Reaction Specificities of the E-Ionone-Forming Lycopene

Total Page:16

File Type:pdf, Size:1020Kb

Load more

FEBS Letters 586 (2012) 3415–3420 journal homepage: www.FEBSLetters.org Reaction specificities of the e-ionone-forming lycopene cyclase from rice (Oryza sativa) elucidated in vitro ⇑ Qiuju Yu, Peter Beyer Faculty of Biology, Centre for Biological Signaling Studies (BIOSS), University of Freiburg, D-79104 Freiburg, Germany article info abstract Article history: Lycopene cyclases responsible for the formation of e-ionone rings (LCYe) mark a plant-specific bifur- Received 18 June 2012 cation of carotenogenesis. We investigated purified rice LCYe (OsLCYe) in a liposome-based biphasic Revised 19 July 2012 assay system. OsLCYe depends on reduced flavin cofactors stabilizing a transient state formed dur- Accepted 20 July 2012 ing the non-redox cyclization reaction. In contrast to OsLCYb, OsLCYe produces predominantly Available online 31 July 2012 monocyclic products and monocyclic carotene intermediates are not suitable substrates. Determi- Edited by Ulf-Ingo Flügge nation of the OsLCYe reaction specificities and the combined use of OsLCYb allow the characteriza- tion of the reaction sequence leading to heterocyclic carotenoids. It was also found that 5-cis- lycopene, which was thought to be decisive for -cyclization, was not involved in the reaction, with Keywords: e Carotenoid OsLCYe acting as an exclusion filter for this naturally occurring isomer. Alpha carotene Ó 2012 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved. Lycopene cyclase Provitamin A Flavoenzyme 1. Introduction quenching requires, inter alia, zeaxanthin [5]. Moreover, bicyclic carotenoids of the b-carotene branch are the precursors of phyto- Cyclic carotenoids are biosynthesized with two isomeric ionone hormones formed by the action of carotenoid cleaving dioxygen- end-groups differing in the position of the double bond in the ring, ases (CCDs). The 9-cis-epoxycarotenoid dioxygenases (NCEDs) which is C5–C6 (b-ionone) or C4–C5 (e-ionone). Beta-ionone-con- subfamily initiates the biosynthesis of abscisic acid from 9-cis vio- taining carotenoids are common in carotenoid producing organ- laxanthin [8] while the strigolactones – modulators of plant archi- isms, while the formation of the e-ionone ring is restricted to tecture, mycorrhizal interaction and infestation with parasitic plants, with the exception of the cyanobacterial genus Prochloro- weeds – are derivatives of 9-cis-b-carotene [9]. When ingested by coccus, which possesses a lycopene cyclase capable of forming both vertebrates, carotenoids possessing at least one unsubstituted b- ring-types [1]. ionone ring are termed provitamin A carotenoids, which in turn The ability of plants to form both rings allows for a bifurcation are converted to retinoids by oxygenase cleavage [10]. The relative in the carotenoid biosynthesis pathway leading to either b-caro- activities of LCYb and LCYe are therefore among the primary deter- tene (b, b -Carotene) or a-carotene (b,e-carotene) and their xantho- minants of the vitamin A-nutritional value of crop plants [11]. phyll derivatives (see Supplementary Fig. 1, for an overview). Lycopene cyclases are membrane-bound enzymes which makes Carotenoids possessing two e-rings, such as in lactucaxanthin of biochemical investigations on the purified enzyme difficult. There- Lactuca sativa, are rare [2,3]. The genetic basis for b- and e-ring for- fore, all available knowledge stems from in vivo studies, such as mation is given by homologous single copy genes encoding lyco- mutant analyses or complementation in Escherichia coli strains pene b- and lycopene e-cyclase (LCYb; LCYe) [4]. engineered to accumulate the lycopene substrate. Such analyses, The products of the two carotenoid biosynthesis branches are although representing major advances in the field, leave room for vitally important in various ways. In plants, the b-carotene deriva- interpretation. tives zeaxanthin, violaxanthin, neoxanthin and the a-carotene Recent findings using purified bacterial lycopene b-cyclase from derivative lutein are constituents of the light harvesting complexes Pantoea ananatis have shown that the reaction mechanism de- [5] and function in light harvesting and photoprotection. b-Caro- pends on the presence of reduced FAD to stabilize an intermediate tene is a constituent of the photosystems [6] and involved in the transient state while acid base catalysis is the catalytic principle. 