Cladosporium Lebrasiae, a New Fungal Species Isolated from Milk Bread Rolls in France

Home , Capnodiales, Cladosporium, Cladosporium herbarum, Davidiellaceae

fungal biology 120 (2016) 1017e1029

journal homepage: www.elsevier.com/locate/funbio

Cladosporium lebrasiae, a new fungal species isolated from milk bread rolls in France

Josiane RAZAFINARIVOa, Jean-Luc JANYa, Pedro W. CROUSb, Rachelle LOOTENa, Vincent GAYDOUc, Georges BARBIERa, Jerome^ MOUNIERa, Valerie VASSEURa,* aUniversite de Brest, EA 3882, Laboratoire Universitaire de Biodiversite et Ecologie Microbienne, ESIAB, Technopole^ Brest-Iroise, 29280 Plouzane, France bCBS-KNAW Fungal Biodiversity Centre, P.O. Box 85167, 3508 AD Utrecht, The Netherlands cMeDIAN-Biophotonique et Technologies pour la Sante, Universite de Reims Champagne-Ardenne, FRE CNRS 3481 MEDyC, UFR de Pharmacie, 51 rue Cognacq-Jay, 51096 Reims cedex, France article info abstract

Article history: The fungal genus Cladosporium (Cladosporiaceae, Dothideomycetes) is composed of a large Received 12 February 2016 number of species, which can roughly be divided into three main species complexes: Cla- Received in revised form dosporium cladosporioides, Cladosporium herbarum, and Cladosporium sphaerospermum. The 29 March 2016 aim of this study was to characterize strains isolated from contaminated milk bread rolls Accepted 15 April 2016 by phenotypic and genotypic analyses. Using multilocus data from the internal transcribed Available online 23 April 2016 spacer ribosomal DNA (rDNA), partial translation elongation factor 1-a, actin, and beta- Corresponding Editor: tubulin gene sequences along with Fourier-transform infrared (FTIR) spectroscopy and Matthew Charles Fisher morphological observations, three isolates were identiﬁed as a new species in the C. sphaerospermum species complex. This novel species, described here as Cladosporium lebrasiae,is Keywords: phylogenetically and morphologically distinct from other species in this complex. Cladosporium sphaerospermum ª 2016 British Mycological Society. Published by Elsevier Ltd. All rights reserved. complex Fourier-transform infrared spectroscopy analysis Multilocus phylogeny Systematics

Introduction products usually occurs during the final stages of production. Contamination is commonly due to species belonging to the Mould contamination is of particular concern for the bakery genera Aspergillus, Aureobasidium, Cladosporium, Eurotium, Penicil- industry and causes important economic losses due to prod- lium or Wallemia that are frequently encountered in wheat flour, uct spoilage. Fungal spoilage results in visible growth on prod- and form conidia well adapted to aerial dispersal (Berghofer et al. ucts, alteration of taste and texture, potential production of 2003; Pitt & Hocking 2009; Weidenborner€ et al. 2000). Conidia of mycotoxins, and allergenic compounds. Since most fungal these different taxa may contaminate products during their fi- conidia and mycelia are sensitive to heat and destroyed nal cooling stages in bakeries. Moisture on the surface of the through the baking process, fungal contamination of bakery product after packaging, and before the product is fully cooled,

* Corresponding author. Tel.: þ33 0 290915100; fax: þ33 0 290915101. E-mail address: [email protected] (V. Vasseur). http://dx.doi.org/10.1016/j.funbio.2016.04.006 1878-6146/ª 2016 British Mycological Society. Published by Elsevier Ltd. All rights reserved. 1018 J. Razaﬁnarivo et al.

