NEUROSURGICAL FOCUS Neurosurg Focus 51 (3):E3, 2021
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
PARSANA-DISSERTATION-2020.Pdf
DECIPHERING TRANSCRIPTIONAL PATTERNS OF GENE REGULATION: A COMPUTATIONAL APPROACH by Princy Parsana A dissertation submitted to The Johns Hopkins University in conformity with the requirements for the degree of Doctor of Philosophy Baltimore, Maryland July, 2020 © 2020 Princy Parsana All rights reserved Abstract With rapid advancements in sequencing technology, we now have the ability to sequence the entire human genome, and to quantify expression of tens of thousands of genes from hundreds of individuals. This provides an extraordinary opportunity to learn phenotype relevant genomic patterns that can improve our understanding of molecular and cellular processes underlying a trait. The high dimensional nature of genomic data presents a range of computational and statistical challenges. This dissertation presents a compilation of projects that were driven by the motivation to efficiently capture gene regulatory patterns in the human transcriptome, while addressing statistical and computational challenges that accompany this data. We attempt to address two major difficulties in this domain: a) artifacts and noise in transcriptomic data, andb) limited statistical power. First, we present our work on investigating the effect of artifactual variation in gene expression data and its impact on trans-eQTL discovery. Here we performed an in-depth analysis of diverse pre-recorded covariates and latent confounders to understand their contribution to heterogeneity in gene expression measurements. Next, we discovered 673 trans-eQTLs across 16 human tissues using v6 data from the Genotype Tissue Expression (GTEx) project. Finally, we characterized two trait-associated trans-eQTLs; one in Skeletal Muscle and another in Thyroid. Second, we present a principal component based residualization method to correct gene expression measurements prior to reconstruction of co-expression networks. -
Defining Functional Interactions During Biogenesis of Epithelial Junctions
ARTICLE Received 11 Dec 2015 | Accepted 13 Oct 2016 | Published 6 Dec 2016 | Updated 5 Jan 2017 DOI: 10.1038/ncomms13542 OPEN Defining functional interactions during biogenesis of epithelial junctions J.C. Erasmus1,*, S. Bruche1,*,w, L. Pizarro1,2,*, N. Maimari1,3,*, T. Poggioli1,w, C. Tomlinson4,J.Lees5, I. Zalivina1,w, A. Wheeler1,w, A. Alberts6, A. Russo2 & V.M.M. Braga1 In spite of extensive recent progress, a comprehensive understanding of how actin cytoskeleton remodelling supports stable junctions remains to be established. Here we design a platform that integrates actin functions with optimized phenotypic clustering and identify new cytoskeletal proteins, their functional hierarchy and pathways that modulate E-cadherin adhesion. Depletion of EEF1A, an actin bundling protein, increases E-cadherin levels at junctions without a corresponding reinforcement of cell–cell contacts. This unexpected result reflects a more dynamic and mobile junctional actin in EEF1A-depleted cells. A partner for EEF1A in cadherin contact maintenance is the formin DIAPH2, which interacts with EEF1A. In contrast, depletion of either the endocytic regulator TRIP10 or the Rho GTPase activator VAV2 reduces E-cadherin levels at junctions. TRIP10 binds to and requires VAV2 function for its junctional localization. Overall, we present new conceptual insights on junction stabilization, which integrate known and novel pathways with impact for epithelial morphogenesis, homeostasis and diseases. 1 National Heart and Lung Institute, Faculty of Medicine, Imperial College London, London SW7 2AZ, UK. 2 Computing Department, Imperial College London, London SW7 2AZ, UK. 3 Bioengineering Department, Faculty of Engineering, Imperial College London, London SW7 2AZ, UK. 4 Department of Surgery & Cancer, Faculty of Medicine, Imperial College London, London SW7 2AZ, UK. -