1 detoxification of O2 [7]. The process of non-photochemical This and the discovery that partially disordered phosphatidyl-cho- line liposomes are well suited as a biphasic in vitro system for lyco- ⇑ Corresponding author. Fax: +49 761 203 2675. pene cyclases [12] enabled the here-presented research on LCYe E-mail address: [email protected] (P. Beyer). from Oryza sativa (OsLCYe). Applying the same methodology led 0014-5793/$36.00 Ó 2012 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.febslet.2012.07.060 3416 Q. Yu, P. Beyer / FEBS Letters 586 (2012) 3415–3420 to very strong OsLCYe activity in vitro which allowed to assess ba- chaperonin system under the control of an arabinose-inducible sic reaction parameters, determine the LCYe/LCYb reaction se- promoter. The cultures were grown in 2Â YT medium at 37 °C quence and test the hypothesis whether the 5-cis-configured to an OD600 of 0.6 and then induced with arabinose (8 mM) lycopene is needed to produce the e-ionone group [13,14]. This lat- and IPTG (0.2 mM) for Gateway vectors or with arabinose for ter component was inspired by the recent finding that the carotene pThio-OsLCYb vectors. The recombinant proteins were overex- cis–trans isomerase CRTISO, operating directly upstream of lyco- pressed at 16 °C over night. Cells were resuspended in buffer A pene cyclases, produced considerable amounts of 5-mono-cis-lyco- (25 mM phosphate buffer, pH 6.2; MgCl2, 2.5 mM; NaCl, pene – apart from the main product all-trans-lycopene [15]. This 300 mM; glycerol 15%) and lysed by French Pressure Cell pas- led to the question of whether the single 5-cis configuration at sages. After centrifugation at 17,000Âg for 30 min the superna- one end of the symmetrical lycopene precursor was a determining tant was solubilized by adding 10Â CMC of Tween 20 (1Â factor in the formation of the single e-ionone end groups that pre- CMC = 0.0067%) and applied to Protino Glutathione Agarose 4B vail in the plant a-carotenoid branch of the biosynthetic pathway. (Macherey–Nagel). After washing with buffer A containing 2Â CMC Tween 20, the elution was accomplished with buffer B 2. Materials and methods (50 mM Tris–HCl, pH 8.0; MgCl2, 2.5 mM; NaCl, 300 mM; glyc- erol, 15%; 2Â CMC Tween 20 and glutathione, 10 mM). The 2.1. Chemicals used induction and purification of the proteins were checked by SDS–PAGE using 10% polyacrylamide gels. Proteins were quanti- 5-cis-Lycopene, 5,5-di-cis-lycopene, trans-lycopene and trans-d- fied using the Bradford method. carotene were from CaroteNature; trans-c-carotene was a gift from BASF. Concert™ plant RNA reagent and SuperScript™ III Reverse 2.4. Enzymatic assays Transcriptase were from Invitrogen. Phusion™ High-Fidelity DNA Polymerase is a product of Finnzymes. Protein-free liposomes containing lycopene substrates were prepared with soybean lecithin (Sigma–Aldrich) in buffer A, as de- 2.2. OsLCYe cloning and DNA constructs scribed [12]. The effective incorporation of lycopene into the lipid bilayer was assessed spectro-photometrically (Shimadzu, UV- To clone the lycopene e-cyclase cDNA of OsLCYe (Acc. 2501PC) after extraction of a liposome aliquot with CHCl3/MeOH NM_001049945.1) total RNA was extracted from young leaves of (2:1, v/v). The concentration of carotenes was calculated using À1 À1 the rice variety TP309 with Concert™ plant RNA and reverse tran- e470 nm = 187,000 l mol cm for all-trans-lycopene, e470 nm = À1 À1 À1 scribed into cDNA with oligo d(T)16 and SuperScript™ III Reverse 184,000 l mol cm for 5-cis-lycopene, e470 nm = 182,000 l mol À1 0 À1 À1 Transcriptase. PCR amplification was performed with the primers cm for 5, 5 -di-cis-lycopene, e456 nm = 178,327 l mol cm for 0 0 À1 À1 OsLCYe Forward: 5 -CATCTCGAGATGGAGTTCTCCGGCGGCGC – 3 d-carotene and e460 nm = 166,470 l mol cm for trans-c-carotene (XhoI) and OsLCYe Reverse: 50-CGGAAGCTTACAAGGTCAGGTAGGTC [17]. Cyclization reactions were carried out in a glove box under an 0 TTGATCATCG -3 (HindIII), using 100 ng cDNA, 500 nM of each pri- N2 atmosphere. All solutions were gassed with N2 for 20 min. The mer, 200 lM each dNTP, 3% of DMSO and 0.2 unit of Phusion™ standard assay (200 ll) consisted of liposome suspension contain- High-Fidelity DNA Polymerase. The XhoI/HindIII digested fragment ing 1 nmol carotene substrate (typically around 30 ll), 30 lg of cy- of purified PCR product was inserted into the respective site of clase, 10 nmol FAD or FMN, 20 ll hexane [12] and buffer A, added pThio-DAN1 (a modified version of pBAD/TOPOÒ ThioFusion (Invit- to the final volume of 200 ll. Reducing conditions were achieved rogen)). The resulting expression vector pThio-OsLCYe was verified with 2 ll of a freshly prepared 0.1 M dithionite solution. The assays by sequencing. were incubated at 37 °C for 60 min and extracted with one volume To clone OsLCYe lacking a predicted 52-amino-acid transit pep- of CHCl3/MeOH (2:1, v/v). The organic phase was dried and sub- tide (ChloroP 1.1 software) into a series of Gateway vectors [16] jected to HPLC analysis. the primers, GW Fw1 50-CTTGAAGTCCTCTTTCAGGGACCCATTAATT For in vivo complementation, the plasmids were transformed GCGTGGCGACG-30 and GW Rs1 GGGGACCACTTTGTACAAGAAAGCT into JM109 E. coli cells containing the plasmid pFarbeR enabling GGGTCGGATCCTTACAAGGTCAGGTAGGTCTTG were used for ampli- lycopene synthesis [18]. Bacteria were grown overnight at 28 °C fication from pThio-OsLCYe, and for introducing a 3C protease and extracted with CHCl3/MeOH (2:1, v/v).
Recommended publications
  • Carotenoid Oxidation Products Are Stress Signals That Mediate Gene Responses to Singlet Oxygen in Plants

