DOCSLIB.ORG

Synthesis of Calcitonin Gene-Related Peptide (CGRP) by Rat Arterial Endothelial Cells

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Synthesis of Calcitonin Gene-Related Peptide (CGRP) by Rat Arterial Endothelial Cells Histol Histopathol (2001) 16: 1073-1079 Histology and 001: 10.14670/HH-16.1073 Histopathology http://www.hh.um.es Cellular and Molecular Biology Synthesis of calcitonin gene-related peptide (CGRP) by rat arterial endothelial cells Y. DOi, H. Kudo, T. Nishino, K. Kayashima, H. Kiyonaga, T. Nagata, S. Nara, M. Morita and S. Fujimoto Department of Anatomy, University of Occupational and Environmental Health, School of Medicine, Kitakyushu, Japan Summary. We investigated the protein and mRNA demonstrated that immunoreactivity for CGRP was expression of calcitonin gene-related peptide (CGRP) in localized in regions of the rough endoplasmic reticulum endothelial cells of the rat thoracic aorta and femoral (rER). Ozaka et al. (1997) showed that immunoreactivity artery. Light microscopic immunocytochemistry for CGRP was observed in cisterns of the rER in revealed that immunoreactivity for CG RP was endothelial cells of the rat carotid body artery and its preferentially located in the endothelium of both vessels. branches. These data imply that such endothelial cells Immunoelectron microscopy showed that CGRP­ can synthesize CGRP. However, to our knowledge, immunoreactive gold particles were preferentially mRNA expression of this peptide in endothelial cells of localized on cisterns of the rough endoplasmic reticulum mammalian vessels has not been studied previously. and on the Weibel-Palade (WP) bodies in the endothelial Following the proposal of endothelium-dependent cells. Prepro CGRP mRNA signals were also detected vasodilation by Furchgott and Zawadzki (1980) and on the endothelium. Our results are the firs t to vasoconstriction by De May and Vanhoutte (1983), demonstrate that endothelial cells of both elastic and extensive pharmacological and biochemical analyses large muscular arteries synthesize CGRP and store it, in revealed vasomotor functions of endothelium-derived part, in WP bodies, implying that CGRP may act as an relaxing factors (EDRF) such as nitric oxide (NO) and endothelium-derived relaxing factor in these vessels. prostacyclin (Rubanyi, 1991). In addition, endothelium­ derived constricting factors (EDCF) such as endothelin Key words: Calcitonin gene-related peptide, III situ (ET)-I, angiotensin-II and thromboxane-A2 have been hybridization, Immunocytochemistry, Immunoelectron identified in a variety of vessels (Drexler and Hornig, microscopy, Weibel-Palade bodies 1999; Ruschitzka et aI., 1999). Endothelial cells possess Weibel-Palade (WP) bodies, Golgi apparatus-derived specific granules, in Introduction which ET-l (Sakamoto et al., 1993; Doi et al., 1996; Nomiyama et aI., 1998; Kayashima et aI., 1999) and NO Calcitonin gene-related peptide (CGRP) is a 37- synthase (Fukuda et aI., 1995) are stored. Furthermore, amino-acid peptide encoded by tissue-specific Ozaka et al. (1997) demonstrated by the double alternative messenger RNA (mRNA) processing of the immunolabeling that both ET-l and CGRP coexist in the calcitonin gene (Amara et al., 1982). Initially isolated same WP bodies of the rat carotid body artery and its from the thyroid, CGRP was subsequently found to be branches, implying that these peptides may be involved ubiquitously distributed throughout the body and in regulating local blood flow through the carotid body. particularly abundant in the central nervous system and Although the significance of ET-l as an EDCF is widely nerve fibers associated with blood vessels (Rosenfeld et accepted (Yanagisawa et aI., 1988), more detailed studies aI., 1983; Mulderry et aI., 1985). Recently, Kawasaki et combined with in situ hybridization are necessary to al. (1988) identified a vasodilatory action of CGRP as elucidate whether WP bodies