Moyamoya Disease Susceptibility Gene RNF213 Links Inflammatory
www.nature.com/scientificreports OPEN Moyamoya disease susceptibility gene RNF213 links inflammatory and angiogenic signals in Received: 19 March 2015 Accepted: 03 July 2015 endothelial cells Published: 17 August 2015 Kazuhiro Ohkubo1,*, Yasunari Sakai1,*, Hirosuke Inoue1, Satoshi Akamine1, Yoshito Ishizaki1, Yuki Matsushita1, Masafumi Sanefuji1, Hiroyuki Torisu1,3, Kenji Ihara1,2, Marco Sardiello4 & Toshiro Hara1 Moyamoya disease (MMD) is a cerebrovascular disorder characterized by occlusive lesions of the circle of Willis. To date, both environmental and genetic factors have been implicated for pathogenesis of MMD. Allelic variations in RNF213 are known to confer the risk of MMD; however, functional roles of RNF213 remain to be largely elusive. We herein report that pro-inflammatory cytokines, IFNG and TNFA, synergistically activated transcription of RNF213 both in vitro and in vivo. Using various chemical inhibitors, we found that AKT and PKR pathways contributed to the transcriptional activation of RNF213. Transcriptome-wide analysis and subsequent validation with quantitative PCR supported that endogenous expression of cell cycle-promoting genes were significantly decreased with knockdown of RNF213 in cultured endothelial cells. Consistently, these cells showed less proliferative and less angiogenic profiles. Chemical inhibitors for AKT (LY294002) and PKR (C16) disrupted their angiogenic potentials, suggesting that RNF213 and its upstream pathways cooperatively organize the process of angiogenesis. Furthermore, RNF213 down-regulated expressions of matrix metalloproteases in endothelial cells, but not in fibroblasts or other cell types. Altogether, our data illustrate that RNF213 plays unique roles in endothelial cells for proper gene expressions in response to inflammatory signals from environments. Moyamoya disease (MMD) represents a specific intracranial vascular disorder characterized by progres- sive, occlusive lesions of internal carotid arteries and branches in the circle of Willis1,2. -
The Borg Family of Cdc42 Effector Proteins Cdc42ep1–5
View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Institute of Cancer Research Repository Biochemical Society Transactions (2016) 0 1–8 DOI: 10.1042/BST20160219 1 2 The Borg family of Cdc42 effector proteins 3 4 Cdc42EP1–5 5 6 Aaron J. Farrugia and Fernando Calvo 7 8 Tumour Microenvironment Team, Division of Cancer Biology, Institute of Cancer Research, 237 Fulham Road, London SW2 6JB, U.K. 9 Correspondence: Fernando Calvo ([email protected]) 10 11 12 13 Despite being discovered more than 15 years ago, the Borg (binder of Rho GTPases) 14 – family of Cdc42 effector proteins (Cdc42EP1 5) remains largely uncharacterised and rela- 15 tively little is known about their structure, regulation and role in development and disease. 16 Recent studies are starting to unravel some of the key functional and mechanistic 17 aspects of the Borg proteins, including their role in cytoskeletal remodelling and signal- 18 ling. In addition, the participation of Borg proteins in important cellular processes such as 19 cell shape, directed migration and differentiation is slowly emerging, directly linking Borgs 20 with important physiological and pathological processes such as angiogenesis, neuro- 21 fi transmission and cancer-associated desmoplasia. Here, we review some of these nd- 22 ings and discuss future prospects. 