The Journal of Poultry Science, .- : +,0ῌ+-., ,**0

Kenjiro Arisawa+, ,, Shigenobu Yazawa-, Yusuke Atsumi., Hiroshi Kagami+ and Tamao Ono+

+ Department of Food Production Science, Faculty of Agriculture, Shinshu University, Minamiminowa, Kamiina, Nagano -33ῌ./32, Japan , Science of Biological Production, The United Graduate School of Agricultural Science, Gifu University, Yanagido, Gifu /*+ῌ++3-, Japan - Division of Biological Sciences, Graduate School of Science, Kyoto University, Kitashirakawa-Oiwakecho, Kyoto 0*0ῌ2/*,, Japan . Department of Bioscience and Food Production, Interdisciplinary Graduate School of Science and Technology, Shinshu University, Minamiminowa, Kamiina, Nagano -33ῌ./32, Japan

The Japanese Silkie (Ukokkei) is a breed of domestic fowl with several unique characteristics. Skeletal analysis revealed that an extra cartilaginous digit was apparent transiently in the wing bud of Japanese Silkie embryos between stages -, and -0. In contrast, an extra digit of the leg resembled digit , in terms of its skeletal elements. Whole-mount in situ hybridization analysis revealed that Shh, Bmp-,, and Hoxd-+- genes are ex- pressed in the presumptive region of the extra digit in the leg buds at stage ,0. Expression of Shh and Hoxd-+- was also apparent in the anterior region, including the presumptive area of the extra digit, in the developing wing bud of Japanese Silkie embryos. The Japanese Silkie fowl thus warrants further investigation as a potential model animal for the study of limb development.

Key words : Japanese Silkie, limb bud, polydactyly, skeletal development

ῌῌῌῌῌῌῌῌῌῌῌῌῌῌῌῌῌῌῌῌῌῌῌ

are thought to have been established in China and Introduction Japan (Roberts, +331). These breeds are now bred Silkie fowls are among the oldest of the rare breeds worldwide and varieties are categorized on the basis of domestic fowl. The first unambiguous record of of the area of their production. The Silkie fowl in the Silkie fowl is found in a Chinese book, Wu lei Japan is thus known as the Japanese Silkie (Ukokkei xiang gan zhi, written by Su Dongpo (+*-1ῌ++*+,ac- in Japanese). cording to http : //www.greatchinese.net/famous/ The Japanese Silkie fowl possesses numerous schooler/sushi.htm ; http : //su-shi.biography.ms/; unique characteristics (Tsudzuki, ,**-). The feathers http : //www.silkqin.com/*3hist/other/sushi.htm) of this fowl do not have a flat web. They also have in the ++th century. The Silkie fowl was introduced abnormal barbules and no barbicels, resulting in a into Japan from China or India early in the +1th silky appearance. The skin is blackish, as is the sur- century, and the modern breeds of the Silkie fowl face of the bones and viscera, and the earlobes are