may also contribute to mould growth. Species pertaining to As- contaminated product sampled from the edge of fungal colo- pergillus, Cladosporium, Eurotium, Mucor,andPenicillium (Guynot nies were deposited on yeast malt agar medium (2 % malt ex- et al. 2002; Pitt & Hocking 2009; Suhr & Nielsen 2004; Tancinov a tract, 0.3 % yeast extract, and 1.5 % agar) supplemented with et al. 2012), as well as Wallemia sebi (Deschuyffeleer et al. 2015), penicillin G (50 mg L 1) and streptomycin (50 mg L 1). Plates a xerophilic fungus well adapted to low moisture products, were incubated for 10 d at 25 C prior to isolation. Three iso- have regularly been isolated from bakery products. The pH of lates were identified as Cladosporium sp. according to micro- the product, its water activity and organic acids present are scopic features (Bensch et al. 2012), and kept for further among the most important factors affecting the type and growth study. Isolates were deposited in the culture collection of the intensity of fungal contaminants (Guynot et al. 2002). Identifica- Universite de Bretagne Occidentale (Culture Collection of Uni- tion of the causal organism is necessary for better control versity of Western Brittany, LUBEM Plouzane, France) as against product spoilage, and requires an up to date knowledge strains UBOCC-A-112061, UBOCC-A-112062, and UBOCC-A- of fungal taxonomy, with special reference to the genera en- 112063 and in addition in the culture collection of the CBS- countered in bakery products. KNAW Fungal Biodiversity Centre (CBS, Utrecht, The Nether- Among these genera, the genus Cladosporium s. lat. comprises lands) as CBS 138280, CBS 138281, and CBS 138283. Nomencla- more than 993 names (Bensch et al. 2012), and is cosmopolitan in tural novelties and descriptions were deposited in MycoBank distribution. Cladosporium species are commonly isolated from (www.MycoBank.org; Crous et al. 2004). An additional 34 Clado- air, food, paint, plants, soil, and textiles (Ellis 1971, 1976; Farr sporium reference strains for Cladosporium fusiforme, Cladospo- et al. 1989; Flannigan 2001; Mullins 2001; Pitt & Hocking 2009; rium velox, Cladosporium sphaerospermum, Cladosporium Schubert et al. 2007), occur as endophytes, plant pathogens dominicanum, Cladosporium langeronii, Cladosporium psychroto- (Brown et al. 1998; El-Morsy 2000; Riesen & Sieber 1985), or as hy- lerans, and Cladosporium halotolerans were obtained from di- perparasites on other fungi (Heuchert et al. 2005). verse collections to append to the dataset used in the Phylogenetic studies based on sequence data from plastid and phylogenetic study (Table 1). All strains were maintained on nuclear regions have provided a framework for understanding yeast malt agar medium at 25 C in the dark. Cladosporium taxonomy (Bensch et al. 2010, 2012; Schubert et al. 2007; Zalar et al. 2007) and supported the recognition of three DNA extraction and sequencing main species complexes, namely Cladosporium cladosporioides, Cladosporium herbarum,andCladosporium sphaerospermum. Addi- DNA was extracted using the FastDNA SPIN Kit (MP Biomed- tional studies based on multilocus analysis allowed a better res- icals, Irvine, CA) following the manufacturer’s instructions. olution for Cladosporium species within each complex. Using 18S For each strain, partial nuclear rDNA ITS region and partial ribosomal DNA (rDNA), rDNA ITS (Internal Transcribed Spacer) translation elongation factor 1-a gene sequence (tef1), partial as well as the partial sequences of the actin (act) and of the trans- actin (act), and b-tubulin (tub) genes were amplified using re- lation elongation factor 1-a (tef1), 22 species were newly described spectively primers ITS4 and ITS5 (White et al. 1990), EF1-728F by Bensch et al. (2010) within the C. cladosporioides complex. A phy- and EF1-986R (Bensch et al. 2012), ACT-512F and ACT-783R logeny of species from the C. sphaerospermum complex isolated (Carbone & Kohn 1999), and T1 and T22 (O’Donnell & from hypersaline environments was performed by Zalar et al. Cigelnik 1997). PCR was performed under the conditions listed (2007),whereasSchubert et al. (2007) addressed the taxonomy in Table 2. within the C. herbarum species complex. A recent revision of Cla- Each PCR product was sequenced using both primers at the dosporium taxonomy, employing morphological, ecological, and ‘plateforme Biogenouest’ (Roscoff, France, http://www.sb- molecular data recognised only 169 species of the 993 names, roscoff.fr/SG/). Sequence analyses were carried out with concluding that the genus Cladosporium in the old broad sense DNA Baser (Heracle Software, Germany), and the contig was is heterogeneous and polyphyletic (Bensch et al. 2012). manually edited using MESQUITE v.7.2 (Maddison & The present study focuses on the characterization of Clado- Maddison 2009). Sequences were deposited in GenBank under sporium isolates obtained from contaminated milk bread rolls. the accession numbers listed in Table 1. Isolates were initially identified according to macro- and microscopic criteria, combined with an analysis of rDNA ITS sequence Phylogenetic analyses data. Initial data indicated that these isolates could represent a previously undescribed species, requiring comprehensive mo- In addition to sequences obtained in the present study from 20 lecular analyses using a multilocus approach. Isolates were also Cladosporium strains, 20 rDNA ITS sequences, 34 tef1 sequences, investigated by using phenotypic (macroscopic and microscopic 22 act sequences, and 20 tub sequences pertaining to 17 differ- morphological examinations), and Fourier-transform infrared ent Cladosporium strains used in Zalar et al. (2007), along with (FTIR) spectroscopy features, which have been successfully ap- the seven reference strains (Table 1) were obtained from the plied for differentiation of moulds in the past. GenBank database. Sequences for each taxon and locus, including both introns and exons, were aligned using MAFFT v.6 (Katoh et al. 2005) using the E-INS-i strategy and refined Materials and methods manually using MESQUITE v.7.2 (Maddison & Maddison 2009). Incongruence Length Difference (ILD) tests were performed Cladosporium strains and culture conditions as implemented in PAUP v.4.0b10 (hompart option) (Farris et al. 1995). Maximum Likelihood (ML), Maximum Parsimony Visible olivaceous brown fungal colonies were observed on (MP), and Bayesian Inference (BI) analyses were performed the surface of commercial milk bread rolls. Pieces of on separate and concatenated datasets. MODELTEST v.3.7 ldsoimlebrasiae Cladosporium

