Reaction Specificities of the E-Ionone-Forming Lycopene
Total Page：16
File Type：pdf, Size：1020Kb
FEBS Letters 586 (2012) 3415–3420 journal homepage: www.FEBSLetters.org Reaction specificities of the e-ionone-forming lycopene cyclase from rice (Oryza sativa) elucidated in vitro ⇑ Qiuju Yu, Peter Beyer Faculty of Biology, Centre for Biological Signaling Studies (BIOSS), University of Freiburg, D-79104 Freiburg, Germany article info abstract Article history: Lycopene cyclases responsible for the formation of e-ionone rings (LCYe) mark a plant-specific bifur- Received 18 June 2012 cation of carotenogenesis. We investigated purified rice LCYe (OsLCYe) in a liposome-based biphasic Revised 19 July 2012 assay system. OsLCYe depends on reduced flavin cofactors stabilizing a transient state formed dur- Accepted 20 July 2012 ing the non-redox cyclization reaction. In contrast to OsLCYb, OsLCYe produces predominantly Available online 31 July 2012 monocyclic products and monocyclic carotene intermediates are not suitable substrates. Determi- Edited by Ulf-Ingo Flügge nation of the OsLCYe reaction specificities and the combined use of OsLCYb allow the characteriza- tion of the reaction sequence leading to heterocyclic carotenoids. It was also found that 5-cis- lycopene, which was thought to be decisive for -cyclization, was not involved in the reaction, with Keywords: e Carotenoid OsLCYe acting as an exclusion filter for this naturally occurring isomer. Alpha carotene Ó 2012 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved. Lycopene cyclase Provitamin A Flavoenzyme 1. Introduction quenching requires, inter alia, zeaxanthin [5]. Moreover, bicyclic carotenoids of the b-carotene branch are the precursors of phyto- Cyclic carotenoids are biosynthesized with two isomeric ionone hormones formed by the action of carotenoid cleaving dioxygen- end-groups differing in the position of the double bond in the ring, ases (CCDs). The 9-cis-epoxycarotenoid dioxygenases (NCEDs) which is C5–C6 (b-ionone) or C4–C5 (e-ionone). Beta-ionone-con- subfamily initiates the biosynthesis of abscisic acid from 9-cis vio- taining carotenoids are common in carotenoid producing organ- laxanthin [8] while the strigolactones – modulators of plant archi- isms, while the formation of the e-ionone ring is restricted to tecture, mycorrhizal interaction and infestation with parasitic plants, with the exception of the cyanobacterial genus Prochloro- weeds – are derivatives of 9-cis-b-carotene [9]. When ingested by coccus, which possesses a lycopene cyclase capable of forming both vertebrates, carotenoids possessing at least one unsubstituted b- ring-types [1]. ionone ring are termed provitamin A carotenoids, which in turn The ability of plants to form both rings allows for a bifurcation are converted to retinoids by oxygenase cleavage [10]. The relative in the carotenoid biosynthesis pathway leading to either b-caro- activities of LCYb and LCYe are therefore among the primary deter- tene (b, b -Carotene) or a-carotene (b,e-carotene) and their xantho- minants of the vitamin A-nutritional value of crop plants [11]. phyll derivatives (see Supplementary Fig. 1, for an overview). Lycopene cyclases are membrane-bound enzymes which makes Carotenoids possessing two e-rings, such as in lactucaxanthin of biochemical investigations on the purified enzyme difficult. There- Lactuca sativa, are rare [2,3]. The genetic basis for b- and e-ring for- fore, all available knowledge stems from in vivo studies, such as mation is given by homologous single copy genes encoding lyco- mutant analyses or complementation in Escherichia coli strains pene b- and lycopene e-cyclase (LCYb; LCYe) [4]. engineered to accumulate the lycopene substrate. Such analyses, The products of the two carotenoid biosynthesis branches are although representing major advances in the field, leave room for vitally important in various ways. In plants, the b-carotene deriva- interpretation. tives zeaxanthin, violaxanthin, neoxanthin and the a-carotene Recent findings using purified bacterial lycopene b-cyclase from derivative lutein are constituents of the light harvesting complexes Pantoea ananatis have shown that the reaction mechanism de- [5] and function in light harvesting and photoprotection. b-Caro- pends on the presence of reduced FAD to stabilize an intermediate tene is a constituent of the photosystems [6] and involved in the transient state while acid base catalysis is the catalytic principle. 