Received : November -*, ,**/, Accepted : January +*, ,**0 Correspondence to : T. Ono, Department of Food Production Science, Faculty of Agriculture, Shinshu University, 2-*. Minami- minowa, Kamiina, Nagano -33ῌ./32, Japan Tel/Fax : 2+ῌ,0/ῌ11ῌ+.-. E-mail : [email protected] Arisawa et al. : Polydactyly in Japanese Silkie Embryos 127 blue. This breed has five digits per leg. Wada et al. on the side of digit +, is one of the most common (,**.) recently compared the mitochondrial DNA such abnormalities and is often coupled with hyper- of the Japanese Silkie with that of the White Leg- phalangy and malformation of the tibia. It is also horn and found that the similarity between the two associated with duplication of digits in a mirror- breeds was 33.11ῌ (-3 nucleotide di#erences out of image sequence along the A-P axis in chickens a total of +0,12. base pairs). (Landauer, +3/0). The talpid, and talpid- mutant In tetrapod vertebrates, limb patterning along the chickens manifest many digits in limbs that lack the proximal-distal (P-D), anterior-posterior (A-P) and characteristic A-P pattern (Ede and Kelly, +30. ; dorsal-ventral (D-V) axes is controlled by coordina- Hinchli#e and Ede, +302 ; Dvorak and Fallon, +33+ ; tion of signaling centers. Patterning along the P-D Galis et al., ,**/). Hereditary multiple malforma- axis is controlled by signaling from the apical ec- tion (HMM) is an embryonic-lethal condition of todermal ridge (Crossley et al., +330 ; Loomis et al., Japanese quail characterized by syndactylous poly- +332 ;Minet al., +332 ; Lewandoski et al., ,*** ; dactyly in both wing and leg buds with four to eight Moon and Capecchi, ,***). Signaling along the A-P digits (Tsudzuki et al., +332). The molecular mech- axis originates from the zone of polarizing activity anisms responsible for these forms of preaxial poly- (ZPA) at the posterior margin of limb bud meso- dactyly are poorly understood, however. derm. Grafting of the ZPA to the anterior margin We have now examined the skeletal patterns of of limb bud of a recipient animal results in the for- the developing wing and leg buds of the Japanese mation of additional digits with a mirror-image se- Silkie fowl. Furthermore, we characterized the dis- quence along the A-P axis (Tickle et al., +31/ ; Tickle, tribution of Shh, Bmp-,, and Hoxd-+- mRNAs dur- +32+). The dorsal nonridge ectoderm generates the ing limb formation in embryos of this breed. D-V axis formation (Kengaku et al., +332). Materials and Methods Several genes including sonic hedgehog (Shh), bone morphogenetic protein , (Bmp-,) and home- Animals obox D+- (Hoxd-+-) are expressed in the posterior The study was performed in accordance with the mesenchyme of the presumptive limb buds and are policies on animal care developed by the Animal thought to contribute to pattern formation along the Care and Management Committee of the Faculty of A-P axis (Francis et al., +33.). Indeed, a cascade of Agriculture at Shinshu University. Fertilized White Shh, Bmp-,, and Hoxd-+- expression was found to Leghorn eggs were obtained from Aichi Livestock occur in the developing chick limb (Francis et al., and Poultry Breeding Center (Anjo, Japan). The +33.). Ectopic expression of Shh activates expres- black-feathered Japanese Silkie breed was intro- sion of /’ members of Hoxd complex and induces duced from Tokai Biken (Gifu, Japan) to our labo- digit duplications, suggesting that the product of ratory and fertilized eggs were obtained in-house. Shh is one of the first signals in the polarizing path- Eggs were incubated at -1./῍ and 1*ῌ relative way (Riddle et al., +33-). In contrast, activation of humidity, with tilting to a 3*ῌ angle at -*-min inter- Bmp-, and Hoxd-+- expression appears to occur in vals. Embryos were staged as described by Ham- response to the polarizing signal (Izpisuÿa-Belmonte burger and Hamilton (+3/+). et al., +33+ ; Francis et al., +33.). Skeletal Preparations Currently, there are two hypotheses on the digit Skeletons of the Japanese Silkie and White Leg- identity of the wing of birds. Traditional naming is horn embryos were stained with Alcian blue 2GX that the digits are ,, - and . based on embryological (Sigma-Aldrich, St. Louis, MO, USA) and alizarin evidence (Galis et al., ,**/) and the