are involved in storage of either neurotransmitter or neuromodulator, independent CGRP in a wide range of vessels. The present study was of noncholinergic nonadrenergic vasomotor nerve designed to investigate expressions of CGRP protein and endings. By immunocytochemical analyses on mRNA in rat thoracic aorta and femoral artery, in which endothelial cells of the human umbilical vein and artery, endothelial cells possess many WP bodies. both in situ and in culture, Cai et al. (l993a,b) Materials and methods Offprint requests to: Dr. Yoshiaki Doi, Department of Anatomy. University of Occupational and Environmental Health. School of Animals Medicine, 1-1 Iseigaoka. Yahatanishi-ku. Kitakyushu 807·8555. Japan. Fax: +8 1 (93) 692-0121. e-mail: [email protected] Male adult Wistar rats weighing 280±20 g were used 1074 Synthesis of CGRP in rat arteries for the present study. We followed the Guiding PBS, blocked in 1 % BSA in 0.1 M PBS for 20 min, Principles for the Care and Use of Animals approved by incubated with goat anti-rabbit IgG-coated 15 nm the University of Occupational and Environmental colloidal gold (Ultra Biosols, Liverpool, UK) with a Health in accordance with the principles of the dilution of 1: 1 00 in 0.1 % BSA in 0.1 M PBS for 1 hr at declaration of Helsinki (1983) for the care and use of room temperature, and then rinsed in O.lM PBS. The animals. Animals were deeply anesthetized with an specificity of the immunostaining was confirmed by intraperitoneal injection of pentobarbital (50 mg/kg). substituting the primary antibodies for normal rabbit The thoracic aorta and femoral artery were isolated after serum or PBS. perfusion with a physiological saline followed by a solution of 2 % paraformaldehyde (PFA) in O.IM In situ hybridization phosphate buffer via the left ventricle for 5 min each. Deparaffinized and hydrated sections (approximately Tissue preparation 5-,um thick) were blocked with 0.1 % H20z in methanol for 20 min to destroy endogenous peroxidase, digested For light microscopy, specimens were fixed in a with 1 ,ug/ml of proteinase K in 10 mM Tris-HCI (pH solution of 4% PFA in O.IM phosphate buffer for two 8.0), 1 mM ethylenediamine- N,N,N',N'-tetraacetic acid days at 4 0c. For conventional electron microscopy, (EDTA) for 5 min, fixed in 4% PFA at room temperature specimens were fixed in a mixture of 2% PFA and 2.5% for 10 min, immersed in 0.2M HCI for 10 min to remove glutaraldehyde in O.lM phosphate buffer for 2 hr at basic substances and then acetylated with 0.25% acetic 4°C, postfixed in 1 % osmium tetroxide in the same anhydride, 0.1 M triethanolamine-HCI (pH 8.0) for 10 buffer for 2 hr at 4 °C, dehydrated in ethanol, and min. Subsequently, the sections were dehydrated and air­ embedded in epoxy resin. Ultrathin sections were dried at room temperature for 30 min. Sections were prepared using an ultramicrotome (LKB 2128), were pre incubated with a hybridization buffer containing 20 stained with saturated uranyl acetate and lead citrate, and mM Tris-HCI (pH 7.5), 0.9M NaCI, 6 mM EDTA, IX examined using a JEM 1200 EX electron microscope. Denhardt's reagent (0.02% Ficoll, 0.02% polyvinyl pyrrolidone, and 0.02% BSA), at room temperature for 1 Light microscopic immunocytochemistry hr in a humid chamber. The oligonucleotides for prepro CGRP mRNA used in this in situ hybridization study Paraffin-embedded sections (approximately 5-,um were labeled at the 3' tail with digoxigenin (DIG)-ll­ thick) were deparaffinized, rinsed briefly in O.IM dUTP using a DIG Oligonucleotide Tailing Kit phosphate-buffered saline (PBS), digested with 0.4% (Boehringer Mannheim, Mannheim, Germany). The pepsin in distilled water containing O.OIN HC1, treated sequence of the antisense oligonucleotide probe (5'­ with 0.3 % H 20 2 in absolute methanol to block AAGCCTGCCAGCCGATGGGTCACGCAGGTGGCA endogenous peroxidase activity, and thoroughly washed GTGTTGCAGGATCTCIT-3'; 50 mer) was determined in O.IM