23 24 25 26 27 28 29 Introduction 30 The Rho GTPase family member Cdc42 regulates a diverse range of cellular functions including cyto- 31 kinesis, cytoskeletal remodelling and cell polarity [1,2]. Like other Rho family members, Cdc42 cycles 32 between two tightly regulated conformational states, a GTP-bound active state and a GDP-bound 33 inactive state [3]. -
MECHANISMS in ENDOCRINOLOGY: Novel Genetic Causes of Short Stature
J M Wit and others Genetics of short stature 174:4 R145–R173 Review MECHANISMS IN ENDOCRINOLOGY Novel genetic causes of short stature 1 1 2 2 Jan M Wit , Wilma Oostdijk , Monique Losekoot , Hermine A van Duyvenvoorde , Correspondence Claudia A L Ruivenkamp2 and Sarina G Kant2 should be addressed to J M Wit Departments of 1Paediatrics and 2Clinical Genetics, Leiden University Medical Center, PO Box 9600, 2300 RC Leiden, Email The Netherlands [email protected] Abstract The fast technological development, particularly single nucleotide polymorphism array, array-comparative genomic hybridization, and whole exome sequencing, has led to the discovery of many novel genetic causes of growth failure. In this review we discuss a selection of these, according to a diagnostic classification centred on the epiphyseal growth plate. We successively discuss disorders in hormone signalling, paracrine factors, matrix molecules, intracellular pathways, and fundamental cellular processes, followed by chromosomal aberrations including copy number variants (CNVs) and imprinting disorders associated with short stature. Many novel causes of GH deficiency (GHD) as part of combined pituitary hormone deficiency have been uncovered. The most frequent genetic causes of isolated GHD are GH1 and GHRHR defects, but several novel causes have recently been found, such as GHSR, RNPC3, and IFT172 mutations. Besides well-defined causes of GH insensitivity (GHR, STAT5B, IGFALS, IGF1 defects), disorders of NFkB signalling, STAT3 and IGF2 have recently been discovered. Heterozygous IGF1R defects are a relatively frequent cause of prenatal and postnatal growth retardation. TRHA mutations cause a syndromic form of short stature with elevated T3/T4 ratio. Disorders of signalling of various paracrine factors (FGFs, BMPs, WNTs, PTHrP/IHH, and CNP/NPR2) or genetic defects affecting cartilage extracellular matrix usually cause disproportionate short stature. -
Transcriptome Analysis of Human Diabetic Kidney Disease
ORIGINAL ARTICLE Transcriptome Analysis of Human Diabetic Kidney Disease Karolina I. Woroniecka,1 Ae Seo Deok Park,1 Davoud Mohtat,2 David B. Thomas,3 James M. Pullman,4 and Katalin Susztak1,5 OBJECTIVE—Diabetic kidney disease (DKD) is the single cases, mild and then moderate mesangial expansion can be leading cause of kidney failure in the U.S., for which a cure has observed. In general, diabetic kidney disease (DKD) is not yet been found. The aim of our study was to provide an considered a nonimmune-mediated degenerative disease unbiased catalog of gene-expression changes in human diabetic of the glomerulus; however, it has long been noted that kidney biopsy samples. complement and immunoglobulins sometimes can be de- — tected in diseased glomeruli, although their role and sig- RESEARCH DESIGN AND METHODS Affymetrix expression fi arrays were used to identify differentially regulated transcripts in ni cance is not clear (4). 