Table 1 e List of Cladosporium strains with their current names, geographical origin and GenBank accession numbers. Strain number Current accepted name Substrate Country of origin GenBank accession number

dITS eact ftub gEF-1a aCBS 119415 Cladosporium dominicanum Hypersaline water of saltern Dominican Republic KJ596558 KJ596641 KJ596612 KJ596578 bEXF-718 Cladosporium dominicanum Hypersaline water Dominican Republic DQ780356 EF101370 EF101418 KJ596581 EXF-720 Cladosporium dominicanum Hypersaline water Dominican Republic DQ780355 KJ596643 EF101417 KJ596579 EXF-727 Cladosporium dominicanum Hypersaline water Dominican Republic DQ780354 EF101416 KJ596580 CBS 119414 Cladosporium fusiforme Hypersaline water of Secovlje saltern Slovenia KJ596577 KJ596640 KJ596617 KJ596596 EXF-397 Cladosporium fusiforme Hypersaline water Slovenia DQ780389 EF101373 EF101445 KJ596595 CBS 119416 Cladosporium halotolerans Hypersaline water of saltern Namibia KJ596569 KJ596633 KJ596630 EXF-564 Cladosporium halotolerans Hypersaline water Namibia DQ780363 EF101395 EF101433 KJ596584 EXF-977 Cladosporium halotolerans Bathroom Slovenia DQ780362 EF101396 EF101431 KJ596586 EXF-1072 Cladosporium halotolerans Hypersaline water Israel DQ780373 EF101399 EF101428 KJ596585 CBS 123171 Cladosporium langeronii Moisture damaged building Finland KJ596574 KJ596629 KJ596593 EXF-1933 (dH13833) Cladosporium langeronii Ice Arctics DQ780383 EF101361 EF101437 KJ596594 c UBOCC-A-112084 Cladosporium langeronii Pound cake France KJ596575 KJ596645 KJ596623 KJ596590 UBOCC-A-112121 Cladosporium langeronii Pound cake France KJ596571 KJ596624 KJ596587 UBOCC-A-112124 Cladosporium langeronii Pound cake France KJ596572 KJ596625 KJ596588 UBOCC-A-112132 Cladosporium langeronii Pound cake France KJ596576 KJ596615 KJ596589 CBS 119412 Cladosporium psychrotolerans Hypersaline water of Secovlje saltern Slovenia KJ596573 KJ596632 KJ596614 EXF-332 Cladosporium psychrotolerans Hypersaline water Slovenia DQ780385 EF101364 EF101441 KJ596591 EXF-714 Cladosporium psychrotolerans Hypersaline water Dominican Republic DQ780384 EF101366 EF101443 KJ596592 CBS 123179 Cladosporium sphaerospermum Moisture damaged building Finland KJ596567 KJ596638 KJ596627 EXF-455 Cladosporium sphaerospermum Hypersaline water Slovenia DQ780349 EF101375 EF101412 EXF-739 Cladosporium sphaerospermum Bathroom Slovenia DQ780344 EF101381 EF101407 UBOCC-A-101107 Cladosporium sphaerospermum Wheat France KJ596563 KJ596634 KJ596618 UBOCC-A-101110 Cladosporium sphaerospermum Melon KJ596564 KJ596637 KJ596619 UBOCC-A-101111 Cladosporium sphaerospermum Melon KJ596565 KJ596635 KJ596620 UBOCC-A-101115 Cladosporium sphaerospermum KJ596562 KJ596622 UBOCC-A-108054 Cladosporium sphaerospermum Rimicaris exoculata KJ596566 KJ596636 KJ596621 UBOCC-A-112116 Cladosporium sphaerospermum Pound cake France KJ596561 KJ596639 KJ596628 UBOCC-A-112061 Cladosporium lebrasiae Milk bread France KJ596559 KJ596644 KJ596613 KJ596582 UBOCC-A-112062 Cladosporium lebrasiae Milk bread France KJ596560 KJ596642 KJ596626 UBOCC-A-112063 Cladosporium lebrasiae Milk bread France KJ596568 KJ596631 KJ596616 KJ596583 CBS 119417 Cladosporium velox Bamboo sp. India KJ596570 EXF-466 Cladosporium velox Hypersaline water Slovenia DQ780359 EF101386 EXF-471 Cladosporium velox Hypersaline water Slovenia DQ780360 EF101387 a CBS: Centraalbureau voor Schimmelcultures, Utrecht, The Netherlands. b EXF: Infrastructural Centre Mycosmo, Biotechnical Faculty, University of Ljubljana, Slovenia. c UBOCC: Culture Collection of University of Western Brittany, LUBEM Plouzane, France. d ITS: Internal Transcribed Spacer. e act: Actin. f tub: b-tubulin. 1019 g EF-1a: Elongation factor 1. 1020 J. Razaﬁnarivo et al.

