DOCSLIB.ORG

Chromosome 5 and Parkinson Disease

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Chromosome 5 and Parkinson Disease European Journal of Human Genetics (2006) 14, 1106–1110 & 2006 Nature Publishing Group All rights reserved 1018-4813/06 $30.00 www.nature.com/ejhg ARTICLE Chromosome 5 and Parkinson disease Tatiana Foroud*,1, Nathan Pankratz1, Maria Martinez2 and the PROGENI/GSPD-European Consortium3 1Indiana University School of Medicine, Indianapolis, IN, USA; 2INSERM EMI00-06, 523 Place des Terrasses de l’Agora, Evry, France Parkinson disease (PD) is the second most common neurodegenerative disorder. Despite the identification of five causative genes, the majority of PD etiology is still unknown. A region on chromosome 5q is one of the few regions of the genome found linked in multiple studies of familial PD. Analyses were performed using genotypic data from two independent research studies to evaluate rigorously the evidence of linkage on chromosome 5. The combined sample consisting of 1238 affected individuals from 569 multiplex PD families were genotyped for a common set of 20 microsatellite markers spanning an 80 cM region on chromosome 5q. Two disease models were employed and model-free linkage analyses were performed to detect linkage to a PD susceptibility gene and also to detect linkage to a quantitative phenotype, age of onset of PD. There was little evidence of linkage using either a narrower or broader disease definition (lod o0.5). Analyses employing age of onset of PD as the phenotype produced a lod score of 1.8. These results in a very large sample of familial PD suggest that it is unlikely that a PD susceptibility gene is located on chromosome 5q. Evidence for a locus contributing to the age of onset of PD is modest at best (empirical P-value ¼ 0.07). European Journal of Human Genetics (2006) 14, 1106–1110. doi:10.1038/sj.ejhg.5201666; published online 31 May 2006 Keywords: Parkinson disease; chromosome 5; linkage analysis Introduction LRRK2, act in an autosomal dominant manner whereas the Parkinson disease (PD) is the second most common other three genes, PRKN, PINK1 and DJ1, are autosomal neurodegenerative disorder. There is wide variability in recessive in their mode of action. The majority of families the age of onset of disease, although the average age is with PD are not segregating a simple Mendelian form of approximately 60 years.1 PD is characterized by bradyki- disease. Rather, in many of these families, particularly nesia, resting tremor, muscular rigidity and postural those with multiple members with PD, it is expected that instability, as well as a clinically significant response to PD susceptibility genes may be interacting with each other treatment with levodopa.2 Recent studies have consistently or environmental factors, thereby increasing the risk of PD. found a significant genetic contribution to the risk of PD. Ongoing studies of multiplex PD pedigrees have provided Genetic analyses have identified five genes, which when evidence of linkage to several chromosomal regions. mutated can result in PD.3 Two of these genes, SNCA and Chromosome 5q is one of the few regions of the genome identified as a locus for PD susceptibility in multiple studies (Figure 1). Linkage to a PD susceptibility locus has *Correspondence: Dr T Foroud, Department of Medical and Molecular been detected using four different studies of multiplex PD Genetics (IB 130), Indiana University School of Medicine, 975 West Walnut Street, Indianapolis, IN 46202-5251, USA. Tel: þ 1 317 278 1291; families. In the PROGENI study, initial linkage analyses Fax: þ 1 317 278 1100; performed in a sample of 90 families with 96 affected E-mail: [email protected] sibling pairs meeting the narrow PD definition produced 3 For more details regarding PROGENI/GSPD-European Consortium see a maximum lod score of 1.6.4 Analyses in the GSPD- Appendix A. Received 14 February 2006; revised 26 April 2006; accepted 27 April 2006; European Consortium consisting of 199 families yielded a published online 31 May 2006 maximum lod score of 1.05 near the marker D5S471 using Chromosome 5 and Parkinson disease T Foroud et al 1107 45 years or younger, the typical criteria for early onset PD. Screening for mutations in known PD genes was not performed in all study samples. The majority of families (85%) consisted of a single pair of affected siblings. The PROGENI sample was primarily Caucasian (94%), although Hispanics (5%) also participated. The male-to-female ratio in this sample was 1.2. Appropriate written informed Figure 1 Evidence of linkage to chromosome 5q from four studies. consent approved by each individual institution’s Institu- The location of the markers used for fine mapping in this study are tional Review Board was completed. represented as dots below the ideogram. The GSPD-European Consortium sample consisted of 654 genotyped individuals (406 affected) from 199 multiplex PD pedigrees, ascertained through an index case a narrow disease definition. The evidence of linkage was with a definite diagnosis of PD. One hundred and eighty- greatest (lod ¼ 2.2) among