alternative one red S (Wako, Osaka, Japan) for cartilage and ossi- is that the digits are +, , and - based on evolutionary fied bone, respectively. Staining was performed as evidence (Vargas and Fallon, ,**/ a, b). In the pre- described by Nakane and Tsudzuki (+333), with sent study we adopt the naming of wing digits as ,, some modifications. Embryos at stages ,0 and ./ - and .. were fixed overnight in Bouin’s solution, rinsed with Abnormal pattern formation in the limbs gives distilled water, and maintained with gentle agitation rise to various bird mutants. Preaxial polydactyly, in 1*ῌ ethanol containing +* mM ammonia. The which is characterized by the presence of extra digits ammoniated alcohol was changed every - h until 128 J. Poult. Sci., .- (,) most picric acid had been removed. The embryos formaldehyde in phosphate-bu#ered saline contain- were then dehydrated by exposure to 3/ῌ ethanol ing *.+ῌ Tween-,* (PBS-T). The embryos were for , days before stained for + day at -1῍ in a then washed in PBS-T and dehydrated with a series freshly prepared solution comprising Alcian blue 2 of ethanol solutions of increasing concentration in GX (-* mg), 3/ῌ ethanol (2* mL) and acetic acid PBS-T. After rehydration in a series of ethanol (,* mL). After dehydration with 3/ῌ ethanol for - solutions of decreasing concentration in PBS-T and days, the viscera were removed and the embryos washing with PBS-T, the embryos were treated with were macerated for + day in *.**,ῌ alizarin red S in proteinase K (+* mg/mL) for / to +/ min and then +ῌ KOH. They were finally exposed for 1 days to with glycine (, mg/mL) for / min before washing each of a series of glycerol solutions of increasing twice with PBS-T. They were then fixed again with concentration (,/, /*, 1/ and +**ῌ). Embryos .ῌ paraformaldehyde and *.,ῌ glutaraldehyde. between stages ,0 and -/ were not treated with After incubation for 3* min with a solution compris- alizarin red S. ing /*ῌ formamide, /ῌ saline sodium citrate (SSC, RNA Probes for Chicken Shh, Bmp-, and Hoxd-+- pH ../), yeast tRNA (/* mg/mL) and heparin (/* Total RNA was extracted from the limb buds of mg/mL), the embryos were subjected to hybridiza- White Leghorn embryos at stage ,0 by the acid tion overnight at 1*῍ in the same solution contain- guanidium-phenol-chloroform method (Chomczyn- ing the digoxigenin-labeled RNA probe (+** ng/ ski and Sacchi, +321) and was subjected to reverse mL). Embryos were washed consecutively with transcription. The resulting cDNA was subjected to solutions containing /*ῌ formamide, /ῌ SSC, and the polymerase chain reaction with forward and +ῌ sodium dodecylsulfate (SDS) ; /*ῌ formamide, reverse primers shown in Table + ; the primers were ,ῌ SSC and +ῌ SDS ; and +/* mM NaCl, +** mM designed on the basis of chicken Shh, Bmp-, and Tris HCl (pH 1./)and*.+ῌ Tween-,* (TBS-T). Hoxd-+- cDNA sequences (GenBank accession nos. For the detection of hybridization signals, the em- NM,*.2,+,AY,-1,.3 and NM,*/.-., respective- bryos were incubated with alkaline phosphatase- ly). The amplification products were ligated into conjugated Fab fragments of sheep polyclonal anti- pCR,.+ (Invitrogen, Carlsbad, CA, USA). Antis- bodies to digoxigenin (+ : ,*** dilution ; Roche Di- ense RNA probes labeled with digoxigenin-++-uridine- agnostics) in TBS-T containing +./ῌ Blocking Rea- /῍-triphosphate were prepared by transcription of gent (Roche Diagnostics). Specimens were washed the chicken Shh, Bmp-, and Hoxd-+- cDNAs from consecutively with TBS-T containing / mM levami- the T1 promoter in the linearized vector with the use sole ; with a solution containing +** mM NaCl, +** of a DIG RNA Labeling Kit (Roche Diagnostics, mM Tris HCl (pH 3./), /* mM MgCl, and +ῌ Mannheim, Germany). Tween-,* ; and with /ῌ polyvinylalcohol in the Whole-Mount In Situ Hybridization latter solution. They were then stained with the Whole-mount in situ hybridization was performed polyvinylalcohol solution containing nitro blue tet- essentially as described by Ohuchi and Noji (,***) razolium chloride and /-bromo-.-chloro---indolyl and Arisawa et al. (,**/). In brief, embryos were phosphate (+ : /* dilution ; Roche Diagnostics), fol- isolated from eggs and fixed overnight with .ῌ para- lowed by destaining with ethanol.