Table 2 e Nuclear regions targeted to amplify Cladosporium DNA. Locus Domain ampliﬁed Primer name Sequence of Annealing Amplicon size (bp) the primer (50 / 30) temperature (C)

tub b-tubulin T1 AACATGCGTGAGATTGTAAGT 52 1300 T22 TCTGGATGTTGTTGGGAATCC act Actin ACT-512F ATGTGCAAGGCCGGTTTCGC a58/55/52 300 ACT-783R TACGAGTCCTTCTGGCCCAT EF-1a Translation elongation factor 1-a EF1-728F CATCGAGAAGTTCGAGAAGG 52 350 EF1-986R TACTTGAAGGAACCCTTACC ITS Internal transcribed spacer ITS4 TCCTCCGCTTATTGATATGC 58 680 ITS5 GGAAGTAAAAGTCGTAACAAGG

a Annealing temperature depends on DNA strain ampliﬁcation.

(Nylander 2004) was used to determine the best model of evo- the analyses. MP analysis was conducted by heuristic search lution for ML and MP analysis. The substitution model with in PAUP v.4.0b10 (Swofford 2003) with the following settings: the best ﬁt to the data was chosen based on Akaike Informa- all characters were equally weighted, gaps were treated as miss- tion Criterion (AIC) (Akaike 1974). ML phylogenetic trees with ing characters, starting trees obtained by random addition with bootstrap analysis were constructed using PhyML v.3.0 1000 replicates, and TBR branchswappingalgorithm.Nodal sup- (Guindon et al. 2010). Unordered characters, random taxon ad- port for MP and ML was determined by nonparametric boot- dition sequences, gaps treated as missing data and the Tree strapping, performing 1000 replicates with a heuristic search Bisection-Reconnection (TBR) branch swapping were used in consisting of 100 stepwise random addition replicates and TBR

Fig 1 e Unrooted Bayesian tree based on analysis of partial tub gene data. Posterior probability followed by bootstrap value of maximum likelihood and parsimony analyzes are indicated. Branch line widths indicate relationships supported by bootstrap percentages (>50 %). The bar indicates the number of substitutions per site. Cladosporium lebrasiae 1021

branch swapping for each bootstrap replicate. MrBayes v.3.1 France) coupled to a high-throughput module (HTS-XT, Bruker (Ronquist & Huelsenbeck 2003) was used to construct phyloge- Optics). Spectra were obtained using the following parameters: nies under BI. Bayesian analyses included two Markov chain 64 accumulations per well, spectral resolution of 4 cm 1,spec- Monte Carlo (MCMC) runs, composed of four chains tral range of 4000e400 cm 1. (Huelsenbeck & Ronquist 2001). Each Markov chain was per- Pre-processing of infrared spectra included a quality test as formed using up to 106 generations, sampling the chains every previously described by Lecellier et al. (2014), followed by Ex- 100th cycle. The sampling was considered adequate when the tended Multiplicative Signal Correction (EMSC) (Afseth & average standard deviation of split frequencies was inferior to Kohler 2012) and second derivative pretreatments. Each cul- 0.01. After discarding the ‘burn-in’ samples (Huelsenbeck & ture was validated if at least ﬁve out of 16 spectra passed the Bollback 2001), posterior probabilities were determined from quality test. To obtain a non-supervised discrimination plan, a consensus tree generated with half compatible method. Align- the Principal Component Analysis (PCA) method was used. ments and trees were deposited in TreeBASE (www.treeba- PCA involves a mathematical procedure that transforms se.org). Single nucleotide polymorphism (SNP) analysis was a number of possibly correlated variables into a smaller num- applied to compare the polymorphism of different clades using ber of uncorrelated variables called principal components. DnaSP v.5 (Librado & Rozas 2009). The ﬁrst principal component accounts for as much of the variability in the data as possible, and each following component FTIR analyses accounts for as much of the remaining variability as possible (Hoskuldsson€ 1996). Sample preparation was performed using the procedure described in Lecellier et al. (2014). Twenty millilitres of Chemboost Growth assessment YM Broth (AES Chemunex, Bruz, France) were inoculated with a conidial suspension and incubated for 48 h at 25 Cinarotary Isolates UBOCC-A-112061, UBOCC-A-112062, and UBOCC-A- shaker at 150 rpm. FTIR measurements were performed using 112063 along with seven references strains pertaining to the a spectrometer (Tensor 27, Bruker Optics, Champs sur Marne, Cladosporium sphaerospermum complex, i.e., Cladosporium

Fig 2 e Unrooted Bayesian tree based on analysis of the partial translation tef1 data. Posterior probability followed by bootstrap value of maximum likelihood and parsimony analyzes are indicated. Branch line widths indicate relationships supported by bootstrap percentages (>50 %). The bar indicates the number of substitutions per site. 1022 J. Razaﬁnarivo et al.

