative splicing and to analyze the expression levels of different splice isoforms in different tissues. Such analyses are vitally important because, as I have shown in this introduction, the function of a particular protein can depend quite heavily on which exons are included in its mRNA. To truly understand the function of any neuronal gene, functional analysis of each splice isoform must be performed.

It is equally important to study the splicing factors that regulate neuronal splice isoforms. Genome-wide studies of splicing factor binding sites show how the splicing of networks of genes can be influenced by the expression of a single splicing factor protein.

At the single-gene level, identifying the splicing factor(s) that regulate a particular exon allows us to modify expression of this factor to change the splicing of the target protein.

With this change in splicing pattern, we are able to study the functions of different splice isoforms. I used this technique to my advantage in studies discussed in Chapter 3, where my colleagues and I used an siRNA to knockdown expression of Fox-2 in neurons.

Knocking down Fox-2 changed the splicing of CaV2.2 e18a, which in turn affected G protein-mediated inhibition of the calcium current. Knowledge about the regulation of specific splice events can also be used to develop therapeutics that fix disease states caused by aberrant splicing (further examined in the discussion chapter).

To this end, researchers have developed several techniques to try to identify cis elements and splicing factors that regulate the splicing of alternative exons, both in single genes and across the genome. These include HITS-CLIP, minigene assays, RNA interference, in vitro splicing assays, and various bioinformatics tools—techniques that I describe below. I used several of these techniques in the projects presented in this thesis.

HITS-CLIP

As described above, HITS-CLIP/CLIP-seq was first used to identify sites of Nova binding in the mouse genome (Licatalosi et al 2008). Since then it has been used to identify binding sites for Fox (Yeo et al 2009), PTB (Xue et al 2009), and SFRS1 (Sanford et al

2009), among others. It has also been used to identify sites of microRNA binding (Chi et al 2009). A recent paper discusses a new technique that allows identification of HITS-

CLIP binding sites at the single nucleotide level (Zhang & Darnell 2011). Results from the

Nova-2 HITS-CLIP map compiled by Robert Darnell provided the evidence which spawned my experiments described in Chapter 2.

Minigenes

One of the most common first steps toward identifying splicing regulators is the development of a so-called minigene. A minigene is a section of genomic DNA that contains a limited number of exons and introns. Its small size means it is easy to

29 manipulate and transfect into cells. Generally, a minigene study involves inserting a minigene into an expression vector, transfecting this plasmid into a cell line or using it in an in vitro splicing reaction, extracting RNA, and then performing RT-PCR with primers specific for exonic regions in the minigene. Running the RT-PCR products on a gel allows for the detection of the relative abundance of transcripts containing and lacking the alternative exon. If the splicing of a pair of mutually exclusive exons results in products of the same size, restriction digests performed on the final product can show the relative level at which each exon was included. Several groups have successfully used different minigene techniques to identify regulators of alternatively spliced exons (Jiang et al 1998; Kuroyanagi et al 2006; Newman et al 2006; Stamm et al 1994)(and many others).

For example, Takenaka and colleagues used various minigene constructs to identify the cis elements that regulate the splicing of mutually exclusive exons 9 and 10 within the pyruvate kinase M gene (Takenaka et al 1996). The different pyruvate kinase M isoforms show tissue-specific expression. Exon 9 is expressed only in skeletal muscle, heart, and brain, whereas exon 10 is expressed in most tissue types. The authors inserted a minigene containing exons 8, 9, 10, and 11, as well as the interleaving introns, into an expression vector. Transfection of this construct in dRLh-84 hepatoma cells resulted in expression of the isoform containing exon 10. The group then created several variations of this minigene which had deletions in various exonic and intronic regions. They also created constructs in which one of the splice sites of exon 9 was

30 switched with the corresponding splice site of exon 10. After transfecting these constructs into two different cell lines and examining the subsequent expression patterns, the authors were able to identify cis splicing regulatory elements within the 3’ end of exon 9 and the 5’ end of intron 9.

Given the success of several different groups in using minigenes to identify splicing factors, I created a minigene to explore the mutually exclusive splicing of exons 37a and

37b in CaV2.2. I present these results in Chapter 4.

RNA interference

Another method that can be used to determine whether a specific splicing factor regulates the expression of an alternatively spliced exon is RNA interference. There are two main ways this approach can be used. An investigator can search for a known splicing consensus sequence and see whether knocking down the splicing factor that binds to that sequence changes the splicing pattern (usually in conjunction with a minigene approach). Alternatively, an investigator can knock down many splicing factors one at a time and use a splicing minigene to identify changes in the splicing pattern. Both of these methods have been used successfully. I will present two examples below.

Baraniak and colleagues used RNAi, among other techniques, to determine that Fox-2 regulates the splicing of mutually exclusive exons IIIb and IIIc in the fibroblast growth factor receptor 2 gene (Baraniak et al 2006). They found that when Fox-2 is knocked down, the inclusion of exon IIIc increases. This corresponded to another part of their study which showed that overexpression of Fox-2 results in increased inclusion of exon

IIIb. This effect is dependent on the presence of the Fox-2 consensus sequence,

UGCAUG. Thus, in this study, the authors successfully identified both the cis element and the trans factor responsible for the splicing of a pair of exons. Other groups have also used RNAi to confirm Fox-1/2 as splicing regulators in their systems (Baraniak et al

2006; Ponthier et al 2006; Underwood et al 2005).

Park and colleagues identified several regulators of alternatively spliced exons by using an RNAi screen in cultured Drosophila cells (Park & Graveley 2005; Park et al 2004). The authors created dsRNAs against 250 genes known to encode proteins with RNA-binding motifs. They then treated the Drosophila S2 cells with each of the 250 dsRNAs and used

RT-PCR to see which of these dsRNAs affected the splicing of 19 alternative exons in three endogenous genes. Using this screening technique, the authors identified 47 splicing regulators, 26 of which had not been previously identified as regulators of alternative splicing. In the future, a large screen similar to this one may be used in conjunction with minigenes to identify splicing regulators of exons 37 and 37b in CaV2.2.

Motivated by these studies, I designed experiments to use siRNA to show that Fox-2 represses the inclusion of e18a in CaV2.2 (presented in Chapter 3).

In vitro splicing assays

Several groups have used in vitro splicing assays to identify components of the basal spliceosome as well as trans factors and cis elements that regulate the splicing of alternative exons (Hicks et al 2005). In brief, this technique involves the in vitro transcription of pre-RNAs from short minigenes and an in vitro splicing reaction in the presence of nuclear extract, cytoplasmic extract, and/or recombinant proteins. In many protocols, radiolabeled UTPs are used in the in vitro transcription step which allows the products of the splicing reaction to be separated on acrylamide gels and imaged on a phosphoimager. When attempting to identify splicing products that may contain one of two or more mutually exclusive exons that are the same size, separation by size cannot be used to identify which exon is included in a spliced product. In this case, other techniques such as the RNA invasive cleavage assay, RNAse protection assay, and semi- quantitative RT-PCR can be used with probes/primers specific to the different exons

(Wagner et al 2003).

Bioinformatics tools

Several web-based bioinformatics tools have been developed specifically for identifying potential cis elements and trans factors that regulate particular alternative exons. I used many of these tools in my studies. A few examples of such tools are given below:

ESRsearch: This tool predicts exonic regulatory elements—both ESSs and ESEs—within sequences (Fairbrother et al 2002; Goren et al 2006). It has two modes: one that allows for the identification of cis elements that are known binding targets for specific trans factors and one that identifies putative cis elements for as of yet undiscovered trans factors. The binding sites for known splicing factors include those for Fox, Nova, Tra2, several of the hnRNP proteins, as well as others. The set of putative cis elements was created by combining (1) the conservation of the third ‘wobble’ base in codons from human and mouse orthologous exons (the wobble positions are almost free of coding constraints); and (2) a comparison of the expected and observed frequencies of a particular sequence motif. 285 significant exonic splicing motifs were identified using these methods. Sanz and colleagues recently used ESRsearch to predict mutations that may affect the splicing of the BRCA1 and 2 genes in patients with hereditary breast/ovarian cancer (Sanz et al 2010).

ESE finder: ESEfinder is a bioinformatics tool that looks specifically for a particular class of ESEs, the consensus binding sites for SR proteins (Cartegni et al 2003). The makers of

ESEfinder used Systematic Evolution of Ligands by Exponential Enrichment (SELEX) to identify the motifs that are recognized by some of the specific SR proteins.

RESCUE-ESE: RESCUE-ESE is a bioinformatics tool that identifies putative ESEs

(Fairbrother et al 2004). It was developed by identifying hexanucleotide sequences that occur more frequently in exons than in introns and more frequently in exons with weak

34 splice sites rather than strong splice sites. Potential ESEs were inserted into a splicing reporter with a weakly expressed alternative exon. The reporter construct was transfected into cells and spliced RNA from these cells was assayed using quantitative

RT-PCR. Point mutations in these splicing reporters were inserted to further refine the putative ESE motifs.

FAS-ESS: Unlike RESCUE-ESE and ESEfinder, FAS-ESS is designed to look for exonic splicing suppressors (ESSs) rather than enhancers (Wang et al 2004). Potential suppressor motifs were identified using cell-based methods similar to those used for

RESCUE-ESE. In addition, the authors used an algorithm called ExonScan to simulate how these motifs could influence splicing.

SFMap: The bioinformatics tools above are used for identifying potential splicing factor binding sites within exons (Paz et al 2010). We know, however, that splicing factors can also bind to introns. While it is difficult to identify ISEs and ISSs for unknown splicing factors in introns because they are so variable in length, we can look for potential binding sites for known splicing factors. A tool called SFMap does this and maps the results to the UCSC genome browser.

I used ESRSearch, RESCUE-ESE, FAS-ESS, and SFMap to identify potential regulators of the mutually exclusively spliced exons 37a and 37b in CaV2.2. The results from these tools are included in Chapter 4.

Summary

Alternative splicing in the nervous system is an important regulator of neuronal function.

CaV2.2 calcium channels control neurotransmission and are extensively alternatively spliced in a cell-type specific manner. RNA-binding proteins called splicing factors regulate the inclusion of alternative exons. There are several methods that can be used to identify the splicing factors that regulate inclusion of a particular exon. In this dissertation, I explore the factors that regulate the inclusion of functionally important alternative exons within CaV2.2. In Chapter 2, I show that Nova-2 represses inclusion of exons 31a in CaV2.1 and CaV2.2 in the CNS and present evidence that Nova-2 enhances inclusion of an exon which I discovered, exon 24a in CaV2.1. In Chapter 3, I show that

Fox proteins repress inclusion of exon 18a in CaV2.2 and that this splicing regulation controls the voltage-independent inhibition of channel proteins by Gs coupled receptor agonists. In Chapter 4, I present results from minigene and bioinformatics analyses that were used to attempt to identify the splicing factors that regulate the splicing of mutually exclusive exons 37a and 37b in CaV2.2.

Figure 1-1. Voltage-gated calcium channels contain multiple protein subunits.

Voltage-gated calcium channels are made up of a complex of protein subunits including the α1 pore-forming subunit and the β and α2δ accessory subunits. Calmodulin (CaM) is a calcium-binding protein that interacts with the channel intracellularly.

Figure 1-2. Types of alternative splicing.

Gray rectangles represent constitutive exons; blue and red rectangles represent alternative exons or splice sites. Lines between exons represent introns. Dotted lines represent possible splicing paths. The images on the left show unspliced premRNA, whereas the images on the right show the possible spliced mRNAs.

Figure 1-3. CaV2.2 channels contain multiple sites of alternative splicing.

A splayed out representation of the CaV2.2 α1 protein subunit is shown. The α1 subunit is made up of four protein domains, each of which contains six transmembrane segements, as well as intracellular N and C termini tails. Black circles represent sites of alternative exon inclusion. Superscript a denotes an alternative 3’ splice site.

Figure 1-4. The spliceosome assembly and the splicing reaction.

A) This figure depicts important sites on the pre-mRNA that mediate the splicing reaction. These include the 3’ and 5’ splice sites, the branch point, and the

41 polypyrmidine tract. B) The splicing reaction is initiated when the U1 snRNP binds to the 5’ splice site, the SF1 protein binds to the branch point, U2AF65 binds to the polypyrmidine tract, and U2AF35 binds to the 3’ splice site. This is called the E ‘early’ complex. The A complex is formed when the U2 snRNP binds to the branch point and to the U1 snRNP. Next, U4, U5, and U6 snRNPs bind to form the B complex. This complex then rearranges to form the catalytic C complex. During this rearrangement, U1 and U4 leave the complex and U6 forms a complex with the 5’ splice site. A transesterfication reaction causes the introns to remain associated with the spliceosomal complex (in the

‘intron lariat’) and the newly joined exons (spliced RNA) to be released from the complex.

Figure 1-5. Trans factors can bind to cis elements to regulate the splicing of alternative exons.

Constitutive exons are shown in gray, alternative exons in orange. Splicing factors are represented as yellow circles. Splicing factors can repress exon inclusion by binding to cis elements within the exon (ESS, exonic splicing suppressor) or intron (ISS, intronic splicing suppressor). They can also enhance exon inclusion by binding to cis elements within the exon (ESE, exonic splicing enhancer) or intron (ISE, intronic splicing enhancer).

CHAPTER 2

The neuronal splicing factor Nova controls alternative splicing in N-type and P-type CaV2 calcium channels

Summer E. Allen, Robert B. Darnell, Diane Lipscombe

Published as Allen, S.E., Darnell, R.B., and Lipscombe, D. (2010). The neuronal splicing factor Nova controls alternative splicing in N-type and P- type CaV2 calcium channels. Channels (Austin) 4, 483-489.

Contributions: I performed all experimental work presented in this chapter. Robert Darnell provided us with information from his Nova-2 HITS-CLIP map. Diane Lipscombe and I wrote the manuscript.

ABSTRACT

Many cellular processes are involved in optimizing protein function for specific neuronal tasks; here we focus on alternative pre-mRNA splicing. Alternative pre-mRNA splicing gives cells the capacity to modify and selectively re-balance their existing pool of transcripts in a coordinated way across multiple mRNAs, thereby effecting relatively rapid and relatively stable changes in protein activity. Here we report on and discuss the coordinated regulation of two sites of alternative splicing, e24a and e31a, in P-type

CaV2.1 and N-type CaV2.2 channels. These two exons encode 4 and 2 amino acids, respectively, in the extracellular linker regions between transmembrane spanning segments S3 and S4 in domains III and IV of each CaV2 subunit. Recent genome-wide screens of splicing factor-RNA binding events by Darnell and colleagues show that Nova-

2 promotes inclusion of e24a in CaV2.2 mRNAs in brain. We review these studies and show that a homologous e24a is present in the CaV2.1 gene, Cacna1a, and that it is expressed in different regions of the nervous system. Nova-2 enhances inclusion of e24a but represses e31a inclusion in CaV2.1 and CaV2.2 mRNAs in brain. It is likely that coordinated alternative pre-mRNA splicing across related CaV2 genes by common splicing factors allows neurons to orchestrate changes in synaptic protein function while maintaining a balanced and functioning system.

INTRODUCTION

Genes that encode the CaV1 pore-forming subunits of voltage-gated calcium channels are large. Each CaV1 gene includes 40-45 constitutive exons that are invariable in processed mRNA, as well as several alternative exons that are optional and cell-specific.

Alternatively spliced (AS) exons serve two major functions. First, inclusion or exclusion of certain AS exons can shift the reading frame of mRNAs and result in early termination of protein translation, which may result in mRNA degradation by nonsense mediated decay(Isken & Maquat 2007; Le Hir & Seraphin 2008; McGlincy & Smith 2008). Cells use these exons to regulate protein expression levels downstream of transcription (Boutz et al 2007b; Makeyev et al 2007). Second, AS exons can modify protein sequence and thereby modify protein function. This is achieved by the inclusion, exclusion, or substitution of alternatively spliced exons that encode as few as one and up to ~100 amino acids in key domains of the channel protein (Lipscombe 2005). In this paper we focus on the regulation of alternatively spliced exons that give rise to protein splice isoforms of CaV2 channels with unique expression patterns and functions.

The decision to include, skip, or substitute a given AS exon usually occurs in the cell’s nucleus (although see (Glanzer et al 2005)) and depends on interactions among the spliceosome, splicing factor proteins, and the transcribed pre-mRNA. The spliceosome, a highly specialized macromolecular complex, is composed of five small nuclear RNA proteins (snRNPS) and hundreds of associated proteins and is common to all cells (see

(Jurica & Moore 2003) for review). Components of the spliceosome bind at intron-exon

46 boundaries and catalyze intron removal and exon joining. Additionally, cis elements in pre-mRNAs and the cell-specific splicing factors that bind to them direct cell-specific AS.

Collectively they define the cell’s unique mRNA isoform profile.

Cell-specific splicing factors enhance or repress AS exons, and their expression patterns are tissue-, activity-, and cell-specific (Chen & Manley 2009). Our discussion here focuses on existing and new evidence that Nova, one of the earliest discovered tissue- specific splicing factors, regulates the pattern of AS exons in CaV2 channels (Yang et al

1998). Our emphasis on Nova is driven by two important facts. First, Nova is the first – and to date the only – splicing factor validated as a regulator of AS splicing of CaV2 pre- mRNAs (Ule et al 2006). Second, Nova-2 knockout mice exist, providing a way to test directly the consequences of Nova-2 loss on AS exon composition in CaV2 mRNAs (Ule et al 2005b).

Nova proteins regulate alternative splicing of synaptic proteins

Nova proteins, originally discovered as the target antigens in the autoimmune neurological disorder paraneoplastic opsoclonus myoclonus ataxia (POMA), were the first mammalian neuron-specific splicing factors identified (Buckanovich et al 1993;

Jensen et al 2000a; Yang et al 1998). Two genes encode Nova proteins: Nova1 and

Nova2, although there is some evidence that other members of the Nova family await discovery (Fletcher et al 1997). Nova-1 and Nova-2 proteins bind similar motifs, but their expression patterns differ. Nova-1 proteins are limited to subcortical CNS

47 structures in developing and adult mice. Nova-2 proteins, by contrast, are expressed throughout the CNS and particularly in cortex, olfactory bulb, thalamus, inferior colliculus, inferior olive, and the internal and external granule cell layers of the cerebellum (Yang et al 1998). Like other splicing factors, Nova-1 and Nova-2 bind to consensus sequences close to target AS exons on pre-mRNAs. The three KH domains mediate Nova binding to clusters of YCAY motifs on target pre-mRNAs (Jensen et al

2000b; Yang et al 1998).

Nova-1 and Nova-2 knockout mice die 2-3 weeks after birth, but Darnell and colleagues used tissue from early postnatal animals to show that Nova is especially important for correct alternative splicing of two inhibitory receptor mRNAs in brain: glycine alpha 2 and GABAA (Dredge & Darnell 2003; Jensen et al 2000a). Nova-1 -/- mice and POMA patients share a phenotypic similarity – weakness and tremulousness due to motor neuron atrophy – that led Darnell and colleagues to hypothesize a role for disrupted AS of inhibitory synaptic proteins in POMA disease pathology (Jensen et al 2000a).

Evidence is accumulating that misregulation of alternative splicing of synaptic proteins, including voltage-gated calcium channels, can result in disease (Altier et al 2007; Baralle

& Baralle 2005; Cáceres & Kornblihtt 2002; Eunson et al 2005; Faustino & Cooper 2003;

Grabowski & Black 2001; Liao et al 2009).

CaV2.2 is a Nova target

Darnell and colleagues have transformed our understanding of the extent, mechanisms, and potential functional importance of Nova-regulation of AS exons in the mammalian brain. By combining protein-RNA crosslinking and Nova-immunoprecipitation, in a technique called CLIP (cross-linking and immunoprecipitation), they were able to identify new Nova RNA targets (Ule et al 2005a; Ule et al 2003). Their studies generated the most comprehensive view to date of the extent and the mechanism of action of a cell-specific splicing factor. Nova binds YCAY clusters in introns generally within 500 nucleotides of target AS exons. When Nova binds clusters upstream of a target AS exon, it generally represses inclusion by blocking U1 snRNP binding; when Nova binds downstream of the target AS exon, it generally enhances inclusion (see Fig. 2-1) (Ule et al 2006). Subsequent studies have indicated that this appears to be a general feature of alternative splicing regulators, evident for example with not only Nova but Fox2, MBNL, hnRNP-L, hnRNP-C, TIA1 and PTB (Witten & Ule 2011). By microarray analyses, Darnell and colleagues showed that the majority of Nova-regulated exons are located in genes encoding proteins with important synaptic functions (Ule et al 2005b). Furthermore, they combined the CLIP technique with high throughput sequencing (HITS-CLIP) and mapped more than 16,000 putative sites of Nova-2 binding onto the mouse genome

(Licatalosi et al 2008).

While the importance of these landmark studies rests in the genome-wide scale of the analyses, our interest was piqued by one target: e24a in Cacna1b, the gene that encodes the CaV2.2 channel. With analyses that compared e24a expression in wildtype and Nova-2 -/- mice, Darnell and colleagues confirmed that Nova-2 enhances e24a expression in mouse brain, likely by binding YCAY clusters in the 3’ intron downsteam of e24a (see Fig. 2-2 for YCAY motifs located downstream of e24a in mouse Cacna1b) (Ule et al 2006). Splicing regulation of e24a by Nova is conserved in the homologous

Cacna1b genes of zebrafish and chicken, strongly suggesting that this AS exon plays a critical role in optimizing neuronal function in specific regions of the nervous system

(Jelen et al 2007). Additional Nova-2 binding sites have been identified in Cacna1b, motivating us to explore whether Nova-2 coordinates inclusion of other AS exons in

CaV2.2 and homolous exons in the CaV2.1 paralog.

AS exons in CaV2 genes

Figure 2-3 highlights some of the known AS exons in three closely related CaV2 genes –

Cacna1a, Cacna1b, and Cacna1e – that encode CaV2.1, CaV2.2, and CaV2.3 proteins, respectively. These proteins (in association with accessory subunit proteins) in turn underlie P-type, N-type, and R-type currents in neurons. We, and others have mapped the tissue distribution and functional consequences of AS exons on channel activity and drug action in mice in vivo (Adams et al 2009; Adams et al 2010; Altier et al 2007;

Andrade et al 2010; Asadi et al 2009; Bell et al 2004; Bourinet et al 1999; Castiglioni et al

2006; Eunson et al 2005; Ghasemzadeh et al 1999; Gray et al 2007; Hans et al 1999;

Jiménez et al 2000; Kaneko et al 2002; Kanumilli et al 2006; Lin et al 2004; Lin et al 1997;

Lin et al 1999; Lipscombe et al 2002; Pereverzev et al 2002; Raingo et al 2007; Thaler et al 2004). Several AS exons are conserved among the three CaV2 genes, and in some cases, for example the homologous exons e18a of Cacna1b and Cacna1e, their inclusion appears to be coregulated (Gray et al 2007). Here we review published data from the

Darnell lab and show new evidence that the same splicing factor, Nova-2, regulates the splicing of homologous exons, e24a and e31a in CaV2.1 and CaV2.2 channels.

RESULTS

Nova-2 regulates e24a and e31a in CaV2 channels

E24a and e31a encode short sequences in the S3-S4 extracellular linkers of domains III and IV, respectively, of CaV2.1 and CaV2.2. In separate studies, the Snutch and Williams labs showed that inclusion of e31a in CaV2.1 decreases the affinity of ω-agatoxin IVA for the channel ~10-fold, while inclusion of e31a in either channel slows channel activation and deactivation kinetics (Bourinet et al 1999; Hans et al 1999; Lin et al 1999). We analyzed gating currents from CaV2.2 channels containing e31a and showed that it affects the putative S4 voltage sensor (Lin et al 2004). Most relevant to this discussion, we found e31a is absent (CaV2.2) or at lower levels (CaV2.1) in rat brain compared to peripheral ganglia (Lin et al 1999). E24a of Cacna1b encodes 4 amino acids, SFMG, in domain IIIS3-IIIS4 of mouse and rat CaV2.2 and SFVG in human CaV2.2 (S. Schorge and

D.L.) (Lin et al 1997). E24a is found in the majority of CaV2.2 mRNAs in brain but is found

51 at lower levels in ganglia. Although it is not currently present in EST or cDNA databases, we also recently discovered a corresponding e24a in Cacna1a (see below).