Table +. Primers used for the polymerase chain reaction in preparation of RNA probes

GenBank /῍ -῍ Gene accession no. Primer sequence ( to ) Product size (bp) Shh NM,*.2,+ CAGTGACTTCCTCACCTTCCTC 0** TCCCACACTCTGTCTCTGTCC Bmp-, AY,-1,.3 AACAGCACGACGTTTCTTCTTT /33 CATGGCAGTAAAAGCCACTGTA Hoxd-+- NM,*/.-. GCTTAAGGAACTCGAGAACGAA /33 TTTTCCGACCAATACACCAAAT The polymerase chain reaction was performed for -/ cycles of denaturation at 30῍ for 0* s, annealing at //῍ for 0* s, and extension at 1,῍ for 0* s, with a preliminary denaturation at 30῍ for / min and a final extension at 1,῍ for +* min. Arisawa et al. : Polydactyly in Japanese Silkie Embryos 129

addition, Bmp-, expression was detected in the ante- Results rior region of the leg bud, including the presumptive Skeletal Analysis region of the extra digit, in the Japanese Silkie Skeletal pattern of the wing buds of the Japanese embryo (Fig. . C). Expression of Hoxd-+- was also Silkie and White Leghorn embryos are shown in apparent at the distal tips of the limb buds of both Figure +. Three cartilaginous digits were observed types of embryo (Fig. . E-H), with expression in in the wings of both types of embryo at stage -+ both wing and leg buds of the Japanese Silkie em- (Fig. + A, B). Ossification of wing digits occurred bryo also being manifest in the anterior region, in- at stage -/ (data not shown). An extra digit that cluding the presumptive area of the extra digit (Fig. bifurcated from the root of digit , was apparent in . E, G). the wing of Japanese Silkie from stages -, and -0 Discussion (Fig. + C, E, G) but was no longer detectable at stage -1 (Fig. + I) and thereafter. Figure , shows Polydactyly in the Silkie fowl has been shown to skeletal patterns of the leg buds of Japanese Silkie be caused by the dominant gene, Po (Somes, +33*). and White Leghorn embryos. Four cartilaginous dig- We have now detected a cartilaginous extra digit its were apparent in both types of embryos at stage anterior to digit , of the wing bud in Japanese Silkie ,3 (Fig. , A, B). Ossification in digits occurred at embryos between stages -, and -0 ; this digit was no stage -2 (Fig. , G, H). An extra cartilaginous digit longer apparent at stage -1 and thereafter. Barfurth that bifurcated from the root of digit + was detected (+3++) showed that, in polydactylous chicken em- in Japanese Silkie embryos between stages -* and -1 bryos, a small rudimentary extra digit is often man- (Fig. , C, E). There were no di#erences in digits ,, ifest at the anterior edge of the wing, near the bas- - and . between the two types of embryos. Two tard wing, at 2 to +* days of incubation (approxi- cartilaginous joints were apparent in the original mately corresponding to stages -- to -0) but not digit + of Japanese Silkie embryos, whereas the extra thereafter. In normal chick embryos, the rudimen- digit possessed three joints similar to those of digit , tary extra digit (mesenchymal condensations) is ob- (Fig. , I). The extra digit persisted throughout life. served transiently posterior to digit . bothinthe Gene Expression Patterns wing and leg buds (Burke and Feduccia, +331 ; Figure - shows whole-mount in situ hybridization Larsson and Wagner, ,**, ; Galis et al., ,**/). The analysis of the localization of Shh mRNA in the limb transient condensation is also observed in the area buds of Japanese Silkie and White Leghorn embryos. anterior to digit , in the chick embryonic wing bud At stage ,., both types of embryo manifested marked at stage ,3 but it remains in arrested state through- expression of Shh in the posterior regions of the out life (Larsson and Wagner, ,**,). The chondri- wing and leg buds (Fig. - A-D). Expression of Shh fied extra digit shown in the present study is unlikely was also apparent in the anterior region of the leg the transient condensation shown by Larsson and bud in the Japanese Silkie embryo (Fig. - C). As the Wagner (,**,) but it is the characteristic feature of limb buds elongated at stage ,0, Shh expression in the Japanese Silkie embryos. the wing buds of both types of embryo became lo- An extra toe is found in breeds of fowl other than calized to the posterior margin (Fig. - E, F). In the Silkie, including Dorking, Houdan and Sultan contrast, Shh expression in the leg buds became (Somes, +33* ; Roberts, +331). The extra toe devel- localized to the distal tip (Fig. - G, H). In addition, ops on top of the normal digit +, arising from the expression of Shh was apparent in the anterior metatarsal, but there is considerable variation in the region of the leg bud in the Japanese Silkie embryo expression of polydactyly (Somes, +33*). Kaufmann- at stage ,0, with no such expression being evident in Wolf (+3*2) described polydactyly as being appar- the White Leghorn embryo. ent at / days of incubation (approximately corre- The expression patterns of Bmp-, and Hoxd-+- in sponding to stage ,0). As described above the tran- the limb buds of Japanese Silkie and White Leghorn sient formation of the anlage of digit / posterior to embryos at stage ,0 are shown in Figure .. Expres- digit . was observed in the leg bud of normal chick sion of Bmp-, was apparent at the distal tips of the embryos (Burke and Feduccia, +331). Burke and limb buds of both types of embryo (Fig. .A-D). In Feduccia (+331) did not mention the developmental 130 J. Poult. Sci., .- (,)