    Carotenoid Oxidation Products Are Stress Signals That Mediate Gene Responses to Singlet Oxygen in Plants

    Carotenoid oxidation products are stress signals that mediate gene responses to singlet oxygen in plants Fanny Ramela,b,c, Simona Birtica,b,c, Christian Giniesd, Ludivine Soubigou-Taconnate, Christian Triantaphylidèsa,b,c, and Michel Havauxa,b,c,1 aCommissariat à l’Energie Atomique et aux Energies Alternatives, Direction des Sciences du Vivant, Institut de Biologie Environnementale et Biotechnologie, Laboratoire d’Ecophysiologie Moléculaire des Plantes, F-13108 Saint-Paul-lez-Durance, France; bCentre National de la Recherche Scientifique, Unité Mixte de Recherche Biologie Végétale et Microbiologie Environnementales, F-13108 Saint-Paul-lez-Durance, France; cUniversité Aix-Marseille, F-13108 Saint-Paul-lez- Durance, France; dInstitut National de la Recherche Agronomique, Unité Mixte de Recherche 408 SQPOV, Université d’Avignon et des Pays de Vaucluse, F-84000 Avignon, France; and eGénomiques Fonctionnelles d’Arabidopsis, Unité de Recherche en Génomique Végétale, Unité Mixte de Recherche Institut National de la Recherche Agronomique 1165, Equipe de Recherche Labellisée Centre National de la Recherche Scientifique 8196, Université d’Evry Val d’Essonne, 91057 Evry, France Edited by Krishna K. Niyogi, University of California, Berkeley, CA, and accepted by the Editorial Board February 23, 2012 (received for review September 29, 2011) 1 O2 (singlet oxygen) is a reactive O2 species produced from triplet toxicity (4, 10, 11) and, therefore, products resulting from their 1 excited chlorophylls in the chloroplasts, especially when plants are direct oxidation by O2 are potential candidates for this function. exposed to excess light energy. Similarly to other active O2 species, This possibility is explored in the present work. 1 O2 has a dual effect: It is toxic, causing oxidation of biomolecules, and it can act as a signal molecule that leads to cell death or to Results 1 1 acclimation.
  • Ionones When Used As Fragrance Ingredients Q