PBS. Sections were incubated in a humid from the sequence of the cDNA encoding prepro CGRP chamber with rabbit anti-rat CGRP polyclonal (whole and synthesized by Takara Custom DNA Services serum) antibody (Sigma-Genosys, The Woodlands, TX) (Takara Shuzo, Kyoto, Japan). The probe was diluted in diluted to 1 :200 with 0.1 % bovine serum albumin (BSA) the hybridization buffer to which 10% dextran sulfate in O.IM PBS for 18 hr at 4 0c. After rinsing in 0.1 M had been added, and lOng probe/ lOO ,ul was applied to PBS, sections were reacted using the indirect each glass slide. Parafilm M (American National Can, immunoperoxidase method (Histfine Simple Stain PO Greenwich, CT) was placed over the sections, and the Kit, Nichirei, Tokyo, Japan). The peroxidase complex sections were incubated overnight at 45 °C in a humid was visualized by treatment with a freshly prepared chamber. After removing the coverslips in 2x saline­ diaminobenzidine tetrahydrochloride (DAB; 0.1 mg/ml) sodium citrate (SCC; Ix SCC; 150 mM NaCI, 15 mM solution with 0.01 % H20 2 for 5 min. The specificity of sodium citrate; pH 7.0) at room temperature, the sections the immunostaining was confirmed by substituting the were washed in 2x SCC at room temperature for 20 min, primary antibodies for normal rabbit serum or PBS. twice in Ix SCC at 45 °C for 30 min each, and in 2x SCC at room temperature for 20 min. They were then Immunoelectron microscopy immunoreacted with peroxidase-conjugated anti-DIG antibody (Boehringer Mannheim, Mannheim, Germany). For the post-embedding method, specimens were After rinsing with O.IM Tris-HCI (pH 7.5), 0.15 M immersed in a periodate-Iysine-PFA solution (Mclean NaCl, and 0.05% Tween 20, the peroxidase complex was and Nakane, 1974) for 6 hr at 4°C, dehydrated in amplified by Tyramide Signal Amplification Kit ethanol, and embedded in epoxy resin. After non­ (DuPont NEN, Boston, MA) and visualized by treatment specific binding was blocked with 1 % BSA in O.IM with a freshly prepared DAB (0.1 mg/ml) solution with PBS, ultrathin sections of gold interference colors were 0 .01 % Hz02 for 5 min at room temperature. After immunolabeled with rabbit anti-rat CGRP antibody at a dehydration, sections were counterstained with dilution of 1 :800 to 1:1600 in 1% BSA in O.lM PBS for methylgreen, and then mounted with cover slips by 4 hr at room temperature.
Load more

Recommended publications
  • The Cardiopulmonary Effects of the Calcitonin Gene- Related Peptide Family Kalsitonin-Geni İle İlişkili Peptit Ailesinin Kardiyopulmoner Etkileri
    Turk J Pharm Sci 2020;17(3):349-356 DOI: 10.4274/tjps.galenos.2019.47123 REVIEW The Cardiopulmonary Effects of the Calcitonin Gene- related Peptide Family Kalsitonin-Geni İle İlişkili Peptit Ailesinin Kardiyopulmoner Etkileri Gökçen TELLİ1, Banu Cahide TEL1, Bülent GÜMÜŞEL2* 1Hacettepe University Faculty of Pharmacy, Department of Pharmacology, Ankara, Turkey 2Lokman Hekim University Faculty of Pharmacy, Department of Pharmacology, Ankara, Turkey ABSTRACT Cardiopulmonary diseases are very common among the population. They are high-cost diseases and there are still no definitive treatments. The roles of members of the calcitonin-gene related-peptide (CGRP) family in treating cardiopulmonary diseases have been studied for many years and promising results obtained. Especially in recent years, two important members of the family, adrenomedullin and adrenomedullin2/intermedin, have been considered new treatment targets in cardiopulmonary diseases. In this review, the roles of CGRP family members in cardiopulmonary diseases are investigated based on the studies performed to date. Key words: CGRP family, cardiopulmonary diseases, adrenomedullin, adrenomedullin2/intermedin, pulmonary hypertension ÖZ Kardiyopulmoner hastalıklar toplumda sık görülen, tedavi maliyeti oldukça yüksek ve halen kesin bir tedavisi bulunmayan hastalıklardır. Kalsitonin- geni ile ilişkili peptit (CGRP) ailesinin üyelerinin bir çok kardiyopulmoner hastalıktaki rolleri uzun yıllardır çalışılmakta ve umut vadeden sonuçlar elde edilmektedir. Özellikle son yıllarda CGRP ailesine