dominicanum, Cladosporium fusiforme, Cladosporium halotolerans, ZEN software. Slides were prepared using transparent adhe- Cladosporium langeronii, Cladosporium psychrotolerans, C. sphaer- sive tape (Titan Ultra Clear Tape, Conglom Inc., Toronto, Can- ospermum, and Cladosporium velox were point-inoculated onto ada) (Schubert et al. 2007). Shear’s was used as mounting 2 % malt extract agar (MEA) and incubated at 4, 10, 25, 30, medium for measurements (Crous et al. 2009). The morpholog- and 37 C. Radial growth of each thallus was measured along ical structure terminology followed that used for Cladosporium two predetermined perpendicular directions after incubation species (Bensch et al. 2010, 2012; Schubert et al. 2007). The 95 % for 14 d. Colony colours (obverse and reverse) were established conﬁdence intervals were derived from 30 observations using the colour charts of Rayner (1970). (1000 magniﬁcation), with the extremes given in parenthe- ses. Ranges of the dimensions of other characters are given. Taxonomy Results Isolates were cultivated for 7 d at 25 C on synthetic nutrient- poor agar (SNA) (Crous et al. 2009). Microscopic observations of Phylogenetic analyses the conidiogenous structures were performed using a Zeiss V20 Discovery dissecting microscope, and with a Zeiss Axio Respectively 22, 34, 20, and 20 isolates were sequenced for act, Imager 2 light microscope using differential interference con- tef1, tub, and rDNA ITS regions (Table 1). The alignment matri- trast (DIC) illumination and an AxioCam MRc5 camera, and ces consisted of 205 base pairs (bp), 314 bp, 602 bp, and 489 bp

Fig 3 e Unrooted Bayesian tree based on analysis of partial actin gene data. Posterior probability followed by bootstrap value of maximum likelihood and parsimony analyzes are indicated. Branch line widths indicate relationships supported by bootstrap percentages (>50 %). The bar indicates the number of substitutions per site. Cladosporium lebrasiae 1023

respectively for act, tef1, tub, and rDNA ITS sequences. Because Cladosporium sphaerospermum, Cladosporium dominicanum, Cla- ILD tests indicated signiﬁcant incongruence among the stud- dosporium langeronii, Cladosporium psychrotolerans, and Clado- ied gene trees in the datasets (P < 0.01) when including the sporium halotolerans) whereas the eighth clade was act dataset but no incongruence between tef1, tub, and rDNA considered to be a new species Cladosporium lebrasiae sp. ITS trees, further phylogenetic analyses were also performed nov. (Fig 1). This clade included isolates obtained from the using a 1405 bp concatenated dataset including tef1, tub, and contaminated milk bread rolls. Other trees were less resolved rDNA ITS sequences. Models for Bayesian and maximum like- (Figs 2e4). Indeed, artiﬁcial polytomies were observed in act lihood analyses were chosen accordingly to Jmodel test results gene and rDNA ITS trees for C. dominicanum isolates, which indicating that the most suitable model for Bayesian and max- grouped together but did not form a well-supported clade imum likelihood analysis were: HKY þ G model for act gene, (Figs 3 and 4). The same was observed in tef1 gene tree for TIM2 þ G model for tef1, tub, and the combined dataset, and milk bread roll isolates (Fig 2). In addition, the rDNA ITS tree TIM3ef þ I model for rDNA ITS. For each region, tree topologies did not support C. langeronii and C. psychrotolerans as two inde- were identical whatever the method used (MP, ML or Bayesian pendent clades (Fig 4). As observed for the tub gene analysis, analyses). Tub gene tree was the most resolved tree including the three-locus combined analysis recognized a clade com- eight well-supported clades (>50 % bootstrap value) (Fig 1). prising all the milk bread roll isolates described in this study Seven clades included multiple isolates, all belonging to a dis- as C. lebrasiae sp. nov. (Fig 5). Importantly, when considering tinct species (Cladosporium fusiforme, Cladosporium velox, the well-supported clades, no incongruences were detected

Fig 4 e Unrooted Bayesian tree based on analysis of partial ITS rDNA data. Posterior probability followed by bootstrap value of maximum likelihood and parsimony analyzes are indicated. Branch line widths indicate relationships supported by bootstrap percentages (>50 %). The bar indicates the number of substitutions per site. 1024 J. Razaﬁnarivo et al.

Fig 5 e Unrooted Bayesian tree based on analysis of the combined sequence data (tub, tef1, rDNA ITS). Posterior probabilities followed by bootstrap value of maximum likelihood and parsimony analyzes are indicated next to branches. Branch line widths indicate relationships supported by bootstrap percentages (>50 %). The bar indicates the number of substitutions per site.

among the nodes between the different gene genealogies. and called the ‘discriminant range’. Fig 6 presents the ‘dis- Moreover, each of the eight clades detected in the combined criminant range’ together with pretreated spectra. By means analysis harboured specific SNPs (Table 3). Three specific of the PCA method and variance of this selected wavelength, SNPs were found for C. lebrasiae. Only C. halotolerans, C. fusi- it was possible to calculate the discriminant principal compo- forme, and C. velox included more specific SNPs (12, 7, and 5 re- nents. The obtained discrimination plan revealed a sample spectively) (Table 3). A 1.9 % variation in nucleotide grouping as a function of their species assignment. Fig 7 pres- composition among the four analysed loci was observed be- ents the discrimination plan obtained with spectra of Clado- tween C. lebrasiae and its sister C. dominicanum clade. This dif- sporium dominicanum and Cladosporium lebrasiae sp. nov. In ference was comparable to that observed between C. Fig 7, it is possible to highlight two groups, corresponding to psychrotolerans and C. langeronii clades for which a 2.4 % differ- the two studied species. Although there is some overlap, the ence was observed. Although Genealogical Concordance Phy- PCA could discriminate C. dominicanum and the Cladosporium logenetic Species Recognition criterion (GC-PSR) could not be isolates from milk bread rolls. applied over the four single gene trees due to artificial polytomies and despite the low number of isolates analysed (three Cultural characteristics isolates), it is noteworthy that no incongruities were observed between C. lebrasiae and the C. dominicanum clades. Colonies of Cladosporium lebrasiae sp. nov. on MEA are dense and black in colour. Colonies diameters on MEA reached FTIR analysis 30e36 mm in 14 d at 25 C, and 27e32 mm at 30 C. No growth was observed at 4 C, 10 C, and 37 C. Small droplets of exu- During preliminary studies, the infrared spectral data was ex- dates were sometimes present in the centre of the culture. amined range by range. A range of wavelength was selected These data were very similar to those obtained for Cladosporium lebrasiae 1025