    Ionones When Used As Fragrance Ingredients Q

    Available online at www.sciencedirect.com Food and Chemical Toxicology 45 (2007) S130–S167 www.elsevier.com/locate/foodchemtox Review A toxicologic and dermatologic assessment of ionones when used as fragrance ingredients q The RIFM Expert Panel D. Belsito a, D. Bickers b, M. Bruze c, P. Calow d, H. Greim e, J.M. Hanifin f, A.E. Rogers g, J.H. Saurat h, I.G. Sipes i, H. Tagami j a University of Missouri (Kansas City), c/o American Dermatology Associates, LLC, 6333 Long Avenue, Third Floor, Shawnee, KS 66216, USA b Columbia University Medical Center, Department of Dermatology, 161 Fort Washington Avenue, New York, NY 10032, USA c Lund University, Malmo University Hospital, Department of Occupational and Environmental Dermatology, Sodra Forstadsgatan 101, Entrance 47, Malmo SE-20502, Sweden d Institut for Miliovurdering, Environmental Assessment Institute, Linne´sgade 18, First Floor, Copenhagen 1361 K, Denmark e Technical University of Munich, Institute for Toxicology and Environmental Hygiene, Hohenbachernstrasse 15-17, Freising-Weihenstephan D-85354, Germany f Oregon Health Sciences University, Department of Dermatology L468, 3181 SW Sam Jackson Park Road, Portland, OR 97201-3098, USA g Boston University School of Medicine, Department of Pathology and Laboratory Medicine, 715 Albany Street, L-804, Boston, MA 02118-2526, USA h Hospital Cantonal Universitaire, Clinique et Policlinique de Dermatologie, 24, Rue Micheli-du-Crest, Geneve 14 1211, Switzerland i Department of Pharmacology, University of Arizona, College of Medicine, 1501 North Campbell Avenue, P.O. Box 245050, Tucson, AZ 85724-5050, USA j 3-27-1 Kaigamori, Aoba-ku, Sendai 981-0942, Japan Abstract An evaluation and review of a structurally related group of fragrance materials.
  • Light-Induced Changes in an Aqueous Β-Carotene

    Light-Induced Changes in an Aqueous Β-Carotene

    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by AIR Universita degli studi di Milano 5238 J. Agric. Food Chem. 2007, 55, 5238−5245 Light-Induced Changes in an Aqueous â-Carotene System Stored under Halogen and Fluorescent Lamps, Affected by Two Oxygen Partial Pressures SARA LIMBO,* LUISA TORRI, AND LUCIANO PIERGIOVANNI Department of Food Science and Microbiology, University of Milan, Via Celoria 2, 20133 Milan, Italy The aim of this work was to investigate the reaction kinetics of â-carotene in an aqueous medium as a function of exposure to commercial lights (halogen and fluorescent sources) and oxygen partial pressures. The evolution of the pigment concentration, the changes in color, and the accumulation of a volatile compound (â-ionone) were monitored during storage. The kinetics of degradation were mathematically modeled to compare the effects of lighting conditions and oxygen partial pressures. Lighting was also a critical variable in the presence of a low oxygen partial pressure (5 kPa), and in these conditions, the â-carotene degraded completely during storage, even if more slowly than at 20 kPa of O2. The pigment degradation was correlated to illuminance and UVA irradiance values, but the different decay rates of the fluorescent lamps were explained by the differences in the blue region of the energy emission spectra. A halogen lamp gave minor negative effects on â-carotene degradation. KEYWORDS: Light; halogen lamp; fluorescent lamp; â-carotene; â-ionone; aqueous system; color INTRODUCTION chemical bonds (6, 9). The effects of light on the degradation of packaged foods have been widely investigated especially Food color and appearance are important visually perceived when lipidic substrates are involved (10); attention has therefore factors that contribute to customer selection (1).
  • Photochemical Degradation of Antioxidants: Kinetics and Molecular End Products