44 microdissected human kidney samples. The DKD samples were The understanding of DKD has been challenged by multi- significant for their racial diversity and decreased glomerular ple issues. First, the diagnosis of DKD usually is made using filtration rate (~20–30 mL/min). Stringent statistical analysis, using clinical criteria, and kidney biopsy often is not performed. the Benjamini-Hochberg corrected two-tailed t test, was used to According to current clinical practice, the development of identify differentially expressed transcripts in control and diseased albuminuria in patients with diabetes is sufficient to make the glomeruli and tubuli. Two different Web-based algorithms were fi diagnosis of DKD (5). We do not understand the correlation used to de ne differentially regulated pathways. -
Misexpression of Cancer/Testis (Ct) Genes in Tumor Cells and the Potential Role of Dream Complex and the Retinoblastoma Protein Rb in Soma-To-Germline Transformation
Michigan Technological University Digital Commons @ Michigan Tech Dissertations, Master's Theses and Master's Reports 2019 MISEXPRESSION OF CANCER/TESTIS (CT) GENES IN TUMOR CELLS AND THE POTENTIAL ROLE OF DREAM COMPLEX AND THE RETINOBLASTOMA PROTEIN RB IN SOMA-TO-GERMLINE TRANSFORMATION SABHA M. ALHEWAT Michigan Technological University, [email protected] Copyright 2019 SABHA M. ALHEWAT Recommended Citation ALHEWAT, SABHA M., "MISEXPRESSION OF CANCER/TESTIS (CT) GENES IN TUMOR CELLS AND THE POTENTIAL ROLE OF DREAM COMPLEX AND THE RETINOBLASTOMA PROTEIN RB IN SOMA-TO- GERMLINE TRANSFORMATION", Open Access Master's Thesis, Michigan Technological University, 2019. https://doi.org/10.37099/mtu.dc.etdr/933 Follow this and additional works at: https://digitalcommons.mtu.edu/etdr Part of the Cancer Biology Commons, and the Cell Biology Commons MISEXPRESSION OF CANCER/TESTIS (CT) GENES IN TUMOR CELLS AND THE POTENTIAL ROLE OF DREAM COMPLEX AND THE RETINOBLASTOMA PROTEIN RB IN SOMA-TO-GERMLINE TRANSFORMATION By Sabha Salem Alhewati A THESIS Submitted in partial fulfillment of the requirements for the degree of MASTER OF SCIENCE In Biological Sciences MICHIGAN TECHNOLOGICAL UNIVERSITY 2019 © 2019 Sabha Alhewati This thesis has been approved in partial fulfillment of the requirements for the Degree of MASTER OF SCIENCE in Biological Sciences. Department of Biological Sciences Thesis Advisor: Paul Goetsch. Committee Member: Ebenezer Tumban. Committee Member: Zhiying Shan. Department Chair: Chandrashekhar Joshi. Table of Contents List of figures .......................................................................................................................v -
Supplementary Table 1
Supplementary Table 1. 492 genes are unique to 0 h post-heat timepoint. The name, p-value, fold change, location and family of each gene are indicated. Genes were filtered for an absolute value log2 ration 1.5 and a significance value of p ≤ 0.05. Symbol p-value Log Gene Name Location Family Ratio ABCA13 1.87E-02 3.292 ATP-binding cassette, sub-family unknown transporter A (ABC1), member 13 ABCB1 1.93E-02 −1.819 ATP-binding cassette, sub-family Plasma transporter B (MDR/TAP), member 1 Membrane ABCC3 2.83E-02 2.016 ATP-binding cassette, sub-family Plasma transporter C (CFTR/MRP), member 3 Membrane ABHD6 7.79E-03 −2.717 abhydrolase domain containing 6 Cytoplasm enzyme ACAT1 4.10E-02 3.009 acetyl-CoA acetyltransferase 1 Cytoplasm enzyme ACBD4 2.66E-03 1.722 acyl-CoA binding domain unknown other containing 4 ACSL5 1.86E-02 −2.876 acyl-CoA synthetase long-chain Cytoplasm enzyme family member 5 ADAM23 3.33E-02 −3.008 ADAM metallopeptidase domain Plasma peptidase 23 Membrane ADAM29 5.58E-03 3.463 ADAM metallopeptidase domain Plasma peptidase 29 Membrane ADAMTS17 2.67E-04 3.051 ADAM metallopeptidase with Extracellular other thrombospondin type 1 motif, 17 Space ADCYAP1R1 1.20E-02 1.848 adenylate cyclase activating Plasma G-protein polypeptide 1 (pituitary) receptor Membrane coupled type I receptor ADH6 (includes 4.02E-02 −1.845 alcohol dehydrogenase 6 (class Cytoplasm enzyme EG:130) V) AHSA2 1.54E-04 −1.6 AHA1, activator of heat shock unknown other 90kDa protein ATPase homolog 2 (yeast) AK5 3.32E-02 1.658 adenylate kinase 5 Cytoplasm kinase AK7 -