Table 3 e Single nucleotide polymorphisms (SNPs) from sequence data of actin, translation elongation factor 1-a, ITS rDNA, and ß-tubulin loci.

act tef1 ITS tub Strain number Species 17 29 32 33 55 60 75 146 154 155 160 165 248 305 307 309 322 372 421 494 535 547 562 644 1218 1258 1266 1315 1318 1354 1363 1424 1483 1558 1582 # speciﬁc SNPs UBOCC-A-112061 C. lebrasiae GTCACCACATTCCGCCACGCTCGCCCCAATTCTCT UBOCC-A-112062 C. lebrasiae ...... 3 UBOCC-A-112063 C. lebrasiae ...... CBS 119415 C. dominicanum ...... TT.T.CC.C.. EXF-718 C. dominicanum ...... TT.T.CC.C.. 3 EXF-720 C. dominicanum ...... TT.T.CC.C.. EXF-727 C. dominicanum ...... TT.T.CC.C.. CBS 119414 C. fusiforme ....GT..C...T..T..T.AT.A.....CC.C.. 7 EXF-397 C. fusiforme ....GT..C...T..T..T.AT.A.....CC.C.. CBS 119416 C. halotolerans CCTT..C.CC..AA..TT.T...T...G.CC.C.. EXF-564 C. halotolerans CCTT..C.CC..AA..TT.T...T...G.CC.C.. 12 EXF-977 C. halotolerans CCTT..C.CC..AA..TT.T...T...G.CC.C.. EXF-1072 C. halotolerans CCTT..C.CC..AA..TT.T...T...G.CC.C.. CBS 123171 C. langeronii ...... T...... T..CC.C.C EXF-1933 C. langeronii ...... T...... T..CC.C.C UBOCC-A-112084 C. langeronii ...... T...... T..CC.C.C 2 UBOCC-A-112121 C. langeronii ...... T...... T..CC.C.C UBOCC-A-112124 C. langeronii ...... T...... T..CC.C.C UBOCC-A-112132 C. langeronii ...... T...... T..CC.C.C CBS 119412 C. psychrotolerans ...... TT...... CC.CT. EXF-332 C. psychrotolerans ...... TT...... CC.CT. 2 EXF-714 C. psychrotolerans ...... TT...... CC.CT. CBS 123179 C. sphaerospermum .....G.A....T.G...... CC.C.. EXF-455 C. sphaerospermum .....G.A....T.G...... CC.C.. EXF-739 C. sphaerospermum .....G.A....T.G...... CC.C.. UBOCC-A-101107 C. sphaerospermum .....G.A....T.G...... CC.C.. UBOCC-A-101110 C. sphaerospermum .....G.A....T.G...... CC.C.. 3 UBOCC-A-101111 C. sphaerospermum .....G.A....T.G...... CC.C.. UBOCC-A-101115 C. sphaerospermum .....G.A....T.G...... CC.C.. UBOCC-A-108054 C. sphaerospermum .....G.A....T.G...... CC.C.. UBOCC-A-112116 C. sphaerospermum .....G.A....T.G...... CC.C.. CBS 119417 C. velox ...... G.G.T...... A....CTCC.C.. EXF-466 C. velox ...... G.G.T...... A....CTCC.C.. 5 EXF-471 C. velox ...... G.G.T...... A....CTCC.C..

Fig 6 e EMSC preprocessed second derivative spectra and discriminant range.