    Photochemical Degradation of Antioxidants: Kinetics and Molecular End Products

    Photochemical degradation of antioxidants: kinetics and molecular end products Sofia Semitsoglou Tsiapou 2020 Americas Conference IUVA [email protected] 03/11/2020 Global carbon cycle and turnover of DOC 750 Atmospheric CO2 Surface Dissolved Inorganic C 610 1,020 Dissolved Terrestrial Organic Biosphere Carbon 662 Deep Dissolved 38,100 Inorganic C Gt C (1015 gC) Global carbon cycle and turnover of DOC DOC (mM) Stephens & Aluwihare ( unpublished) Buchan et al. 2014, Nature Reviews Microbiology Problem definition Enzymatic processes Bacteria Labile Recalcitrant Fungi Light Corganic Algae Corganic Radicals Carotenoids (∙OH, ROO∙) ➢ LC-MS ➢ GC-MS H2O-soluble products As Biomarkers for ➢ GC-IRMS Corg sources, fate and reactivity??? Hypotheses 1. Carotenoids in fungi neutralize free radicals and counteract oxidative stress and in marine environments are thought to serve as precursors for recalcitrant DOC 2. Carotenoid oxidation products can accumulate and their production and release can represent an important flux of recalcitrant DOC 3. Biological sources and diagenetic pathways of carotenoids are encoded into the fine-structure as well as isotopic composition of the degradation products FUNgal experiments Strains Culture cultivation - Unidentified - Potato Dextrose broth medium - Aspergillus candidus - Incubated 7 days - Aspergillus flavus - Aerobic conditions - Aspergillus terreus - Under natural light (28℃ ) - Penicillium sp. Biomass and Media Lyophilization extracts Bligh and Dyer method (for lipids analysis) FUNgal experiments a) ABTS assay: antioxidant activity Biomass and Media extracts b) LC-MS : CAR-like compounds c) Photo-oxidation of selected Biomass carotenoids extracts ABTS assay: fungal antioxidant activity Trolox Equivalent Antioxidant Capacity (TEAC) 400 350 300 250 200 Medium 150 Biomass extracted] 100 50 0 TEAC [µmol of Trolox/mg of biomass of of[µmol Trolox/mg TEAC Unidentified Aspergillus Aspergillus Aspergillus Penicillium candidus flavus terreus sp.
  • Tomato-Based Products and Lycopene in the Prevention of Cancer: Bioavailability and Antioxidant Properties

    Tomato-Based Products and Lycopene in the Prevention of Cancer: Bioavailability and Antioxidant Properties

    CANCER PREVENTION RESEARCH □ REVIEW ARTICLE □ Tomato-based Products and Lycopene in the Prevention of Cancer: Bioavailability and Antioxidant Properties Eun-Sun Hwang School of Agricultural Biotechnology and Center for Agricultural Biomaterials, College of Agriculture and Life Sciences, Seoul National University, Seoul 151-742, Korea Epidemiological studies showed that dietary intakes of tomatoes and tomato products are associated with a decreased risk of chronic diseases, such as cancer and cardiovascular disease. This beneficial effect could be related to a high intake of carotenoids such as lycopene or β-carotene. Lycopene is present in tomatoes and tomato products and it is one of the most potent antioxidants among dietary carotenoids. Serum and tissue lycopene levels have been found to be inversely related to the incidence of several types of cancer, including prostate cancer. Although the antioxidant properties of lycopene are thought to be primarily responsible for its beneficial effects, evidence is accumulating to suggest that other mechanisms may also be involved. The bioavailability of lycopene is an essential requirement to sustain its in vivo role. This review outlined the characteristics of lycopene and its bioavailability in human body. (Cancer Prev Res 10, 81-88, 2005) ꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏ Key Words: Tomato, Lycopene, Carotenoids, Bioavailability, Antioxidant, Cancer prevention of vitamin A.2) The ability to function as a provitamin A was INTRODUCTION limited to those carotenoids with an unsubstituted β-ionone group, and include α-carotene, β-carotene, and β-cryptoxan- Carotenoids are the most common natural pigments and thin. Lycopene lacks the β-ionone ring structure of β-carotene more than 600 different compounds have been characterized and it dose not have provitamin A activity.
  • Astaxanthin, Cell Membrane Nutrient with Diverse Clinical Benefits and Anti-Aging Potential Parris Kidd, Phd

    Astaxanthin, Cell Membrane Nutrient with Diverse Clinical Benefits and Anti-Aging Potential Parris Kidd, Phd