those 115 families that did not eight pedigrees were ascertained from five European provide evidence of linkage to chromosome 2.5 A genome countries (France – 70, United Kingdom – 33, Netherlands screen in a sample of 51 Icelandic families resulted in a – 26, Germany – 30 and Italy – 29), and the remaining 11 maximum lod score of 1.6 on chromosome 5q near the pedigrees were recruited in the United States. Following a marker D5S666.6 The Duke PD study, using 174 families standardized neurological evaluation,5 subjects were clas- generated a maximum lod score of 1.5 on chromosome 5q sified as definite PD if the following criteria were near the marker D5S816.7 Further studies in these families met: presence of three of the four cardinal signs of PD also detected linkage to a gene that may contribute to PD age (bradykinesia, rigidity, rest tremor, asymmetry of signs at of onset in this same region of chromosome 5q.8 Clearly, the onset), at least 30% improvement with levodopa therapy evidence from each study individually is relatively modest; and absence of exclusion criteria (supranuclear gaze palsy, however, the convergence of linkage evidence from so many Babinski sign, cerebellar signs, dyspraxia, prominent and different studies suggests that a gene with moderate effect on early urinary symptoms, MMSE o24/30 within 2 years of PD risk may be located in this region of chromosome 5. onset). Probable PD was defined as three of the four To test rigorously whether a gene contributing to PD cardinal signs, or two of the four cardinal signs and at least susceptibility or PD age of onset is found on chromosome 30% improvement with levodopa therapy, and absence of 5q, a global genetics consortium was established between exclusion criteria. Age of onset information was available the PROGENI and GSPD-European Consortium studies. from 388 affected individuals. There was no difference in The goal of this consortium was to genotype a common set the subject’s age at participation, age at onset or clinical of markers across the region linked to PD susceptibility and symptoms between the six ascertainment sites.5 Thirteen test within an expanded sample of multiplex PD families percent of those with age of onset information in the whether a gene affecting the risk for PD was located on GSPD-European Consortium sample had an age of onset of chromosome 5. 45 years or younger, the typical criteria for early-onset PD. Screening for mutations in known PD genes was not performed in all study samples. The sample was nearly Methods exclusively Caucasian with an affected male-to-female Consortium samples ratio of 1.1. The PROGENI study samples were recruited through 59 Parkinson Study Group (PSG) sites located throughout Molecular genotyping and statistical analyses North America. The sample included 832 affected indivi- A common set of 20 equally spaced, microsatellite markers, duals with DNA from 379 multiplex PD families ascer- with an average intermarker density of 4.3 cM, was tained through a sibling pair reportedly affected with PD. genotyped across a 79 cM region of chromosome 5q23 All study participants completed a uniform clinical evalua- region. The PROGENI and GSPD-European Consortium tion (UPDRS;9) and a Diagnostic Checklist.4 The Diagnostic samples were genotyped in different laboratories using Checklist was developed with inclusion criteria consisting previously described methods.4,5 A CEPH control sample of clinical features highly associated with autopsy- (1347-02) was genotyped in both laboratories to assist in confirmed PD and exclusion criteria highly associated combining the two samples for joint analyses. with other non-PD pathological diagnoses.10,11 Responses A genome screen had been previously been completed in on the Diagnostic Checklist were used to classify study both the PROGENI and GSPD-European Consortium subjects as having verified PD or nonverified PD. Age of samples. Results from the screen had been used to verify onset information was available for 769 of the 832 sampled all family structures. The data from the 20 markers individuals. Twelve percent of those with age of onset genotyped as part of this study was evaluated for information in the PROGENI sample had an age of onset of Mendelian inheritance of marker alleles using the program European Journal of Human Genetics Chromosome 5 and Parkinson disease T Foroud et al 1108 Pedcheck.12 The distribution of the marker allele sizes and genetic analyses (see Table 1). To employ genotypic frequencies were reviewed in each sample and were found information from all available family members, those not to be significantly different. To further test for subtle genotyped family members which were not considered differences in allele frequencies within the GSPD-European affected within a particular model were coded as unknown. Consortium sample, given the varied origin of the families, A second series of analyses was also performed to assess the examination of the allele frequencies was performed based evidence of linkage for a gene contributing to the age of on the country of origin of the family.