We recently used RT-PCR to compare the expression pattern of CaV2 channel mRNAs including and lacking e24a and e31a in brains and ganglia of wildtype and Nova-2 -/- mice to determine whether Nova-2 regulates tissue-specific expression of these exons.

CaV2.1 and CaV2.2 e31a

Exons 31a in CaV2.1 and CaV2.2 map to the extracellular linker between transmembrane spanning segments 3 and 4 in the IV domain of both channel proteins. An AS exon is located in this region of several CaVα1 subunits and in many species, including human and Drosophila (Lipscombe et al 2002). E31a in both CaV2.1 and CaV2.2 encode two amino acids, NP in CaV2.1 and ET in CaV2.2 (Lin et al 1999). We have shown that e31a is found in CaV2.1 mRNAs in dorsal root ganglia (DRG) and superior cervical ganglia, similar to the distribution of e31a of CaV2.2 (Lin et al 1999). However, e31a-containing CaV2.1 mRNAs are also expressed in hippocampus and cerebellum albeit at levels lower than in ganglia, an expression pattern that is different from e31a of CaV2.2 which is at very low levels in all regions of the CNS (Lin et al 1999).

Putative Nova-2 binding sites have been mapped very close to the 31a exons of the

Cacna1b and Cacna1a genes. As discussed above, exons 31a of both genes are found at

52 very low levels in brain, suggesting that Nova-2 might repress e31a inclusion. Consistent with this, we found an increase in the percentage of CaV2.1[e31a] transcripts (from 30% to 80%) and CaV2.2[e31a] transcripts (from not detectable to ~45%) in RT-PCR amplified products from Nova-2 knockout mouse brain cDNA compared to wild-type brain cDNA

(Fig. 2-4). In cerebellum (CB), the increase in e31a-containing CaV2 sequences in Nova-2

-/- was smaller (CaV2.1: from 20% to 50% and CaV2.2: ~10% to 30%) compared to the rest of the brain. But in DRG, the proportion of e31a-containing sequences was not different in wild-type compared to Nova-2 -/- mice (~80-85%); this is consistent with the lack of Nova-2 in this tissue.

Our data show that Nova-2 is a repressor of e31a in both CaV2.1 and CaV2.2 pre-mRNAs in the mammalian brain (Fig. 2-1). Based on the very low to undetectable levels of e31a- containing CaV2.2 mRNAs in brain, Nova appears to exert stronger repression of e31a in

CaV2.2 than in CaV2.1. Additional studies are needed to explore the precise mechanism of Nova action. For example, Nova repression of e31a in CaV2.2 might be stronger compared to CaV2.1, or the inclusion of e31a in CaV2.1 may also be influenced by other as yet unidentified splicing factors, such as a splicing enhancer that promotes e31a inclusion in specific brain regions.

CaV2.1 and CaV2.2 e24a

Several observations led us to hypothesize the presence of an AS exon in Cacna1a equivalent to e24a of Cacna1b. These include the overall high degree of conservation

53 between Cacna1a and Cacna1b genes, their close functional roles, the conservation of

AS exons 31a that are located in the homologous region of the channel in domain IV

(IVS3-IVS4), and the location of a putative Nova binding site in the intron between exons

24 and 25 in Cacna1a. We located a region in the intron that is strongly conserved among species (Fig. 2-5A). We used RT-PCR with primers located in constitutive exons e24 and e25 to amplify CaV2.1 mRNA isolated from different regions of the brains of wildtype mice (Fig. 2-5B). We observed two differently sized bands when we analyzed

PCR cDNA products by gel separation, consistent with the presence of two alternative sequences that differ by only a few nucleotides. We confirmed a 12-nucleotide insert encoding the tetrapeptide sequence SSTR in CaV2.1-derived products by sequencing (see

Fig. 2-5A).

We tested whether e24a of Canca1a was regulated by Nova-2 by comparing its expression levels in wildtype and Nova-2 -/- mice. In wildtype brain e24a-containing sequences represented about ~10% of CaV2.1 sequences, but we were unable to detect e24a containing sequences in PCR amplified products derived from RNA from Nova-2 -/- brain (Fig. 2-5C). Levels of e24a-containing CaV2.1 sequences were very low (~ 5%) similarly in DRG of wildtype and Nova-2 -/- mice. Our data suggest that Nova has an enhancing action on e24a in brain but not in DRG, where Nova-2 is absent. The analogous e24a in CaV2.2 is found at higher levels in brain compared to peripheral ganglia. Furthermore, Darnell and colleagues showed that e24a in CaV2.2 is enhanced by

Nova (Ule et al 2006).

We would like to know the function of e24a in CaV2.1 and CaV2.2 channels. In CaV2.2, e24a has a relatively minor influence on channel properties. As described above, we only recently identified e24a in CaV2.1 and have not assessed its effects on channel properties (Lin et al 1999). However, we speculate that the extracellular location of e24a might point to a role in mediating interactions with extracellular proteins. For example, neurexins have been shown to regulate CaV2.1 and CaV2.2 channel functioning through direct or indirect extracellular coupling (Dudanova et al 2006; Missler et al 2003;

Zhang et al 2005). It is possible that other extracellular proteins might interact with

CaV2.1 and CaV2.2 channels in a splice isoform-dependent manner, a possibility that needs to be tested.

Nova influences a subset of alternatively spliced exons in CaV2

Other sites of alternative splicing have been studied in detail by our lab (e18a and e37a/e37b in CaV2.2) and by other labs (e37a/e37b in CaV2.1)(Altier et al 2007; Andrade et al 2010; Bell et al 2004; Bourinet et al 1999; Castiglioni et al 2006; Chang et al 2007;

Graves et al 2008; Gray et al 2007; Lipscombe & Raingo 2007; Raingo et al 2007; Thaler et al 2004). None of these AS exons appears to be regulated by Nova-2. For example, we find no difference in expression patterns of exon 37a of CaV2.2 in Nova-2 -/- and wildtype mice (data not shown). Exon 37a of CaV2.2 is enriched in nociceptors of DRG but is expressed at very low levels in other parts of the nervous system. Likewise, the expression pattern of e18a in CaV2.2 is similar in wild-type and Nova-2 -/- mice (data not

55 shown). Although we focus on Nova-2 in this report, splicing factors other than Nova must regulate cell-specific inclusion of e18a and e37a/e37b. Furthermore, exon selection in vivo is likely to depend on the concerted actions of splicing enhancers and repressors (see Fig. 2-6) (Licatalosi & Darnell 2010; Xiao & Lee 2010). The Darnell group recently concluded that ~15% of Nova-regulated exons might also be regulated by Fox proteins, another family of neuronal splicing factors (Zhang et al 2010).

DISCUSSION

The nervous system operates with small error margins and adaptive responses are essential to normal neuronal function. These impact neuronal networks, individual neurons, and individual synapses and involve changes in synapse number, morphology, and efficacy. Coordinated and temporal changes in protein activity and function underlie all these adaptive responses. Alternative pre-mRNA splicing has an impressive ability to generate a vast array of functionally distinct proteins. Alternative pre-mRNA splicing gives cells the capacity to modify and selectively re-balance their existing pool of transcripts in a coordinated way across multiple mRNAs, thereby effecting relatively rapid and relatively stable changes in protein activity.

Alternative pre-mRNA splicing events are predicted to occur in ~95% of multi-exon human genes (Castle et al 2008; Wang et al 2008). Genome-wide screens of splicing factor-RNA binding events such as Darnell’s HITS-CLIP Nova screen and those looking at

56 binding sites for other splicing factors such as Fox and PTB are providing us the information we need to define cell-specific mechanisms that orchestrate alternative splicing across multiple genes, including CaV2 genes (Licatalosi et al 2008; Xue et al 2009;

Yeo et al 2009). In this short report we review limited published data and in addition show evidence that four alternative exons in two closely related calcium channel CaV2 subunit genes are regulated by Nova-2. Thus, the ability of Nova to function both as repressor (e31a) and enhancer (e24a), depending on binding locations imprinted in each gene, provides an elegant yet simple mechanism to coordinate splicing of homologous exons in related CaV2 genes (Fig. 2-1). This duality of function, based on RNA binding location relative to the target exon, is a property shared by several splicing factors (Li et al 2007; Licatalosi et al 2008). Cells control and coordinate patterns of alternative splicing by regulating the expression levels and activity of individual splicing factors.

Coordinated alternative pre-mRNA splicing across related CaV2 genes allows neurons to orchestrate changes in synaptic protein function while maintaining a balanced and functioning system.

Acknowledgements. We are grateful to Gerald Zamponi and Terry Snutch for organizing another fantastic Calcium Ion Channel Meeting where we presented some of these data and ideas. This work was supported by Grants RO1NS29967 (Diane Lipscombe),

F31NS066691 (Summer E. Allen), and RO1NS34389 (Robert B. Darnell).

Figure 2-1. Nova acts as a splicing repressor or enhancer depending on its binding site relative to the target exon.

Nova binds to YCAY motifs in introns upstream of e31a in CaV2 pre-mRNAs to repress its inclusion, whereas Nova binds to YCAY motifs in introns downstream of e24a in CaV2 pre-mRNAs to enhance its inclusion, during pre-mRNA splicing.

Figure 2-2. Nova binding motifs are located in the intron downstream of e24a of

CaV2.2.

The genomic sequence in this region of Cacna1b is shown, and the amino acids encoded by e24a indicated (SFMG). The Nova binding motifs (black squares) are shown below the genomic sequence and were mapped to the UCSC genome browser (July 2007 mouse assembly). Nova binding motifs are shown within 70 nucleotides and downstream of e24a in Cacna1b. The Nova binding site track was provided by SFmap (Paz et al 2010).

SFmap is a computational tool that uses an algorithm to predict splicing factor binding sites by identifying binding site motif clusters and evaluating the conservation of these clusters across species.

Figure 2-3. Alternatively spliced exons in the CaV2 genes.

The locations of constitutive exons (black) and conserved alternative exons (colored) in mouse Cacna1a, Cacna1b, and Cacna1e genes. Gene diagrams are adapted from the

UCSC genome browser (Feb. 2006 mouse assembly). Alternative exons 37a and 37b are found in all three CaV2 channel genes. An alternative exon e18a is present in Cacna1b and Cacna1e, but a homologous exon has not been identified in Cacna1a. Alternative exons e24a and e31a are conserved in Cacna1a and Cacna1b, but equivalent exons have not been identified in Cacna1e.

Figure 2-4. Alternative exons e31a of CaV2.1 and CaV2.2 are repressed in brain by

Nova-2.

The approximate locations of e31a of CaV2.1 (NP) and CaV2.2 (ET) are mapped on a schematic of CaV2 channels that shows transmembrane and intracellular domains (A, B).

RT-PCR products amplified from mouse brain using primers that flank e31a are shown separated on 8% denaturing polyacrylamide gels. Predicted sizes of PCR products are

100 (+31a) and 94 (31a) nts for CaV2.1 (A) and 106 (+31a) and 100 (31a) nts for

CaV2.2 (B). RT-PCR amplification was carried out using brain lacking cerebellum (Brain), cerebellum (CB), and dorsal root ganglia (DRG) from wild-type (WT) and Nova-2 knockout mice (KO). Percentages of cDNAs containing e31a of the total amplified cDNA for each reaction are shown below each lane. A) 30% of cDNAs amplified from wildtype brain contain e31a compared to 80% in Nova-2 -/- brain. In cerebellum, 17% of cDNAs amplified from wildtype tissue contain e31a compared to 46% in Nova-2 -/- tissue. cDNA

61 amplified from DRG contains a high percentage of e31a-containing sequence similarly in wildtype and Nova-2 knockout tissue (82%-87%). B) cDNAs amplified from wildtype brain lacked e31a compared to 44% representation in cDNAs from Nova-2 -/- brain. In cerebellum, 13% of cDNAs amplified from wildtype tissue contain e31a compared to 32% in Nova-2 -/- tissue. cDNA amplified from DRG contains a high percentage of e31a- containing sequence (83%-84%) similarly in wildtype and Nova-2 knockout tissue. A schematic shown below the gels illustrates how Nova acts to repress e31a inclusion via a binding site in the upstream intron in brain and cerebellum, but not in DRG.

Figure 2-5. Alternative exon 24a of CaV2.1 is enhanced in brain by Nova-2.

A) Location and sequence, SSTR, of newly identified e24a (red) in the mouse Cacna1a gene. Constitutive exons 24 and e25 are shown in gray flanking the alternatively spliced e24a (red). Below, the degree of sequence conservation among vertebrate Cacna1a genes is represented. Image is adapted from UCSC genome browser, Feb. 2006 mouse assembly. B) RT-PCR products amplified using primers located in e24 and e25 from RNA isolated from the following regions of adult mouse brain: cortex (CTX), hippocampus

(HC), hypothalamus (HP), midbrain (MB), olfactory bulb (OB) and cerebellum (CB).

Predicted sizes of products are 152 nts (+24a) and 140 nts (24a). PCR products were separated on a 8% denaturing polyacrylamide gel. C) RT-PCR products amplified from mouse brain using primers that flank e24a are shown separated on a 3% agarose (DRG) or 8% denaturing polyacrylamide gels (brain and cerebellum). Predicted sizes of PCR

63 products are 152 (+24a) and 140 (24a) nts. RT-PCR amplification was carried out using brain lacking cerebellum (Brain), cerebellum (CB), and dorsal root ganglia (DRG) from wild-type (WT) and Nova-2 knockout mice (KO). Percentages of cDNAs containing e24a of the total amplified cDNA pool are shown below each lane. 13% of cDNAs amplified from wildtype brain contain e24a but this isoform was not detectable in Nova-2 -/- brain samples. In cerebellum, 23% of cDNAs amplified from wildtype tissue contain e24a compared to 12% in Nova-2 -/- tissue. cDNA amplified from DRG contains a very low percentage of e24a-containing sequence similarly in wildtype and Nova-2 knockout tissue (4%-5%). A schematic shown below the gels illustrates how Nova acts to enhance e24a inclusion via a binding site in the downstream intron in brain and cerebellum, but not in DRG.

Figure 2-6. Cellular control of alternative splicing likely involves the net contribution of more than one splicing factor.

Schematic shows hypothetical, combinatorial control of an alternatively spliced exon by

Nova binding downstream and acting as a repressor, by another serine rich (SR) splicing factor binding downstream and acting as an enhancer, and by a third splicing factor of the hnRNP family binding to the target exon and acting as a repressor of exon inclusion.

The relative importance and contribution of each splicing factor depends on several factors, including their expression levels. Thus, tissue specific splicing can arise from the tissue-specific expression profiles of splicing factors.

CHAPTER 3

The neuronal splicing factor Fox-2 controls Gs protein inhibition of CaV2.2 calcium channels

Summer E Allen*, Cecilia G Phillips*, Jesica Raingo, and Diane Lipscombe

* Equal contributions by these authors

Contributions: Jesica Raingo and Cecilia Phillips performed tsA201 cell transfections, recordings, and analyses. I performed F11 cell transfections, RNA extractions, and RT-PCR analysis. I dissected, cultured, and injected sympathetic neurons. Cecilia Phillips recorded from these neurons and analysed the currents. Cecilia Phillips and I conducted the Western blotting and immunocytochemistry experiments. Diane Lipscombe, Cecilia Phillips, and I designed figures and wrote the manuscript.

ABSTRACT

Alternative splicing is extensive in mammalian nervous systems and drastically increases the diversity of the transcriptome. Large, multi-exon, voltage-gated calcium channel genes undergo extensive alternative splicing, but the cellular function of only a few alternative exons is known. Here we show that the alternative exon e18a, which codes for 21 amino acids in the intracellular II-III loop of CaV2.2 (N-type) calcium channels, controls channel sensitivity to inhibition by Gs proteins in sympathetic neurons. We identify Fox-2 as a splicing factor that represses e18a inclusion. siRNA knockdown of

Fox-2 in individual sympathetic neurons increases the sensitivity of N-type currents to voltage-independent inhibition by Gs proteins. We suggest that cell-specific alternative splicing of two different exons in CaV2.2 is a mechanism to adjust the sensitivity of calcium channels to distinct G protein families, independent of GPCR, G protein, and other components of the signaling cascade.

INTRODUCTION

Alternative splicing is highly developed in mammals and underlies the great expansion of the proteome that supports complex nervous system function (Calarco et al 2009;

Lipscombe 2005). Alternative splicing is essential: disruption of splicing factor genes can be lethal (Jensen et al 2000a; Jumaa et al 1999; Mende et al 2010; Shibayama et al 2009;

Wang et al 1996; Xu et al 2005). Patterns of alternative splicing vary with neuronal- subtype, development, and neuronal activity (Grabowski & Black 2001; Nilsen &

Graveley 2010). This variety is consistent with the attractive idea that alternative splicing is a way for individual cells to optimize protein activity as needed. Although large, multi-exon voltage-gated calcium channel genes undergo extensive alternative splicing, the cellular function of only a few alternative exons is known (Andrade et al

2010; Chaudhuri et al 2004; Lipscombe et al 2002; Shen et al 2006).

We recently showed that two splice isoforms of CaV2.2 (N-type) calcium channels have different sensitivities to inhibition by Gi/o proteins (Raingo et al 2007). CaV2.2[e37a], the isoform containing exon 37a, has greater sensitivity than CaV2.2[e37b] to Gi/o.

CaV2.2[e37a] is enriched in nociceptors, so this isoform's sensitivity to Gi/o explains the high sensitivity of N-type currents in nociceptors to inhibition by Gi/o-coupled agonists

(Diverse-Pierluissi et al 1997; Ikeda & Dunlap 2007; Raingo et al 2007).

An impressive number of G protein-coupled receptors (GPCRs) that signal through Gi/o as well as Gq and Gs, converge on CaV2.2 channels to inhibit presynaptic calcium entry

68 and transmitter release (Boehm & Kubista 2002). Some of these pathways are cell-type- specific (Ikeda & Dunlap 1999; Jeong & Ikeda 2000b; Kammermeier et al 2000; Suh &

Hille 2002; Surmeier et al 1995), and it is generally assumed that the cell-specificity of signaling relies on spatial proximity of GPCR and CaV2.2 channel (Bernheim et al 1991).

However, our studies suggest that alternative splicing can be the limiting step that defines the inhibitory actions of G proteins on CaV2.2 channels (Andrade et al 2010;

Raingo et al 2007).

Gq- and Gs-coupled receptor inhibition of CaV2.2 channels is particularly prominent in sympathetic neurons (Kammermeier et al 2000; Surmeier et al 1995; Zhu & Ikeda 1994).

Here we test whether an alternatively spliced exon in Cacna1b (the gene encoding

CaV2.2) controls inhibition of CaV2.2 channels by Gq or Gs. Exon 18a is a strong candidate: it encodes a modular cytoplasmic domain of 21 amino acids in the II-III intracellular loop

(Coppola et al 1994; Ghasemzadeh et al 1999; Gray et al 2007; Pan & Lipscombe 2000)

(Fig. 3-1A); it is expressed at high levels in sympathetic neurons; and in our previous studies using CaV2.2 clones lacking e18a (CaV2.2*Δ18a+), we could not reconstitute Gq or

Gs inhibition of CaV2.2 channels by global G protein activation (Raingo et al 2007).

Cellular control of alternative splicing is achieved by splicing factors that target specific exons. Consequently, manipulations that alter the level of splicing factors impact expression patterns of splice isoforms (Jensen et al 2000a; Tang et al 2009; Underwood et al 2005; Zhang et al 1999). Here we show that neuronal splicing factor Fox-2 is a

69 repressor of e18a. We use siRNA to reduce Fox-2 levels in neurons and show that this reduction promotes voltage-independent inhibition of N-type currents by Gs-coupled receptor activation. We suggest that the efficacy of G protein signaling to CaV2.2 channels is ultimately determined by cellular control of alternatively spliced exons. This control allows cells to adjust the sensitivity of calcium channels to distinct G protein families, independent of GPCR, G protein, and other components of the signaling cascade.

RESULTS

Fox-2 represses e18a inclusion

We aligned Cacna1b gene sequences of several species and confirmed a conserved putative Fox-1/2 binding site, (U)GCAUG (Auweter et al 2006; Jin et al 2003; Nakahata &

Kawamoto 2005), immediately upstream of e18a (Minovitsky et al 2005) (Fig. 3-1B).

Typically, when Fox proteins bind upstream of alternative exons they repress exon inclusion (Underwood et al 2005). We used a Fox-2 siRNA previously validated by

Douglas Black and colleagues (Underwood et al 2005), to establish that Fox-2 represses e18a inclusion in the F11 cell line (dorsal root ganglia/neuroblastoma fusion). F11 cells endogenously express CaV2.2 and Fox-2. Our RT-PCR analyses show concentration- dependent increases in channel mRNAs containing e18a (CaV2.2[e18a]) from cells transfected with Fox-2 siRNAs (Fig. 3-1C; untransfected vs. 100 nM, p = 0.0001).

Transfecting siRNA designed against a different region of the Fox-2 gene also increased

70 e18a inclusion but with lower efficiency (64% increase, data not shown). In contrast, the relative abundance of CaV2.2[e18a] and CaV2.2*Δ18a+ mRNAs was not significantly different in cells transfected with siRNA against cyclophillin B (a housekeeping gene) or a control non-targeting siRNA (#3 from Dharmacon) when compared to untransfected cells (Fig. 3-1D; one-way ANOVA, p = 0.246).

We measured concomitant decreases in endogenous Fox-2 protein levels by Western blot analysis in cells transfected with Fox-2 siRNA (Fig. 3-1E); there was almost complete

Fox-2 protein knockdown in these cells. The Fox antibody labeled three endogenous bands and several additional bands in cells expressing a Fox-2 plasmid (Fig. 3-1E). This result is consistent with the finding that Fox proteins are themselves alternatively spliced (Baraniak et al 2006; Damianov & Black 2010; Nakahata & Kawamoto 2005; Yang et al 2008) and that many splicing factor proteins undergo post-translational modification (for review see (Chen & Manley 2009)).

Having established that Fox-2 represses e18a inclusion in CaV2.2 mRNAs, we revisited the question of e18a’s function. We knew from our earlier analyses that e18a reduces the propensity of CaV2.2 channels to inactivate from the closed state (Pan & Lipscombe

2000; Thaler et al 2004). But this property is not unique to e18a; proteins that bind to the II-III linker region, where e18a resides, also modulate CaV2.2 channel inactivation

(Bezprozvanny et al 1995; Chan et al 2007; Jarvis et al 2000). We speculated a distinct and more unique role for e18a in G protein coupling to CaV2.2 channels.

E18a is required for VI inhibition independent of Gi/o

We expressed CaV2.2[Δ18a] and CaV2.2[e18a] clones with auxiliary subunits CaVβ3 and

CaVα2δ1 in tsA201 cells and compared N-type currents recorded in control conditions and in the presence of internal GTPS. GTPS globally activates all G proteins, inducing maximal G protein inhibition thus bypassing GPCRs. G proteins inhibit CaV2.2 channels by two well-described, functionally distinct pathways that are voltage-dependent (VD) or voltage-independent (VI). VD inhibition is reversed by brief, strong depolarizing prepulses to +80 mV. It depends on G binding to the I-II intracellular CaV2.2 linker, is membrane delimited, and is observed in all neurons. VI inhibition, on the other hand, is resistant to strong depolarization, uses three different G proteins (Gi/o, Gs, and Gq) that each activate distinct signaling cascades, and is cell-specific (Ikeda & Dunlap 1999; Jeong

& Ikeda 2000b; Kammermeier et al 2000; Suh & Hille 2002; Surmeier et al 1995).