    Monograph amr Astaxanthin, Cell Membrane Nutrient with Diverse Clinical Benefits and Anti-Aging Potential Parris Kidd, PhD Abstract Introduction Astaxanthin, a xanthophyll carotenoid, is a nutrient with Astaxanthin is a carotenoid nutrient with unique cell membrane actions and diverse clinical benefits. molecular properties that precisely position it This molecule neutralizes free radicals or other oxidants by within cell membranes and circulating lipoproteins, either accepting or donating electrons, and without being thereby imbuing them with potent antioxidant and destroyed or becoming a pro-oxidant in the process. Its linear, anti-inflammatory actions.1,2 Astaxanthin also polar-nonpolar-polar molecular layout equips it to precisely effectively protects the double membrane system insert into the membrane and span its entire width. In this of mitochondria, to the point of boosting their position, astaxanthin can intercept reactive molecular species energy production efficiency.3 As a dietary supple- within the membrane’s hydrophobic interior and along its ment, astaxanthin demonstrates an exceptional hydrophilic boundaries. Clinically, astaxanthin has shown range of benefits, mostly at very modest dietary diverse benefits, with excellent safety and tolerability. In intakes (40 mg/day or less). The molecular struc- double-blind, randomized controlled trials (RCTs), astaxanthin ture of astaxanthin is illustrated in Figure 1. lowered oxidative stress in overweight and obese subjects and Humans do not make astaxanthin.4 Current in smokers.
  • Ionone: Its Occurrence and Biological Function and Metabolic Engineering

    Ionone: Its Occurrence and Biological Function and Metabolic Engineering

    plants Review β-Ionone: Its Occurrence and Biological Function and Metabolic Engineering Antonello Paparella 1 , Liora Shaltiel-Harpaza 2,3 and Mwafaq Ibdah 4,* 1 Faculty of Bioscience and Technology for Food, Agriculture, and Environment, University of Teramo, Via Balzarini 1, 64100 Teramo, Italy; [email protected] 2 Migal Galilee Research Institute, P.O. Box 831, Kiryat Shmona 11016, Israel; [email protected] 3 Tel Hai College, P.O. Box 831, Kiryat Shmona, Upper Galilee 12210, Israel 4 Newe Yaar Research Center, Agricultural Research Organization, P.O. Box 1021, Ramat Yishay 30095, Israel * Correspondence: [email protected]; Tel.: +972-4-953-9537; Fax: +972-4-983-6936 Abstract: β-Ionone is a natural plant volatile compound, and it is the 9,10 and 90,100 cleavage product of β-carotene by the carotenoid cleavage dioxygenase. β-Ionone is widely distributed in flowers, fruits, and vegetables. β-Ionone and other apocarotenoids comprise flavors, aromas, pigments, growth regulators, and defense compounds; serve as ecological cues; have roles as insect attractants or repellants, and have antibacterial and fungicidal properties. In recent years, β-ionone has also re- ceived increased attention from the biomedical community for its potential as an anticancer treatment and for other human health benefits. However, β-ionone is typically produced at relatively low levels in plants. Thus, expressing plant biosynthetic pathway genes in microbial hosts and engineering the metabolic pathway/host to increase metabolite production is an appealing alternative. In the β β present review, we discuss -ionone occurrence, the biological activities of -ionone, emphasizing insect attractant/repellant activities, and the current strategies and achievements used to reconstruct enzyme pathways in microorganisms in an effort to to attain higher amounts of the desired β-ionone.
  • Ionone Is More Than a Violet's Fragrance