    [Show full text]
  • Nitric Oxide As a Second Messenger in Parathyroid Hormone-Related Protein Signaling
    433 Nitric oxide as a second messenger in parathyroid hormone-related protein signaling L Kalinowski, L W Dobrucki and T Malinski Department of Chemistry and Biochemistry, Ohio University, Athens, Ohio, USA (Requests for offprints should be addressed to T Malinski, Department of Chemistry and Biochemistry, Ohio University, Biochemistry Research Laboratories 136, Athens, Ohio 45701–2979, USA; Email: [email protected]) (L Kalinowski was on sabbatical leave from the Department of Clinical Biochemistry, Medical University of Gdansk and Laboratory of Cellular and Molecular Nephrology, Medical Research Center of the Polish Academy of Science, Poland) Abstract Parathyroid hormone (PTH)-related protein (PTHrP) is competitive PTH/PTHrP receptor antagonists, 10 µmol/l produced in smooth muscles and endothelial cells and [Leu11,-Trp12]-hPTHrP(7–34)amide and 10 µmol/l is believed to participate in the local regulation of vascu- [Nle8,18,Tyr34]-bPTH(3–34)amide, were equipotent in lar tone. No direct evidence for the activation of antagonizing hPTH(1–34)-stimulated NO release; endothelium-derived nitric oxide (NO) signaling pathway [Leu11,-Trp12]-hPTHrP(7–34)amide was more potent by PTHrP has been found despite attempts to identify it. than [Nle8,18,Tyr34]-bPTH(3–34)amide in inhibiting Based on direct in situ measurements, it is reported here for hPTHrP(1–34)-stimulated NO release. The PKC inhibi- the first time that the human PTH/PTHrP receptor tor, H-7 (50 µmol/l), did not change hPTH(1–34)- and analogs, hPTH(1–34) and hPTHrP(1–34), stimulate NO hPTHrP(1–34)-stimulated NO release, whereas the release from a single endothelial cell.
    [Show full text]
  • Recent Advances in Endothelin Research on Cardiovascular and Endocrine Systems
    Endocrine Journal 1994, 41(5), 491-507 Review Recent Advances in Endothelin Research on Cardiovascular and Endocrine Systems MITSUHIDE NARUSE, KIYoxo NARUSE, AND HIR0SH1 DEMURA Department of Medicine, Institute of Clinical Endocrinology, TokyoWomen's Medical College, Tokyo162, Japan Introduction Structure of ET and ET Receptor Since the quite exciting discovery in 1988 of The molecular and biochemical aspects of ET endothelin (ET) in the culture medium of aortic en- family peptides and ET receptors have been re- dothelial cells by Yanagisawa and coworkers [1], viewed by Masaki and Yanagisawa [13] and others evidence has accumulated to support its important [14-16]. We here describe the fundamentals. roles in the regulation of blood pressure and body fluid homeostasis and its pathophysiological sig- 1. ET Peptides nificance in various cardiovascular diseases. The discovery of ET and the opponent substances in- The ET molecule consists of 21 amino acid resi- cluding nitric oxide [2] and natriuretic peptides [3] dues with two intramolecular disulfide bonds be- during the last decade was epoch-making in the tween cystein residues at 1 and 15 and 3 and 11, field of "Cardiovascular Endocrinology". respectively. The ring structure and the hydropho- Because of its impressive potency and the long bic amino acid residues at the C-terminus are in- duration of its pressor action [1], the roles of ET in dispensable to its full biological activities. There the regulation of cardiovascular homeostasis have are three distinct isof orms of ET: ET-1, ET-2, and been extensively studied. However, the co-expres- ET-3 [13]. The difference in the amino acid se- sion or close localization of ET and its receptors in quence is seen in the ring structure, while they various tissues other than the vascular vessels sug- share the same sequence in the linear C-terminal gest non-vascular roles of ET [4-6].