In tsA201 cells, CaV2.2[Δ18a] channels are inhibited by internal GTPS via a VD mechanism exclusively: in the presence of GTPS, strong depolarizing prepulses (+pp) normalize both the voltage-dependence of activation and current amplitudes to control levels (Fig. 3-2D; Raingo et al., 2007). In the absence of GTPS, prepulses do not facilitate

CaV2.2 currents (Fig. 3-2A-C). By contrast, in cells expressing CaV2.2[e18a] channels, we observed prominent VI inhibition as well as VD inhibition in the presence of internal

GTPS. Currents are strongly reduced compared to control recordings over a range of

72 test potentials, and significant inhibition remains following prepulses to +80 mV (Con – pp vs. GTPS +pp at 5 mV, p = 0.034; Fig. 3-2E). Additionally, current densities of cells expressing CaV2.2[e18a] channels are significantly larger than those of cells expressing

CaV2.2[18a] channels (at 0 mV, p = 0.048).

At first sight, the requirement of e18a to reconstitute G protein-dependent VI inhibition of CaV2.2 channels bears remarkable similarity to our analyses of e37a, another alternatively spliced exon. However, while e37a mediates VI inhibition of CaV2.2 channels through Gi/o proteins—the actions of which are completely occluded by pertussis toxin (PTX) (Raingo et al 2007)—e18a-dependent VI inhibition of CaV2.2 channels is independent of PTX-sensitive Gi/o proteins (Fig. 3-3A). PTX occludes VD inhibition of CaV2.2[e18a] channels by internal GTPS while sparing VI inhibition. GTPS- mediated VI inhibition of CaV2.2 channels containing both e18a and e37a (Fig. 3-2F) is greater than the level of VI inhibition exhibited by channels containing e18a (Fig. 3-2E) or e37a alone (Raingo et al 2007). We conclude that a PTX-insensitive G protein uses e18a to mediate VI inhibition of CaV2.2 channels. By contrast, VD inhibition of all splice isoforms tested (18a, e18a, e37b, e37a) uses G generated from Gi/o protein activation when activated by GTPS (Fig. 3-3A; (Raingo et al 2007)).

E18a mediates VI inhibition by Gs and G

Gs and Gq mediate the majority of inhibitory actions of PTX-insensitive GPCRs on CaV2.2 channels in neurons (Boehm & Kubista 2002; Tedford & Zamponi 2006). The regulator of

G protein signaling 2 (RGS2) is used frequently to occlude Gq-mediated signaling, but it is also reported to occlude Gs signaling (Heximer et al 1997; Roy et al 2006a; Roy et al

2006b). In tsA201 cells expressing RGS2, internal GTPS engaged only VD—not VI— inhibition of CaV2.2[e18a] channels (Fig. 3-3B), suggesting Gq and/or Gs was responsible for the VI inhibition. To differentiate between Gs or Gq involvement we pretreated cells with cholera toxin (ChTX), a specific inhibitor of Gs (Fig. 3-3C). In cells pre-treated with

ChTX, similar to our results with RGS2, GTPS triggered VD—not VI—inhibition of CaV2.2 channels, indicating a role for Gs in e18a-dependent VI inhibition.

Gs protein-dependent inhibition of N-type currents in sympathetic neurons is unusual in also requiring G (Jeong & Ikeda 1999). By contrast, VI inhibition of N-type currents by

Gi/o occurs independent of G (Diversé-Pierluissi et al 1995; Raingo et al 2007). We used the G scavenger MAS GRK2ct, which binds to and interferes with G signaling

(Kammermeier & Ikeda 1999), and found that MAS GRK2ct occluded both VD and VI inhibition of CaV2.2[e18a] channels by GTPS (Fig. 3-3D). By contrast, MAS GRK2ct occluded only VD not VI inhibition of CaV2.2[18a, 37a] channels by GTPS. Our data suggest that e18a-containing CaV2.2 clones can support Gs inhibition of N-type currents with properties closely aligned to those observed in neurons.

VI inhibition is present with CaV2a

Others have reported that the efficacy and properties of G protein inhibition of CaV2.2 channels depend on the identity of the auxiliary CaV (Heneghan et al 2009). We use

CaV3, which is found co-localized with CaV2.2 proteins in several brain regions (Scott et al 1996). But CaV2.2 proteins can associate with different CaV subunits, and all four

CaV subunits are expressed in sympathetic ganglia where CaV2.2[e18a] transcripts are at their highest levels (Lin et al 1996). Because CaV2a supports slowly inactivating N- type currents, with kinetics similar to native N-type currents recorded from sympathetic neurons, we also studied N-type currents in cells co-expressing 2a.

N-type currents in cells co-expressing 2a inactivated more slowly compared to 3 and showed robust prepulse facilitation in control recordings in the absence of GTPS (Fig. 3-

4A-E), as reported by others (Dresviannikov et al 2009). In the presence of 2a, prepulse- induced basal facilitation of N-type currents was voltage-dependent and maximal at 0 mV (150 %; Fig. 3-4C). Basal prepulse facilitation of CaV2.2[e18a] channels was statistically greater than that of CaV2.2[18a] channels (at 10 mV, p = 0.035). Despite their distinctly different properties CaV2.2[e18a] and CaV2.2[18a] channels responded similarly to internal GTPS independent of CaV subunit. VI inhibition by GTPS was only observed in CaV2.2 channels containing e18a whereas both e18a-containing and e18a- lacking channels exhibited VD inhibition (Fig. 3-4F-G), consistent with our recordings using CaV3 (Fig. 3-2).

75 siRNA knockdown of Fox-2 in neurons

CaV2.2 channels underlie N-type currents, the major calcium current in sympathetic neurons of superior cervical ganglia (SCG). CaV2.2 channels in SCG neurons are inhibited by several GPCRs, particularly those that use Gq and Gs. The dominant CaV2.2 splice isoforms expressed in SCG lack e18a at birth, but by adulthood 68% of CaV2.2 mRNAs contain e18a (mouse: Fig. 3-5A; rat: Gray et al., 2007). Our analysis of cloned CaV2.2 channels predicts increasing sensitivity of N-type currents in sympathetic neurons to Gs coupled-receptor inhibition with development. However, a large number of molecular and morphological changes accompany neuronal development, severely complicating our ability to attribute any observed changes in G protein inhibition of N-type during development to a change in the pattern of e18a splicing. We therefore manipulated the pattern of pre-mRNA splicing of e18a in neurons from a single developmental time point using siRNA against Fox-2. We used neurons from postnatal day 0-2 mice because these neurons express a low level of CaV2.2[e18a] mRNAs (Fig. 3-5A). Immunofluorescence analyses show strong Fox-2 signal in nuclei of control neurons, consistent with the nuclear localization of splicing factors (Fig. 3-5B). By comparison, Fox-2 signals are reduced substantially in neurons injected with Fox-2 siRNA (co-injected with dextran fluorescein dye; Fig. 3-5B).

Loss of Fox-2 does not affect overall inhibition of calcium currents by Gs

Vasoactive intestinal peptide (VIP) activates Gs-coupled receptors and inhibits calcium currents in sympathetic neurons (Ehrlich & Elmslie 1995; Jeong & Ikeda 2000a; Zhu &

Ikeda 1994) (Fig. 3-5C). We found that 10 M VIP inhibits whole cell calcium currents equally in uninjected neurons, neurons injected with Fox-2 siRNA, and neurons injected with a control non-targeting siRNA (Fig.3-5E,F,H). Inhibition by VIP is significantly occluded after inactivating Gs proteins by cholera toxin treatment (Uninjected vs. ChTX, p = 1.9*10-4, Fig. 3-5G-H). The residual component of VIP inhibition of calcium currents after ChTX treatment (Fig. 3-5H) is observed by others (Zhu & Ikeda 1994) and is thought to reflect the promiscuity of GPCRs (Hermans 2003).

To isolate N-type currents from the whole cell calcium current we used the specific

CaV2.2 blocker -conotoxin GVIA (-CTX). N-type currents comprise ~75% of the total calcium current in newborn mouse SCG (Fig. 3-6A-C). The fraction of N-type current (Fig.

3-6C; p = 0.19), the percentage of N-type current inhibited by VIP (Fig. 3-6D; p = 0.17), and the percentage of non-N-type current inhibited by VIP (Fig. 3-6E; p = 0.28) were not significantly affected by the loss of Fox-2. Our data suggest that the basic inhibitory mechanisms that couple VIP receptors to inhibition of N-type and non-N-type calcium channels are independent of Fox-2 and e18a. However, N-type current density in injected cells was significantly larger than in control cells (p = 0.019, Fig. 3-6F), consistent with the significantly larger N-type current densities in cells expressing

CaV2.2[e18a] compared to those expressing CaV2.2[18a] channels (Figs. 3-2A-E; 3-4A-

G).

Loss of Fox-2 increases VI inhibition of N-type currents by Gs

Finally, we measured the amount of VIP-mediated VI and VD inhibition of total calcium currents and of N-type currents and observed significant differences between neurons containing high and low levels of Fox-2 (Fig. 3-6G-J). The percentage of VI inhibition of total calcium current by VIP was not different in uninjected and control siRNA injected cells (Fig. 3-6I; p = 0.43). By comparison, in neurons injected with Fox-2 siRNA, a significantly larger fraction of VIP inhibition of whole cell calcium current was VI (Fig. 3-

6I; Uninjected vs. siFox; p = 0.001). Furthermore, when we isolated the effects of VIP on

N-type currents, we found an even greater shift toward VI inhibition in neurons injected with Fox-2 siRNA: from 35% to 57% VI inhibition (Fig. 3-6J; p = 0.006). Our analyses in neurons correlate with and strongly support our data from studies of cloned

CaV2.2[18a] and CaV2.2[18a] channels in mammalian cell lines. We conclude that cell- specific inclusion of e18a during alternative splicing of CaV2.2 pre-mRNA is negatively controlled by Fox-2 and augments Gs protein inhibition of calcium channels.

DISCUSSION

Alternative splicing is extensive in mammalian nervous systems (Fagnani et al 2007).

Multi-exon ion channel pre-mRNAs are targets of neuronal splicing factors, which are

78 proposed to individualize exon composition of ion channel mRNAs according to cell needs. While the global importance of alternative pre-mRNA splicing has been amply demonstrated, our study establishes that a single alternatively spliced exon, controlled by Fox-2, can have a highly specific impact on G protein signaling to a neuronal calcium channel. Collectively, we reveal an elegant cellular mechanism to engage or disengage

VI inhibition of CaV2.2 channels by Gi/o and Gs proteins by independent control of e37a and e18a inclusion during pre-mRNA splicing (Andrade et al 2010; Raingo et al 2007).

We suggest that the classic view of multiple GPCRs converging on a single type of CaV2.2 channel needs to be revised to incorporate CaV2.2 channel isoforms and at least two parallel non-converging inhibitory pathways for Gi/o- and Gs-coupled receptors (Fig. 3-7).

Voltage-independent inhibition, not voltage-dependent inhibition, depends on inclusion of alternative exons

A unique characteristic of CaV2.2 channels—by comparison to closely related CaV2.1 channels—is their susceptibility to strong inhibition by numerous GPCRs (Bourinet et al

1996; Currie & Fox 1997) (Elmslie 2003). VD inhibition is observed in all CaV2.2 channel isoforms studied so far and is exhibited independent of alternative splicing. However, we show that CaV2.2 channel susceptibility to VI inhibition by G proteins and GPCRs depends crucially on exon composition; VI inhibition by Gs requires e18a, and previously we demonstrated that VI inhibition by Gi/o requires e37a (Andrade et al 2010; Raingo et al 2007). Interestingly, VD and VI inhibition differ in the spatial restrictions on their ability to inhibit calcium channels. VD inhibition is membrane-delimited and relies on

G directly binding to CaV2.2. It is highly sensitive to the spatial proximity of ion channel and G protein: the influence of Gβγ falls off sharply with distance (Bernheim et al 1991). On the other hand, VI inhibition employs diffusible second messengers that can influence distant signaling partners (Bernheim et al 1991). Alternative splicing of calcium channels therefore might be important for restricting the influence of GPCRs that mediate VI inhibition through Gi/o or Gs proteins. In this way, distant GPCRs would influence only CaV2.2 channels that contain e18a or e37a.

GPCRs also inhibit CaV2.2 channels via Gq by depleting PIP2 (Suh et al 2010). Although

GTPS did not activate Gq inhibition of cloned CaV2.2 channels (Fig. 3-3), we did observe

Gq-mediated VI inhibition of CaV2.2 channels, independent of e18a, when we co- expressed muscarinic M1 or angiotensin AT1 receptors that couple to Gq (unpublished data CGP & DL). Thus Gq-coupled receptors appear to inhibit CaV2.2 channels independent of known alternative splice sites in CaV2.2.

Voltage-independent inhibition via e18a and e37a is additive

Even though their functional effects are indistinguishable, Gs and Gi/o work through different intracellular domains of CaV2.2 and use different second messengers: VI inhibition by Gi/o is Gβγ-independent, src tyrosine kinase-dependent, RGS2-insensitive, and PTX-sensitive (Diverse-Pierluissi et al 1997; Raingo et al 2007), whereas VI inhibition by Gs is Gβγ-dependent, RGS2-sensitive, PTX-insensitive, and ChTX-sensitive.

Consequently, VI inhibition mediated by e18a and e37a is additive (Fig. 3-2). CaV2.2

80 channels containing both e18a and e37a are expressed in a subset of nociceptors (Bell et al., 2004), and they are likely to be strongly inhibited when both Gs and Gi/o coupled receptors are activated, compared to CaV2.2 channels with either one of the exons alone. By contrast, VD inhibition is not additive, consistent with the idea that G proteins share common Gs (Graf et al 1992; Jeong & Ikeda 1999). The modularity and functional autonomy of alternatively spliced exons 18a and 37a enable independent control over the VI inhibitory influence of either G protein on CaV2.2 channels without affecting VD inhibition.

Fox-2 regulates e18a of CaV2.2

The presynaptic CaV2 family of voltage-gated calcium channels contains many splice isoforms that have unique functional, pharmacological and tissue expression patterns

(Bourinet et al 1999; Kaneko et al 2002; Lipscombe et al 2008; Soong et al 2002). We have validated four alternatively spliced exons with unique tissue and developmental expression patterns in the Cacna1b gene that encodes CaV2.2 channels (e18a, e24a, e31a, e37a/e37b)(Lipscombe & Castiglioni 2004). We recently showed that the splicing factor Nova-2 enhances e24a and represses e31a splicing of the Cacna1b gene (Allen et al 2010; Ule et al 2006). Here we show that a second splicing factor, Fox-2, controls e18a inclusion in CaV2.2 channels in neurons.

Like Nova, the Fox family of splicing factors tends to act as repressors when they bind upstream of the target exon and enhancers when they bind downstream (Li et al 2007;

Yeo et al 2009; Zhang et al 2008b). The Fox splicing regulatory network is tissue-specific and many targets are essential for neuronal function (Brudno et al 2001; Minovitsky et al 2005; Nakahata & Kawamoto 2005; Underwood et al 2005; Yeo et al 2009; Zhang et al

2008b). In addition, human mutations in Fox genes are associated with neurological diseases including mental retardation, epilepsy, and autism spectrum disorder (Barnby et al 2005; Bhalla et al 2004; Martin et al 2007; Sebat et al 2007). Here we reveal a new role for Fox-2 in controlling GPCR inhibition of a neuronal calcium ion channel. Given our findings, it would be interesting to test if Fox-2 controls the splicing of other ion channel pre-mRNAs including KCNQ2 and KCNQ3 that encode M current channels (Pan et al

2001) whose activities are similarly regulated by G proteins.

Fox-2 may work in concert with other splicing factors

Our Western analyses of cells expressing 100 nM Fox-2 siRNA show almost complete loss of Fox protein, but our RT-PCR analyses reveal the presence of CaV2.2*Δ18a+ mRNAs

(Fig. 3-1). The e18a splice junction may be sub-optimal, explaining the presence of e18a- lacking mRNAs in the absence of a splicing repressor. Alternatively, additional splicing factor(s) may act in concert with Fox-2 to repress inclusion of e18a. This type of combinatorial splicing regulation is well documented (Chen & Manley 2009; Hertel 2008;

Lipscombe et al 2008) but one splicing factor can dominate, as shown here.

Function of VI inhibition in sympathetic neurons

VI inhibition should curtail calcium entry independent of concomitant neuronal activity in contrast to VD inhibition which is sensitive to voltage, relieved by strong depolarizations, and wanes with stimulus frequency and number (Park & Dunlap 1998).

Sympathetic neurons are the model neuron for studying GPCR inhibition of CaV2.2 channels but our results may have relevance to Gs-mediated regulation of sympathetic tone. Release probabilities at sympathetic synapses are very low (Boehm & Kubista

2002), and transmission is non-linearly related to [Ca2+] entry. Consequently a relatively small reduction in presynaptic calcium entry could have a major impact on transmission efficacy (Catterall & Few 2008). Neurons of the SCG innervate cerebral vessels

(Edvinsson & Uddman 2005), establishing sympathetic tone of these vessels. Therefore, neurotransmitters and neurohormones that activate Gs proteins may be more effective at reducing sympathetic tone of cerebral vessels when e18a is spliced into CaV2.2 mRNAs.

Elegant cellular mechanisms have evolved to regulate inclusion of specific exons depending on cell-type and stage of development (Chen & Manley 2009; Grabowski &

Black 2001; Li et al 2007; Licatalosi & Darnell 2010). A single splicing factor can coordinate the composition of several genes, but we provide evidence that an individual splicing event can be resolved in the activity of channels in individual neurons. We suggest that alternative splicing is a cellular mechanism for setting the sensitivity of

CaV2.2 channels to specific G proteins using parallel independent signaling pathways.

MATERIALS AND METHODS

SCG cell isolation and culture

Superior cervical ganglia were removed from P0-2 mice. We dissociated ganglia in HBSS

( -CaCl2, -MgCl2 -MgSO4) containing 1 mg/ml Trypsin (TRL3, Worthington) while incubating in a 37°C waterbath for 45-60 min. Following trypsinization, cells were dissociated by 5 min of tituration using a fire-polished pipette. Cells were plated on coverslips coated with laminin (Invitrogen) in a growth media modified from the one used by Mahanthappa and Patterson (Mahanthappa & Patterson, 1998). Neurons were maintained at 37°C with 5% CO2. 24 hrs after plating, cells were treated with 10µM ara-

C (Sigma) to inhibit glia growth.

Clones and transfection tsA201 cells were grown in DMEM (Sigma) + 10% Fetal Bovine Serum (Gibco) and split when 70% confluent. Cells were transfected when 70% confluent using Lipofectamine

2000 (Invitrogen) and Opti-MEM (Sigma). Cells were transfected with cDNA clones of

CaV2.2, 2a or 3, and 21 in a molar ratio of 1:1:1 along with EGFP. The following clones were used and isolated in our lab from rat brain: Cav3 (M88751),

CaV21(AF286488); CaV2.2[18a,37b] (AF055477); CaV2.2[18a, 37b] (HQ008360). The

CaV2.2[18a,37a] clone was constructed by cloning the ~4.9 kb AscI -PshAI fragment from

CaV2.2[18a,37b] into the ~7.2 kb AscI - PshAI fragment from CaV2.2[37a]. The 2a clone was a gift from David Yue. It was subcloned into pcDNA3.1/(zeo+) using EcoRI.

Electrophysiology tsA201 cells. We performed standard whole cell patch clamp recording (Thaler et al.,

2004). Extracellular solution (in mM): 135 ChCl, 1 CaCl2, 4 MgCl2, 10 HEPES, pH 7.2 with

CsOH. Internal: 126 CsCl, 10 EGTA, 1 EDTA, 10 HEPES, 4 MgATP, pH 7.2 with CsOH. SCG neurons. External solution: 135 TEA-Cl, 4 MgCl2, 10 CaCl2, 10 HEPES, 100 nM TTX, pH 7.2 w/ TEA-OH. Internal: 126 CsCl, 1 EDTA (Cs2), 10 EGTA (Cs4), 10 HEPES, 4 MgATP, pH 7.2 with CsOH. We sylgard-coated and fire-polished electrodes to a resistance of 2-3 MΩ

(tsA201) or 4–6 MΩ (SCG). Data analysis. We used pClamp version 10 software and the

Axopatch 200A (Axon Instruments) for data acquisition; data were filtered at 2 kHz (–3 dB) and sampled at 20 kHz. We compensated series resistance by 70–90% with a 7-μs lag and performed online leak correction with a P/–4 protocol. All recordings were obtained at room temperature. There is currently no combination of toxins that will completely inhibit all other types of calcium channels while leaving the N-type channel untouched. Therefore we isolated the N-type component of inhibition using - conotoxin (10 M). We inhibited the N-type component, and then subtracted the non-

N-type current from the control current in order to isolate the N-type (as in Andrade et al, 2010). All of the values (Con, VIP, etc.) were calculated by taking the area under the curve during 48 ms of test pulse. All cells did not completely recover from VIP treatment, therefore separate cells were used to calculate the effect of VIP on non-N-type and the

85 effect of VIP on total Ca current. % Inhibition of N-type current = total N-type inhibition

/ total N-type current = [(Con – VIP) – (ω-CTX – ω-CTX+VIP)] / [Con – ω-CTX]. % VD inhibition of N-type current = VD component of N-type inhibition / total N-type inhibition = [(VIP+pp – VIP) – (ω-CTX+VIP+pp – ω-CTX+VIP)] / [(Con – VIP) – (ω-CTX – ω-

CTX+VIP)+. Estimators: ω-CTX = Con * ave inhibition of total Ca current by ω-CTX = 22.6

+/- 3.5% (n=10); ω-CTX+pp = 22.5 +/- 3.7% (n=10). ω-CTX+VIP = Con * ave inhibition of non-N-type by VIP =16.3 +/- 0.8% (n=5); ω-CTX+VIP+pp = 16.3 +/- 0.8% (n=5). P values were obtained using the Student’s t-test unless otherwise indicated.

Genomic sequence alignment

We used the mouse e18a sequence to BLAT other genomes using the UCSC genome browser. For each species, we identified the 18a exonic sequence as well as 200 nucleotides of each of the neighboring introns. We then used the alignment tool on

Vector NTI Advance 10 (Invitrogen) to align the sequences from all species.

RT-PCR

We dissected SCG from wildtype mice (4-10 mice per age group). Ganglia were homogenized in TRIZOL (Invitrogen) using a Polytron homogenizer. We used

SuperScript II (Invitrogen) to reverse transcribe 1 µg of RNA per group. We used 1 µl of this first-strand cDNA in a 25 µl PCR reaction containing Taq polymerase (New England

Biolabs). E18a RT-PCR primers are: BU2118 5’GGCCATTGCTGTGGACAACCTT and

BD2324 5’CGCAGGTTCTGGAGCCTTAGCT. PCR was performed with a thermocycler

(BioRad DNAEngine), using the following program : 1 cycle of 95°C for 2 min; 25 cycles of

95°C for 0.5 min, 60°C for 0.5 min, 72°C for 1 min, a final 6 min extension step at 72°C.

The RT-PCR protocol for amplifying cDNA from F11 cells was identical. RT-PCR products were run on 8% denaturing polyacrylamide gels. Gels were stained with SYBR Gold stain

(Invitrogen). Unsaturated bands were imaged on a BioRad gel doc station. We used the program Scion Image to analyze unsaturated band densities.

F11 cell culture and siRNA transfection

F11 cells are split twice a week and are grown in DMEM culture media plus 10% fetal bovine serum and 1% penicillin/streptomycin. One day before transfection, cells are plated in six-well plates without antibiotics. We used Lipofectamine 2000 (Invitrogen) to transfect cells with siRNAs for 48-60 hrs. siRNAs used (Thermo Scientific Dharmacon):

Fox-2 (original sequence provided by Dr. Doug Black (UCLA)):

CCUGGCUAUUGCAAUAUUUUU. Fox-2b: UAUUGCAAUAGCCAGGCCUCUU. siGENOME

Cyclophillin β control siRNA: catalog #D-001136-01-05. siGENOME non-targeting siRNA

#3: catalog #D-001210-03-05.

Western Blot

We used Lipofectamine 2000 (Invitrogen) to transfect 10cm dishes of F11 cells with 0.5

µg EGFP (C1, Clontech) alone, EGFP + 6 µg Fox-2 plasmid (provided by Douglas Black’s

87 lab; used as a size control), or EGFP + 100 nM Fox-2 siRNA for 48 hrs. Media was changed after 6 hrs. We estimate that approximately 25% of cells were transfected with

EGFP. RIPA buffer containing protease inhibitors (Roche) was used to lyse the cells.