Load more

Recommended publications
  • Parkin Antibody (C-Term) Purified Rabbit Polyclonal Antibody (Pab) Catalog # AP6402B
    10320 Camino Santa Fe, Suite G San Diego, CA 92121 Tel: 858.875.1900 Fax: 858.622.0609 Parkin Antibody (C-term) Purified Rabbit Polyclonal Antibody (Pab) Catalog # AP6402B Specification Parkin Antibody (C-term) - Product Information Application IF, WB, IHC-P, FC,E Primary Accession O60260 Other Accession NP_004553 Reactivity Human, Mouse Host Rabbit Clonality Polyclonal Isotype Rabbit Ig Antigen Region 387-417 Parkin Antibody (C-term) - Additional Information Gene ID 5071 Other Names E3 ubiquitin-protein ligase parkin, 632-, Confocal immunofluorescent analysis of Parkinson juvenile disease protein 2, Parkin Antibody (C-term)(Cat#AP6402b) with Parkinson disease protein 2, PARK2, PRKN NCI-H460 cell followed by Alexa Fluor 488-conjugated goat anti-rabbit lgG Target/Specificity (green).Actin filaments have been labeled This Parkin antibody is generated from with Alexa Fluor 555 phalloidin (red).DAPI rabbits immunized with a KLH conjugated was used to stain the cell nuclear (blue). synthetic peptide between 387-417 amino acids from the C-terminal region of human Parkin. Dilution IF~~1:10~50 WB~~1:1000 IHC-P~~1:50~100 FC~~1:10~50 Format Purified polyclonal antibody supplied in PBS with 0.09% (W/V) sodium azide. This antibody is purified through a protein A column, followed by peptide affinity purification. Storage Maintain refrigerated at 2-8°C for up to 2 weeks. For long term storage store at -20°C Park2 Antibody (C-term) (Cat. #AP6402b) in small aliquots to prevent freeze-thaw western blot analysis in K562 cell line lysates cycles. (35ug/lane).This demonstrates the Park2 antibody detected the Park2 protein (arrow).
    [Show full text]
  • Genome-Wide Association Study of Diabetic Kidney Disease Highlights Biology Involved in Glomerular Basement Membrane Collagen
    CLINICAL RESEARCH www.jasn.org Genome-Wide Association Study of Diabetic Kidney Disease Highlights Biology Involved in Glomerular Basement Membrane Collagen Rany M. Salem ,1 Jennifer N. Todd,2,3,4 Niina Sandholm ,5,6,7 Joanne B. Cole ,2,3,4 Wei-Min Chen,8 Darrell Andrews,9 Marcus G. Pezzolesi,10 Paul M. McKeigue,11 Linda T. Hiraki,12 Chengxiang Qiu,13 Viji Nair,14 Chen Di Liao,12 Jing Jing Cao,12 Erkka Valo ,5,6,7 Suna Onengut-Gumuscu,8 Adam M. Smiles,15 Stuart J. McGurnaghan,16 Jani K. Haukka,5,6,7 Valma Harjutsalo,5,6,7,17 Eoin P. Brennan,9 Natalie van Zuydam,18,19 Emma Ahlqvist,20 Ross Doyle,9 Tarunveer S. Ahluwalia ,21 Maria Lajer,21 Maria F. Hughes,9 Jihwan Park,13 Jan Skupien,15 Athina Spiliopoulou,11 Andrew Liu,22 Rajasree Menon,14,23 Carine M. Boustany-Kari,24 Hyun M. Kang,23,25 Robert G. Nelson,26 Ronald Klein,27 Barbara E. Klein,27 Kristine E. Lee ,27 Xiaoyu Gao,28 Michael Mauer,29 Silvia Maestroni,30 Maria Luiza Caramori,29 Ian H. de Boer ,31 Rachel G. Miller,32 Jingchuan Guo ,32 Andrew P. Boright,12 David Tregouet,33,34 Beata Gyorgy,33,34 Janet K. Snell-Bergeon,35 David M. Maahs,36 Shelley B. Bull ,37 Angelo J. Canty,38 Colin N.A. Palmer,39 Lars Stechemesser,40 Bernhard Paulweber,40 Raimund Weitgasser,40,41 Jelizaveta Sokolovska,42 Vita Rovıte,43 Valdis Pırags, 42,44 Edita Prakapiene,45 Lina Radzeviciene,46 Rasa Verkauskiene,46 Nicolae Mircea Panduru,6,47 Leif C.