    [Show full text]
  • Glucagon-Like Peptide-1 and Its Class BG Protein–Coupled Receptors
    1521-0081/68/4/954–1013$25.00 http://dx.doi.org/10.1124/pr.115.011395 PHARMACOLOGICAL REVIEWS Pharmacol Rev 68:954–1013, October 2016 Copyright © 2016 by The Author(s) This is an open access article distributed under the CC BY-NC Attribution 4.0 International license. ASSOCIATE EDITOR: RICHARD DEQUAN YE Glucagon-Like Peptide-1 and Its Class B G Protein–Coupled Receptors: A Long March to Therapeutic Successes Chris de Graaf, Dan Donnelly, Denise Wootten, Jesper Lau, Patrick M. Sexton, Laurence J. Miller, Jung-Mo Ahn, Jiayu Liao, Madeleine M. Fletcher, Dehua Yang, Alastair J. H. Brown, Caihong Zhou, Jiejie Deng, and Ming-Wei Wang Division of Medicinal Chemistry, Faculty of Sciences, Vrije Universiteit Amsterdam, Amsterdam, The Netherlands (C.d.G.); School of Biomedical Sciences, University of Leeds, Leeds, United Kingdom (D.D.); Drug Discovery Biology Theme and Department of Pharmacology, Monash Institute of Pharmaceutical Sciences, Parkville, Victoria, Australia (D.W., P.M.S., M.M.F.); Protein and Peptide Chemistry, Global Research, Novo Nordisk A/S, Måløv, Denmark (J.La.); Department of Molecular Pharmacology and Experimental Therapeutics, Mayo Clinic, Scottsdale, Arizona (L.J.M.); Department of Chemistry and Biochemistry, University of Texas at Dallas, Richardson, Texas (J.-M.A.); Department of Bioengineering, Bourns College of Engineering, University of California at Riverside, Riverside, California (J.Li.); National Center for Drug Screening and CAS Key Laboratory of Receptor Research, Shanghai Institute of Materia Medica, Chinese Academy of Sciences, Shanghai, China (D.Y., C.Z., J.D., M.-W.W.); Heptares Therapeutics, BioPark, Welwyn Garden City, United Kingdom (A.J.H.B.); and School of Pharmacy, Fudan University, Zhangjiang High-Tech Park, Shanghai, China (M.-W.W.) Downloaded from Abstract.
    [Show full text]
  • Vascular Effects of Parathyroid Hormone and Parathyroid Hormone-Related Protein in the Split Hydronephrotic Rat Kidney
    2827 Journal of Physiology (1995), 483.2, pp. 481-490 481 Vascular effects of parathyroid hormone and parathyroid hormone-related protein in the split hydronephrotic rat kidney K. Endlich *, T. Massfelder t*, J. J. Helwig t and M. Steinhausen t I. Physiologisches Institut der Universitat Heidelberg, D-69120 Heidelberg, Germany and tLaboratoire de Physiologie Cellulaire Re'nale, Universite Louis Pasteur, Strasbourg, France 1. The effects of locally applied parathyroid hormone-related protein (PTHRP), a putative autocrine/paracrine hormone, on vascular diameters and glomerular blood flow (GBF) in the split hydronephrotic rat kidney were studied. As PTHRP interacts with parathyroid hormone (PTH) receptors in all tissues tested so far, the effects of PTHRP were compared with those of PTH. 2. Preglomerular vessels dilated in a concentration- and time-dependent manner that was almost identical for PTH and PTHRP. A significant preglomerular vasodilatation (5-17%) occurred at a threshold concentration of 10-10 mol 1-1 PTH or PTHRP, which raised GBF by 20 + 2 and 31 + 4%, respectively (means + S.E.M., n = 6). PTH or PTHRP (10-7 mol 1-') increased preglomerular diameters (11-36%) and GBF (60 + 10 and 70 + 8%, respectively) to near maximum. The most prominent dilatation was located at the interlobular artery and at the proximal afferent arteriole. 3. Efferent arterioles were not affected by either PTH or PTHRP. 4. Estimated concentrations of half-maximal response (EC50) for preglomerular vasodilatation and GBF increase were in the nanomolar to subnanomolar range. 5. After inhibition of angiotensin I-converting enzyme by 2 x 10-6 mol kg-' quinapril i.v.