Fig. + Fig. -

Fig. , Fig. . Arisawa et al. : Polydactyly in Japanese Silkie Embryos 131 stages when the anlage of digit / appears, but it is ectopic Bmp-, and Hoxd-+- expression (Yang et al., estimated to be between stages ,1 and -- according +331 ; Drossopoulou et al., ,***). We have now to the figures. In the present study, however, such a shown that Shh is expressed prominently in the an- cartilaginous rudiment was not observed in the area terior region of the leg bud of Japanese Silkie em- posterior to digit . of the leg bud in the White bryos but not in the corresponding region of White Leghorn and Japanese Silkie embryos at stage ,0 Leghorn embryos. This region corresponds to the and thereafter. In the Japanese Silkie embryos the presumptive site of development of the extra digit in extra digit that bifurcated from the root of digit + Japanese Silkie embryos. It is thus possible that the was observed at stage -* and persisted throughout extra digit in the leg bud of Japanese Silkie develops life. as a result of the Shh signal in the anterior region The talpid, and talpid- mutant chickens possess and represents a mirror-image duplication of digit ,. polydactylous limbs with partially fused digits that Bmp-, is one of the coding genes of bone morpho- form according to a pattern lacking obvious A-P genetic proteins and Hoxd-+- is essential for the polarity (Ede and Kelly, +30. ; Hinchli#e and Ede, phalange formation (Francis et al., +33. ; Fromen- +302 ; Dvorak and Fallon, +33+ ; Galis et al., ,**/). tal-Ramain et al., +330). Both genes function down- In contrast, Japanese Silkie embryos possess an inde- stream of Shh, which direct positional specification pendent extra digit that resembles digit , both in size during pattern formation in the limbs (Dolleÿet al., and in that it contains three phalanges. +323 ; Izpisuÿa-Belmonte et al., +33+ ;Nohnoet al., Transplantation of Shh-secreting cells located in +33+ ; Niswander et al., +33- ; Francis et al., +33.). the posterior mesenchyme of the ZPA to ectopic The domain of Bmp-, expression overlaps substan- anterior locations induced complete mirror-image tially with that of Hoxd-+- (Francis et al., +33.). duplication of skeletal elements in chicken and mouse BMP-, is a downstream component of the polariz- embryos (Saunders and Gasseling, +302). Further- ing region signaling pathway rather than being the more, transplantation of ectopic Shh-expressing cells polarizing region signal itself since the application of into anterior tissues of the chick wing bud induced recombinant BMP-, protein to anterior margin of

Fig. +. Wing skeletons of Japanese Silkie (A, C, E, G, I) and White Leghorn (B, D, F, H, J) embryos between stages -+ and -1. Dorsal view. Three cartilaginous digits were apparent in both Japanese Silkie and White Leghorn embryos at stage -+. The wing of the Japanese Silkie manifests an extra digit (arrowheads) bifurcated from the root of digit , between stages -, and -0. Digit numbers are labeled in (A). Bars, + mm.

Fig. ,. Leg skeletons of Japanese Silkie (A, C, E, G, I) and White Leghorn (B, D, F, H, J) embryos between stages ,3 and .,. Dorsal view. Four cartilaginous digits were apparent in both Japanese Silkie and White Leghorn embryos at stage ,3. The leg of the Japanese Silkie manifests an extra digit (arrowheads) bifurcated from the root of digit + at stage -* and thereafter. Digit numbers are labeled in (A). Bars, , mm.

Fig. -. Whole-mount in situ hybridization analysis of the localization of Shh mRNA in the limb buds of Japanese Silkie (A, C, E, G) and White Leghorn (B, D, F, H) embryos. Dorsal view of wing (A, B, E, F) and leg (C, D, G, H) buds at stages ,. (A-D) and ,0 (E-H) are shown. At stage ,., Shh expression was apparent in the posterior regions of the limb buds of both types of embryo ; the leg bud of the Japanese Silkie embryo also manifested Shh expression in the anterior region [arrowhead in (C)]. At stage ,0, Shh expression was detected at the posterior margins of the wing buds and at the distal tips of the leg buds of both types of embryo but was also manifest at the anterior margin of the leg bud of the Japanese Silkie embryo [arrowhead in (G)]. Bars, ,** mm.