    [Show full text]
  • Reading Through the Building Blocks of the Genome: Exonic Variation in PD
    UNIVERSITY OF CATANIA INTERNATIONAL PhD PROGRAM IN NEUROSCIENCE XXIX Cycle VALENTINA LA COGNATA READING THROUGH THE BUILDING BLOCKS OF THE GENOME: EXONIC VARIATION IN PARKINSON'S DISEASE PhD Thesis Coordinator: Supervisors: Prof. Salvatore Salomone Prof. Velia D’Agata Dr. Sebastiano Cavallaro January 2017 Copyright © V. La Cognata, 2017 All rights reserved. No part of this book may be reproduced, stored in a retrieval system or transmitted in any form or by any means, without prior permission of the author. The copyright of the published papers remains with the publishers. SUMMARY Abstract ...................................................................................................... 5 Chapter 1 .................................................................................................... 7 PARKINSON’S DISEASE ....................................................................................................... 9 HAS EXONIC VARIATION A ROLE IN PD? ............................................................................12 AIMS OF THE PhD WORK ...................................................................................................13 Chapter 2 .................................................................................................. 15 ABSTRACT ........................................................................................................................17 INTRODUCTION ................................................................................................................18 CNVs: A PREVALENT
    [Show full text]
  • Subgroup-Specific Structural Variation Across 1,000 Medulloblastoma Genomes
    ARTICLE doi:10.1038/nature11327 Subgroup-specific structural variation across 1,000 medulloblastoma genomes A list of authors and their affiliations appears at the end of the paper Medulloblastoma, the most common malignant paediatric brain tumour, is currently treated with nonspecific cytotoxic therapies including surgery, whole-brain radiation, and aggressive chemotherapy. As medulloblastoma exhibits marked intertumoural heterogeneity, with at least four distinct molecular variants, previous attempts to identify targets for therapy have been underpowered because of small samples sizes. Here we report somatic copy number aberrations (SCNAs) in 1,087 unique medulloblastomas. SCNAs are common in medulloblastoma, and are predominantly subgroup-enriched. The most common region of focal copy number gain is a tandem duplication of SNCAIP, a gene associated with Parkinson’s disease, which is exquisitely restricted to Group 4a. Recurrent translocations of PVT1, including PVT1-MYC and PVT1-NDRG1, that arise through chromothripsis are restricted to Group 3. Numerous targetable SCNAs, including recurrent events targeting TGF-b signalling in Group 3, and NF-kB signalling in Group 4, suggest future avenues for rational, targeted therapy. Brain tumours are the most common cause of childhood oncological Twenty-eight regions of recurrent high-level amplification (copy death, and medulloblastoma is the most common malignant paediatric number $ 5) were identified (Fig. 1d and Supplementary Table 7). brain tumour. Current medulloblastoma therapy including surgical The most prevalent amplifications affected members of the MYC resection, whole-brain and spinal cord radiation, and aggressive family with MYCN predominantly amplified in SHH and Group 4, chemotherapy supplemented by bone marrow transplant yields five- MYC in Group 3, and MYCL1 in SHH medulloblastomas.