    [Show full text]
  • Autocrine Endothelin-3/Endothelin Receptor B Signaling Maintains Cellular and Molecular Properties of Glioblastoma Stem Cells
    Published OnlineFirst October 19, 2011; DOI: 10.1158/1541-7786.MCR-10-0563 Molecular Cancer Cancer Genes and Genomics Research Autocrine Endothelin-3/Endothelin Receptor B Signaling Maintains Cellular and Molecular Properties of Glioblastoma Stem Cells Yue Liu1, Fei Ye1,9, Kazunari Yamada1, Jonathan L. Tso1, Yibei Zhang1, David H. Nguyen1, Qinghua Dong1,10, Horacio Soto2, Jinny Choe1, Anna Dembo1, Hayley Wheeler1, Ascia Eskin3, Ingrid Schmid4, William H. Yong5,8, Paul S. Mischel5,8, Timothy F. Cloughesy6,8, Harley I. Kornblum7,8, Stanley F. Nelson3,8, Linda M. Liau2,8, and Cho-Lea Tso1,8 Abstract Glioblastoma stem cells (GSC) express both radial glial cell and neural crest cell (NCC)-associated genes. We report that endothelin 3 (EDN3), an essential mitogen for NCC development and migration, is highly produced by GSCs. Serum-induced proliferative differentiation rapidly decreased EDN3 production and downregulated the expression of stemness-associated genes, and reciprocally, two glioblastoma markers, EDN1 and YKL-40 transcripts, were induced. Correspondingly, patient glioblastoma tissues express low levels of EDN3 mRNA and high levels of EDN1 and YKL-40 mRNA. Blocking EDN3/EDN receptor B (EDNRB) signaling by an EDNRB antagonist (BQ788), or EDN3 RNA interference (siRNA), leads to cell apoptosis and functional impairment of tumor sphere formation and cell spreading/migration in culture and loss of tumorigenic capacity in animals. Using exogenous EDN3 as the sole mitogen in culture does not support GSC propagation, but it can rescue GSCs from undergoing cell apoptosis. Molecular analysis by gene expression profiling revealed that most genes downregulated by EDN3/EDNRB blockade were those involved in cytoskeleton organization, pause of growth and differentiation, and DNA damage response, implicating the involvement of EDN3/EDNRB signaling in maintaining GSC migration, undifferentiation, and survival.
    [Show full text]
  • Airway Endothelin Levels in Asthma: Influence of Endobronchial Allergen Challenge and Maintenance Corticosteroid Therapy
    Eur Respir J 1997; 10: 1026–1032 Copyright ERS Journals Ltd 1997 DOI: 10.1183/09031936.97.10051026 European Respiratory Journal Printed in UK - all rights reserved ISSN 0903 - 1936 Airway endothelin levels in asthma: influence of endobronchial allergen challenge and maintenance corticosteroid therapy A.E. Redington*, D.R. Springall**, M.A. Ghatei+, J. Madden*, S.R. Bloom+, A.J. Frew*, J.M. Polak**, S.T. Holgate* P.H. Howarth* Airway endothelin levels in asthma: influence of endobronchial allergen challenge and *University Medicine, Southampton General maintenance corticosteroid therapy. A.E. Redington, D.R. Springall, M.A. Ghatei, J. Hospital, UK. Depts of **Histochemistry Madden, S.R. Bloom, A.J. Frew, J.M. Polak, S.T. Holgate, P.H. Howarth. ©ERS Journals and +Medicine, Royal Postgraduate Medical Ltd 1997. School, Hammersmith Hospital, London, ABSTRACT: Endothelins (ETs) are 21 amino acid peptides which, in addition to UK. their other properties, are potent bronchoconstrictors. Whilst there is evidence of Correspondence: A.E. Redington the involvement of ET in the pathophysiology of chronic asthma, its contribution Room 4H17-21 to the acute allergic response is undefined. Health Sciences Centre To examine this, we have undertaken segmental bronchoprovocation with aller- Dept of Pathology gen and saline at separate sites in six atopic asthmatics receiving treatment with McMaster University 1200 Main Street West bronchodilators only and six atopic asthmatics additionally receiving treatment with Hamilton inhaled corticosteroids. Each challenged segment was lavaged 10 min after bron- Ontario choprovocation and concentrations of immunoreactive ET were measured in bron- Canada L8N 3Z5 choalveolar lavage fluid. In the non-steroid-treated subjects, there were significantly lower ET levels at the Keywords: Allergen challenge allergen-challenged sites compared to the saline-challenged sites (p<0.05).