Lysed cells were spun at 13,500 RPM at 4°C for 20 min. We used a BCA kit (Pierce) to determine the protein concentration of the supernatant. We denatured 12 µg of each sample for 10 min at 90°C and then ran samples on a 4% stacking and 15% resolving

SDS-PAGE gel. Protein was transferred to a nitrocellulose membrane (Protran,

Whatman) and blocked with 5% dry milk in phosphate-buffered saline with 0.1% Tween-

20 (PBST) for one hour at room temperature. The blot was then incubated in a rabbit anti-FoxRRM primary antibody that recognizes all Fox proteins (1:2000 in PBST with

1%BSA, gift from Doug Black) for one hour at room temperature. Blot was rinsed and then incubated in a donkey-anti-rabbit horseradish peroxidase secondary (1:7500 in

PBST with 1%BSA, Jackson ImmunoResearch) for one hour at room temperature.

Proteins were detected with a ECL chemiluminescence kit (Vector). The blot was then stripped with 2-mercaptoethanol and SDS and reprobed with a rabbit anti-GAPDH antibody (1:1000 in PBST with 1%BSA, Cell Signaling).

SCG injections

SCG neurons used for electrophysiology were injected 24 hrs after plating; those used for immunocytochemistry were injected 7 days after plating. We used an InjectMan NI2 manipulator and Femtojet microinjector (Eppendorf) for injections. We combined 10 µl of 20 µM siRNA with 10 µl of 8.9 mg/ml dextran fluorescein (Invitrogen) and spun down

88 any undissolved dextran by spinning the sample at 14,000 RPM for 10 min at 4°C. We then used 2 µl of this solution to load the microinjection tip (Eppendorf). Injection parameters: Pi 150 hPa, Ti 0.4 sec., Pc 40 hPa.

Immunocytochemistry

SCG neurons were fixed with 4% paraformaldehyde in phosphate-buffered saline (PBS) for 15 min. We then blocked the cells for 1 hr at room temperature (RT) in 10% normal goat serum (NGS) in PBS. Cells were incubated in a rabbit anti-Fox-2 antibody (1:500,

Bethyl) for 2.5 hrs at room temperature in 3% NGS. Cells were washed in PBS and then incubated in a goat-anti-rabbit rhodamine secondary antibody (1:200, Jackson

ImmunoResearch) in 3 % NGS for 45 min at RT. Images were captured with a confocal microscope (LSM 510, Zeiss), and analyzed with AxoVision 4.8.1 (Carl Zeiss Imaging

Solutions).

ACKNOWLEDGEMENTS

We thank the following investigators for their generous gifts: David Yue for β2a, Stephen

Ikeda for RGS2 and MAS GRK-2, Probal Banerjee for F11 cells and Douglas Black for the

Fox-2 plasmid and Fox RRM antibody. Funding for this project was provided by a Sidney

Frank Predoctoral Fellowship (CGP), a Charles A. Dana Interdisciplinary Fellowship (SEA) and NIH grants F31NS066691 (SEA), F31NS066712 (CGP), NS29967 (DL), and NS55251

(DL).

Figure 3-1. The splicing factor Fox-2 represses e18a inclusion.

A) Schematic illustrating CaV2.2 in the cell membrane, amino acid sequence and location of e18a on intracellular II-III linker, and splicing pattern. B) Genomic alignment: a conserved Fox-2 binding site is located upstream of e18a. Star denotes species used in alignment by Minovitsky and colleagues (Minovitsky et al 2005). Putative Fox-1/2 consensus sequence, (U)GCAUG, is 100% conserved in the upstream intron. In most cases, Fox-1/2 proteins act to repress the inclusion of an alternative exon when they bind upstream of the exon. C) RT-PCR analysis of +18a and ∆18a channel mRNAs from

F11 cells transfected with Fox-2 siRNA. Three independent transfections were analyzed per condition. There was a significant increase in percent of channels containing e18a:

22.5% ±2.3 of mRNAs from untransfected cells vs 58.4% ±2.5 in cells transfected with

100nM Fox-2 (star indicates 0 vs. 100 nM, Student’s t-test, p = 0.000129). D) RT-PCR analysis of +18a and ∆18a channel mRNAs extracted from F11 that were untransfected

(none), transfected with siRNA against cyclophillin B (cycB) or transfected with control siRNA (con 3). Above: representative gel; below: average of 3 exps. There is no significant difference in the percentage of channels containing +18a: 20.3 ± 2.3% of mRNAs from cycB cells and 26±1.7% of mRNAs from con 3 cells and 22.5% ±2.3 from untransfected cells (one-way ANOVA, F = 1.789, p = 0.246). E) Western blot showing knockdown of Fox protein in cells transfected with siRNA against Fox-2 and an increase in Fox protein in cells transfected with a Fox-2 expression plasmid. GAPDH expression is shown below as a control. Membrane was cut as indicated to remove redundant lanes

(experiment was run in triplicate).

Figure 3-2. Inclusion of e18a renders CaV2.2 susceptible to G protein-mediated voltage-independent inhibition.

A-F) Calcium currents from cells expressing CaV2.2[18a,37b] (A,D), CaV2.2[18a,37b]

(B,E), or CaV2.2[18a,37a] (C,F) along with 3 and α2δ1. Cells were recorded from with internal solution without (Con) or with (GTPS) 0.4mM GTPS. Currents were evoked by

50 ms test pulses to voltages shown on X-axis without (-pp) or with (+pp) a 25 ms

92 prepulse to 80 mV. (A,B,C) In the absence of GTPS channels did not undergo prepulse facilitation. Example currents are shown above IVs. Schematics above currents indicate splice variant expressed with approximate location of alternative exons on channel structure. D) In the presence of GTPS, currents from cells without e18a (18a) showed only voltage-dependent inhibition: they recovered fully to the Con levels after prepulse

(+pp). Channels expressing e18a (E) showed both voltage-dependent and voltage- independent inhibition: they recovered partially after prepulse (+pp). Channels expressing both e18a and e37a (F) showed even less recovery from GTPS-mediated inhibition, hence even more voltage-independent inhibition. Example current traces from steps to -5, 10, and 25 mV are shown above IVs. N values: (A,D) Con –pp = 14, Con

+pp = 14, GTPS = 12 , GTPS +pp = 10 ; (B,E) Con –pp = 19, Con +pp = 19, GTPS = 15,

GTPS +pp = 11; (C,F) Con –pp = 15, Con +pp = 15, GTPS = 10, GTPS +pp = 8 . Scale bars:

(A-C) 5 ms, 500 pA; (D-F) 20 ms, 500 pA.

Figure 3-3. e18a-mediated voltage-independent inhibition is mediated by Gs and G.

A,B) Calcium currents from cells expressing Cav2.2[18a,37b], 3 and α2δ1. Cells were recorded with internal solution without (Con) or with (GTPS) 0.4mM GTPS. Currents were evoked by 50 ms test pulses to voltages shown on X-axis without (-pp) or with (+pp) a 25 ms prepulse to 80 mV. Example current traces from steps to -5, 10, and 25 mV are

94 shown above IVs. A) Currents from cells pretreated with Gi/o inhibitor pertussis toxin

(PTX; 500 ng/ml, 16hrs). All G protein-mediated inhibition was voltage-independent: currents showed no prepulse facilitation in the presence of GTPS (GTPS -pp vs. GTPS

+pp). B) Currents from cells co-transfected with Gq and Gs inhibitor RGS2 showed mostly VD inhibition. C) Currents from cells pretreated with Gs inhibitor cholera toxin

(ChTX; 500 ng/ml, 16hrs). All G protein-mediated inhibition was voltage-dependent: currents completely recovered to control current density levels (Con) after prepulse

(GTPS+pp). D) Currents from cells co-transfected with G scavenger MAS GRK2ct. Cells did not show VD or VI inhibition when G was scavenged. N values: (A) Con = 17, GTPS

–pp = 21, GTPS +pp = 18; (B) Con = 17, GTPS –pp = 21, GTPS +pp = 18; (C) Con = 12,

GTPS -pp = 9, GTPS +pp = 10; (D) Con = 17, GTPS –pp = 17, GTPS +pp = 15. Scale bars:

(A) 1 nA, 5 ms; (B) 500 pA, 5 ms; (C) 100 pA, 10 ms; (D) 300 pA, 5 ms.

Figure 3-4. Coexpression of 2a does not affect e18a-mediated voltage-independent inhibition.

Calcium currents from cells expressing CaV2.2[18a,37b] (A,D,F) or CaV2.2[18a,37b]

(B,E,G) with 2a and α2δ1. Cells were recorded with internal solution without (Con) or with (GTPS) 0.4 mM GTPS. Currents were evoked by 50 ms test pulses to voltages shown on X-axis without (-pp) or with (+pp) a 25 ms prepulse to 80 mV. A,B) In the absence of GTPS, channels showed prepulse facilitation. C) Prepulse facilitation is voltage dependent and peaks at 0 mV. D,E) Example Con currents shown basal facilitation for 18a and e18a expressing cells. F) In the presence of GTPS, currents from cells 18a cells showed total VD inhibition: they recovered fully to the Con levels

96 after prepulse (+pp). G) Channels expressing e18a showed both VD and VI inhibition: they recovered partially after prepulse (+pp). All cDNA constructs are e37b. N values:

(A,F): Con –pp = 10, Con +pp = 10 , GTPS = 7 , GTPS +pp = 6 ; (B,G) Con –pp = 16, Con

+pp = 16 , GTPS = 6, GTPS +pp = 6. Scale bars: (D, E) 25 ms, 200 pA.

Figure 3-5. Calcium currents from SCG neurons injected with Fox-2 siRNA and uninjected cells are inhibited by the Gs agonist VIP.

A) RT-PCR analysis of e18a in mRNA isolated from mouse SCGs of postnatal ages indicated above gel. Primers flanked the splice site and generated bands of size 291bp

(+18a) and 228bp (∆18a). PCR-derived cDNA products were separated on a 8% denaturing polyacrylamide gel. Results are similar to previous analysis of e18a inclusion in rat SCG during development (Gray, Raingo, & Lipscombe, 2007). B) SCG neurons were injected with Fox-2 siRNA and dextran fluorescein (green) then fixed and stained with an anti-Fox-2 antibody (red). siRNA injected cells show little Fox-2 staining, while uninjected cells show strong Fox-2 expression levels, especially in cell nuclei. C) Diary plot of an example calcium current recording from an uninjected cell. Plot shows reversible inhibition of current by VIP and inhibition of majority of Ca current by N-type inhibitor ω-conotoxin. D) IV from example cell showing peak current at +20 mV and VD +

VI inhibition of Ca current. Example currents from an uninjected (E) a Fox-2 siRNA injected (F), and an uninjected cell pretreated with cholera toxin (G, ChTX; 500 ng/ml,

16hrs). Cells were challenged with VIP (10 M) and currents were evoked with a 50 ms step to 20 mV. H) Percent inhibition of total calcium currents by VIP; Fox-2 and control siRNAs (siCon) do not affect percent inhibition, while ChTX occludes 90% of the VIP- mediated inhibition.

Figure 3-6. Fox-2 siRNA injection in SCG neurons switches the voltage-dependence of

VIP inhibition of the N-type current to mostly voltage independent inhibition.

A) Example currents from an uninjected cell treated with N-type inhibitor -conotoxin

(10 M) followed by treatment with VIP (10 M) and challenged with a voltage step to

10 mV. B) Example currents as in A from a cell injected with Fox-2 siRNA. C-E) Knocking down Fox-2 does not affect the % N-type current, % inhibition of N-type channels or the % inhibition of non-N-type channels. F) Cells injected with Fox-2 siRNA show significantly increased charge density. Example currents from an uninjected cell (G) and a Fox-2 siRNA injected cell (H). Cells were challenged with VIP (10 M) and currents were evoked with a 50 ms step to 20 mV without (VIP -pp) or with (VIP +pp) a 20 ms prepulse to 80 mV. I) Injection with control siRNA does not affect % VI inhibition of total Ca

100 current by VIP while Fox-2 siRNA causes a significant increase in %VI inhibition (VII). J)

Fox-2 siRNA significantly increases the VIP-mediated VI inhibition of N-type currents.

101

Figure 3-7. Models of GPCR inhibition of CaV2.2 channels.

The prevailing view in the calcium channel field has been that multiple GPCR pathways converge on a single CaV2.2 channel. Any cell-specificity in these interactions is therefore due to differences in GPCR expression or activity. We propose a different model, where there is no single CaV2.2 channel, but rather a set of splice isoforms of

CaV2.2 that show varied behavior. In this model there are multiple parallel pathways of

GPCR inhibition specified by the CaV2.2 splice isoform. We have shown that there are at least two parallel pathways based on the expression of e37a or e18a that control Gi/o and Gs inhibition of N-type currents, respectively.

102

CHAPTER 4

Finding factors that regulate CaV2.2 e37a and e37b alternative splicing

Summer E. Allen, Kiauntee Murray, Sylvia Denome, Diane Lipscombe

Contributions: I performed the Nova-2 knockout mice, minigene, and bioinformatics experiments. Sylvia Denome and I cloned the mutated minigenes. Kiauntee Murray and I cloned the EGFP minigenes. I wrote the text in this chapter.

103

ABSTRACT

The Cacna1b gene encodes for the α1 pore-forming CaV2.2 subunit of N-type calcium channels and contains multiple sites of alternative splicing, including mutually exclusive exons 37a and 37b. Splicing of these exons is highly regulated and functionally important. Channels containing e37a, which are enriched in nociceptors of the dorsal root ganglia, are important for the transmission of pain signals; mice lacking e37a show decreased analgesia when administered spinal morphine. The splicing factors that regulate these exons are unknown. In this thesis chapter, I describe experiments using knockout mice, minigene assays, and bioinformatics tools to try to identify such factors.

I show that, although Nova-2 binds to the intron upstream of e37a, its expression alone is not sufficient to regulate e37a and e37b splicing. Additionally, I provide evidence from minigene studies that suggests that an exonic element in e37a is at least partially responsible for the repression of this exon and that the binding of a splicing factor to an intronic element may enhance e37b inclusion. Using evidence from various bioinformatics tools, I suggest that the splicing factors hnRNP-A/B and/or hnRNP-F may regulate splicing of these important calcium channel exons.

104

INTRODUCTION

The Cacna1b gene encodes for the α1 pore-forming CaV2.2 subunit of N-type calcium channels. This gene contains several sites of alternative splicing, which allow for tissue- specific expression of CaV2.2 channel isoforms with unique functional properties. One functionally validated site of alternative splicing in Cacna1b maps to the C-terminus of the protein. This site contains a pair of mutually exclusive exons, 37a and 37b (Bell et al

2004). During splicing, either e37a or e37b is included in the final mRNA transcript; rarely are both (or neither) exons included (Fig. 4-1A schematic). Our lab has shown that channels including e37a are more sensitive to voltage-independent inhibition by

Gi/o-coupled receptors such as the µ-opioid and GABAB receptors (Bell et al 2004; Raingo et al 2007). Our lab recently generated exon-targeted mice where either e37a or e37b is included in all CaV2.2 channels and discovered that mice lacking e37a had normal basal responses to thermal stimuli but had reduced analgesia in response to spinal morphine (Andrade et al 2010). These results support the idea that e37a increases the analgesic effects of morphine by increasing inhibition of the channel through the μ- opioid receptor and highlight the biological importance of splicing at this site.

Splicing of e37a and e37b is highly regulated and tissue-specific. CaV2.2 channels containing e37a are enriched in nociceptive neurons of the dorsal root ganglia (DRG), whereas channels containing e37b are found throughout the nervous system (Bell et al

2004). Despite the tissue-specificity and functional importance of these exons, nothing is known about the factors that regulate their splicing. In the main introduction of this

105 thesis I detailed the basic mechanisms of alternative splicing. With this in mind, there are several possible mechanisms to control the selection of e37a or e37b in a cell- specific way (Fig. 4-1B): i) E37a inclusion is repressed throughout most of the nervous system, therefore a splicing factor expressed in most neurons could bind to an exonic or intronic suppressor cis element and prevent e37a inclusion. Lower expression of this putative splicing factor in a subset of DRG neurons would permit e37a inclusion in these cells. ii) A putative splicing factor expressed in most neurons except DRG nociceptors could enhance e37b inclusion. iii) E37b inclusion could be preferred due to secondary structure and/or preferential binding of components of the spliceosome, and an enhancer protein that is expressed in nociceptors of the DRG would be required to promote e37a inclusion. iv) A splicing factor could be expressed in nociceptors to repress e37b, allowing for increased e37a inclusion. v) Mulitple splicing factors, including both enhancers and repressors, could work in concert to regulate exon choice

(Hertel 2008; Zhang et al 2010). vi) Finally, the activity level, rather than expression level, of a particular splicing factor may be what varies between the DRG nociceptors and the rest of the nervous system. Changes in protein stability, splicing, protein-protein interactions, and nuclear translocation are all known to influence the activity of splicing factor proteins (Heyd & Lynch 2011).

Several methods can be used to identify the cis elements and trans splicing factors that regulate the splicing of a particular site. These include biochemically derived splicing factor binding maps (such as HITS-CLIP), minigene assays, and bioinformatics tools. In

106 this chapter, I show how I have used various techniques to attempt to identify the factors that regulate the alternative splicing of CaV2.2 e37a and e37b. I show that brain mRNA from Nova-2 and wildtype mice express the same pattern of e37a and e37b splicing, and thus conclude that Nova-2 expression is not sufficient to regulate splicing of these exons. Additionally, I present evidence from minigene studies that suggests an exonic repressor regulates e37a and an intronic enhancer may regulate e37b. I also show results from various bioinformatics tools that suggest the splicing factor hnRNP-B may repress e37a inclusion and the splicing factor hnRNP-F may enhance e37b inclusion.

RESULTS

Nova-2 HITS-CLIP

Using HITS-CLIP (high throughput sequencing crosslinking immunoprecipitation), Darnell and colleagues mapped sites of Nova-2 binding throughout the mouse genome.

Generally, when Nova binding was within 500 nucleotides of either an alternative 5’ or constitutive 3’ splice site Nova enhanced exon inclusion; when Nova binding was within

500 nucleotides of the constitutive 5’ splice donor site or surrounding the alternative exon, Nova repressed the alternative exon (Licatalosi et al 2008).

One of the largest and most reproducible clusters of Nova tags within a calcium channel gene is located in the approximately 5,000 basepair intron between constitutive exon 36 and alternative exon 37a in Cacna1b (Fig.4-2A). This cluster is located approximately

107

1kb from the 5’ splice site of exon 36. Extrapolating from the Nova-RNA interaction map,

I predicted that Nova represses exon 37a expression. Further support for this prediction comes from the fact that Nova is expressed in the CNS (where e37a is at low levels) and not expressed in the DRG (where e37a is found at higher levels).

To test this hypothesis, I PCR amplified cDNA from wild-type and Nova-2 knockout brain and DRG using primers in constitutive exons 35 and 38 (Fig. 4-2B). Because exons 37a and 37b are the same size, I used restriction enzymes to digest the PCR products in order to determine the proportion of splice products containing e37a versus e37b (Fig.

4-2C). BsrGI cuts e37a sequence at a single site and does not cut the e37b sequence.

XhoI cuts the e37b sequence once and does not cut e37a (Fig. 4-2D-E). As our lab previously showed, most CaV2.2 mRNA in brain and DRG contains e37b, although mRNA containing e37a sequence is more abundant in DRG compared to brain (as can be seen by examining the uncut PCR product in 2E). There were no obvious differences in the pattern of expression of e37a and e37b CaV2.2 sequences amplified from Nova-2 knockout and wildtype brains.

If Nova-2 does not repress e37a expression, what is the function of the conserved Nova binding site near exon 37a? There are several possibilities. Nova-2 may act in conjunction with Nova-1 or another splicing factor to repress exon 37a in the brain. The redundancy of this repression may make it difficult to see splicing differences in mRNA from whole brain. Another possibility is that an additional splicing factor acts to

108 enhance the splicing of e37b over e37a. Additionally, Nova may play a role other than mediating splicing at this site. A recent study showed that Nova shuttles mRNAs from the nucleus to the cytoplasm in cultured cells and localizes GIRK mRNAs to dendritic processes through binding to the GIRK 3’UTR in neurons (Racca et al 2010). Perhaps

Nova binding to the intron between e36 and e37a is involved in mRNA trafficking rather than splicing.

Minigenes

Because Nova-2 does not appear to repress e37a inclusion, or at least not exclusively, I constructed a minigene that can be used to identify the trans factors and cis elements that regulate e37a and e37b in biased and unbiased screening assays. A minigene is a section of genomic DNA that contains a limited number of exons and introns. Its relatively small size makes it easy to manipulate and transfect into cells. To create a minigene to study the splicing of CaV2.2 e37a and e37b, I inserted a piece of DNA containing exons 36, 37a, 37b, and 38, as well as the interleaving introns, into a mammalian expression vector, pcDNA6 (Invitrogen). I transfected this minigene into tsA201 (HEK293 cells expressing the large T antigen) cells, extracted the RNA, synthesized first-strand cDNA from the mRNA, and used PCR with primers in e36 and e38 to amplify the splice products.

When I used primers in e36 and e38 to amplify the splice products from the minigene transfected into tsA cells I saw three products (pre-digestion): 37 (neither e37a nor

109 e37b), e37a or 37b, e37a and e37b spliced together (Fig. 4-3B, lane 4). The 37 product

(164bp) was more prominent than the splice products containing either e37a or e37b

(261bp). This is in contrast to untransfected tsA cells which express low levels of CaV2.2 mRNA and mostly express the correctly spliced form (along with lower expression of the

37 product, Fig. 4-3B, lane 3). [Note that although the expression of mRNA from the transfected minigene should be much higher than the endogenous CaV2.2 mRNA, it is impossible to tell which transcripts originated from the minigene or the endogenous mRNA.] Endogenous CaV2.2 mRNA from another untransfected cell line, neuronally derived F11 cells, includes very little 37 product (lane 8), indicating that splicing of endogenously expressed CaV2.2 transcripts from this cell line correctly mirrors the splicing seen in most of the nervous system. The digested PCR products from tsA cells transfected with the minigene have more e37b-containing cDNA than e37a-containing cDNA (Fig. 4-3C, lanes 4-6), but the 37 form was still the most prominent splice product. In untransfected cells, e37b-containing cDNA is also more abundant than e37a-containing cDNA, and this could be obscuring the results from the minigene transfected cells (data not shown).

These results show that e37b is preferentially included in tsA cells over e37a, paralleling the much higher abundance of e37b-containing CaV2.2 mRNAs in most of the nervous system. However, the abundance of the Δ37 product suggests that splicing of the minigene in tsA201 cells occurs with much lower efficiency compared to native CaV2.2 pre-mRNA splicing in neurons.

110

Mutant minigenes

To explore the influence of the individual alternative exons on splicing, three mutant minigenes were constructed: one contains two 37a exons and no e37b (AA minigene), one contains two e37b exons and no e37a (BB), and a third lacks e37b (B) (Fig. 4-3A).

In the AA and BB constructs, one exon in each pair is mutated to create a new restriction digest site so that the two exons can be separated (i.e. in the AA minigene, the first e37a can be digested with BsrGI; the second e37a can be digested with Xho1).

I used restriction digests as described above to analyze PCR products from cells transfected with these minigenes. Transfection and splicing of the AA and B minigenes in tsA201 cells predominantly resulted in the 37 product (Fig. 4-3B, lanes 5 and 7).

Neither minigene generated significant levels of e37a-containing product. By contrast, splice products from cells transfected with the BB minigene were similar to those from cells transfected with the wildtype AB minigene (Fig. 4-3B, lane 6). Digestion of these products showed that the second e37b (in its native position) is included more often than the first e37b (Fig. 4-3C, lanes 10-12). These results mirror the splicing seen in the brain mRNA of the AA and BB mice generated by our lab (Andrade et al 2010). Spliced brain mRNA products from the BB mice contained the second 37b exon more frequently than the first 37b exon, and the most prominent splice product from the AA mice was the Δ37 form (data not shown).