A New Horizon of Moyamoya Disease and Associated Health Risks Explored Through RNF213
Environ Health Prev Med (2016) 21:55–70 DOI 10.1007/s12199-015-0498-7 REVIEW A new horizon of moyamoya disease and associated health risks explored through RNF213 1 1 2 1 Akio Koizumi • Hatasu Kobayashi • Toshiaki Hitomi • Kouji H. Harada • 3 4 Toshiyuki Habu • Shohab Youssefian Received: 18 September 2015 / Accepted: 18 November 2015 / Published online: 10 December 2015 Ó The Author(s) 2015. This article is published with open access at Springerlink.com Abstract The cerebrovascular disorder moyamoya dis- and also address the public health contributions to current ease (MMD) was first described in 1957 in Japan, and is unresolved issues of MMD. We also emphasize the typically considered to be an Asian-specific disease. importance of a more updated definition for MMD, of However, it is globally recognized as one of the major qualified cohort studies based on genetic epidemiology and causes of childhood stroke. Although several monogenic an awareness of the ethical issues associated with genetic diseases are known to be complicated by Moyamoya testing of carriers. angiopathy, the ring finger protein 213 gene (RNF213) was identified as a susceptibility gene for MMD. RNF213 is Keywords Moyamoya disease Á RNF213 R4810K Á Asian unusual, because (1) it induces MMD with no other rec- founder mutation Á Angiogenesis Á Hypoxia ognizable phenotypes, (2) the RNF213 p.R4810K variant is an Asian founder mutation common to Japanese, Korean and Chinese with carrier rates of 0.5–2 % of the general Introduction population but a low penetrance, and (3) it encodes a rel- atively largest proteins with a dual AAA? ATPase and E3 Moyamoya disease (MMD) is a steno-occlusive disease of Ligase activities. -
1 Novel Expression Signatures Identified by Transcriptional Analysis
ARD Online First, published on October 7, 2009 as 10.1136/ard.2009.108043 Ann Rheum Dis: first published as 10.1136/ard.2009.108043 on 7 October 2009. Downloaded from Novel expression signatures identified by transcriptional analysis of separated leukocyte subsets in SLE and vasculitis 1Paul A Lyons, 1Eoin F McKinney, 1Tim F Rayner, 1Alexander Hatton, 1Hayley B Woffendin, 1Maria Koukoulaki, 2Thomas C Freeman, 1David RW Jayne, 1Afzal N Chaudhry, and 1Kenneth GC Smith. 1Cambridge Institute for Medical Research and Department of Medicine, Addenbrooke’s Hospital, Hills Road, Cambridge, CB2 0XY, UK 2Roslin Institute, University of Edinburgh, Roslin, Midlothian, EH25 9PS, UK Correspondence should be addressed to Dr Paul Lyons or Prof Kenneth Smith, Department of Medicine, Cambridge Institute for Medical Research, Addenbrooke’s Hospital, Hills Road, Cambridge, CB2 0XY, UK. Telephone: +44 1223 762642, Fax: +44 1223 762640, E-mail: [email protected] or [email protected] Key words: Gene expression, autoimmune disease, SLE, vasculitis Word count: 2,906 The Corresponding Author has the right to grant on behalf of all authors and does grant on behalf of all authors, an exclusive licence (or non-exclusive for government employees) on a worldwide basis to the BMJ Publishing Group Ltd and its Licensees to permit this article (if accepted) to be published in Annals of the Rheumatic Diseases and any other BMJPGL products to exploit all subsidiary rights, as set out in their licence (http://ard.bmj.com/ifora/licence.pdf). http://ard.bmj.com/ on September 29, 2021 by guest. Protected copyright. 1 Copyright Article author (or their employer) 2009. -