    [Show full text]
  • Rare Gain of Chromosome 5 in a Supratentorial Hemispheric
    Images in… BMJ Case Rep: first published as 10.1136/bcr-2020-234878 on 17 March 2020. Downloaded from Rare gain of chromosome 5 in a supratentorial hemispheric paediatric pilomyxoid astrocytoma Katherine Clark Pehlivan,1 Denise M Malicki,2 Michael L Levy,3 John Ross Crawford4 1Department of Neurosciences, DESCRIPTION University of California San A previously healthy 11- year- old boy presented Diego, San Diego, California, with self- limited recurrent episodes of dizziness, USA disorientation and visual changes with a normal 2Department of Pathology, Rady neurological examination. MRI revealed a well- Children’s Hospital University of California San Diego, San Diego, circumscribed mixed solid/cystic left parieto- California, USA occipital mass (figure 1). He underwent a gross 3Department of Neurosurgery, total resection where neuropathology demonstrated University of California San moderately cellular proliferation of bland bipolar Diego, San Diego, California, process- forming spindle cells in a myxoid back- USA ground with focal angiocentric arrangement, and 4 Department of Neurosciences absence of Rosenthal fibres, consistent with a diag- and Pediatrics, University of nosis of pilomyxoid astrocytoma (PMA) (figure 2). California San Diego, San Diego, DNA- based next- generation sequencing panel California, USA consisting of 397 cancer- related genes (table 1) performed on paraffin- embedded formalin- fixed Correspondence to Figure 2 H&E- stained sections showed a moderately Dr John Ross Crawford; tumour revealed no reportable mutations and cellular proliferation of bland bipolar process- forming jrcrawford@ ucsd. edu variants of unknown significance of PMS1 and spindle cells in a myxoid background with focal RB1. However, chromosomal microarray analysis angiocentric arrangement consistent with a diagnosis of Accepted 4 March 2020 revealed a gain of chromosome 5.
    [Show full text]
  • Identification of Significant Genes with Poor Prognosis in Ovarian Cancer Via Bioinformatical Analysis
    Feng et al. Journal of Ovarian Research (2019) 12:35 https://doi.org/10.1186/s13048-019-0508-2 RESEARCH Open Access Identification of significant genes with poor prognosis in ovarian cancer via bioinformatical analysis Hao Feng1†, Zhong-Yi Gu2†, Qin Li2, Qiong-Hua Liu3, Xiao-Yu Yang4* and Jun-Jie Zhang2* Abstract Ovarian cancer (OC) is the highest frequent malignant gynecologic tumor with very complicated pathogenesis. The purpose of the present academic work was to identify significant genes with poor outcome and their underlying mechanisms. Gene expression profiles of GSE36668, GSE14407 and GSE18520 were available from GEO database. There are 69 OC tissues and 26 normal tissues in the three profile datasets. Differentially expressed genes (DEGs) between OC tissues and normal ovarian (OV) tissues were picked out by GEO2R tool and Venn diagram software. Next, we made use of the Database for Annotation, Visualization and Integrated Discovery (DAVID) to analyze Kyoto Encyclopedia of Gene and Genome (KEGG) pathway and gene ontology (GO). Then protein-protein interaction (PPI) of these DEGs was visualized by Cytoscape with Search Tool for the Retrieval of Interacting Genes (STRING). There were total of 216 consistently expressed genes in the three datasets, including 110 up-regulated genes enriched in cell division, sister chromatid cohesion, mitotic nuclear division, regulation of cell cycle, protein localization to kinetochore, cell proliferation and Cell cycle, progesterone-mediated oocyte maturation and p53 signaling pathway, while 106 down-regulated genes enriched in palate development, blood coagulation, positive regulation of transcription from RNA polymerase II promoter, axonogenesis, receptor internalization, negative regulation of transcription from RNA polymerase II promoter and no significant signaling pathways.