111

These results suggest that e37a is included only rarely during splicing in tsA201 cells.

This could be due to cis elements within e37a, rather than its relative location, because it is also not included during splicing when it substitutes for e37b (as with the AA minigene). A splicing factor acting as a repressor may bind to the 37a exon itself (Fig 4-

1B, asterisk). In contrast, the inclusion of e37b seems to be position dependent, because when placed in the e37a position, e37b is infrequently included. A splicing factor could bind to the upstream intron and repress the first exon (e37a in wildtype or e37b in BB) or a splicing enhancer could bind to another intron and enhance the second exon (this effect could be counteracted by the exonic repressor in the AA construct).

Additionally, the prominence of the 37 splice product may suggest that an enhancer protein is needed to promote the inclusion of e37b, although this may also be due to differences in secondary structure between the minigene and native gene.

Fluorescent minigenes

To identify the splicing factors that act to enhance e37b inclusion and/or repress e37a inclusion, Kiauntee Murray and I constructed a GFP-minigene reporter (Fig. 4-3D). With this reporter, GFP is only translatable in correctly spliced products. For example, products lacking a 37 exon or containing two 37 exons spliced together will not produce

GFP. To construct this reporter, we added an EGFP tag to the end of 38 in the wildtype

AB minigene and a Kozak sequence to the beginning of e36 to ensure minigene translation. This minigene was transfected into tsA201 and F11 cells, and we performed

112

RT-PCR using primers specific to e36 and EGFP to screen for correct splicing. I found that while the splicing efficiency is low, some minigene products are correctly spliced

(Fig. 4-3E). The predominant splice product is still 37, while products containing both e37a and e37b spliced together and the correctly spliced product were also present.

[Since the reverse primer was specific to GFP, any endogenous CaV2.2 mRNA was not amplified, unlike with the untagged minigene experiments above.] When I digested the RT-PCR products I found that the majority of the correctly spliced products contain e37b and not e37a (Fig. 4-3F), as I observed with the original wildtype minigene. I used fluorescence microscopy to see if the splicing efficiency was high enough to visualize

GFP expression. At 48 hours post-transfection, approximately one percent of F11 and tsA201 cells expressed visible levels of GFP (Fig. 4-3G). In future experiments I plan to generate mutations within this minigene to create two GFP-minigene reporters—one that will express GFP only when e37a is included and one that will express GFP only when e37b is included (Fig. 4-3D). These minigenes will be cotransfected with plasmids and/or siRNAs for splicing factors in order to assess their ability to modify e37a/37b splicing. I will be able to use these reporters to test the splicing factors predicted by bioinformatics tools to be regulators of e37a and e37b splicing.

Bioinformatics

113

As described in more depth in the introduction to this thesis, researchers have developed various bioinformatics tools to identify potential binding sites for known and unknown splicing factors. I used several of these tools to look for potential regulatory cis elements within exons 37a and 37b as well as their neighboring introns.

ESRsearch

ESRsearch searches sequences for exonic regulatory elements—both ESSs and ESEs

(Fairbrother et al 2002; Goren et al 2006). It has two modes: one identifies cis elements that are known binding targets for specific splicing factors, and the other identifies putative cis elements that could bind novel splicing factors. The binding sites for known splicing factors include those for Fox, Nova, Tra2, several of the hnRNP proteins, as well as others. I analyzed human and mouse e37a and e37b sequences using the ESRsearch program to identify potential cis elements conserved between the human and mouse

Cacna1b genes. Several putative binding sites were conserved between these species

(see Fig. 4-4A).

RESCUE-ESE

Similar to ESRsearch, RESCUE-ESE identifies putative splicing factor binding sites within sequences, although this program identifies potential exonic enhancers, specifically

(Fairbrother et al 2004). I used RESCUE-ESE to identify putative ESEs in human and mouse exons 37a and 37b (Fig. 4A). I compared the hits from the human and mouse results to see which are conserved (see Fig. 4-4A).

114

FAS-ESS

FAS-ESS is a tool designed to identify putative exonic splicing silencers (ESSs) specifically

(Wang et al 2004). Using this tool, I identified conserved cis elements in the mouse and human e37a and e37b sequences (see Fig. 4-4A). Interestingly, there are no conserved

ESSs, as predicted by FAS-ESS, in exon 37b.

SFMap

The bioinformatics tools mentioned above are used for identifying potential splicing factor binding sites within exons. However, splicing factors can also bind to cis elements within introns (Yeo et al 2007). Given the results from the minigene experiments, I predict that at least one splicing factor binds intronically to repress e37a and/or enhance e37b . While it is more difficult to identify putative ISEs and ISSs for unknown splicing factors in introns because introns vary greatly in length, potential binding sites for known splicing factors can be identified. The SFMap program identifies potential binding sequences for known splicing factors that are conserved between human and mouse and maps the results to the UCSC genome browser (Paz et al 2010). Since splicing factors generally bind proximally to splice sites, I used SFMap to analyze potential splicing factor binding sites in the following sequences: 500 bp downstream of constitutive exon 36, 500 bp upstream of e37a, within e37a, 500 bp downstream of e37a, 500 bp upstream of e37b, within e37b, 500 bp downstream of e37b, and 500 bp upstream of constitutive exon 38 (exons-Fig. 4-4A, introns Fig. 4-5). Because many splicing factor binding sites occur in clusters (Ashiya & Grabowski 1997; Ule et al 2006), I

115 tabulated the number of predicted binding sites for each splicing factor for each location

(Fig. 4-5H). Even given the conservation of these sites between mouse and human, many of these sites likely occur by chance and are not actual regulatory elements. For example, Nova-1 has, by far, the highest number of identified sites (36 in all). At least some of these sites are probably not actual binding sites for Nova proteins, especially since Nova has four potential binding sites (TCAT, TCAC, CCAC, CCAT) that are each relatively short and thus are more likely to appear due to chance compared to other longer splicing factor binding motifs. Nevertheless, using this tool I have identified several splicing factors that may regulate e37a/b including SF2/ASF, SC35, Tra2beta, hnRNP-H/F, MBNL, PTB, and CUG. These splicing factors need to be assessed for their ability to influence e37a and e37b splicing.

DISCUSSION

These studies represent the start of our studies aimed at identifying splicing factors that control alternative splicing of e37a and e37b during pre-mRNA processing of CaV2.2.

The work has revealed some potential candidates. The most informative analyses emerged from bioinformatics using ESRsearch, RESCUE-ESE, FAS-ESS, and SFMap. These algorithms generated a number of potentially interesting leads for splicing factors with binding properties that place them close to the e37a/e37b splice sites. By comparing results of these various cis element identification tools, I identified a few sites of possible regulatory elements that were predicted by more than one tool (Fig. 4-4A).

Focusing on a potential repressor of e37a, the TTTG motif at position 31 is contained in

116 motifs predicted by FAS-ESS and ESRsearch and also overlaps the predicted binding motif for hnRNP-B, GTTTG. The location of this motif is also quite well conserved across species (Fig. 4-4B). hnRNPA/B proteins are known to act as splicing repressors (Caputi et al 1999). These proteins are extensively alternatively spliced and isoforms show tissue- specific expression patterns (Kamma et al 1999). Both the hnRNP-A2 and B1 isoforms are highly expressed in rat neurons within the brain, and expression varies based on neuronal subtype (Kamma et al 1999). hnRNP-A1 is also expressed in developing chick dorsal root ganglia—especially in large cell nuclei (Bronstein et al 2003). Since e37a is repressed in the brain and in large cells within the DRG, the expression pattern of hnRNP-B is consistent with the possibility that it may repress e37a inclusion.

Interestingly, there is also a GTTTG site within e37b (Fig. 4-4A). This site was identified by ESRsearch in the ‘known splicing factor’ mode and the TTG segment was part of a putative regulatory motif in the ‘putative cis element’ mode, however, it was not predicted by FAS-ESS, the one tool that specifically predicts repressor elements.

Possibly hnRNP-A/B proteins repress e37a and enhance e37b. It will be interesting to see whether cotransfection of hnRNP-A/B with the minigenes or mutation of the putative hnRNP-A/B binding site within a minigene alters the splicing pattern of e37a and e37b in tsA201 cells.

The idea that hnRNP-A/B proteins could repress the inclusion of e37a by binding to the exon is consistent with results from the minigene experiments. Because e37a was rarely

117 included in spliced minigene products, these experiments provided independent evidence that e37a is probably under the influence of a cellular repressor. However, the predominance of the 37 form following cellular splicing of the minigene in tsA201 cells shows that the minigene failed to successfully recapitulate the in vivo splicing pattern of this region of the CaV2.2 pre-mRNA.

Although the results from the mutant minigene experiments and AA and BB mice suggest that splicing factors bind to cis elements within e37a and in the introns neighboring e37b to regulate splicing of these exons, it is quite possible that a splicing factor also regulates e37b splicing by binding directly to the exon. Within e37b, there is a cluster of predicted binding motifs around position 70 (Fig. 4-4A). RESCUE-ESE predicted the overlapping motifs GGAAGAA and GAAGAAA, while ESRsearch predicted the overlapping motifs GGGAAG, GGAAGAA and AATGCC as well as the binding site for hnRNP-F (GGGA). Min and colleagues showed that hnRNP-F enhances the inclusion of a neuron-specific exon within the c-src gene, despite the fact that hnRNP-F is widely expressed in a number of tissues (Min et al 1995). Interestingly, the results from SFMap show that there are two binding sites for hnRNP-F located in the intron upstream of e37a (Figure 4-5C, H). Perhaps hnRNP-F acts both as a repressor of e37a and an enhancer of e37b. Even more intriguing is the possibility that hnRNP-A/B and hnRNP-F act together to coordinate the splicing of exons 37a and 37b, as there is evidence that these proteins can cooperatively regulate splicing of some transcripts (Martinez-

Contreras et al 2006).

118

We were initially struck by the strong Nova-2 binding signal in the intron between e36 and e37a, but our experiments using Nova-2 deficient mice show that the functional importance of these prominent Nova-2 binding sites remains an open question. If Nova-

2 is involved in splicing at this site, its actions can be readily compensated for by other splicing factors (at least at the level of mRNA analysis from whole brain). Since such combinatorial regulation is thought to lie at the heart of tissue-specific exon inclusion, this is a very real possibility (Han et al 2005; Hanamura et al 1998). I hypothesize that

Nova-2, hnRNP-B, and hnRNP-F all work in concert to regulate the splicing of exons 37a and 37b. Future minigene experiments will allow us to test this possibility.

MATERIALS AND METHODS

Nova-2 mice

Animal housing and experimental procedures were in accordance with Brown institutional animal care and use committee guidelines. Brain (minus cerebellum) and dorsal root ganglia were removed from one homozygote, one heterozygote and one wildtype postnatal day 8 mouse. Tissue was immediately frozen in liquid nitrogen and then stored at -80C. I homogenized tissue in TRIzol reagent (Invitrogen) and extracted

RNA using the protocol contained in the TRIzol packaging.

RT-PCR

119 cDNA was made from 1 microgram RNA using oligo dt primers from Invitrogen’s

SuperscriptIII first-strand synthesis kit. RT-PCR was performed using serial dilutions of this cDNA (undiluted, 1:10, 1:100, 1:1000). 2 µl of each dilution were used for a 50 µl reaction. Primers SD151 (e35) and SD153 (e38) were used. A BioRad thermocycler ran the following program (35 cycles): 94°C 2 min, 94°C 30 sec, 60°C 30 sec, 72°C 1 min, 72°C

5 min. I used 12 µl RT-PCR product per reaction for each restriction digest along with 1

µl of either Xho1 or BsrG1 enzyme (NEB), 3 µl of 10X buffer 2, 0.3 ul of 100X BSA and

13.7 µl of dH20. DNA was digested for 4 hours in a 37°C incubator. Products were run on 3% agarose gels, stained with ethidium bromide and imaged using a GelDoc system.

A similar protocol was used for amplification and digestion of the minigene splice products.

Minigene cloning

The plasmid pSAD4-6 contains a segment of the mouse Cacna1b gene that includes part of the intron before exon 36, exon 36, exons 37a and 37b, part of exon 38, and the interleaving introns. This DNA was removed from Micer clone MHPN-5907 (Welcome

Trust Sanger Institute, Cambridge, UK) using the enzyme AscI and inserted into the

BssHII sites of the p2BluescriptIISK+ vector (Fermentas). I used BssHII to remove the minigene sequence from this vector and inserted it into the eukaryotic expression plasmid pcDNA6/V5-HisA (Invitrogen) at the BamHI and EcoRI sites by inserting an adaptor that contained a BssHII site between BamHI and EcoRI. This minigene (pSEA6-5) was used for the ‘wildtype’ minigene transfections. The AA (pSAD129-4), BB (pSAD127-

120

3), and ΔB (pSAD128-1) constructs were created similarly from the following clones: pSAD78-4, pSAD29-1, and pSAD48-1, respectively.

To create the fluorescent reporter minigene, the wildtype minigene was split into two pieces. BamHI was used to cut out a section of the minigene that contained the intron before exon 36, exon 36, and part of the intron between exons 36 and 37a. This piece was subcloned into pBS at the BamHI site (KMBamHI1-1). The remaining sequence from the wildtype minigene was religated (KM3-12). EGFP was amplified from the pEGFP-C1 plasmid (Clontech) using primers containing BssHII restriction sites as well as a short buffer sequence that ensured EGFP would be in frame when the minigene was transcribed, spliced, and translated. The EGFP sequence was cloned into KM3-12 at the

BssHII site following exon 38. Additionally, site-directed mutagenesis (QuikChange II XL,

Stratagene) was used to remove the intron before exon 36 in KMBamHI1-1 and to add a

Kozak sequence, which is important for the initiation of translation. To create the final fluorescent reporter, I digested both KM3-12 and KMBamHI1-1 with BamHI and inserted the piece of KMBamHI1-1 that contained the minigene segment back into KM3-12 at the

BamHI site. I then sequenced the construct to ensure there were no mutations.

Cell culture and transfections

121 tsA201 and F11 cells were grown in DMEM media containing 10% Fetal Bovine Serum and 1% Penicillin-Streptomycin solution in a 37°C incubator with 5% CO2 and were split twice a week. Cells were transfected for 24-72 hours using Lipofectamine 2000 transfection reagent (Invitrogen).

Imaging

Live cells transfected with the EGFP minigene reporter (pSEA102-4) were visualized with a Zeiss Axiovert 200M fluorescence microscope using a Fluorescein isothiocyanate (FITC) filter (excitation: 460-500 nm, emission 510-560 nm). Images were captured using a

Zeiss AxioCam MRc5 camera and the Zeiss AxioVision software.

Bioinformatics

Bioinformatics tools were accessed at the following websites:

ESRsearch: http://esrsearch.tau.ac.il/

RESCUE-ESE: http://genes.mit.edu/burgelab/rescue-ese/

FAS-ESS (hex3 set was used): http://genes.mit.edu/fas-ess/

SFMap: http://sfmap.technion.ac.il

122

Figure 4-1. Regulation of CaV2.2 e37a and e37b splicing.

A) CaV2.2 exons 37a and 37b are mutually exclusive. During splicing only one of these exons is included in the processed mRNA. B) Hypotheses for how the splicing of CaV2.2 e37a and e37b is regulated in most neurons (where e37b is included) and some DRG nociceptors (where e37a is included). The yellow circle represents a splicing factor.

Arrowheads indicate that the splicing factor acts as an enhancer of the alternative exon; horizontal lines indicate that the factor is acting as a repressor. The first hypothesis

(starred) has the most preliminary data. AA mice have repressed inclusion of both 37a exons in brain mRNA, suggesting that a repressor located on the exon represses

123 inclusion of the exon. This is consistent with data from the AA and BB and ΔB minigenes (Figure 4-3).

124

Figure 4-2. Nova-2 does not regulate e37a and e37b splicing, at least not alone.

A) Schematic from the UCSC genome browser of the Nova-2 binding sites located between exons 36 and 37a in mouse Cacna1b (mm8 assembly). Below is the Vertebrate

Multiz Alignment and Consensus track which shows the conservation of the sequence across a number of vertebrate species. There are peaks of conservation that match up

125 with the exons as well as the site of a large Nova-2 binding cluster. The peak between exon 36 and the large Nova-2 cluster is a string of GTs. The relevance of this site for splicing regulation is unclear. B) RT-PCR with primers in exons 35 and 38 was used to amplify cDNA from brain and DRG of wildtype (WT), Nova-2 +/- (HET), and Nova-2 -/-

(HOM) mice. The amplified product is 430 bp and contains transcripts which include e37a and transcripts which include e37b. C) Since exons 37a and 37b are identically sized, PCR products must be digested to determine which proportion of the transcripts contain e37a versus e37b. There is a restriction site for the enzyme BsrG1 within e37a.

BsrG1 cuts amplified cDNAs containing e37a into two pieces: 280 bp and 150 bp. PCR products containing e37b will remain undigested. There is a restriction site for the enzyme Xho1 located in e37b. Xho1 cuts PCR products that include e37b into two pieces: 340 and 90 bp. Transcripts including e37a will remain uncut. Δ37 transcripts

(333 bp) are not cut by either enzyme. D) Nova-2 WT, HET, and HOM RT-PCR products from Brain and DRG digested by BsrG1 (cuts e37a). RT-PCR was performed using serial dilutions of cDNA in order to compare unsaturated bands. In all three genotypes the uncut e37b band (430 bp) is the most prominent. There is more e37a included in DRG compared to brain in all three genotypes. There is no noticeable difference in the amount of e37a inclusion in brain or DRG in any of the genotypes. E) Nova-2 WT, HET, and HOM RT-PCR products from Brain and DRG digested by Xho1 (cuts e37b). Results are similar to BsrG1 digestion; e37b is the most prominent product in all three genotypes and in both tissues, and there is little difference between genotypes.

126

Interestingly, both of these digestions show the presence of transcripts that include e37a in the brain.

127

Figure 4-3. Splice products from wildtype and mutant CaV2.2 37a/b minigenes transfected into tsA cells show that splicing of e37a is repressed in these cells.

128

A) Schematics showing the introns and exons included in the wildtype (AB), AA, BB and

ΔB minigenes (mG). B) RT-PCR products from tsA and F11 cell cDNA amplified with primers in exon 36 and 38. Bands from a 1kb+ DNA ladder (Invitrogen) are shown in lane

1. RT-PCR products are as follows: no DNA control (lane 2), splice products from untransfected tsA cells (endogenous CaV2.2 transcripts, lane 3), splice products from tsA cells transfected with the wildtype (AB) minigene (lane 4), AA minigene (lane 5), BB minigene (lane 6), ΔB minigene (lane 7), untransfected F11 cells (positive control, lane 8).

These results show that Δ37 transcripts (164 bp) are prominent in the untransfected and transfected tsA cell cDNA, suggesting splicing of both of exons may be somewhat repressed in these cells. Endogenous cDNA from F11 cells contains comparatively much less of this splice product. The cDNA from tsA cells transfected with the AA and ΔB minigenes includes very few e37a-containing transcripts, suggesting that splicing of this exon is particularly repressed in these cells. C) RT-PCR products from tsA and F11 cells digested with BsrG1 (cuts e37a, mut37b) and Xho1 (cuts e37b, mut37a) restriction enzymes. RT-PCR products are shown as follows: endogenous F11 cell cDNA (lanes 1-3), cDNA from tsA cells transfected with AB minigene (lanes 4-6), AA minigene (lanes 7-9),

BB minigene (lanes 10-12). In F11 cells, the majority of the transcripts are cut by Xho1, showing that most splice products contain e37b. Transcripts from tsA cells transfected with the AB mG also contain more e37b than e37a. There also appears to be a splicing intermediate (band size approximately 240 bp) that is digested by Xho1. Splice products from cells transfected with the AA mG show very little inclusion of either e37a but also show the splicing intermediate that is digested with Xho1. Splice products from cells

129 transfected with the BB mG show more inclusion of the wildtype e37b than the mutant e37b since most transcripts including an exon are digested by Xho1 (cuts only wildtype e37b) compared to BsrG1 (cuts only mutant e37b). These results line up with the results from the AA and BB mice which showed repression of both 37a exons as well as a greater inclusion of the wildtype e37b compared to the mutant e37b. This suggests that an exonic repressor may regulate e37a and that it may compete with an intronic element that regulates e37b. D) Schematics of mG-EGFP reporter constructs. With the first construct, inclusion of either exon would result in expression of EGFP. The second construct contains a frameshift mutation in e37a, which means only transcripts including e37b will be successfully translated to express EGFP. The third construct contains a frameshift mutation in e37b, which means only transcripts including e37a will be successfully translated to express EGFP. E) RT-PCR products from F11 and tsA cells transfected with the wildtype mG-EGFP reporter amplified with primers in e36 and EGFP.

Three splice products are present: both e37a and b (660bp), either e37a or 37b (563 bp), and Δ37 (466 bp). F) RT-PCR products from F11 and tsA cells transfected with the wildtype mG-EGFP reporter amplified with primers in e36 and EGFP and digested with either BsrG1 or Xho1. Most correctly spliced products are digested with Xho1 and thus contain e37b. These results align with the untagged minigene results. G) tsA (left) and

F11 (right) cells transfected with the mG-EGFP reporter. Left panels show cells with phase contrast microscopy, right panels show cells expressing mG-EGFP.

130

Figure 4-4. Bioinformatics tools predict exonic splicing regulators in CaV2.2 e37a and e37b.

A) Predicted splicing motifs from FAS-ESS, RESCUE-ESE, ESRsearch, and SFMap located in exons 37a and 37b. Underlined nucleotides are contained in more than one predicted motif. Red nucleotides in the exons denote every tenth base. Binding sites for known splicing factors were predicted by ESRsearch and SFMap. ESRsearch predicts that these splicing factors may bind to e37a (location of first nucleotide in the binding motif is given in parentheses): Nova(10), hnRNP-B(30), and SRp40(72). SFMap also predicted

131 the Nova site. In e37b, ESRsearch predicted hnRNP-B(25,27) and hnRNP-F(65). SFMap predicted CUG-BP(33), SRp20(53), and Tra2beta(67). B) Conservation of exons 37a and

37b. Image from the UCSC genome browser mouse genome, July 2007 assembly with

Multiz Alignment and Conservation track.

132

133

134

Figure 4-5. Potential intronic splicing factor binding sites as predicted by SFMap.

A) SFMap predicted binding sites mapped onto the Cacna1b genomic sequence between exons 36 and 38 in the human UCSC genome browser. Black and gray bars represent predicted binding sites. Black boxes show locations of blown up regions in B-G.

SFMap binding sites located in the 500 bp downstream of e36 (B), upstream of e37a (C), downstream of e37a (D), upstream of e37b (E), downstream of e37b (F), and upstream

135 of e38 (G). (H) Table showing the number of binding sites for each splicing factor in different regions (D=downstream, U=upstream).

136

CHAPTER 5

Discussion

137

In my dissertation research I have studied factors that regulate splicing of important alternative exons in calcium channels. I showed that Fox-2 represses e18a inclusion in

CaV2.2 channels, and Cecilia Phillips and I used this repression as a tool to show that e18a regulates Gs inhibition of these channels. I also showed that exons 24a and 31a, in both CaV2.1 and CaV2.2 channels, are regulated by Nova-2. This information could be used in studies designed to elucidate the functional significance of these exons, which to date has largely eluded us. Finally I used various methods to attempt to identify splicing factors that regulate the tissue-specific inclusion of CaV2.2 e37a in dorsal root ganglia nociceptors.

In this discussion I explore how my studies fit in with the current state of the splicing field. I describe factors, such as secondary structure, that work in concert with RNA- binding proteins to regulate splicing of alternative exons. Last, I present intriguing avenues for future research on the alternative splicing of calcium channels and possible therapeutics for conditions caused by misspliced proteins.