International Journal of Genomics and Data Mining
International Journal of Genomics and Data Mining Asadi S, et al. Int J Genom Data Min 01: 103. Research Article DOI: 10.29011/2577-0616.000103 Molecular Study of Genomics Mutations in RNF213, ACTA2, GUCY1A3 Genes in Patients Moyamoya Syndrome in Human Shahin Asadi1*, Mahsa Jamali1, Samaneh Sadeh Dell2, Manoush Tohidirad2 *1Young Researchers and Elite Club, Tabriz Branch, Islamic Azad University, Tabriz, Iran. 2Molecular Biology Genetics, Elite Club, Tabriz Branch, Islamic Azad University, Tabriz, Iran *Corresponding author: Shahin Asadi, Molecular Genetics, Elite Club, Tabriz Branch, Islamic Azad University, Tabriz, Iran, Tel: +98 9379923364; Email: [email protected]. Citation: Asadi S, Jamali M, Dell SS (2017) Molecular Study of Genomics Mutations in RNF213, ACTA2,GUCY1A3 Genes in patients Moyamoya Syndrome in Human.Int J Genom Data Min 01: 103. DOI: 10.29011/2577-0616.000103 Received Date: 17 February 2017; Accepted Date: 27 February 2017; Published Date: 06 March, 2017 Abstract In this study, we have analyzed 50 people. 20 patients Moyamoya disease and 30 Persons control group.The genes RNF213 on chromosome 17q25, ACTA2 on chromosome 10q23.3,GUCY1A3 on chromosome 4q32, analyzed in terms of genetic mutations made. In this study, people who have genetic mutations were targeted, with nervous dis- orders, Moyamoya disease. In fact, of all people with Moyamoya disease. 20 patients Moyamoya disease had a genetic mutation in the genes RNF213 on chromosome 17q25,ACTA2 on chromosome 10q23.3,GUCY1A3 on chromosome 4q32 Moyamoya disease. Any genetic mutations in the target genes control group, did not show. Keywords: Genetic study; Moyamoya disease; Mutations in and also by blood clots (thrombosis) [1]. -
RNF213 (NM 020954) Human Untagged Clone Product Data
OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC126169 RNF213 (NM_020954) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: RNF213 (NM_020954) Human Untagged Clone Tag: Tag Free Symbol: RNF213 Synonyms: ALO17; C17orf27; KIAA1618; MYMY2; MYSTR; NET57 Vector: pCMV6-XL5 E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: None Fully Sequenced ORF: >OriGene sequence for NM_020954 edited GCGCGCGGCAGGCGGCGAGCTCGGGGGCCGCAGAAAATGAAACTGAAGCCGTGGTCACGT GACAGGACATGTAGTATATAGCAGGCTGCCAGCGACTCCTGCTCTTGCTTCTGGATCTGC AGGGCAGTCCCAGCAGGACCCATGGAGTGTCCTTCGTGCCAGCATGTCTCCAAGGAGGAA ACCCCCAAGTTCTGCAGCCAGTGCGGAGAGAGGCTGCCTCCTGCAGCCCCCATAGCAGAT TCTGAGAACAATAACTCCACAATGGCGTCGGCCTCGGAGGGTGAAATGGAGTGTGGGCAG GAGCTGAAGGAGGAAGGGGGCCCGTGCTTGTTCCCGGGCTCAGACAGTTGGCAAGAAAAC CCCGAGGAGCCCTGTTCCAAAGCCTCCTGGACCGTCCAAGAAAGCAAAAAGAAGAAAAGG AAGAAGAAAAAGAAGGGGAACAAGTCCGCTTCCTCAGAGCTGGCTTCCTTGCCCCTTTCT CCTGCCAGCCCCTGTCACCTGACTTTGCTTTCAAACCCATGGCCTCAGGACACAGCCCTG CCCCACAGCCAAGCCCAGCAGAGTGGCCCCACTGGCCAGCCGAGCCAGCCCCCGGGCACA GCCACCACGCCACTGGAGGGTGACGGCCTCTCCGCGCCCACCGAGGTTGGCGACAGCCCC CTGCAGGCCCAGGCTTTGGGAGAGGCAGGAGTGGCCACAGGAAGTGAGGCTCAGAGCAGC CCGCAATTCCAGGACCACACGGAAGGGGAGGACCAGGACGCTTCCATCCCCTCTGGGGGC AGAGGCCTGTCCCAGGAGGGGACCGGTCCCCCCACCTCTGCTGGTGAAGGCCATTCTAGG ACTGAAGATGCTGCCCAGGAGCTCCTGTTGCCTGAGTCAAAAGGAGGCAGCTCTGAGCCC GGGACAGAACTGCAGACCACCGAGCAACAGGCAGGGGCCTCAGCCTCTACGGCAGTTGAT