Fig. .. Whole-mount in situ hybridization analysis of the localization of Bmp-, (A-D) and Hoxd-+- (E-H) mRNAs in the limb buds of Japanese Silkie (A, C, E, G) and White Leghorn (B, D, F, H) embryos at stage ,0. Dorsal view. Expression of Bmp-, was apparent at the distal tips of the limb buds of both types of embryo as well as at the anterior margin of the leg bud, including the presumptive region of the extra digit, in the Japanese Silkie embryo [arrowhead in (C)]. Expression of Hoxd-+- was apparent in the presumptive regions of the normal digits in the wing and leg buds of both types of embryo as well as in the presumptive region of the extra digit in both wing and leg buds of the Japanese Silkie embryo [arrowheads in (E) and (G)]. Bars, ,** mm. 132 J. Poult. Sci., .- (,) chick wing buds did not induce digit duplications wing bud, mirror-image development of an extra (Francis et al., +33.). Francis et al. (+33.) also sug- digit in the leg, and expression of Shh, Bmp-,, or gested that cells might activate Hoxd-+- shortly Hoxd-+- in the presumptive regions of the extra after they have activated Bmp-, and raises the possi- digits in the limb buds of Japanese Silkie embryos. bility that BMP-, is involved in the activation of The Japanese Silkie fowl warrants further investiga- Hoxd-+-. tion as a potential model animal for the study of Japanese Silkie embryos showed weak expression limb development. of Hoxd-+- without that of Shh and Bmp-, in the Acknowledgments presumptive region of the extra digit in the wing bud, whereas no corresponding region of expression This study was supported in part by a grant from was apparent in the wing bud of White Leghorn Shinshu Foundation for Promotion of Agricultural embryos. It should be examined whether the expres- and Forest Science to K.A. and a Grant-in Aid (no. sion of Shh and Bmp-, is below the detectable level +0/2*,,1) from the Japan Society for the Promo- or these genes are expressed in the earlier stages of tion of Science to T.O. development. Formation of the extra digit was ini- References tiated at the anterior tip of the wing bud at stage -, in Japanese Silkie embryos but it was disappeared at Arisawa K, Yazawa S, Eguchi J, Kagami H and Ono T. . stage -1 with unknown reasons. Our literature sur- Spatiotemporal pattern of EphA gene expression in de- veloping quail limb buds. Animal Science Journal, 10, vey could not find molecular evidence concerning 0/ῌ1+. ,**/. the transient expression of the extra digit in the Barfurth D. Experimentelle Untersuchung¤ uber die Verer- chicken. Recent studies have shown that the expres- bung der Hyperdactylie bei Hu¤hnern. IV. Mitteilung. ¤ ¤ sion of the Hoxd-+, and Hoxd-+- is related to the Der Flugelho¨cker des Huhnchens, eine rudimenta¨re ¤ + +33, Hyperdactylie. Archiv fur Entwicklungsmechanik der development of digit (Ros et al., ; Chiang et Organismen, --, ,//ῌ,1-. +3++. al., ,**+ ; Litingtung et al., ,**,). In the chick em- Burke AC and Feduccia A. Developmental patterns and the bryos, Hoxd-+, is not expressed in the most anterior identification of homologies in the avian hand. Science, digit (digit , and + in the wing and leg buds, res- ,12, 000ῌ002. +331. pectively ; as mentioned above there are two hy- Chen Y, Knezevic V, Ervin V, Hutson R, Ward Y and Mackem S. Direct interaction with Hoxd proteins re- potheses on the digit identity of the wing of bird) verses Gli--repressor function to promote digit forma- butitisexpressedinallotherdigitsatday/ of tion downstream of Shh. Development, +-+, ,--3ῌ,-.1. incubation (approximately corresponding to stage ,**.. ,0) and later stages (Ros et al., +33, ; Knezevic et Chiang C, Litingtung Y, Harris MP, Simandl BK, Li Y, Beachy PA and Fallon JF. Manifestation of the limb al., +331 ; Chiang et al., ,**+ ; Chen et al., ,**.). prepattern : limb development in the absence of sonic +- Hoxd- , in turn, is expressed in all other digits in- hedgehog function. Developmental Biology, ,-0, .,+ῌ cluding the most anterior digit (Ros et al., +33, ; .-/. ,**+. Knezevic et al., +331 ; Chiang et al., ,**+ ; Chen et Chomczynski P and Sacchi N. Single-step method of RNA ,**. ,**/ isolation by acid guanidinium thiocyanate-phenol-chlo- al., ). Vargas and Fallon ( a, b) showed +0, +/0ῌ +, +- roform extraction. Analytical Biochemistry, , both expression of Hoxd- and Hoxd- in the +/3. +321. extra digit of the leg bud of the Silkie fowl. The leg Crossley PH, Minowada G, MacArthur CA and Martin GR. buds of the Japanese Silkie embryos in the present Roles for FGF2 in the induction, initiation, and mainte- study manifested expression of Bmp-, and Hoxd-+- nance of chick limb development. Cell, 2., +,1ῌ+-0. +330. in the presumptive regions of the extra digit as well ÿ ÿ ,0 Dolle P, Izpisua-Belmonte JC, Falkenstein H, Renucci A and as in the original digits in the leg bud at stage . Duboule D. Coordinate expression of the murine Hox-/ The expression of both Bmp-, and Hoxd-+- may complex homoeobox-containing genes during limb pat- lead to the formation of the extra ossified bones in tern formation. Nature, -.,, 101ῌ11,. +323. the leg of Japanese Silkie embryos. However, it Drossopoulou G, Lewis KE, Sanz-Ezquerro JJ, Nikbakht N, +, McMahon AP, Hofmann C and Tickle C. A model for should be examined whether Hoxd- is expressed in anteroposterior patterning of the vertebrate limb based the presumptive regions of the extra digit. on sequential long- and short-range Shh signalling and In conclusion, we have demonstrated formation Bmp signalling. Development, +,1, +--1ῌ+-.2. ,***. , of a rudimentary extra cartilaginous digit in the Dvorak L and Fallon JF. Talpid mutant chick limb has Arisawa et al. : Polydactyly in Japanese Silkie Embryos 133