    Ionone Is More Than a Violet's Fragrance

    molecules Review Ionone Is More than a Violet’s Fragrance: A Review Lujain Aloum 1 , Eman Alefishat 1,2 , Abdu Adem 1 and Georg Petroianu 1,* 1 Department of Pharmacology, College of Medicine and Health Sciences, Khalifa University of Science and Technology, Abu Dhabi 127788, UAE; [email protected] (L.A.); Eman.alefi[email protected] (E.A.); [email protected] (A.A.) 2 Center for Biotechnology, Khalifa University of Science and Technology, Abu Dhabi 127788, UAE * Correspondence: [email protected]; Tel.: +971-50-413-4525 Academic Editor: Domenico Montesano Received: 25 November 2020; Accepted: 8 December 2020; Published: 10 December 2020 Abstract: The term ionone is derived from “iona” (Greek for violet) which refers to the violet scent and “ketone” due to its structure. Ionones can either be chemically synthesized or endogenously produced via asymmetric cleavage of β-carotene by β-carotene oxygenase 2 (BCO2). We recently proposed a possible metabolic pathway for the conversion of α-and β-pinene into α-and β-ionone. The differences between BCO1 and BCO2 suggest a unique physiological role of BCO2; implying that β-ionone (one of BCO2 products) is involved in a prospective biological function. This review focuses on the effects of ionones and the postulated mechanisms or signaling cascades involved mediating these effects. β-Ionone, whether of an endogenous or exogenous origin possesses a range of pharmacological effects including anticancer, chemopreventive, cancer promoting, melanogenesis, anti-inflammatory and antimicrobial actions. β-Ionone mediates these effects via activation of olfactory receptor (OR51E2) and regulation of the activity or expression of cell cycle regulatory proteins, pro-apoptotic and anti-apoptotic proteins, HMG-CoA reductase and pro-inflammatory mediators.
  • Engineering the Oleaginous Yeast Yarrowia Lipolytica to Produce the Aroma Compound Β- Ionone

    Engineering the Oleaginous Yeast Yarrowia Lipolytica to Produce the Aroma Compound Β- Ionone

    Lawrence Berkeley National Laboratory Recent Work Title Engineering the oleaginous yeast Yarrowia lipolytica to produce the aroma compound β- ionone. Permalink https://escholarship.org/uc/item/0nq772w2 Journal Microbial cell factories, 17(1) ISSN 1475-2859 Authors Czajka, Jeffrey J Nathenson, Justin A Benites, Veronica T et al. Publication Date 2018-09-01 DOI 10.1186/s12934-018-0984-x Peer reviewed eScholarship.org Powered by the California Digital Library University of California Czajka et al. Microb Cell Fact (2018) 17:136 https://doi.org/10.1186/s12934-018-0984-x Microbial Cell Factories RESEARCH Open Access Engineering the oleaginous yeast Yarrowia lipolytica to produce the aroma compound β‑ionone Jefrey J. Czajka1, Justin A. Nathenson1, Veronica T. Benites2, Edward E. K. Baidoo2, Qianshun Cheng3,4, Yechun Wang5* and Yinjie J. Tang1* Abstract Background: β-Ionone is a fragrant terpenoid that generates a pleasant foral scent and is used in diverse applica- tions as a cosmetic and favoring ingredient. A growing consumer desire for natural products has increased the mar- ket demand for natural β-ionone. To date, chemical extraction from plants remains the main approach for commercial natural β-ionone production. Unfortunately, changing climate and geopolitical issues can cause instability in the β-ionone supply chain. Microbial fermentation using generally recognized as safe (GRAS) yeast ofers an alternative method for producing natural β-ionone. Yarrowia lipolytica is an attractive host due to its oleaginous nature, estab- lished genetic tools, and large intercellular pool size of acetyl-CoA (the terpenoid backbone precursor). Results: A push–pull strategy via genome engineering was applied to a Y.
  • Application of the Dehydration Homogeneous Liquid–Liquid Extraction (DHLLE) Sample Preparation Method for Fingerprinting of Honey Volatiles

    Application of the Dehydration Homogeneous Liquid–Liquid Extraction (DHLLE) Sample Preparation Method for Fingerprinting of Honey Volatiles

    molecules Article Application of the Dehydration Homogeneous Liquid–Liquid Extraction (DHLLE) Sample Preparation Method for Fingerprinting of Honey Volatiles Piotr M. Ku´s 1,* and Igor Jerkovi´c 2 1 Department of Pharmacognosy, Wrocław Medical University, ul. Borowska 211a, 50-556 Wrocław, Poland 2 Department of Organic Chemistry, Faculty of Chemistry and Technology, University of Split, Rudera¯ Boškovi´ca35, 21000 Split, Croatia; [email protected] * Correspondence: [email protected] Abstract: Recently, we proposed a new sample preparation method involving reduced solvent and sample usage, based on dehydration homogeneous liquid–liquid extraction (DHLLE) for the screening of volatiles and semi-volatiles from honey. In the present research, the method was applied to a wide range of honeys (21 different representative unifloral samples) to determine its suitability for detecting characteristic honey compounds from different chemical classes. GC-FID/MS disclosed 130 compounds from different structural and chemical groups. The DHLLE method allowed the extraction and identification of a wide range of previously reported specific and nonspecific marker compounds belonging to different chemical groups (including monoterpenes, norisoprenoids, benzene derivatives, or nitrogen compounds). For example, DHLLE allowed the detection of cornflower honey chemical markers: 3-oxo-retro-α-ionols, 3,4-dihydro-3-oxoedulan, phenyllactic acid; Citation: Ku´s,P.M.; Jerkovi´c,I. coffee honey markers: theobromine and caffeine; linden honey markers: 4-isopropenylcyclohexa- Application of the Dehydration 1,3-diene-1-carboxylic acid and 4-(2-hydroxy-2-propanyl)cyclohexa-1,3-diene-1-carboxylic acid, as Homogeneous Liquid–Liquid well as furan derivatives from buckwheat honey. The obtained results were comparable with the Extraction (DHLLE) Sample Preparation Method for previously reported data on markers of various honey varieties.
  • Β-Carotene Biotransformation to Obtain Aroma Compounds Biotransformação De Β-Caroteno Para Obtenção De Compostos De Aroma