1 detoxification of O2 [7]. The process of non-photochemical This and the discovery that partially disordered phosphatidyl-cho- line liposomes are well suited as a biphasic in vitro system for lyco- ⇑ Corresponding author. Fax: +49 761 203 2675. pene cyclases [12] enabled the here-presented research on LCYe E-mail address: [email protected] (P. Beyer). from Oryza sativa (OsLCYe). Applying the same methodology led 0014-5793/$36.00 Ó 2012 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.febslet.2012.07.060 3416 Q. Yu, P. Beyer / FEBS Letters 586 (2012) 3415–3420 to very strong OsLCYe activity in vitro which allowed to assess ba- chaperonin system under the control of an arabinose-inducible sic reaction parameters, determine the LCYe/LCYb reaction se- promoter. The cultures were grown in 2Â YT medium at 37 °C quence and test the hypothesis whether the 5-cis-configured to an OD600 of 0.6 and then induced with arabinose (8 mM) lycopene is needed to produce the e-ionone group [13,14]. This lat- and IPTG (0.2 mM) for Gateway vectors or with arabinose for ter component was inspired by the recent finding that the carotene pThio-OsLCYb vectors. The recombinant proteins were overex- cis–trans isomerase CRTISO, operating directly upstream of lyco- pressed at 16 °C over night. Cells were resuspended in buffer A pene cyclases, produced considerable amounts of 5-mono-cis-lyco- (25 mM phosphate buffer, pH 6.2; MgCl2, 2.5 mM; NaCl, pene – apart from the main product all-trans-lycopene [15]. This 300 mM; glycerol 15%) and lysed by French Pressure Cell pas- led to the question of whether the single 5-cis configuration at sages. After centrifugation at 17,000Âg for 30 min the superna- one end of the symmetrical lycopene precursor was a determining tant was solubilized by adding 10Â CMC of Tween 20 (1Â factor in the formation of the single e-ionone end groups that pre- CMC = 0.0067%) and applied to Protino Glutathione Agarose 4B vail in the plant a-carotenoid branch of the biosynthetic pathway. (Macherey–Nagel). After washing with buffer A containing 2Â CMC Tween 20, the elution was accomplished with buffer B 2. Materials and methods (50 mM Tris–HCl, pH 8.0; MgCl2, 2.5 mM; NaCl, 300 mM; glyc- erol, 15%; 2Â CMC Tween 20 and glutathione, 10 mM). The 2.1. Chemicals used induction and purification of the proteins were checked by SDS–PAGE using 10% polyacrylamide gels. Proteins were quanti- 5-cis-Lycopene, 5,5-di-cis-lycopene, trans-lycopene and trans-d- fied using the Bradford method. carotene were from CaroteNature; trans-c-carotene was a gift from BASF. Concert™ plant RNA reagent and SuperScript™ III Reverse 2.4. Enzymatic assays Transcriptase were from Invitrogen. Phusion™ High-Fidelity DNA Polymerase is a product of Finnzymes. Protein-free liposomes containing lycopene substrates were prepared with soybean lecithin (Sigma–Aldrich) in buffer A, as de- 2.2. OsLCYe cloning and DNA constructs scribed [12]. The effective incorporation of lycopene into the lipid bilayer was assessed spectro-photometrically (Shimadzu, UV- To clone the lycopene e-cyclase cDNA of OsLCYe (Acc. 2501PC) after extraction of a liposome aliquot with CHCl3/MeOH NM_001049945.1) total RNA was extracted from young leaves of (2:1, v/v). The concentration of carotenes was calculated using À1 À1 the rice variety TP309 with Concert™ plant RNA and reverse tran- e470 nm = 187,000 l mol cm for all-trans-lycopene, e470 nm = À1 À1 À1 scribed into cDNA with oligo d(T)16 and SuperScript™ III Reverse 184,000 l mol cm for 5-cis-lycopene, e470 nm = 182,000 l mol À1 0 À1 À1 Transcriptase. PCR amplification was performed with the primers cm for 5, 5 -di-cis-lycopene, e456 nm = 178,327 l mol cm for 0 0 À1 À1 OsLCYe Forward: 5 -CATCTCGAGATGGAGTTCTCCGGCGGCGC – 3 d-carotene and e460 nm = 166,470 l mol cm for trans-c-carotene (XhoI) and OsLCYe Reverse: 50-CGGAAGCTTACAAGGTCAGGTAGGTC [17]. Cyclization reactions were carried out in a glove box under an 0 TTGATCATCG -3 (HindIII), using 100 ng cDNA, 500 nM of each pri- N2 atmosphere. All solutions were gassed with N2 for 20 min. The mer, 200 lM each dNTP, 3% of DMSO and 0.2 unit of Phusion™ standard assay (200 ll) consisted of liposome suspension contain- High-Fidelity DNA Polymerase. The XhoI/HindIII digested fragment ing 1 nmol carotene substrate (typically around 30 ll), 30 lg of cy- of purified PCR product was inserted into the respective site of clase, 10 nmol FAD or FMN, 20 ll hexane [12] and buffer A, added pThio-DAN1 (a modified version of pBAD/TOPOÒ ThioFusion (Invit- to the final volume of 200 ll. Reducing conditions were achieved rogen)). The resulting expression vector pThio-OsLCYe was verified with 2 ll of a freshly prepared 0.1 M dithionite solution. The assays by sequencing. were incubated at 37 °C for 60 min and extracted with one volume To clone OsLCYe lacking a predicted 52-amino-acid transit pep- of CHCl3/MeOH (2:1, v/v). The organic phase was dried and sub- tide (ChloroP 1.1 software) into a series of Gateway vectors [16] jected to HPLC analysis. the primers, GW Fw1 50-CTTGAAGTCCTCTTTCAGGGACCCATTAATT For in vivo complementation, the plasmids were transformed GCGTGGCGACG-30 and GW Rs1 GGGGACCACTTTGTACAAGAAAGCT into JM109 E. coli cells containing the plasmid pFarbeR enabling GGGTCGGATCCTTACAAGGTCAGGTAGGTCTTG were used for ampli- lycopene synthesis [18]. Bacteria were grown overnight at 28 °C fication from pThio-OsLCYe, and for introducing a 3C protease and extracted with CHCl3/MeOH (2:1, v/v).