anteroposterior polarity and altered patterns of pro- tion of ectopic apical ectodermal ridges in mouse En- grammed cell death. The Anatomical Record, ,-+, ,/+ῌ grailed-+ mutant limbs. Development, +,/, ++-1ῌ++.2. ,0*. +33+. +332. Ede DA and Kelly WA. Developmental abnormalities in the Min H, Danilenko DM, Scully SA, Bolon B, Ring BD, trunk and limbs of the talpid- mutant of the fowl. Tarpley JE, DeRose M and Simonet WS. Fgf-+* is Journal of Embryology and Experimental Morphology, required for both limb and lung development and exhib- +,, --3ῌ-/0. +30.. its striking functional similarity to Drosophila branch- Francis PH, Richardson MK, Brickell PM and Tickle C. less. Genes & Development, +,, -+/0ῌ-+0+. +332. Bone morphogenetic proteins and a signalling pathway Moon AM and Capecchi MR. Fgf2 is required for outgrowth that controls patterning in the developing chick limb. and patterning of the limbs. Nature Genetics, ,0, .//ῌ Development, +,*, ,*3ῌ,+2. +33.. ./3. ,***. Fromental-Ramain C, Warot X, Messadecq N, LeMeur M, Nakane Y and Tsudzuki M. Development of the skeleton in DolleÿP and Chambon P. Hoxa-+- and Hoxd-+- play a Japanese quail embryos. Development, Growth & Dif- crucial role in the patterning of the limb autopod. Devel- ferentiation, .+, /,-ῌ/-.. +333. opment, +,,, ,331ῌ-*++. +330. Niswander L, Tickle C, Vogel A, Booth I and Martin GR. Galis F, Kundra´t M and Metz JA. Hox genes, digit identities FGF-. replaces the apical ectodermal ridge and directs and the theropod/bird transition. Journal of Experimen- outgrowth and patterning of the limb. Cell, 1/, /13ῌ/21. tal Zoology Part B : Molecular and Developmental Ev- +33-. olution, -*., +32ῌ,*/. ,**/. Nohno T, Noji S, Koyama E, Ohyama K, Myokai F, Kuro- Hamburger V and Hamilton HL. A series of normal stages in iwa A, Saito T and Taniguchi S. Involvement of the the development of the chick embryo. Journal of Mor- Chox-. chicken homeobox genes in determination of phology, 22, .3ῌ3,. +3/+. anteroposterior axial polarity during limb development. Hinchli#e JR and Ede DA. Abnormalities in bone and car- Cell, 0., ++31ῌ+,*/. +33+. tilage development in the talpid mutant of the fowl. Ohuchi H and Noji S. Whole-mount in situ hybridization Journal of Embryology and Experimental Morphology, for mRNA detection in chick embryos. In : Molecular +3, -,1ῌ--3. +302. Histochemical Techniques (Koji T ed.). pp. ,,,ῌ,-.. Izpisuÿa-Belmonte JC, Tickle C, Dolleÿ P, Wolpert L and Springer-Verlag. Tokyo. ,***. Duboule D. Expression of the homeobox Hox-. genes Riddle RD, Johnson RL, Laufer E and Tabin C. Sonic and the specification of position in chick wing develop- hedgehog mediates the polarizing activity of the ZPA. ment. Nature, -/*, /2/ῌ/23. +33+. Cell, 1/, +.*+ῌ+.+0. +33-. Kaufmann-Wolf M. Embryologische und anatomische Bei- Roberts V. British Poultry Standards. /th ed. Blackwell Pub- tra¨ge zur Hyperdactylie (Houdanhuhn). Gegenbaurs lishing Ltd. Malden. MA. USA. +331. Morphologische Jahrbuch, -2, .1+ῌ/-+. +3*2. Ros MA, Lyons G, Kosher RA, Upholt WB, Coelho CN and Kengaku M, Capdevila J, Rodriguez-Esteban C, De La Pen›a Fallon JF. Apical ridge dependent and independent mes- J, Johnson RL, Izpisuÿa-Belmonte JC and Tabin CJ. odermal domains of GHox-1 and GHox-2 expression in Distinct WNT pathways regulating AER formation and chick limb buds. Development, ++0, 2++ῌ2+2. +33,. dorsoventral polarity in the chick limb bud. Science, Saunders JW Jr. and Gasseling MT. Ectodermal-mesodermal ,2*, +,1.