Examining the regulation of alternative splicing: splicing maps and single gene analysis

The study of cell-specific splicing regulation is a new but rapidly growing field in neuroscience. Researchers have used various technologies including exon-junction microarrays, RNA-seq, bioinformatics, and CLIP (and later HITS-CLIP/CLIP-seq and iCLIP) to perform genome-wide screens for alternatively spliced exons and the factors that regulate them. These studies have provided extremely valuable genome-wide maps of

138

RNA-binding protein interaction sites. Splicing regulatory maps can be used to make predictions about whether a splicing factor will enhance or repress inclusion of an alternative exon based on its binding location relative to the target exon. For example, when Fox-2 binds downstream of an alternative exon, near its 5’splice site, it generally acts to enhance inclusion of the exon (Yeo et al 2009), whereas when it binds upstream, as I predicted for e18a based on sequence analyses of the Cacna1b gene (Chapter 3), it can repress exon inclusion. Similar results were obtained from Nova and PTB RNA splicing maps (Ule et al 2006; Xue et al 2009). Witten and Ule have used information from splicing factor-specific RNA splicing maps to suggest global principles that describe splicing factor regulation of alternative exons (Witten & Ule 2011). They find that several splicing factors share similar regulatory mechanisms. For example, Fox, Nova,

Mbnl1, PTB, and hnRNP-L all enhance exon inclusion when binding downstream of an alternative exon and repress inclusion when binding immediately upstream. This may suggest some evolutionarily conserved mechanism for splicing regulation; however not all RNA-binding proteins share this mechanism, as hnRNP-C enhances inclusion by binding either upstream or downstream of an alternative exon (Witten & Ule 2011).

An important feature not captured by the analyses described above is cell-specific control of alternative splicing by the coordinated action of several splicing factors, which is known to occur. Thus, even if splicing factor binding sites near a particular alternative exon are identified and validated, it can be difficult to predict how this exon is regulated by the combinatoric actions of more than one splicing factor. It is technically difficult to

139 obtain this kind of information for several reasons. First, precise estimates of splicing factor expression levels in specific cell types and at specific developmental stages are limited. The picture in vivo is also confounded by the fact that many splicing factors themselves are alternatively spliced and the resultant splice isoforms may have very different splicing efficacies. Second, several second messenger pathways regulate the activity of splicing factors. For example, Fox protein activity can be regulated by neuronal excitation (Lee et al 2009), and phosphorylation of splicing factors can also affect their splicing efficacy (Feng et al 2008). Last, there is a void in our understanding of how different splicing factors interact with one another to regulate splicing. We know, for example, that Fox and Nova proteins show combinatorial control over the splicing of many neuronal exons (Zhang et al 2010), and splicing factors can regulate the splicing of themselves and other splicing factors. However, we lack information to predict the nature of cross-regulation of splicing factors by other splicing factors given that this is likely to depend on the specific target exon, cell-type, and the functional state of the cell.

For these reasons and others, studies that focus on the splicing of a given gene or gene family in an identified cell are critically important. Very few studies have been able to link a single splicing event in a gene to the acquisition of a specific phenotype in a particular neuronal subtype. As work from our lab and others shows, detailed analyses of the function and regulation of alternative exons within a single gene can provide unique insight into the physiological significance of alternative splicing. For example, by

140 focusing on the role of Nova-2 in regulating alternative splicing in CaV2.1 and CaV2.2 voltage-gated calcium channels, we discovered information not readily accessible from the Nova-2 HITS-CLIP map alone (chapter 2): we identified a previously undiscovered exon 24a within CaV2.1, and we learned that Nova-2 acts similarly on homologous exons in CaV2.1 and CaV2.2 pre-mRNAs to enhance e24a and repress e31a inclusion. These findings have led us to explore the physiological relevance of coordinated splicing events in CaV2 presynaptic calcium channels. Additionally, by identifying Fox-2 as a regulator of CaV2.2 e18a splicing, we used this information to manipulate its expression, thereby regulating expression of e18a and assessing its function in neurons (chapter 3).

Analyses of alternative exons in the context of single genes also allow us to explore more complex forms of alternative splicing. This is the case for mutually exclusive exons, which generally are not represented in RNA splicing maps. Minigenes can often be used to determine exact splicing factor binding sites close to specific target exons, to identify new regulatory elements, to explore combinatorial splicing regulation, and to examine the participation of other factors including secondary structure that influence exon inclusion.

141

Splicing factors work in concert with other regulators to control alternative exon inclusion

RNA-binding splicing factor proteins work together with other factors including RNA structure, microRNAs, transcriptional regulation, and histone modifications to influence the splicing of alternative exons. One or more of these factors may be involved in the regulation of calcium channel alternative exons. A short description of each factor is included below.

Secondary structure influences alternative splicing

The secondary structure of pre-mRNA can strongly influence alternative splicing

(McManus & Graveley 2011). In vivo, pre-mRNAs can have secondary and tertiary structures (Russell 2008). Local RNA secondary structures can influence alternative splicing by occluding splice sites, branch point sequences, and splicing factor binding sites (Buratti & Baralle 2004). Furthermore, these types of structures are more conserved near alternative than constitutive exons (Shepard & Hertel 2008).

Additionally, splice sites around alternative exons are more likely to be GC rich, resulting in stable secondary structures at these sites; this is particularly true for tissue-specific exons (Zhang et al 2011). Interestingly, there is a GC rich region in the constitutive

CaV2.2 exon 19, which may be involved in the regulation of alternative exon 18a.

142

Long-range RNA interactions can also regulate alternative splicing. This is famously the case for the Drosophila DSCAM gene that contains competing secondary structures around some of its many mutually exclusive exons (Graveley 2005). The DSCAM exon 6 cluster contains 48 alternative exons. The intron downstream of constitutive exon 5 contains a ‘docking’ site, while complementary ‘selector’ sites are located upstream of each alternative exon 6. When a selector site binds to the docking site, one and only one exon 6 is then juxtaposed next to exon 5, preventing all the other exon 6 variants from being included in the spliced mRNA.

Additionally, splicing factor binding is sometimes used to stabilize secondary structures that in turn regulate splicing. This is the case for the regulation of exon 5 of the human cardiac troponin C (cTNT) gene. Binding of the MBNL1 splicing factor to the 3’ splice site of the upstream intron creates a stable hairpin loop that occludes U2AF65 from recognizing the splice site. This leads to skipping of the alternative exon 5 (Warf et al

2009). Small sections of RNA called riboswitches can also regulate alternative exons by binding small target molecules; this binding causes a conformational change in the RNA that can hide or present splice sites and regulatory elements (Cheah et al 2007). As of yet, riboswitches have only been found in bacteria, plants, and fungi.

Secondary RNA structure is likely to play a role in the regulation of CaV2.2 e37a and e37b mutually exclusive splicing. The secondary structure prediction tool, Evofold

(Pedersen et al 2006), predicts sites of conserved secondary hairpins both within

143 constitutive exon 36 and alternative exon 37b (Fig. 5-1). Mutating these hairpins in the

CaV2.2 e37a/b minigene could tell us whether secondary structure modulates the inclusion of exon 37a or 37b, although it is possible that secondary and tertiary structures present in the transcribed minigene differ from those of the native channel transcript.

There are several other mechanisms of splicing regulation which have been shown to regulate splicing of alternative exons, but have yet to be investigated with regards to exons within CaV2.2. They are each potentially interesting avenues of research which should be considered when attempting to understand regulation of channel alternative splicing. I describe three especially intriguing regulators below.

Non-coding RNAs regulate alternative splicing microRNAs are short RNA sequences that bind complementarily to target RNAs to repress gene translation. microRNAs regulate alternative splicing by repressing expression of splicing factor genes, including PTB, CELF, and CUGBP (Kalsotra et al 2010;

Makeyev et al 2007). Thus microRNAs can act as master regulators of splicing factors, causing global changes in alternative splicing that underlie important developmental processes such as muscle and neuronal differentiation and postnatal heart remodeling

(Boutz et al 2007a; Boutz et al 2007b; Kalsotra et al 2010; Makeyev et al 2007).

144

Other non-coding RNAs can also regulate the splicing of alternative exons. A long non- coding RNA called MALAT-1 sequesters SR proteins in nuclear splicing speckles. MALAT-

1 downregulation results in increased alternative exon inclusion, likely by allowing splicing active dephosphorylated SR proteins to accumulate outside of the speckles

(Tripathi et al 2010). Reports also show that processed small nucleolar RNAs (psnoRNAS) can regulate alternative splicing. For example, binding of brain-specific psnoRNAs to the

5-HT2C serotonin receptor pre-mRNA results in increased inclusion of exon Vb, presumably by binding to a silencer element and preventing binding of a splicing repressor to this element (Kishore et al 2010; Kishore & Stamm 2006). The role of non- coding RNAs in the regulation of alternative calcium channel exons has yet to be examined and could be an interesting avenue of research.

Transcription-coupled alternative splicing

There is increasing evidence that transcription is coupled to alternative splicing. There are two main models for how RNA polymerase II (RNAPII) regulates splicing (Chen &

Manley 2009). The first posits that RNAPII and transcription factors interact directly or indirectly with splicing factors. Supporting this model is evidence that the transcriptional coactivator PGC-1 interacts directly with several SR proteins, and inclusion of PGC-1 in the promoter region of a fibronectin minigene regulated the inclusion of an alternative exon (Monsalve et al 2000). The second model suggests that the kinetics of transcript elongation controls efficacy of spliceosome assembly (Nogues et al 2003). Evidence for this model comes in part from experiments on the human

145

RNAPII gene. A mutation in the human RNAPII gene, shown to slow elongation time in

Drosophila, affects alternative splicing of the fibronectin and adenovirus genes (de la

Mata et al 2003). Additionally, UV-induced hyperphosphorylated RNAPII slows transcription elongation time, resulting in aberrant splicing of genes involved in apoptosis (Muñoz et al 2009). Like non-coding RNAs, it is not known how transcription time affects the alternative splicing of calcium channel genes.

Chromatin localization and histone modifications regulate alternative splicing

There is growing recognition for the roles of chromatin localization and histone modifications in the regulation of alternative exons (Luco & Misteli 2011). Nucleosomes are enriched at exons and this enrichment is less prevalent near alternative exons

(Schwartz et al 2009). Histone modifications and DNA methylation sites also cluster near exons and the decreased number of H3K36me3 (trimethylation of lysine 36 of histone H3) sites in alternative exons relative to constitutive exons may be part of what prevents these exons from being constitutively expressed (Kolasinska-Zwierz et al 2009).

Histone modifications are dynamic and can regulate the inclusion of alternative exons in response to neuronal depolarization, as is the case for an exon within in the NCAM gene

(Schor et al 2009). Histone modifications can recruit splicing factors to preRNAs by forming chromatin-splicing complexes, as is the case for many exons regulated by PTB

(Luco et al 2010). Histone modifications may also regulate splicing of alternative exons by creating nucleosome “speed bumps”. These bumps slow the speed of transcription

146 which in turn affects the inclusion of exons as mentioned above (Luco & Misteli 2011).

Epigenetic histone modifications that create chromatin-splicing complexes and nucleosome ‘speed bumps’ may be important regulators of tissue and cell type-specific splicing, as their cellular signatures can be passed on through subsequent cell divisions

(Luco et al 2011). As genome-wide, tissue-specific histone modification maps become available, it will be interesting to examine whether histone modifications play a role in the regulation of calcium channel alternative exons.

Future directions

While the experiments and results in this dissertation widen our knowledge about the regulation and function of alternative exons within voltage-gated calcium channel genes they also prompt additional questions that deserve exploration. Possible future directions are discussed below.

What are the functions of exons 24a and 31a in CaV2.1 and 2.2?

The co-regulation of exon 24a and 31a by Nova-2 in CaV2 genes is interesting for a couple of reasons. First, both Cacna1a and Cacna1b (the genes that code for CaV2.1 and

2.2, respectively) contain exons 24a and 31a, which are similarly regulated by Nova-2

(although the extent of such regulation differs between the genes): Nova-2 enhances e24a and represses e31a inclusion. CaV2.1 and 2.2 channels are functionally related— they are both presynaptic—therefore it is possible that e24a and e31a underlie similar

147 functions in these two channels. CaV2 transcripts containing e31a dominate in the peripheral nervous system, whereas channels containing e24a are expressed in the CNS.

Perhaps the reciprocal pattern of expression of e24a and e31a points to a reciprocal function, resulting in CNS- and PNS-specific isoforms for both channels. E24a and e31a are predicted to encode short (dipeptide and tetrapeptide) sequences in extracellular loops of the channels, raising the possibility that these exons are involved in binding transsynaptic proteins. Extracellular protein interactions with presynaptic CaV2 channels could be important for synapse stabilization and organization, similar to the association between calcium channels and laminin which organizes active sites in motor nerve terminals (Nishimune et al 2004). One possibility is that e24a provides a direct or indirect interaction site for the -neurexins, as there is evidence that neurexins interact with CaV2 calcium channel proteins extracellularly (Dudanova et al 2006; Missler et al

2003; Zhang et al 2005). E31a may mediate a similar interaction in the PNS, or may even disrupt such an interaction.

What is the role of retained introns within CaV2.2?

Recent work on calcium-activated big potassium channel (BKCa) mRNAs with retained introns suggest that incompletely processed mRNAs are likely to be functionally relevant

(Bell et al 2010; Bell et al 2008). A recent study showed that retained introns 18 and 31 in CaV2.2 are found in dendritic mRNA from rat hippocampal neurons (Buckley et al

2011). These introns likely contain elements that allow CaV2.2 transcripts to be targeted to dendrites. Since the spliceosome machinery and splicing factor proteins are also

148 found in dendrites (Glanzer et al 2005), it is possible that the regulation of exons 18a and 31a in the cytoplasm of dendrites may differ from the regulation of these exons in the nucleus. These retained introns may also be importation for the regulation of activity-dependent splicing (Denis et al 2005) or may include microRNAs that could regulate the entire channel transcript (Buckley et al 2011). If intron-containing CaV2.2 channel mRNAs are translated and localized to postsynaptic membranes this would suggest a new role for this class of voltage-gated ion channel.

Nova proteins are also known to play a role in shuttling transcripts from the nucleus to the cytoplasm and in dendritic targeting (Racca et al 2010). It would be interesting to see if a retained intron within CaV2.2 facilitates targeting by Nova. Could this be the purpose of the large Nova binding cluster between exons 36 and 37a? Further research is needed to explore the role of CaV2.2 intronic sequences in dendritic mRNA targeting.

Can knowledge of splicing regulation be translated into novel therapeutics?

Because alternative splicing is necessary for proper functioning of the nervous system, it follows that misregulation of alternative splicing could result in disease states. A recent study examining human genetic diseases showed that a remarkable 25% of known disease-causing nonsense and missense mutations alter splice signals within exons, generally by creating a loss of an ESE or a new ESS (Sterne-Weiler et al 2011). Indeed many genetic neurological disorders are due to aberrant splicing. These include

149 inherited frontotemporal dementia and parkinsonism (FTDP), spinal muscle atrophy, amyotrophic lateral sclerosis, and myotonic dystrophy (Dredge et al 2001). There is also evidence that splicing misregulation may play a role in more complicated pathologies of the nervous system such as the development of glioblastomas (Camacho-Vanegas et al

2007) and Alzheimer’s disease (Ishunina & Swaab 2010). In addition, the splicing of many exons is changed by cellular stressors such as chemotherapy agents and radiation

(Dutertre et al 2011). As our knowledge about the importance and regulation of alternative exons in particular diseases grows, new treatment strategies to correct the disease-causing aberrant splicing are likely to emerge. Such treatments are currently in development for spinal muscular atrophy (Hua et al 2010) and are already in clinical trials for those suffering from Duchenne muscular dystrophy (Mitrpant et al 2009).

New knowledge about the regulation of alternative CaV2.2 calcium channel exons by splicing factors may help us develop new therapeutic targets for the treatment of chronic pain. Levels of DRG CaV2.2 transcripts containing e37a are decreased after peripheral nerve injury, a common model for neuropathic pain conditions (Altier et al

2007). Because spinal morphine analgesia is weakened in the absence of e37a (Andrade et al 2010), a strategy aimed at promoting or correcting e37a inclusion in CaV2.2 during splicing may enhance the actions of morphine in chronic pain conditions.

One approach to therapeutic intervention for chronic pain is to inhibit the action of a repressor of e37a. Alternatively, a synthetic splicing factor could be engineered to

150 selectively affect splicing of e37a (Wang et al 2009). A related strategy is to use siRNAs to target sequences near the alternative exon to regulate inclusion of the exon (Allo et al 2009). microRNAs designed to knockdown a specific splice isoform might be useful in other disorders. This approach has been used to downregulate the expression of the noncardiac CaV1.2 isoform in a vascular smooth muscle cell line (Rhee et al 2009). This result has implications for the treatment of hypertension

Conclusion

Alternative splicing is a vital component of a functioning nervous system because it allows protein isoforms with specific functional properties to be expressed at specific time points, at specific locations, and/or in response to changes in neuronal activity. The cell-type specific splicing of presynaptic calcium channels is exceptionally important, as influx of calcium through these channels initiates neurotransmitter release. In this dissertation I have shown results from several projects aimed at identifying the regulators of calcium channel cell-specific alternative splicing. In these studies I have identified a previously unknown e24a in CaV2.1 as well as splicing factor proteins that regulate CaV2.2 exons 18a, 24a, and 31a and CaV2.1 exons 24a and 31a. I have also provided evidence for proteins that may regulate mutually exclusive e37a and e37b in

CaV2.2, exons which play an important role in the pain pathway. The study of splicing regulation is a burgeoning field with exciting prospects. Studies in this area help us better understand neuronal proteins and their functions and have appealing

151 implications for innovative therapeutics that could prevent or intercept misspliced proteins that cause disease.

152

Figure 5-1. Predicted hairpin secondary structures in Cacna1b exons 36 and 37b.

Cacna1b exons 36 (above) and 37b (below) from the UCSC genome browser (human

February 2009 assembly) are shown in blue. The track immediately below the UCSC gene track shows predicted hairpin structures as predicted using Evofold (Pedersen et al

2006). The dark blue track shows mammalian conservation. Nucleotide alignments of the gene from several species are shown at the bottom.

153

REFERENCES

154

Adams PJ, Garcia E, David LS, Mulatz KJ, Spacey SD, Snutch TP. 2009. Ca(V)2.1 P/Q-type calcium channel alternative splicing affects the functional impact of familial hemiplegic migraine mutations: implications for calcium channelopathies. Channels (Austin, Tex.) 3:110-21 Adams PJ, Rungta RL, Garcia E, van den Maagdenberg aMJM, MacVicar Ba, Snutch TP. 2010. Contribution of calcium-dependent facilitation to synaptic plasticity revealed by migraine mutations in the P/Q-type calcium channel. Proceedings of the National Academy of Sciences:1-6 Allen SE, Darnell RB, Lipscombe D. 2010. The neuronal splicing factor Nova controls alternative splicing in N-type and P-type CaV2 calcium channels. Channels (Austin) 4:483-9 Allo M, Buggiano V, Fededa JP, Petrillo E, Schor I, et al. 2009. Control of alternative splicing through siRNA-mediated transcriptional gene silencing. Nat Struct Mol Biol 16:717-24 Altier C, Dale CS, Kisilevsky AE, Chapman K, Castiglioni AJ, et al. 2007. Differential role of N-type calcium channel splice isoforms in pain. The Journal of neuroscience : the official journal of the Society for Neuroscience 27:6363-73 Andrade A, Denome S, Jiang Y-Q, Marangoudakis S, Lipscombe D. 2010. Opioid inhibition of N- type Ca2+ channels and spinal analgesia couple to alternative splicing. Nature neuroscience 13:1249-56 Arikkath J, Campbell KP. 2003. Auxiliary subunits: essential components of the voltage-gated calcium channel complex. Curr Opin Neurobiol 13:298-307 Asadi S, Javan M, Ahmadiani A, Sanati MH. 2009. Alternative splicing in the synaptic protein interaction site of rat Ca(v)2.2 (alpha (1B)) calcium channels: changes induced by chronic inflammatory pain. Journal of molecular neuroscience : MN 39:40-8 Ashiya M, Grabowski PJ. 1997. A neuron-specific splicing switch mediated by an array of pre- mRNA repressor sites: evidence of a regulatory role for the polypyrimidine tract binding protein and a brain-specific PTB counterpart. RNA 3:996-1015 Auweter SD, Fasan R, Reymond L, Underwood JG, Black DL, et al. 2006. Molecular basis of RNA recognition by the human alternative splicing factor Fox-1. The EMBO journal 25:163-73 Baralle D, Baralle M. 2005. Splicing in action: assessing disease causing sequence changes. Journal of medical genetics 42:737-48 Baraniak AP, Chen JR, Garcia-Blanco MA. 2006. Fox-2 mediates epithelial cell-specific fibroblast growth factor receptor 2 exon choice. Molecular and cellular biology 26:1209-22 Barnby G, Abbott A, Sykes N, Morris A, Weeks DE, et al. 2005. Candidate-gene screening and association analysis at the autism-susceptibility locus on chromosome 16p: evidence of association at GRIN2A and ABAT. American journal of human genetics 76:950-66 Bean BP. 1989. Neurotransmitter inhibition of neuronal calcium currents by changes in channel voltage dependence. Nature 340:153-6 Bell TJ, Miyashiro KY, Sul JY, Buckley PT, Lee MT, et al. 2010. Intron retention facilitates splice variant diversity in calcium-activated big potassium channel populations. Proc Natl Acad Sci U S A 107:21152-7 Bell TJ, Miyashiro KY, Sul JY, McCullough R, Buckley PT, et al. 2008. Cytoplasmic BK(Ca) channel intron-containing mRNAs contribute to the intrinsic excitability of hippocampal neurons. Proc Natl Acad Sci U S A 105:1901-6 Bell TJ, Thaler C, Castiglioni AJ, Helton TD, Lipscombe D. 2004. Cell-specific alternative splicing increases calcium channel current density in the pain pathway. Neuron 41:127-38 Bernheim L, Beech DJ, Hille B. 1991. A diffusible second messenger mediates one of the pathways coupling receptors to calcium channels in rat sympathetic neurons. Neuron 6:859-67

155

Bezprozvanny I, Scheller RH, Tsien RW. 1995. Functional impact of syntaxin on gating of N-type and Q-type calcium channels. Nature 378:623-6 Bhalla K, Phillips HA, Crawford J, McKenzie OL, Mulley JC, et al. 2004. The de novo chromosome 16 translocations of two patients with abnormal phenotypes (mental retardation and epilepsy) disrupt the A2BP1 gene, J. Hum. Genet. 49:308-11 Black DL. 2003. Mechanisms of alternative pre-messenger RNA splicing. Annual review of biochemistry 72:291-336 Boehm S, Kubista H. 2002. Fine Tuning of Sympathetic Transmitter Release via Ionotropic and Metabotropic Presynaptic Receptors. Pharmacological Reviews 54:43-99 Bourinet E, Soong TW, Stea A, Snutch TP. 1996. Determinants of the G protein-dependent opioid modulation of neuronal calcium channels. Proceedings of the National Academy of Sciences of the United States of America 93:1486-91 Bourinet E, Soong TW, Sutton K, Slaymaker S, Mathews E, et al. 1999. Splicing of alpha 1A subunit gene generates phenotypic variants of P- and Q-type calcium channels. Nature neuroscience 2:407-15 Boutz PL, Chawla G, Stoilov P, Black DL. 2007a. MicroRNAs regulate the expression of the alternative splicing factor nPTB during muscle development. Genes Dev 21:71-84 Boutz PL, Stoilov P, Li Q, Lin C-H, Chawla G, et al. 2007b. A post-transcriptional regulatory switch in polypyrimidine tract-binding proteins reprograms alternative splicing in developing neurons. Gene Dev 21:1636-52 Bronstein NB, Kishore R, Ismail Z, Zhang Q, Taylor T, Newman SA. 2003. cDNA cloning and spatiotemporal expression during avian embryogenesis of hnRNP A1, a regulatory factor in alternative splicing. Gene Expr Patterns 3:285-95 Brudno M, Gelfand MS, Spengler S, Zorn M, Dubchak I, Conboy JG. 2001. Computational analysis of candidate intron regulatory elements for tissue-specific alternative pre-mRNA splicing. Nucleic Acids Res 29:2338-48 Buckanovich RJ, Posner JB, Darnell RB. 1993. Nova, the paraneoplastic Ri antigen, is homologous to an RNA-binding protein and is specifically expressed in the developing motor system. Neuron 11:657-72 Buckley PT, Lee MT, Sul JY, Miyashiro KY, Bell TJ, et al. 2011. Cytoplasmic intron sequence- retaining transcripts can be dendritically targeted via ID element retrotransposons. Neuron 69:877-84 Buratti E, Baralle FE. 2004. Influence of RNA secondary structure on the pre-mRNA splicing process. Mol Cell Biol 24:10505-14 Cáceres JF, Kornblihtt AR. 2002. Alternative splicing: multiple control mechanisms and involvement in human disease. Trends in genetics : TIG 18:186-93 Cahill AL, Hurley JH, Fox AP. 2000. Coexpression of cloned alpha(1B), beta(2a), and alpha(2)/delta subunits produces non-inactivating calcium currents similar to those found in bovine chromaffin cells. The Journal of neuroscience : the official journal of the Society for Neuroscience 20:1685-93 Calarco JA, Superina S, O’hanlon D, Gabut M, Raj B, et al. 2009. Regulation of vertebrate nervous system alternative splicing and development by an SR-related protein. Cell 138:898-910 Camacho-Vanegas O, Narla G, Teixeira MS, DiFeo A, Misra A, et al. 2007. Functional inactivation of the KLF6 tumor suppressor gene by loss of heterozygosity and increased alternative splicing in glioblastoma. Int J Cancer 121:1390-5 Caputi M, Mayeda a, Krainer aR, Zahler aM. 1999. hnRNP A/B proteins are required for inhibition of HIV-1 pre-mRNA splicing. The EMBO journal 18:4060-7