    [Show full text]
  • Endocrine Test Selection and Interpretation
    The Quest Diagnostics Manual Endocrinology Test Selection and Interpretation Fourth Edition The Quest Diagnostics Manual Endocrinology Test Selection and Interpretation Fourth Edition Edited by: Delbert A. Fisher, MD Senior Science Officer Quest Diagnostics Nichols Institute Professor Emeritus, Pediatrics and Medicine UCLA School of Medicine Consulting Editors: Wael Salameh, MD, FACP Medical Director, Endocrinology/Metabolism Quest Diagnostics Nichols Institute San Juan Capistrano, CA Associate Clinical Professor of Medicine, David Geffen School of Medicine at UCLA Richard W. Furlanetto, MD, PhD Medical Director, Endocrinology/Metabolism Quest Diagnostics Nichols Institute Chantilly, VA ©2007 Quest Diagnostics Incorporated. All rights reserved. Fourth Edition Printed in the United States of America Quest, Quest Diagnostics, the associated logo, Nichols Institute, and all associated Quest Diagnostics marks are the trademarks of Quest Diagnostics. All third party marks − ®' and ™' − are the property of their respective owners. No part of this publication may be reproduced or transmitted in any form or by any means, electronic or mechanical, including photocopy, recording, and information storage and retrieval system, without permission in writing from the publisher. Address inquiries to the Medical Information Department, Quest Diagnostics Nichols Institute, 33608 Ortega Highway, San Juan Capistrano, CA 92690-6130. Previous editions copyrighted in 1996, 1998, and 2004. Re-order # IG1984 Forward Quest Diagnostics Nichols Institute has been
    [Show full text]
  • Dual Endothelin Receptor Blockade Acutely Improves Insulin Sensitivity in Obese Patients with Insulin Resistance and Coronary Artery Disease
    Emerging Treatments and Technologies ORIGINAL ARTICLE Dual Endothelin Receptor Blockade Acutely Improves Insulin Sensitivity in Obese Patients With Insulin Resistance and Coronary Artery Disease 1 2 GUNVOR AHLBORG, MD, PHD ADRIAN GONON, MD, PHD The vascular responses to ET-1 are 2 2 ALEXEY SHEMYAKIN, MD JOHN PERNOW, MD, PHD mediated via two receptor subtypes: ET 2 A FELIX B¨OHM, MD, PHD and ETB receptors (10,11). Both types of receptors are located on vascular smooth muscle cells and mediate vasoconstric- OBJECTIVE — Endothelin (ET)-1 is a vasoconstrictor and proinflammatory peptide that may tion. The ETB receptor is also located on inhibit glucose uptake. The objective of the study was to investigate if ET (selective ETA and dual endothelial cells and mediates vasodilata- ϩ ETA ETB) receptor blockade improves insulin sensitivity in patients with insulin resistance and tion by stimulating release of NO and coronary artery disease. prostacyclin. Early reports show that Ϯ ET-1 interferes with glucose metabolism RESEARCH DESIGN AND METHODS — Seven patients (aged 58 2 years) with as indicated by a drop in splanchnic glu- insulin resistance and coronary artery disease completed three hyperinsulinemic-euglycemic clamp protocols: a control clamp (saline infusion), during ET receptor blockade (BQ123), and cose production and peripheral glucose A utilization during ET-1 infusion in during combined ETA (BQ123) and ETB receptor blockade (BQ788). Splanchnic blood flow (SBF) and renal blood flow (RBF) were determined by infusions of cardiogreen and p- healthy subjects (12). Ferri et al. (4) dem- aminohippurate. onstrated a negative correlation between total glucose uptake and circulating ET-1 RESULTS — Total-body glucose uptake (M) differed between the clamp protocols with the levels in non–insulin-dependent diabe- highest value in the BQ123ϩBQ788 clamp (P Ͻ 0.05).
    [Show full text]
  • The Clinical Significance of Endothelin Receptor Type B in Hepatocellular
    Experimental and Molecular Pathology 107 (2019) 141–157 Contents lists available at ScienceDirect Experimental and Molecular Pathology journal homepage: www.elsevier.com/locate/yexmp The clinical significance of endothelin receptor type B in hepatocellular T carcinoma and its potential molecular mechanism ⁎ Lu Zhanga,1, Bin Luob,1, Yi-wu Danga, Rong-quan Heb, Gang Chena, Zhi-gang Pengb, , ⁎ Zhen-bo Fenga, a Department of Pathology, First Affiliated Hospital of Guangxi Medical University, No. 6 Shuangyong Road, Nanning, Guangxi Zhuang Autonomous Region530021,PR China b Department of Medical Oncology, First Affiliated Hospital of Guangxi Medical University, No. 6 Shuangyong Road, Nanning, Guangxi Zhuang Autonomous Region 530021, PR China ARTICLE INFO ABSTRACT Keywords: Objective: To explore the clinical significance and potential molecular mechanism of endothelin receptor typeB Endothelin receptor type B (EDNRB) in hepatocellular carcinoma (HCC). Hepatocellular carcinoma Methods: Immunohistochemistry was used to detect EDNRB protein expression level in 67 HCC paraffin em- Immunohistochemistry bedded tissues and adjacent tissues. Correlations between EDNRB expression level and clinicopathologic para- meters were analyzed in our study. The expression level and clinical significance of EDNRB in HCC were also evaluated from The Cancer Genome Atlas (TCGA) and Gene Expression Omnibus (GEO) database. The cBioPortal for Cancer Genomics was employed to analyze the EDNRB related genes, and Gene Ontology (GO) annotation, Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis and Protein-Protein Interaction (PPI) network were conducted for those EDNRB related genes. Results: Lower expression level of EDNRB in HCC was verified by immunohistochemistry than adjacent tissues (P < 0.0001). The expression level of EDNRB in HCC tissues was lower than normal control liver tissues based on TCGA and GEO data (standard mean difference [SMD] = −1.48, 95% [confidence interval] CI: 2 −1.63−(−1.33), P heterogeneity = 0.116, I = 32.4%).