    [Show full text]
  • Parkinson's Disease
    Parkinson´s Disease Parkinson's disease (PD) is a chronic, progressive neurodegenerative disorder of the central nervous system characterized by tremor, muscle rigidity, postural abnormalities and slowed movement (bradykinesia), with dementia manifesting in 20 % of the afflicted. Onset before age 20 is categorized as juvenile-onset, before age 50 as early-onset and after age 50 as late-onset PD. After Alzheimer's disease, PD is the second most common neurodegenerative disorder. Symptoms occur from decreased stimulation of the motor cortex by the basal ganglia, resulting from insufficient formation of dopamine produced in the dopaminergic neurons in the midbrain (especially in the substantia nigra). Mutations in SNCA, UCHL1, PARK8/LRRK2 and PARK3 result in autosomal dominant PD, while mutations in PARK2, PARK7, and PINK1 result in autosomal recessive PD. NR4A2 and SNCAIP have been identified as susceptibility for PD. Alpha-synuclein (SNCA) is an acidic neuronal protein. Parkin coregulated gene protein (PACRG) is a gene Accumulation of insoluble fibrils of aggregated SNCA located close to parkin and thought to be co-transcribed protein is found in the central pathologic feature of PD, the with parkin. The PACRG protein is also a component of Lewy bodies. Therefore, PD is generally considered a Lewy bodies in PD patients. synucleinopathy. DJ-1/PARK7 participates in protection of neuronal cells from oxidative stress and mutation may lead to loss of this protection causing neuronal degradation. The roles of oxidative stress and mitochondrial dysfunction are under investigation as contributing factors to onset of PD. IHC staining using SNCA mouse mono- clonal antibody TA506533 of paraffin- embedded Human embryonic cerebellum PTEN-induced putative kinase 1 (PINK1) is a Ubiquitin carboxy-terminal hydrolase L1 (UCHL1) is a mitochondrial serine/threonine-protein kinase thought deubiquitinating enzyme.
    [Show full text]
  • Entrez ID Gene Name Fold Change Q-Value Description
    Entrez ID gene name fold change q-value description 4283 CXCL9 -7.25 5.28E-05 chemokine (C-X-C motif) ligand 9 3627 CXCL10 -6.88 6.58E-05 chemokine (C-X-C motif) ligand 10 6373 CXCL11 -5.65 3.69E-04 chemokine (C-X-C motif) ligand 11 405753 DUOXA2 -3.97 3.05E-06 dual oxidase maturation factor 2 4843 NOS2 -3.62 5.43E-03 nitric oxide synthase 2, inducible 50506 DUOX2 -3.24 5.01E-06 dual oxidase 2 6355 CCL8 -3.07 3.67E-03 chemokine (C-C motif) ligand 8 10964 IFI44L -3.06 4.43E-04 interferon-induced protein 44-like 115362 GBP5 -2.94 6.83E-04 guanylate binding protein 5 3620 IDO1 -2.91 5.65E-06 indoleamine 2,3-dioxygenase 1 8519 IFITM1 -2.67 5.65E-06 interferon induced transmembrane protein 1 3433 IFIT2 -2.61 2.28E-03 interferon-induced protein with tetratricopeptide repeats 2 54898 ELOVL2 -2.61 4.38E-07 ELOVL fatty acid elongase 2 2892 GRIA3 -2.60 3.06E-05 glutamate receptor, ionotropic, AMPA 3 6376 CX3CL1 -2.57 4.43E-04 chemokine (C-X3-C motif) ligand 1 7098 TLR3 -2.55 5.76E-06 toll-like receptor 3 79689 STEAP4 -2.50 8.35E-05 STEAP family member 4 3434 IFIT1 -2.48 2.64E-03 interferon-induced protein with tetratricopeptide repeats 1 4321 MMP12 -2.45 2.30E-04 matrix metallopeptidase 12 (macrophage elastase) 10826 FAXDC2 -2.42 5.01E-06 fatty acid hydroxylase domain containing 2 8626 TP63 -2.41 2.02E-05 tumor protein p63 64577 ALDH8A1 -2.41 6.05E-06 aldehyde dehydrogenase 8 family, member A1 8740 TNFSF14 -2.40 6.35E-05 tumor necrosis factor (ligand) superfamily, member 14 10417 SPON2 -2.39 2.46E-06 spondin 2, extracellular matrix protein 3437
    [Show full text]