156

Cartegni L, Wang J, Zhu Z, Zhang MQ, Krainer AR. 2003. ESEfinder: A web resource to identify exonic splicing enhancers. Nucleic Acids Res 31:3568-71 Castiglioni AJ, Raingo J, Lipscombe D. 2006. Alternative splicing in the C-terminus of CaV2.2 controls expression and gating of N-type calcium channels. The Journal of physiology 576:119-34 Castle JC, Zhang C, Shah JK, Kulkarni AV, Kalsotra A, et al. 2008. Expression of 24,426 human alternative splicing events and predicted cis regulation in 48 tissues and cell lines. Nat Genet 40:1416-25 Catterall WA, Few AP. 2008. Calcium Channel Regulation and Presynaptic Plasticity. Neuron 59:882-901 Chan AW, Khanna R, Li Q, Stanley EF. 2007. Munc18: A Presynaptic Transmitter Release Site N type (CaV2.2) Calcium Channel Interacting Protein. Channels 1:11-20 Chang SY, Yong TF, Yu CY, Liang MC, Pletnikova O, et al. 2007. Age and gender-dependent alternative splicing of P/Q-type calcium channel EF-hand. Neuroscience 145:1026-36 Chaudhuri D, Chang S-Y, DeMaria CD, Alvania RS, Soong TW, Yue DT. 2004. Alternative Splicing as a Molecular Switch for Ca2+/Calmodulin-Dependent Facilitation of P/Q-Type Ca2+ Channels. J. Neurosci. 24:6334-42 Cheah MT, Wachter A, Sudarsan N, Breaker RR. 2007. Control of alternative RNA splicing and gene expression by eukaryotic riboswitches. Nature 447:497-500 Chen M, Manley JL. 2009. Mechanisms of alternative splicing regulation: insights from molecular and genomics approaches. Nature reviews. Molecular cell biology 10:741-54 Cheung HC, Baggerly Ka, Tsavachidis S, Bachinski LL, Neubauer VL, et al. 2008. Global analysis of aberrant pre-mRNA splicing in glioblastoma using exon expression arrays. BMC genomics 9:216- Chi SW, Zang JB, Mele A, Darnell RB. 2009. Argonaute HITS-CLIP decodes microRNA-mRNA interaction maps. Nature 460:479-86 Coppola T, Waldmann R, Borsotto M, Heurteaux C, Romey G, et al. 1994. Molecular cloning of a murine N-type calcium channel alpha 1 subunit. Evidence for isoforms, brain distribution, and chromosomal localization. FEBS letters 338:1-5 Coutinho-Mansfield GC, Xue Y, Zhang Y, Fu XD. 2007. PTB/nPTB switch: a post-transcriptional mechanism for programming neuronal differentiation. Genes Dev 21:1573-7 Currie KP, Fox AP. 1997. Comparison of N- and P/Q-type voltage-gated calcium channel current inhibition. J Neurosci 17:4570-9 Damianov A, Black DL. 2010. Autoregulation of Fox protein expression to produce dominant negative splicing factors. RNA 16:405-16 de la Mata M, Alonso CR, Kadener S, Fededa JP, Blaustein M, et al. 2003. A slow RNA polymerase II affects alternative splicing in vivo. Mol Cell 12:525-32 Del Gatto-Konczak F, Olive M, Gesnel MC, Breathnach R. 1999. hnRNP A1 recruited to an exon in vivo can function as an exon splicing silencer. Mol Cell Biol 19:251-60 Delmas P, Coste B, Gamper N, Shapiro MS. 2005. Phosphoinositide lipid second messengers: new paradigms for calcium channel modulation. Neuron 47:179-82 Denis MM, Tolley ND, Bunting M, Schwertz H, Jiang HM, et al. 2005. Escaping the nuclear confines: Signal-dependent Pre-mRNA splicing in anucleate platelets. Cell 122:379-91 Denisov S, Gelfand MS. 2003. Conservedness of the Alternative Splicing Signal UGCAUG in the Human and Mouse Genomes. Biophysics 48:S30-S5 Diversé-Pierluissi M, Goldsmith PK, Dunlap K. 1995. Transmitter-mediated inhibition of N-type calcium channels in sensory neurons involves multiple GTP-binding proteins and subunits. Neuron 14:191-200

157

Diverse-Pierluissi M, Remmers AE, Neubig RR, Dunlap K. 1997. Novel form of crosstalk between G protein and tyrosine kinase pathways. Proc Natl Acad Sci U S A 94:5417-21 Dredge BK, Darnell RB. 2003. Nova regulates GABA(A) receptor gamma2 alternative splicing via a distal downstream UCAU-rich intronic splicing enhancer. Mol Cell Biol 23:4687-700 Dredge BK, Jensen KB. 2011. NeuN/Rbfox3 Nuclear and Cytoplasmic Isoforms Differentially Regulate Alternative Splicing and Nonsense-Mediated Decay of Rbfox2. PLoS One 6:e21585 Dredge BK, Polydorides aD, Darnell RB. 2001. The splice of life: alternative splicing and neurological disease. Nature reviews. Neuroscience 2:43-50 Dresviannikov A, Page K, Leroy J, Pratt W, Dolphin A. 2009. Determinants of the voltage dependence of G protein modulation within calcium channel β subunits. Pflügers Archiv European Journal of Physiology 457:743-56 Dudanova I, Sedej S, Ahmad M, Masius H, Sargsyan V, et al. 2006. Important contribution of alpha-neurexins to Ca2+-triggered exocytosis of secretory granules. The Journal of neuroscience : the official journal of the Society for Neuroscience 26:10599-613 Dunlap K, Luebke JI, Turner TJ. 1995. Exocytotic Ca2+ channels in mammalian central neurons. Trends Neurosci 18:89-98 Dutertre M, Sanchez G, Barbier J, Corcos L, Auboeuf D. 2011. The emerging role of pre- messenger RNA splicing in stress responses: Sending alternative messages and silent messengers. RNA Biol 8 Edvinsson L, Uddman R. 2005. Neurobiology in primary headaches. Brain Research Reviews 48:438-56 Ehrlich I, Elmslie KS. 1995. Neurotransmitters acting via different G proteins inhibit N-type calcium current by an identical mechanism in rat sympathetic neurons. Journal of neurophysiology 74:2251-7 Elia J, Gai X, Xie HM, Perin JC, Geiger E, et al. 2010. Rare structural variants found in attention- deficit hyperactivity disorder are preferentially associated with neurodevelopmental genes. Mol Psychiatry 15:637-46 Elmslie KS. 2003. Neurotransmitter Modulation of Neuronal Calcium Channels. Journal of Bioenergetics and Biomembranes 35:477-89 Eunson LH, Graves TD, Hanna MG. 2005. New calcium channel mutations predict aberrant RNA splicing in episodic ataxia. Neurology 65:308-10 Fagnani M, Barash Y, Ip JY, Misquitta C, Pan Q, et al. 2007. Functional coordination of alternative splicing in the mammalian central nervous system. Genome Biol 8:R108 Fairbrother WG, Lipscombe D. 2008. Repressing the neuron within. Bioessays 30:1-4 Fairbrother WG, Yeh R-F, Sharp Pa, Burge CB. 2002. Predictive identification of exonic splicing enhancers in human genes. Science (New York, N.Y.) 297:1007-13 Fairbrother WG, Yeo GW, Yeh R, Goldstein P, Mawson M, et al. 2004. RESCUE-ESE identifies candidate exonic splicing enhancers in vertebrate exons. Nucleic acids research 32:W187-90 Faustino NA, Cooper TA. 2003. Pre-mRNA splicing and human disease. Genes Dev. 17:419-37 Feng Y, Chen M, Manley JL. 2008. Phosphorylation switches the general splicing repressor SRp38 to a sequence-specific activator. Nature structural & molecular biology 15:1040-8 Fletcher CF, Okano HJ, Gilbert DJ, Yang Y, Yang C, et al. 1997. Mouse chromosomal locations of nine genes encoding homologs of human paraneoplastic neurologic disorder antigens. Genomics 45:313-9 Gehman LT, Stoilov P, Maguire J, Damianov A, Lin CH, et al. 2011. The splicing regulator Rbfox1 (A2BP1) controls neuronal excitation in the mammalian brain. Nat Genet

158

Ghasemzadeh MB, Pierce RC, Kalivas PW. 1999. The monoamine neurons of the rat brain preferentially express a splice variant of alpha1B subunit of the N-type calcium channel. Journal of neurochemistry 73:1718-23 Glanzer J, Miyashiro KY, Sul JY, Barrett L, Belt B, et al. 2005. RNA splicing capability of live neuronal dendrites. Proceedings of the National Academy of Sciences of the United States of America 102:16859-64 Goren A, Ram O, Amit M, Keren H, Lev-Maor G, et al. 2006. Comparative analysis identifies exonic splicing regulatory sequences--The complex definition of enhancers and silencers. Mol Cell 22:769-81 Grabowski PJ, Black DL. 2001. Alternative RNA splicing in the nervous system. Progress in neurobiology 65:289-308 Graf R, Mattera R, Codina J, Evans T, Ho Y-K, et al. 1992. Studies on the interaction of α subunits of GTP-binding proteins with βγ dimers. European Journal of Biochemistry 210:609-19 Graveley BR. 2000. Sorting out the complexity of SR protein functions. Rna 6:1197-211 Graveley BR. 2005. Mutually exclusive splicing of the insect Dscam pre-mRNA directed by competing intronic RNA secondary structures. Cell 123:65-73 Graveley BR, Hertel KJ, Maniatis T. 2001. The role of U2AF35 and U2AF65 in enhancer- dependent splicing. RNA 7:806-18 Graves TD, Imbrici P, Kors EE, Terwindt GM, Eunson LH, et al. 2008. Premature stop codons in a facilitating EF-hand splice variant of CaV2.1 cause episodic ataxia type 2. Neurobiology of Disease 32:10-5 Gray AC, Raingo J, Lipscombe D. 2007. Neuronal calcium channels: splicing for optimal performance. Cell calcium 42:409-17 Halling DB, Aracena-Parks P, Hamilton SL. 2006. Regulation of voltage-gated Ca2+ channels by calmodulin. Sci STKE 2006:er1 Han J, Ding JH, Byeon CW, Kim JH, Hertel KJ, et al. 2011. SR proteins induce alternative exon skipping through their activities on the flanking constitutive exons. Mol Cell Biol 31:793- 802 Han K, Yeo G, An P, Burge CB, Grabowski PJ. 2005. A combinatorial code for splicing silencing: UAGG and GGGG motifs. PLoS Biol 3:e158 Hanamura A, Caceres JF, Mayeda A, Franza BR, Jr., Krainer AR. 1998. Regulated tissue-specific expression of antagonistic pre-mRNA splicing factors. RNA 4:430-44 Hans M, Urrutia A, Deal C, Brust PF, Stauderman K, et al. 1999. Structural Elements in Domain IV that Influence Biophysical and Pharmacological Properties of Human [alpha]1A- Containing High-Voltage-Activated Calcium Channels. Biophysical Journal 76:1384-400 Harsing LG, Jr., Sershen H, Vizi SE, Lajtha A. 1992. N-type calcium channels are involved in the dopamine releasing effect of nicotine. Neurochem Res 17:729-34 Heneghan JF, Mitra-Ganguli T, Stanish LF, Liu L, Zhao R, Rittenhouse AR. 2009. The Ca2+ channel Î² subunit determines whether stimulation of Gq-coupled receptors enhances or inhibits N current. The Journal of General Physiology 134:369-84 Herlitze S, Garcia DE, Mackie K, Hille B, Scheuer T, Catterall WA. 1996. Modulation of Ca2+ channels by G-protein beta gamma subunits. Nature 380:258-62 Hermans E. 2003. Biochemical and pharmacological control of the multiplicity of coupling at G- protein-coupled receptors. Pharmacology & Therapeutics 99:25-44 Hertel KJ. 2008. Combinatorial control of exon recognition. J. Biol. Chem. 283:1211-5 Heximer SP, Watson N, Linder ME, Blumer KJ, Hepler JR. 1997. RGS2/G0S8 is a selective inhibitor of Gqalpha function. Proceedings of the National Academy of Sciences of the United States of America 94:14389-93

159

Heyd F, Lynch KW. 2011. DEGRADE, MOVE, REGROUP: signaling control of splicing proteins. Trends Biochem Sci Hicks MJ, Lam BJ, Hertel KJ. 2005. Analyzing mechanisms of alternative pre-mRNA splicing using in vitro splicing assays. Methods 37:306 Hirning LD, Fox AP, McCleskey EW, Olivera BM, Thayer SA, et al. 1988. Dominant role of N-type Ca2+ channels in evoked release of norepinephrine from sympathetic neurons. Science 239:57-61 Hodgkin J, Zellan JD, Albertson DG. 1994. Identification of a candidate primary sex determination locus, fox-1, on the X chromosome of Caenorhabditis elegans. Development 120:3681-9 Holz GGt, Dunlap K, Kream RM. 1988. Characterization of the electrically evoked release of substance P from dorsal root ganglion neurons: methods and dihydropyridine sensitivity. J Neurosci 8:463-71 Holz GGt, Kream RM, Spiegel A, Dunlap K. 1989. G proteins couple alpha-adrenergic and GABAb receptors to inhibition of peptide secretion from peripheral sensory neurons. J Neurosci 9:657-66 Hua Y, Sahashi K, Hung G, Rigo F, Passini MA, et al. 2010. Antisense correction of SMN2 splicing in the CNS rescues necrosis in a type III SMA mouse model. Genes Dev 24:1634-44 Ikeda SR. 1996. Voltage-dependent modulation of N-type calcium channels by G-protein beta gamma subunits. Nature 380:255-8 Ikeda SR, Dunlap K. 1999. Voltage-dependent modulation of N-type calcium channels: role of G protein subunits. Advances in Second Messenger and Phosphoprotein Research 22:133- 51 Ikeda SR, Dunlap K. 2007. Calcium channels diversify their signaling portfolio. Nature neuroscience 10:269-71 Ishunina TA, Swaab DF. 2010. Decreased alternative splicing of estrogen receptor-alpha mRNA in the Alzheimer's disease brain. Neurobiol Aging Isken O, Maquat LE. 2007. Quality control of eukaryotic mRNA: safeguarding cells from abnormal mRNA function. Genes Dev 21:1833-56 Jarvis SE, Magga JM, Beedle AM, Braun JEA, Zamponi GW. 2000. G Protein Modulation of N-type Calcium Channels Is Facilitated by Physical Interactions between Syntaxin 1A and GÎ²Î³. Journal of Biological Chemistry 275:6388-94 Jelen N, Ule J, Zivin M, Darnell RB. 2007. Evolution of Nova-dependent splicing regulation in the brain. PLoS genetics 3:1838-47 Jensen KB, Dredge BK, Stefani G, Zhong R, Buckanovich RJ, et al. 2000a. Nova-1 regulates neuron-specific alternative splicing and is essential for neuronal viability. Neuron 25:359-71 Jensen KB, Musunuru K, Lewis HA, Burley SK, Darnell RB. 2000b. The tetranucleotide UCAY directs the specific recognition of RNA by the Nova K-homology 3 domain. Proceedings of the National Academy of Sciences of the United States of America 97:5740-5 Jeong S-W, Ikeda SR. 1999. Sequestration of G-Protein beta gamma Subunits by Different G- Protein alpha Subunits Blocks Voltage-Dependent Modulation of Ca2+ Channels in Rat Sympathetic Neurons. J. Neurosci. 19:4755-61 Jeong S-W, Ikeda SR. 2000a. Effect of G protein heterotrimer composition on coupling of neurotransmitter receptors to N-type Ca2+ channel modulation in sympathetic neurons. Proceedings of the National Academy of Sciences 97:907-12

160

Jeong SW, Ikeda SR. 2000b. Endogenous regulator of G-protein signaling proteins modify N-type calcium channel modulation in rat sympathetic neurons. The Journal of neuroscience : the official journal of the Society for Neuroscience 20:4489-96 Jiang ZH, Zhang WJ, Rao Y, Wu JY. 1998. Regulation of Ich-1 pre-mRNA alternative splicing and apoptosis by mammalian splicing factors. Proc Natl Acad Sci U S A 95:9155-60 Jiménez C, Bourinet E, Leuranguer V, Richard S, Snutch TP, Nargeot J. 2000. Determinants of voltage-dependent inactivation affect Mibefradil block of calcium channels. Neuropharmacology 39:1-10 Jin Y, Suzuki H, Maegawa S, Endo H, Sugano S, et al. 2003. A vertebrate RNA-binding protein Fox- 1 regulates tissue-specific splicing via the pentanucleotide GCAUG. The EMBO journal 22:905-12 Jumaa H, Wei G, Nielsen PJ. 1999. Blastocyst formation is blocked in mouse embryos lacking the splicing factor SRp20. Curr Biol 9:899-902 Jurica MS, Moore MJ. 2003. Pre-mRNA splicing: awash in a sea of proteins. Molecular cell 12:5- 14 Kalsotra A, Wang K, Li PF, Cooper TA. 2010. MicroRNAs coordinate an alternative splicing network during mouse postnatal heart development. Gene Dev 24:653-8 Kamma H, Horiguchi H, Wan L, Matsui M, Fujiwara M, et al. 1999. Molecular characterization of the hnRNP A2/B1 proteins: tissue-specific expression and novel isoforms. Exp Cell Res 246:399-411 Kammermeier PJ, Ikeda SR. 1999. Expression of RGS2 alters the coupling of metabotropic glutamate receptor 1a to M-type K+ and N-type Ca2+ channels. Neuron 22:819-29 Kammermeier PJ, Ruiz-Velasco V, Ikeda SR. 2000. A Voltage-Independent Calcium Current Inhibitory Pathway Activated by Muscarinic Agonists in Rat Sympathetic Neurons Requires Both Galpha q/11 and Gbeta gamma. Journal of Neuroscience 20:5623-9 Kaneko S, Cooper CB, Nishioka N, Yamasaki H, Suzuki A, et al. 2002. Identification and characterization of novel human Ca(v)2.2 (alpha 1B) calcium channel variants lacking the synaptic protein interaction site. The Journal of neuroscience : the official journal of the Society for Neuroscience 22:82-92 Kanumilli S, Tringham EW, Payne CE, Dupere JRB, Venkateswarlu K, Usowicz MM. 2006. Alternative splicing generates a smaller assortment of CaV2.1 transcripts in cerebellar Purkinje cells than in the cerebellum. Physiological genomics 24:86-96 Katz B. 1969. The Release of Neural Transmitter Substances. Liverpoll: Liverpool Univ. Press Katz B, Miledi R. 1967. The timing of calcium action during neuromuscular transmission. J Physiol 189:535-44 Kim KK, Adelstein RS, Kawamoto S. 2009. Identification of Neuronal Nuclei (NeuN) as Fox-3, a New Member of the Fox-1 Gene Family of Splicing Factors * □. Journal of Biological Chemistry 284:31052-61 Kim KK, Kim YC, Adelstein RS, Kawamoto S. 2010. Fox-3 and PSF interact to activate neural cell- specific alternative splicing. Nucleic Acids Res Kishore S, Khanna A, Zhang Z, Hui J, Balwierz PJ, et al. 2010. The snoRNA MBII-52 (SNORD 115) is processed into smaller RNAs and regulates alternative splicing. Hum Mol Genet 19:1153- 64 Kishore S, Stamm S. 2006. The snoRNA HBII-52 regulates alternative splicing of the serotonin receptor 2C. Science 311:230-2 Kolasinska-Zwierz P, Down T, Latorre I, Liu T, Liu XS, Ahringer J. 2009. Differential chromatin marking of introns and expressed exons by H3K36me3. Nat Genet 41:376-81

161

Kramer A. 1996. The structure and function of proteins involved in mammalian pre-mRNA splicing. Annu Rev Biochem 65:367-409 Kuo CC, Bean BP. 1993. G-protein modulation of ion permeation through N-type calcium channels. Nature 365:258-62 Kuroyanagi H, Kobayashi T, Mitani S, Hagiwara M. 2006. Transgenic alternative-splicing reporters reveal tissue-specific expression profiles and regulation mechanisms in vivo. Nat Methods 3:909-15 Kuroyanagi H, Ohno G, Mitani S, Hagiwara M. 2007. The Fox-1 family and SUP-12 coordinately regulate tissue-specific alternative splicing in vivo. Molecular and cellular biology 27:8612-21 Ladd AN, Charlet N, Cooper TA. 2001. The CELF family of RNA binding proteins is implicated in cell-specific and developmentally regulated alternative splicing. Mol Cell Biol 21:1285-96 Ladd AN, Cooper TA. 2002. Finding signals that regulate alternative splicing in the post-genomic era. Genome Biol 3:reviews0008 Le Hir H, Seraphin B. 2008. EJCs at the heart of translational control. Cell 133:213-6 Lee J-A, Tang Z-Z, Black DL. 2009. An inducible change in Fox-1/A2BP1 splicing modulates the alternative splicing of downstream neuronal target exons. Gene Dev 23:2284-93 Lewis BP, Green RE, Brenner SE. 2003. Evidence for the widespread coupling of alternative splicing and nonsense-mediated mRNA decay in humans. Proc Natl Acad Sci U S A 100:189-92 Li Q, Lee J-A, Black DL. 2007. Neuronal regulation of alternative pre-mRNA splicing. Nature reviews. Neuroscience 8:819-31 Liao P, Zhang HY, Soong TW. 2009. Alternative splicing of voltage-gated calcium channels: from molecular biology to disease. Pflügers Archiv : European journal of physiology 458:481-7 Licatalosi DD, Darnell RB. 2010. RNA processing and its regulation: global insights into biological networks. Nature reviews. Genetics 11:75-87 Licatalosi DD, Mele A, Fak JJ, Ule J, Kayikci M, et al. 2008. HITS-CLIP yields genome-wide insights into brain alternative RNA processing. Nature 456:464-9 Lin Y, McDonough SI, Lipscombe D. 2004. Alternative splicing in the voltage-sensing region of N- Type CaV2.2 channels modulates channel kinetics. Journal of neurophysiology 92:2820- 30 Lin Z, Harris C, Lipscombe D. 1996. The molecular identity of Ca channel alpha 1-subunits expressed in rat sympathetic neurons. Journal of Molecular Neuroscience 7:257-67 Lin Z, Haus S, Edgerton J, Lipscombe D. 1997. Identification of functionally distinct isoforms of the N-type Ca2+ channel in rat sympathetic ganglia and brain. Neuron 18:153-66 Lin Z, Lin Y, Schorge S, Pan JQ, Beierlein M, Lipscombe D. 1999. Alternative splicing of a short cassette exon in alpha1B generates functionally distinct N-type calcium channels in central and peripheral neurons. The Journal of neuroscience : the official journal of the Society for Neuroscience 19:5322-31 Lipscombe D. 2005. Neuronal proteins custom designed by alternative splicing. Current opinion in neurobiology 15:358-63 Lipscombe D, Allen SE, Gray AC, Marangoudakis S, Raingo J. 2008. Alternative Splicing of Neuronal Cav2 Calcium Channels. In Structure, Function, and Modulation of Neuronal Voltage Gated Ion Channels ed. VK Gribkoff, LK Kaczmarek. Hoboken, NJ, USA: John Wiley & Sons Lipscombe D, Castiglioni A. 2004. Alternative splicing in voltage gated calcium channels: Kulwer Academic/Plenum Publishers. 369-409 pp.