Cladosporium dominicanum (colonies 27e28.5 mm in 14 d at verruculose, walls slightly thickened. Conidiophores small or 25 C, and 23e23.5 mm at 30 C), with colonies turning reseda reduced to inconspicuous lateral loci on hyphae, or arising ter- green on MEA. The other strains of the Cladosporium sphaero- minally and laterally from hyphae, erect or ascending, straight spermum complex are distinguished by no growth after 14 d to slightly flexuous, subcylindrical, 1e6-septate, medium at 30 C on MEA and growth at 10 C. brown, verruculose, 2e80 3e4 mm, rarely branched. Macroco- nidiophores not seen. Setae sterile, observed in older cultures, Taxonomy cylindrical-oblong, neither geniculate nor nodulose, un- branched, medium brown, thick-walled, flexuous, to 450 mm Cladosporium lebrasiae Vasseur & Crous, sp. nov. long, terminating in obtusely rounded apical cells, 5e6 mm MycoBank No.: MB816303; Fig 8AeI. diam, septa 10e15 mm apart. Conidiogenous cells integrated, ter- Etymology: lebrasiae from the French word ‘Le Bras’ the sur- minal, rarely intercalary, cylindrical, usually short, 10e20 mm name of the mycologist (Marie Le Bras) who isolated the spe- long, proliferation sympodial, with a few apical scars, loci pro- cies from milk bread. tuberant, denticulate, 0.5e1.5 mm diam, thickened and dark- In vitro on SNA: Mycelium partly submerged, partly superfi- ened-refractive. Ramoconidia often formed, cylindrical, cial; hyphae branched, 2e4 mm diam, septate, pale to medium 20e35 3e4 mm, 2e3-septate, base broadly truncate, 3e4 mm olivaceous brown, smooth to sometimes minutely diam; hilum 1e2 mm diam, slightly thickened and somewhat 1026 J. Razafinarivo et al.

Fig 7 e Discrimination map of C. dominicanum and C. lebrasiae PCA model. The two ﬁrst one principal component were used for this plan and the colours correspond to C. dominicanum and C. lebrasiae isolates.

Fig 8 e Cladosporium lebrasiae on SNA (CBS 138283). AeH. Conidiophores showing secondary ramoconidia, intercalary and small, terminal conidia in chains. I. Sterile seta. Scale bars [ 10 mm. Cladosporium lebrasiae 1027

darkened-refractive, but not coronate. Conidia catenulate, in species (Zalar et al. 2007). In addition to these seven species, branched chains, branching in all directions, with up to six the recognition of a new Cladosporium species closely related conidia per chain, small terminal conidia globose to subglobose, to C. dominicanum was supported. The four gene multilocus sometimes ovoid, (2.5e)3L4 (2e)2.5 mm, aseptate, minutely phylogenetic analysis placed the isolates from milk bread verruculose to verruculose, narrower at both ends, intercalary rolls within a well supported independent clade in different conidia with 1e2 apical hila, subglobose, ovoid to ellipsoidal, gene trees, as well as in the three-gene concatenated gene (3e)4L5(e6) (2.5e)3 mm, aseptate, attenuated towards tree. Species recognition by concordance of independent apex and base, secondary ramoconidia ellipsoidal to cylindrical, phylogenetic genes (Baum & Shaw 1995; Sites & Marshall aseptate, (6e)10L15(e20) (2e)3(e4) mm, pale to usually me- 2003; Taylor et al. 2000) is often used even for microfungi dium olivaceous brown, becoming dark brown with age, (Stewart et al. 2014; Taylor et al. 2000). Although GC-PSR could smooth to minutely verruculose, with 1e3 pronounced dentic- not be applied over the four single-gene trees and despite the ulate distal hila, 0.5e1 mm diam. low number of isolates analysed in the present study, it is Substrates and distribution: Air borne in bakeries, milk noteworthy that both genealogical concordance and non- bread roll. discordance were observed for the clade comprising the three Specimens examined: France: Britany, on a milk bread roll, Cladosporium isolates from milk bread rolls. The occurrence of 2012, M. Le Bras (holotype CBS H-22367, culture ex-type CBS SNPs specific to these isolates was also consistent with the 138283). occurrence of a novel species closely related to C. dominicanum. These results were also supported by the morphological Discussion features of Cladosporium lebrasiae sp. nov. Indeed, C. lebrasiae sp. nov. is not dimorphic as it only exhibits microconidio- A preliminary analysis of rDNA ITS sequences of the Cladospo- phores and lacks macroconidiophores. Instead, we observed rium isolates from milk bread rolls suggested that these iso- sterile setae (after 7, 14, and 21 d on SNA), which may indicate lates were distinct from other accepted Cladosporium species that this species has lost the ability to form macroconidio- and belong to the Cladosporium sphaerospermum species com- phores. To our best knowledge, this feature has never been de- plex. This result was consistent with the ecological abilities scribed in other taxa in the C. sphaerospermum species of species from the C. sphaerospermum complex, being consid- complex. ered as halotolerant fungi (Zalar et al. 2007). Halotolerance is It is noteworthy that in contrast to other closely related a common feature of foodborne fungi that are able to develop species within the C. sphaerospermum species complex such on bakery products. The usual water activity of milk bread as C. psychrotolerans and C. langeronii (Bensch et al. 2012), C. leb- rolls is 0.85e0.88. rasiae sp. nov. and C. dominicanum, the two closest related con- In order to characterize these Cladosporium isolates, a multi- sidering our phylogeny, did not significantly differ in their locus phylogenetic study including strains pertaining to dif- growth abilities under the different conditions tested. How- ferent Cladosporium species within the C. sphaerospermum ever, it was possible to discriminate C. lebrasiae sp. nov. iso- complex was performed. In previous studies, multilocus anal- lates from C. dominicanum isolates using a specific region of yses have allowed a better understanding of speciation in their FTIR spectra which corresponded to the absorption a large number of fungal genera (Obanor et al. 2010; Peterson zone of CeH bond elongation (n CeH) which is present in lipids et al. 2004; Scott & Chakraborty 2006), allowing for species and proteins. This result suggested that FTIR analysis could be identification using the GC-PSR. a potential identification tool in addition to tub sequence data, For the genus Cladosporium, the multilocus DNA sequence which in this study performed the best among the different approach offered a better phylogenetic resolution within the gene regions tested for Cladosporium species identification. Cladosporium herbarum (Schubert et al. 2007), Cladosporium cla- Morphologically C. lebrasiae also differs from C. dominicanum dosporioides (Bensch et al. 2010), and Cladosporium sphaerosper- in that the latter ramoconidia are rarely observed, conidio- mum species complexes (Zalar et al. 2007). Actually, several phores are narrower, (1e)22.5(e3) mm diam, and conidial studies have demonstrated the advantage of using protein- chains are longer (Zalar et al. 2007). coding genes to study fungal evolution at the species/popula- Investigating the source of contamination by C. lebrasiae sp. tion level (Carbone & Kohn 1999; Geiser et al. 1998; O’Donnell nov. within industrial facilities as well as the environmental & Cigelnik 1997). In this study, three genes (act, tub, and tef1) reservoirs of this species could be informative regarding its were combined with rDNA ITS to delineate the new species in ecology. Furthermore, future studies aimed at evaluating its the C. sphaerospermum species complex. The molecular phy- resistance to different common biocides could help prevent logeny established in the present study produced the same its occurrence on food products. overall topology as that established by Zalar et al. (2007). Eight clades were obtained, with seven of them including a reference strain. As in Zalar et al. (2007) Cladosporium dominicanum, Cladosporium fusiforme, Cladosporium halotolerans, C. sphaero- Acknowledgements spermum, and Cladosporium velox and the two closely related species Cladosporium psychrotolerans and Cladosporium langero- The study was supported by MycoTech project funded by the nii could be distinguished. Strains of the sphaerospermum European Union and the Brittany Region. We are also grateful complex are often isolated from extreme ecological condi- to Amelie Weill for her excellent technical assistance and the tions and share a similar ecology, but belong to different managing of the fungal strains. 1028 J. Razafinarivo et al.