  • Robles JTO Supplemental Digital Content 1
    Supplementary Materials An Integrated Prognostic Classifier for Stage I Lung Adenocarcinoma based on mRNA, microRNA and DNA Methylation Biomarkers Ana I. Robles1, Eri Arai2, Ewy A. Mathé1, Hirokazu Okayama1, Aaron Schetter1, Derek Brown1, David Petersen3, Elise D. Bowman1, Rintaro Noro1, Judith A. Welsh1, Daniel C. Edelman3, Holly S. Stevenson3, Yonghong Wang3, Naoto Tsuchiya4, Takashi Kohno4, Vidar Skaug5, Steen Mollerup5, Aage Haugen5, Paul S. Meltzer3, Jun Yokota6, Yae Kanai2 and Curtis C. Harris1 Affiliations: 1Laboratory of Human Carcinogenesis, NCI-CCR, National Institutes of Health, Bethesda, MD 20892, USA. 2Division of Molecular Pathology, National Cancer Center Research Institute, Tokyo 104-0045, Japan. 3Genetics Branch, NCI-CCR, National Institutes of Health, Bethesda, MD 20892, USA. 4Division of Genome Biology, National Cancer Center Research Institute, Tokyo 104-0045, Japan. 5Department of Chemical and Biological Working Environment, National Institute of Occupational Health, NO-0033 Oslo, Norway. 6Genomics and Epigenomics of Cancer Prediction Program, Institute of Predictive and Personalized Medicine of Cancer (IMPPC), 08916 Badalona (Barcelona), Spain. List of Supplementary Materials Supplementary Materials and Methods Fig. S1. Hierarchical clustering of based on CpG sites differentially-methylated in Stage I ADC compared to non-tumor adjacent tissues. Fig. S2. Confirmatory pyrosequencing analysis of DNA methylation at the HOXA9 locus in Stage I ADC from a subset of the NCI microarray cohort. 1 Fig. S3. Methylation Beta-values for HOXA9 probe cg26521404 in Stage I ADC samples from Japan. Fig. S4. Kaplan-Meier analysis of HOXA9 promoter methylation in a published cohort of Stage I lung ADC (J Clin Oncol 2013;31(32):4140-7). Fig. S5. Kaplan-Meier analysis of a combined prognostic biomarker in Stage I lung ADC.
    [Show full text]
  • (SNCAIP) (NM 005460) Human 3' UTR Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC207980 Synphilin 1 (SNCAIP) (NM_005460) Human 3' UTR Clone Product data: Product Type: 3' UTR Clones Product Name: Synphilin 1 (SNCAIP) (NM_005460) Human 3' UTR Clone Vector: pMirTarget (PS100062) Symbol: SNCAIP Synonyms: Sph1; SYPH1 ACCN: NM_005460 Insert Size: 753 bp Insert Sequence: >SC207980 3’UTR clone of NM_005460 The sequence shown below is from the reference sequence of NM_005460. The complete sequence of this clone may contain minor differences, such as SNPs. Blue=Stop Codon Red=Cloning site GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC GCTAGCAAAGGAAAGAATAAGGCAGCATAATGACATCAATAGAAAAATGAAGAAATCCTACAGCATAAA GCACATTGCTGAGCCAGAGTCAAAAGAACTCTTCTTGTAAATCACTTTTTAAATTTTCTCTCACTGATG CCCTTTGGAAATTATTGGAAATTTCTGGACTATCCTCTTTGGAAAGAGAACCATGAAAACAATGCCTCA CCAGCAGAAGAACAGAATATCAGGATGCCTTAAATTTATAGTAGTAGACTGTAAAAGATTCATTTTGGG GTGATATCTGTATATATAACTTGTTTTTTTAAAAGATGCCGTTTAAAAGCATGATTGGGAAAATGTATG TTTTTTAAGAGTAGATTGATTCACCCTACCCACAGGACATTCACCAAGCCACTGATACCATTTTATATT TCATCAATTGCATGAGTATTTGCTAATGTTGATTGAACCTCCCTTTCCCCATAATGTGGGCAGATTTGG CTCAGCTCCTTCATGAGATCAGGTCAGTGGTATTGTTTCTGTCAAGAGTGTTTTTTCTGTCATTTCTAC TTTTTGTATAAAGGAAATAAAACAATGTTAACAGCCACCTATAAGCTTGGGGCACCTACTTTCTAACAA ATCTGTGATGTTCTGATTTCTAAGGGACTTTGCAAGTATTTTGATTGCTGATATTTGATTTCAGGAACA AACTGCTCAGTTTAGCAGTTTTCCCATAGGCGTCAAATAAAACATTCTATATTTCATTAAGTA
    [Show full text]
  • Description: Uniprot:O60260 Alternative Names： Specificity