162

Lipscombe D, Kongsamut S, Tsien RW. 1989. Alpha-adrenergic inhibition of sympathetic neurotransmitter release mediated by modulation of N-type calcium-channel gating. Nature 340:639-42 Lipscombe D, Pan JQ, Gray AC. 2002. Functional diversity in neuronal voltage-gated calcium channels by alternative splicing of Ca(v)alpha1. Molecular neurobiology 26:21-44 Lipscombe D, Raingo J. 2007. Alternative splicing matters: N-type calcium channels in nociceptors. Channels (Austin, Tex.) 1:225-7 Lisbin MJ, Qiu J, White K. 2001. The neuron-specific RNA-binding protein ELAV regulates neuroglian alternative splicing in neurons and binds directly to its pre-mRNA. Genes Dev 15:2546-61 Liu HX, Zhang M, Krainer AR. 1998. Identification of functional exonic splicing enhancer motifs recognized by individual SR proteins. Genes Dev 12:1998-2012 Long JC, Caceres JF. 2009. The SR protein family of splicing factors: master regulators of gene expression. The Biochemical journal 417:15-27 Loya CM, Van Vactor D, Fulga TA. 2010. Understanding neuronal connectivity through the post- transcriptional toolkit. Genes Dev 24:625-35 Luco RF, Allo M, Schor IE, Kornblihtt AR, Misteli T. 2011. Epigenetics in alternative pre-mRNA splicing. Cell 144:16-26 Luco RF, Misteli T. 2011. More than a splicing code: integrating the role of RNA, chromatin and non-coding RNA in alternative splicing regulation. Curr Opin Genet Dev Luco RF, Pan Q, Tominaga K, Blencowe BJ, Pereira-smith OM, et al. 2010. Regulation of Alternative Splicing by Histone Modifications. Genes to Cells Luebke JI, Dunlap K. 1994. Sensory neuron N-type calcium currents are inhibited by both voltage-dependent and -independent mechanisms. Pflugers Arch 428:499-507 Makeyev EV, Zhang J, Carrasco Ma, Maniatis T. 2007. The MicroRNA miR-124 promotes neuronal differentiation by triggering brain-specific alternative pre-mRNA splicing. Molecular cell 27:435-48 Maniatis T, Tasic B. 2002. Alternative pre-mRNA splicing and proteome expansion in metazoans. Nature 418:236-43 Martin CL, Duvall JA, Ilkin Y, Simon JS, Arreaza MG, et al. 2007. Cytogenetic and molecular characterization of A2BP1/FOX1 as a candidate gene for autism. Am J Med Genet B Neuropsychiatr Genet 144B:869-76 Martinez-Contreras R, Fisette JF, Nasim FU, Madden R, Cordeau M, Chabot B. 2006. Intronic binding sites for hnRNP A/B and hnRNP F/H proteins stimulate pre-mRNA splicing. PLoS Biol 4:e21 Mauger DM, Lin C, Garcia-Blanco Ma. 2008. hnRNP H and hnRNP F complex with Fox2 to silence fibroblast growth factor receptor 2 exon IIIc. Molecular and cellular biology 28:5403-19 McGlincy NJ, Smith CW. 2008. Alternative splicing resulting in nonsense-mediated mRNA decay: what is the meaning of nonsense? Trends Biochem Sci 33:385-93 McManus CJ, Graveley BR. 2011. RNA structure and the mechanisms of alternative splicing. Curr Opin Genet Dev Mende Y, Jakubik M, Riessland M, Schoenen F, Rossbach K, et al. 2010. Deficiency of the splicing factor Sfrs10 results in early embryonic lethality in mice and has no impact on full-length SMN/Smn splicing. Hum Mol Genet 19:2154-67 Min H, Chan RC, Black DL. 1995. The generally expressed hnRNP F is involved in a neural-specific pre-mRNA splicing event. Genes Dev 9:2659-71 Min H, Turck CW, Nikolic JM, Black DL. 1997. A new regulatory protein, KSRP, mediates exon inclusion through an intronic splicing enhancer. Genes Dev 11:1023-36

163

Minovitsky S, Gee SL, Schokrpur S, Dubchak I, Conboy JG. 2005. The splicing regulatory element, UGCAUG, is phylogenetically and spatially conserved in introns that flank tissue-specific alternative exons. Nucleic Acids Res. 33:714-24 Missler M, Zhang W, Rohlmann A, Kattenstroth G, Hammer RE, et al. 2003. Alpha-neurexins couple Ca2+ channels to synaptic vesicle exocytosis. Nature 423:939-48 Mitrpant C, Fletcher S, Wilton SD. 2009. Personalised genetic intervention for Duchenne muscular dystrophy: antisense oligomers and exon skipping. Curr Mol Pharmacol 2:110- 21 Monsalve M, Wu Z, Adelmant G, Puigserver P, Fan M, Spiegelman BM. 2000. Direct coupling of transcription and mRNA processing through the thermogenic coactivator PGC-1. Mol Cell 6:307-16 Muñoz MJ, Soledad M, Paronetto MP, de la Mata M, Pelisch F, et al. 2009. DNA damage regulates alternative splicing through inhibition of RNA polymerase II elongation. Cell 137:708-20 Nakahata S, Kawamoto S. 2005. Tissue-dependent isoforms of mammalian Fox-1 homologs are associated with tissue-specific splicing activities. Nucleic Acids Res 33:2078-89 Newman EA, Muh SJ, Hovhannisyan RH, Warzecha CC, Jones RB, et al. 2006. Identification of RNA-binding proteins that regulate FGFR2 splicing through the use of sensitive and specific dual color fluorescence minigene assays. Rna 12:1129-41 Nilsen TW, Graveley BR. 2010. Expansion of the eukaryotic proteome by alternative splicing. Nature 463 Nishimune H, Sanes JR, Carlson SS. 2004. A synaptic laminin-calcium channel interaction organizes active zones in motor nerve terminals. Nature 432:580-7 Nogues G, Kadener S, Cramer P, de la Mata M, Fededa JP, et al. 2003. Control of alternative pre- mRNA splicing by RNA Pol II elongation: faster is not always better. IUBMB Life 55:235- 41 Olivera BM, Gray WR, Zeikus R, McIntosh JM, Varga J, et al. 1985. Peptide neurotoxins from fish- hunting cone snails. Science 230:1338-43 Olson S, Blanchette M, Park J, Savva Y, Yeo GW, et al. 2007. A regulator of Dscam mutually exclusive splicing fidelity. Nature Structural & Molecular Biology 14:1134-40 Pan JQ, Lipscombe D. 2000. Alternative splicing in the cytoplasmic II-III loop of the N-type Ca channel alpha 1B subunit: functional differences are beta subunit-specific. The Journal of neuroscience : the official journal of the Society for Neuroscience 20:4769-75 Pan Z, Selyanko AA, Hadley JK, Brown DA, Dixon JE, McKinnon D. 2001. Alternative splicing of KCNQ2 potassium channel transcripts contributes to the functional diversity of M- currents. J Physiol 531:347-58 Park D, Dunlap K. 1998. Dynamic Regulation of Calcium Influx by G-Proteins, Action Potential Waveform, and Neuronal Firing Frequency. J. Neurosci. 18:6757-66 Park JW, Graveley BR. 2005. Use of RNA interference to dissect the roles of trans-acting factors in alternative pre-mRNA splicing. Methods 37:341 Park JW, Parisky K, Celotto AM, Reenan RA, Graveley BR. 2004. Identification of alternative splicing regulators by RNA interference in Drosophila. Proc Natl Acad Sci U S A 101:15974-9 Paz I, Akerman M, Dror I, Kosti I, Mandel-Gutfreund Y. 2010. SFmap: a web server for motif analysis and prediction of splicing factor binding sites. Nucleic acids research:1-5 Pedersen JS, Bejerano G, Siepel A, Rosenbloom K, Lindblad-Toh K, et al. 2006. Identification and classification of conserved RNA secondary structures in the human genome. PLoS Comput Biol 2:e33

164

Pereverzev A, Leroy J, Krieger A, Malecot CO, Hescheler J, et al. 2002. Alternate splicing in the cytosolic II-III loop and the carboxy terminus of human E-type voltage-gated Ca(2+) channels: electrophysiological characterization of isoforms, Mol. Cell. Neurosci. 21:352- 65 Perez I, Lin CH, McAfee JG, Patton JG. 1997. Mutation of PTB binding sites causes misregulation of alternative 3' splice site selection in vivo. Rna 3:764-78 Polydorides AD, Okano HJ, Yang YY, Stefani G, Darnell RB. 2000. A brain-enriched polypyrimidine tract-binding protein antagonizes the ability of Nova to regulate neuron-specific alternative splicing. Proc Natl Acad Sci U S A 97:6350-5 Ponthier JL, Schluepen C, Chen W, Lersch RA, Gee SL, et al. 2006. Fox-2 splicing factor binds to a conserved intron motif to promote inclusion of protein 4.1R alternative exon 16. The Journal of biological chemistry 281:12468-74 Racca C, Gardiol A, Eom T, Ule J, Triller A, Darnell RB. 2010. The Neuronal Splicing Factor Nova Co-Localizes with Target RNAs in the Dendrite. Frontiers in neural circuits 4:5- Raingo J, Castiglioni AJ, Lipscombe D. 2007. Alternative splicing controls G protein-dependent inhibition of N-type calcium channels in nociceptors. Nature neuroscience 10:285-92 Reed R. 1996. Initial splice-site recognition and pairing during pre-mRNA splicing. Curr Opin Genet Dev 6:215-20 Rettig J, Sheng ZH, Kim DK, Hodson CD, Snutch TP, Catterall WA. 1996. Isoform-specific interaction of the alpha1A subunits of brain Ca2+ channels with the presynaptic proteins syntaxin and SNAP-25. Proc Natl Acad Sci U S A 93:7363-8 Rhee SW, Stimers JR, Wang W, Pang L. 2009. Vascular smooth muscle-specific knockdown of the noncardiac form of the L-type calcium channel by microRNA-based short hairpin RNA as a potential antihypertensive therapy. J Pharmacol Exp Ther 329:775-82 Rooke N, Markovtsov V, Cagavi E, Black DL. 2003. Roles for SR proteins and hnRNP A1 in the regulation of c-src exon N1. Mol Cell Biol 23:1874-84 Roy AA, Baragli A, Bernstein LS, Hepler JR, Hébert TE, Chidiac P. 2006a. RGS2 interacts with Gs and adenylyl cyclase in living cells. Cellular Signalling 18:336-48 Roy AA, Nunn C, Ming H, Zou M-X, Penninger J, et al. 2006b. Up-regulation of Endogenous RGS2 Mediates Cross-desensitization between Gs and Gq Signaling in Osteoblasts. Journal of Biological Chemistry 281:32684-93 Russell R. 2008. RNA misfolding and the action of chaperones. Front Biosci 13:1-20 Sanford JR, Wang X, Mort M, Vanduyn N, Cooper DN, et al. 2009. Splicing factor SFRS1 recognizes a functionally diverse landscape of RNA transcripts. Genome Res 19:381-94 Sanz DJ, Acedo A, Infante M, Duran M, Perez-Cabornero L, et al. 2010. A high proportion of DNA variants of BRCA1 and BRCA2 is associated with aberrant splicing in breast/ovarian cancer patients. Clin Cancer Res 16:1957-67 Schor IE, Rascovan N, Pelisch F, Allo M, Kornblihtt AR. 2009. Neuronal cell depolarization induces intragenic chromatin modifications affecting NCAM alternative splicing. Proc Natl Acad Sci U S A 106:4325-30 Schwartz S, Meshorer E, Ast G. 2009. Chromatin organization marks exon-intron structure. Nat Struct Mol Biol 16:990-5 Scott VES, De Waard M, Liu H, Gurnett CA, Venzke DP, et al. 1996. betaSubunit Heterogeneity in N-type Ca[IMAGE] Channels. Journal of Biological Chemistry 271:3207-12 Sebat J, Lakshmi B, Malhotra D, Troge J, Lese-Martin C, et al. 2007. Strong association of de novo copy number mutations with autism. Science 316:445-9

165

Shen Y, Yu D, Hiel H, Liao P, Yue DT, et al. 2006. Alternative Splicing of the CaV1.3 Channel IQ Domain, a Molecular Switch for Ca2+-Dependent Inactivation within Auditory Hair Cells. The Journal of Neuroscience 26:10690-9 Sheng ZH, Rettig J, Cook T, Catterall WA. 1996. Calcium dependent interaction of N-type calcium channels with the synaptic core complex. Nature 379:101038/379451a0- 101038/379451a0 Sheng ZH, Rettig J, Takahashi M, Catterall WA. 1994. Identification of a syntaxin-binding site on N-type calcium channels. Neuron 13:1303-13 Shepard PJ, Hertel KJ. 2008. Conserved RNA secondary structures promote alternative splicing. RNA 14:1463-9 Shibayama M, Ohno S, Osaka T, Sakamoto R, Tokunaga A, et al. 2009. Polypyrimidine tract- binding protein is essential for early mouse development and embryonic stem cell proliferation. FEBS J 276:6658-68 Singh R, Valcarcel J, Green MR. 1995. Distinct binding specificities and functions of higher eukaryotic polypyrimidine tract-binding proteins. Science 268:1173-6 Skipper M, Milne CA, Hodgkin J. 1999. Genetic and molecular analysis of fox-1, a numerator element involved in Caenorhabditis elegans primary sex determination. Genetics 151:617-31 Smith CW, Valcarcel J. 2000. Alternative pre-mRNA splicing: the logic of combinatorial control. Trends Biochem Sci 25:381-8 Soong TW, DeMaria CD, Alvania RS, Zweifel LS, Liang MC, et al. 2002. Systematic Identification of Splice Variants in Human P/Q-Type Channel alpha 12.1 Subunits: Implications for Current Density and Ca2+-Dependent Inactivation. J. Neurosci. 22:10142-52 Spellman R, Llorian M, Smith CW. 2007. Crossregulation and functional redundancy between the splicing regulator PTB and its paralogs nPTB and ROD1. Mol Cell 27:420-34 Stamm S, Zhang MQ, Marr TG, Helfman DM. 1994. A sequence compilation and comparison of exons that are alternatively spliced in neurons. Nucleic Acids Res 22:1515-26 Sterne-Weiler T, Howard J, Mort M, Cooper DN, Sanford JR. 2011. Loss of exon identity is a common mechanism of human inherited disease. Genome Res Strock J, Diverse-Pierluissi MA. 2004. Ca2+ channels as integrators of G protein-mediated signaling in neurons. Mol Pharmacol 66:1071-6 Suh B-C, Hille B. 2002. Recovery from Muscarinic Modulation of M Current Channels Requires Phosphatidylinositol 4,5-Bisphosphate Synthesis. Neuron 35:507-20 Suh B-C, Leal K, Hille B. 2010. Modulation of High-Voltage Activated Ca2+ Channels by Membrane Phosphatidylinositol 4,5-Bisphosphate. Neuron 67:224-38 Surmeier DJ, Bargas J, Hemmings HC, Nairn AC, Greengard P. 1995. Modulation of calcium currents by a D1 dopaminergic protein kinase/phosphatase cascade in rat neostriatal neurons. Neuron 14:385-97 Taddese A, Nah SY, McCleskey EW. 1995. Selective opioid inhibition of small nociceptive neurons. Science 270:1366-9 Takenaka M, Yamada K, Lu T, Kang R, Tanaka T, Noguchi T. 1996. Alternative splicing of the pyruvate kinase M gene in a minigene system. Eur J Biochem 235:366-71 Tang ZZ, Zheng S, Nikolic J, Black DL. 2009. Developmental control of CaV1.2 L-type calcium channel splicing by Fox proteins. Molecular and cellular biology 29:4757-65 Tedford HW, Zamponi GW. 2006. Direct G protein modulation of Cav2 calcium channels. Pharmacological reviews 58:837-62

166

Thaler C, Gray AC, Lipscombe D. 2004. Cumulative inactivation of N-type CaV2.2 calcium channels modified by alternative splicing. Proceedings of the National Academy of Sciences of the United States of America 101:5675-9 Tripathi V, Ellis JD, Shen Z, Song DY, Pan Q, et al. 2010. The nuclear-retained noncoding RNA MALAT1 regulates alternative splicing by modulating SR splicing factor phosphorylation. Mol Cell 39:925-38 Turner TJ, Adams ME, Dunlap K. 1992. Calcium channels coupled to glutamate release identified by omega-Aga-IVA. Science 258:310-3 Turner TJ, Lampe RA, Dunlap K. 1995. Characterization of presynaptic calcium channels with omega-conotoxin MVIIC and omega-grammotoxin SIA: role for a resistant calcium channel type in neurosecretion. Mol Pharmacol 47:348-53 Ule J, Jensen K, Mele A, Darnell RB. 2005a. CLIP: a method for identifying protein-RNA interaction sites in living cells. Methods (San Diego, Calif.) 37:376-86 Ule J, Jensen KB, Ruggiu M, Mele A, Ule A, Darnell RB. 2003. CLIP identifies Nova-regulated RNA networks in the brain. Science (New York, N.Y.) 302:1212-5 Ule J, Stefani G, Mele A, Ruggiu M, Wang X, et al. 2006. An RNA map predicting Nova-dependent splicing regulation. Nature 444:580-6 Ule J, Ule A, Spencer J, Williams A, Hu J-S, et al. 2005b. Nova regulates brain-specific splicing to shape the synapse. Nature genetics 37:844-52 Underwood JG, Boutz PL, Dougherty JD, Stoilov P, Black DL. 2005. Homologues of the Caenorhabditis elegans Fox-1 protein are neuronal splicing regulators in mammals. Molecular and cellular biology 25:10005-16 Van Petegem F, Minor DL, Jr. 2006. The structural biology of voltage-gated calcium channel function and regulation. Biochem Soc Trans 34:887-93 Venables JP, Klinck R, Koh C, Gervais-Bird J, Bramard A, et al. 2009. Cancer-associated regulation of alternative splicing. Nature structural & molecular biology 16:670-6 Venables JP, Koh C-S, Froehlich U, Lapointe E, Couture S, et al. 2008. Multiple and specific mRNA processing targets for the major human hnRNP proteins. Molecular and cellular biology 28:6033-43 Wagner EJ, Curtis ML, Robson ND, Baraniak AP, Eis PS, Garcia-Blanco MA. 2003. Quantification of alternatively spliced FGFR2 RNAs using the RNA invasive cleavage assay. Rna 9:1552- 61 Wang ET, Sandberg R, Luo S, Khrebtukova I, Zhang L, et al. 2008. Alternative isoform regulation in human tissue transcriptomes. Nature 456:470-6 Wang J, Takagaki Y, Manley JL. 1996. Targeted disruption of an essential vertebrate gene: ASF/SF2 is required for cell viability. Genes Dev 10:2588-99 Wang Y, Cheong C-G, Hall TMT, Wang Z. 2009. Engineering splicing factors with designed specificities. Nature methods 6:825-30 Wang Z, Rolish ME, Yeo G, Tung V, Mawson M, Burge CB. 2004. Systematic identification and analysis of exonic splicing silencers. Cell 119:831-45 Warf MB, Diegel JV, von Hippel PH, Berglund JA. 2009. The protein factors MBNL1 and U2AF65 bind alternative RNA structures to regulate splicing. Proc Natl Acad Sci U S A 106:9203-8 Will CL, Luhrmann R. 2005. Splicing of a rare class of introns by the U12-dependent spliceosome. Biol Chem 386:713-24 Witten JT, Ule J. 2011. Understanding splicing regulation through RNA splicing maps. Trends Genet 27:89-97 Xiao X, Lee J-H. 2010. Systems analysis of alternative splicing and its regulation. Wiley Interdisciplinary Reviews: Systems Biology and Medicine:n/a-n/a

167

Xu X, Yang D, Ding JH, Wang W, Chu PH, et al. 2005. ASF/SF2-regulated CaMKIIdelta alternative splicing temporally reprograms excitation-contraction coupling in cardiac muscle. Cell 120:59-72 Xue Y, Zhou Y, Wu T, Zhu T, Ji X, et al. 2009. Genome-wide analysis of PTB-RNA interactions reveals a strategy used by the general splicing repressor to modulate exon inclusion or skipping. Molecular cell 36:996-1006 Yang G, Huang S-C, Wu JY, Benz EJ. 2008. Regulated Fox-2 isoform expression mediates protein 4.1R splicing during erythroid differentiation. Blood 111:392-401 Yang YY, Yin GL, Darnell RB. 1998. The neuronal RNA-binding protein Nova-2 is implicated as the autoantigen targeted in POMA patients with dementia. Proceedings of the National Academy of Sciences of the United States of America 95:13254-9 Yeo GW, Coufal NG, Liang TY, Peng GE, Fu XD, Gage FH. 2009. An RNA code for the FOX2 splicing regulator revealed by mapping RNA-protein interactions in stem cells. Nat. Struct. Mol. Biol 16:130-7 Yeo GW, L. E, Nostrand ELV, Liang TY. 2007. Discovery and analysis of evolutionarily conserved intronic splicing regulatory elements. PLoS genetics 3:e85-e Zhang C, Darnell RB. 2011. Mapping in vivo protein-RNA interactions at single-nucleotide resolution from HITS-CLIP data. Nat Biotechnol Zhang C, Frias MA, Mele A, Ruggiu M, Eom T, et al. 2010. Integrative Modeling Defines the Nova Splicing-Regulatory Network and Its Combinatorial Controls. Science (New York, N.Y.) 439 Zhang C, Zhang Z, Castle J, Sun S, Johnson J, et al. 2008a. Defining the regulatory network of the tissue-specific splicing factors Fox-1 and Fox-2 (Supplementary Figures). Gene Dev 22:2550-63 Zhang J, Kuo CC, Chen L. 2011. GC content around splice sites affects splicing through pre-mRNA secondary structures. BMC Genomics 12:90 Zhang L, Grabowski PJ, Liu W. 1999. Coordinate repression of a trio of neuron-specific splicing events by the splicing regulator PTB. RNA (New York, N.Y.) 5:117-30 Zhang W, Liu H, Han K, Grabowski PJ. 2002. Region-specific alternative splicing in the nervous system: implications for regulation by the RNA-binding protein NAPOR. Rna 8:671-85 Zhang W, Rohlmann A, Sargsyan V, Aramuni G, Hammer RE, et al. 2005. Extracellular domains of alpha-neurexins participate in regulating synaptic transmission by selectively affecting N- and P/Q-type Ca2+ channels. The Journal of neuroscience : the official journal of the Society for Neuroscience 25:4330-42 Zhang Z, Lotti F, Dittmar K, Younis I, Wan L, et al. 2008b. SMN deficiency causes tissue-specific perturbations in the repertoire of snRNAs and widespread defects in splicing. Cell 133:585-600 Zhu J, Mayeda A, Krainer AR. 2001. Exon identity established through differential antagonism between exonic splicing silencer-bound hnRNP A1 and enhancer-bound SR proteins. Mol Cell 8:1351-61 Zhu Y, Ikeda SR. 1994. VIP inhibits N-type Ca2+ channels of sympathetic neurons via a pertussis toxin-insensitive but cholera toxin-sensitive pathway. Neuron 13:657-69

168