    Β-Carotene Biotransformation to Obtain Aroma Compounds Biotransformação De Β-Caroteno Para Obtenção De Compostos De Aroma

    ISSN 0101-2061 Ciência e Tecnologia de Alimentos Original β-Carotene biotransformation to obtain aroma compounds Biotransformação de β-caroteno para obtenção de compostos de aroma Mariana UENOJO1*, Glaucia Maria PASTORE1 Abstract Carotenoids are important constituents of food due to their color and because their degradation products generate important volatile compounds in foods. Aroma compounds derived from carotenoids are widely distributed in nature, and they are precursors of many important aromas in foods such as fruits and in flowers as well. They present high aromatic potential and are therefore of great interest to the industries of aromas and fragrances. In this study, more than 300 previously isolated microorganisms with potential for biotransformation of β-carotene present in the culture medium were selected using the plate method; about 80 strains presented capacity to produce aroma compounds and 7 strains were selected by an untrained panel of tasters to generate aroma compounds. Theβ -ionone was the main compound produced by CS1 (34.0 mg.L-1) and CF9 (42.4 mg.L-1) microorganisms at 72 and 24 hours of fermentation, cultured with and without pre-inoculation, respectively. The β-damascone and pseudoionone were found in low concentrations, 1,1,6-trimethyl-1,2,3,4-tetrahydronaphthalen (TTN) was tentatively identified and other compounds such as apocarotenoids, apparently obtained from the cleavage of the central part of the carotenoid, were detected. Keywords: carotenoids; biotransformation; β-carotene, β-ionone; aroma. Resumo Carotenoides são importantes constituintes de alimentos por sua coloração e por seus produtos de degradação gerarem compostos voláteis em alimentos. Compostos de aromas derivados de carotenoides estão distribuídos na natureza, constituem precursores de aromas importantes em alimentos como frutas e em flores.
  • Development of the Industrial Synthesis of Vitamin A

    Development of the Industrial Synthesis of Vitamin A

    Tetrahedron 72 (2016) 1645e1652 Contents lists available at ScienceDirect Tetrahedron journal homepage: www.elsevier.com/locate/tet Tetrahedron report 1103 Development of the industrial synthesis of vitamin A Gemma L. Parker, Laura K. Smith *, Ian R. Baxendale Department of Chemistry, Durham University, South Road, Durham, DH1 3LE, UK article info abstract Article history: The advances made in chemistry during the last 70 years are excellently illustrated by the development Received 8 October 2015 of the industrial synthesis of vitamin A, a diterpene crucial in preventing premature death and visual Received in revised form 29 January 2016 problems. Arens and van Dorp published the first route in 1946, and critical contributions have been Accepted 10 February 2016 made by a number of scientists since, benefitting from fruitful collaborations between industry and Available online 11 February 2016 academia. However, these improvements have been mostly incremental, and the work has been per- formed by a limited number of companies; as yet, there is still no ‘ideal’ synthesis of vitamin A. Keywords: Ó 2016 Elsevier Ltd. All rights reserved. Vitamin A b-Ionone Arens-van Dorp reaction Wittig reaction Julia Olefination Contents 1. Introduction . ................................................1645 2. Previous work . ................................................1646 3. Arens-van Dorp synthesis of vitamin A (Organon) . ...................................1646 4. Isler synthesis and modification (Hoffmann-La Roche) . ...................................1647