    [Show full text]
  • Participation of Renal and Circulating Endothelin in Salt-Sensitive Essential Hypertension
    Journal of Human Hypertension (2002) 16, 459–467 2002 Nature Publishing Group All rights reserved 0950-9240/02 $25.00 www.nature.com/jhh REVIEW ARTICLE Participation of renal and circulating endothelin in salt-sensitive essential hypertension F Elijovich, and CL Laffer Department of Medicine, College of Human Medicine, Michigan State University, Medical Education and Research Center of Grand Rapids, MI, USA Salt sensitivity of blood pressure is a cardiovascular depending on their site of generation and binding to dif- risk factor, independent of and in addition to hyperten- ferent receptors. We review the available data on endo- sion. In essential hypertension, a conglomerate of clini- thelin in salt-sensitive essential hypertension and con- cal and biochemical characteristics defines a salt-sensi- clude that abnormalities of renal endothelin may play a tive phenotype. Despite extensive research on multiple primary role. More importantly, the salt-sensitive patient natriuretic and antinatriuretic systems, there is no may have blood pressure-dependency on endothelin in definitive answer yet about the major causes of salt-sen- all states of salt balance, thus predicting that endothelin sitivity, probably reflecting the complexity of salt- receptor blockers will have a major therapeutic role in balance regulation. The endothelins, ubiquitous pep- salt-sensitive essential hypertension. tides first described as potent vasoconstrictors, also Journal of Human Hypertension (2002) 16, 459–467. doi: have vasodilator, natriuretic and antinatriuretic
    [Show full text]
  • Novel Players in Cardioprotection: Insulin Like Growth Factor-1, Angiotensin-(1–7) and Angiotensin-(1–9)
    Pharmacological Research 101 (2015) 41–55 Contents lists available at ScienceDirect Pharmacological Research j ournal homepage: www.elsevier.com/locate/yphrs Review Novel players in cardioprotection: Insulin like growth factor-1, angiotensin-(1–7) and angiotensin-(1–9) a a a a Francisco Westermeier , Mario Bustamante , Mario Pavez , Lorena García , a b,c a,d,∗ Mario Chiong , María Paz Ocaranza , Sergio Lavandero a Advanced Center for Chronic Diseases (ACCDiS), Facultad Ciencias Químicas y Farmacéuticas & Facultad de Medicina, Universidad de Chile, Santiago, Chile b Advanced Center for Chronic Diseases (ACCDiS), Facultad de Medicina, Pontificia Universidad Católica de Chile, Santiago, Chile c División de Enfermedades Cardiovasculares, Facultad de Medicina, Pontificia Universidad Católica de Chile, Santiago, Chile d Departments of Internal Medicine (Division of Cardiology) and Molecular Biology, University of Texas Southwestern Medical Center, Dallas, TX, USA a r a t i b s c l e i n f o t r a c t Article history: Insulin-like growth factor-1, angiotensin-(1–7) and angiotensin-(1–9) have been proposed to be impor- Received 23 June 2015 tant mediators in cardioprotection. A large body of evidence indicates that insulin like growth factor-1 Received in revised form 27 June 2015 has pleotropic actions in the heart (i.e., contractility, metabolism, hypertrophy, autophagy, senescence Accepted 28 June 2015 and cell death) and, conversely, its deficiency is associated with impaired cardiac function. Recently, Available online 31 July 2015 we reported that insulin like growth factor-1 receptor is also located in plasma membrane invagina- 2+ tions with perinuclear localization, highlighting the role of nuclear Ca signaling in the heart.
    [Show full text]