    TA6500 Parkin Antibody Order 021-34695924 [email protected] Support 400-6123-828 50ul [email protected] 100 uL √ √ Web www.ab-mart.com.cn Description: Functions within a multiprotein E3 ubiquitin ligase complex, catalyzing the covalent attachment of ubiquitin moieties onto substrate proteins, such as BCL2, SYT11, CCNE1, GPR37, RHOT1/MIRO1, MFN1, MFN2, STUB1, SNCAIP, SEPTIN5, TOMM20, USP30, ZNF746 and AIMP2. Mediates monoubiquitination as well as 'Lys-6', 'Lys-11', 'Lys-48'-linked and 'Lys-63'-linked polyubiquitination of substrates depending on the context. Participates in the removal and/or detoxification of abnormally folded or damaged protein by mediating 'Lys-63'-linked polyubiquitination of misfolded proteins such as PARK7: 'Lys-63'-linked polyubiquitinated misfolded proteins are then recognized by HDAC6, leading to their recruitment to aggresomes, followed by degradation. Mediates 'Lys-63'-linked polyubiquitination of a 22 kDa O-linked glycosylated isoform of SNCAIP, possibly playing a role in Lewy-body formation. Mediates monoubiquitination of BCL2, thereby acting as a positive regulator of autophagy. Promotes the autophagic degradation of dysfunctional depolarized mitochondria (mitophagy) by promoting the ubiquitination of mitochondrial proteins such as TOMM20, RHOT1/MIRO1 and USP30. Preferentially assembles 'Lys-6'-, 'Lys-11'- and 'Lys-63'-linked polyubiquitin chains following mitochondrial damage, leading to mitophagy. Mediates 'Lys-48'-linked polyubiquitination of ZNF746, followed by degradation of ZNF746 by the proteasome; possibly playing a role in the regulation of neuron death. Limits the production of reactive oxygen species (ROS). Regulates cyclin-E during neuronal apoptosis. In collaboration with CHPF isoform 2, may enhance cell viability and protect cells from oxidative stress.
    [Show full text]
  • Mirna and Parkinson's Disease Protein PARK2
    open access www.bioinformation.net Editorial Volume 9(8) Molecule of the month: miRNA and Parkinson’s disease protein PARK2 Paul Shapshak1, 2 1Divsion of Infectious Disease and International Health, Department of Medicine and Department of Psychiatry and Behavioral Medicine, USF Morsani School of Medicine, Tampa General Hospital, 1 Tampa Gen Circle, Room G318, Tampa FL 33606; 2Deputy Chief Editor, Bioinformation; Paul Shapshak - Email: [email protected] Received April 07, 2013; Accepted April 07, 2013; Published April 30, 2013 Parkinson’s disease is generally associated with aging, i.e. Up-regulation, beige Regulation, purple Co-expression, brown elderly individuals. We are gaining many deep insights into Physical Interaction, turquoise dotted Predicted Protein neuropathogenesis in Parkinson’s disease and there are many Interaction, and mauve dotted Predicted TFactor Regulation publications on this topic; we briefly mention a few as they (GenePro SA Biosciences, http://www.sabiosciences.com/). relate to the increasingly studied miRNAs. Parkinson’s disease results from protein inclusions or Lewy bodies and destruction of (mid-brain) substantia nigra pars compacta neurons that are dopaminergic. A novel approach to investigate molecular processes in human diseases as well as in normal control and function is through the study of miRNAs. miRNAs are increasingly associated with many diseases and in Parkinson's disease [1, 2]. Figure 2: Network of input proteins from figure 1 (Park2, CASK, SNCAIP, HSPA4, STUB1, SIM2, CBL, LIMK1, PACRG, SEPT5, PSMA7, BAG5) and showing additional neighbors of these proteins (up to 100 total). In this figure, line-colors and various interactions with other genes are red Down-regulation, green Up-regulation, beige Regulation, purple Co-expression, Figure 1: Network of input protein (Park2) with immediate brown Physical Interaction, turquoise dotted Predicted Protein interactive proteins.
    [Show full text]