ῌ+,11. +332. interactions in the origin of limb symmetry. In : Epi- Knezevic V, De Santo R, Schughart K, Hu#stadt U, Chiang thelial-Mesenchymal Interactions (Fleischmajer R and C, Mahon KA and Mackem S. Hoxd-+, di#erentially Billingham R eds.). pp. 12ῌ31. Williams and Wilkins. a#ects preaxial and postaxial chondrogenic branches in Baltimore. +302. the limb and regulates Sonic hedgehog in a positive Somes RG Jr. Mutations and major variants of muscles and feedback loop. Development, +,., ./,-ῌ./-0. +331. skeleton in chickens. In : Poultry Breeding and Genetics Landauer W. Rudimentation and duplication of the radius in (Crawford RD ed.). pp. ,*3ῌ,-1. Elsevier. Amsterdam. the duplicate mutant form of fowl. Journal of Genetics, +33*. /., +33ῌ,+2. +3/0. Tickle C, Summerbell D and Wolpert L. Positional signalling Larsson HC and Wagner GP. Pentadactyl ground state of and specification of digits in chick limb morphogenesis. the avian wing. Journal of Experimental Zoology Part Nature, ,/., +33ῌ,*,. +31/. B : Molecular and Developmental Evolution, ,3., +.0ῌ Tickle C. The number of polarizing region cells required to +/+. ,**,. specify additional digits in the developing chick wing. Lewandoski M, Sun X and Martin GR. Fgf2 signalling from Nature, ,23, ,3/ῌ,32. +32+. the AER is essential for normal limb development. Tsudzuki M. Japanese native chickens. In : The Relationship Nature Genetics, ,0, .0*ῌ.0-. ,***. between Indigenous Animals and Humans in APEC Litingtung Y, Dahn RD, Li Y, Fallon JF and Chiang C. Shh Region (Chang HL and Huang YC eds.). pp. 3+ῌ++0. and Gli- are dispensable for limb skeleton formation but The Chinese Society of Animal Science. Tainan. ,**-. regulate digit number and identity. Nature, .+2, 313ῌ Tsudzuki M, Nakane Y and Wada A. Hereditary multiple 32-. ,**,. malformation in Japanese quail : a possible powerful Loomis CA, Kimmel RA, Tong CX, Michaud J and Joyner animal model for morphogenetic studies. The Journal of AL. Analysis of the genetic pathway leading to forma- Heredity, 23, ,.ῌ-+. +332. 134 J. Poult. Sci., .- (,)

Vargas AO and Fallon JF. Birds have dinosaur wings : The nucleotide sequence of mitochondrial genome in Silkie molecular evidence. Journal of Experimental Zoology. fowl (Gallus gallus var. domesticus). Journal of Poultry Part B, Molecular and Developmental Evolution, -*., Science, .+, 10ῌ2,. ,**.. 20ῌ3*. ,**/ a. Yang Y, Drossopoulou G, Chuang PT, Duprez D, Marti E, Vargas AO and Fallon JF. The digits of the wing of birds are Bumcrot D, Vargesson N, Clarke J, Niswander L, +, ,,and-. A review. Journal of Experimental Zoology McMahon A and Tickle C. Relationship between dose, Part B : Molecular and Developmental Evolution, -*., distance and time in Sonic Hedgehog-mediated regula- ,*0ῌ,+3. ,**/ b. tion of anteroposterior polarity in the chick limb. Devel- Wada Y, Yamada Y, Nishibori M and Yasue H. Complete opment, +,., .-3-ῌ..*.. +331.