references Heuchert B, Braun U, Schubert K, 2005. Morphotaxonomic revision of fungicolous Cladosporium species (hyphomycetes). Schlechtendalia 13:1e78. Hoskuldsson€ A, 1996. Prediction Methods in Science and Technology, Afseth NK, Kohler A, 2012. Extended multiplicative signal cor- Basic Theory, vol. 1, Thor Publishing, Copenhagen, Denmark, rection in vibrational spectroscopy, a tutorial. Chemometrics p. 245. and Intelligent Laboratory Systems 117:92e99. Huelsenbeck JP, Bollback JP, 2001. Empirical and hierarchical Akaike H, 1974. A new look at the statistical model identification. Bayesian estimation of ancestral states. Systematic Biology 50: IEEE Transactions on Automatic Control 19: 716e723. 351e366. Baum DA, Shaw KL, 1995. Genealogical perspectives on the spe- Huelsenbeck JP, Ronquist F, 2001. MRBAYES: Bayesian inference cies problem. In: Hoch PC, Stephenson AG (eds), Experimental of phylogeny. Bioinformatics 17: 754e755. and Molecular Approaches to Plant Biosystematic. Missouri Bo- Katoh K, Kuma K, Toh H, Miyata T, 2005. MAFFT version 5: im- tanical Garden Press, St. Louis, pp. 289e303. provement in accuracy of multiple sequence alignment. Nu- Bensch K, Groenewald JZ, Dijksterhuis J, Starink-Willemse M, cleic Acids Research 33: 511e518. Andersen B, Shin H-D, Dugan FM, Schroers H-J, Braun U, Lecellier A, Mounier J, Gaydou V, Castrec L, Barbier G, Ablain W, Crous PW, 2010. Species and ecological diversity within the Manfait M, Toubas Sockalingum GD, 2014. Differentiation and Cladosporium cladosporioides complex (Davidiellaceae, Capno- identification of filamentous fungi by high-throughput FTIR diales). Studies in Mycology 67:1e94. spectroscopic analysis of mycelia. International Journal of Food Bensch K, Braun U, Groenewald JZ, Crous PW, 2012. The genus Microbiology 168e169:32e41. Cladosporium. Studies in Mycology 72:1e401. Librado P, Rozas J, 2009. DnaSP v5: a software for comprehensive Berghofer LK, Ailsa D, Hocking AD, Miskelly D, Jansson E, 2003. analysis of DNA polymorphism data. Bioinformatics 25: Microbiology of wheat and flour milling in Australia. Interna- 1451e1452. tional Journal of Food Microbiology 85: 137e149. Maddison WP, Maddison DR, 2009. Mesquite: a modular system for Brown KB, Hyde KD, Guest DI, 1998. Preliminary studies on en- evolutionary analysis Version 2.6. Available from: http: dophytic fungal communities of Musa acuminata species //mesquiteproject.org complex in Hong Kong and Australia. Fungal Diversity 1: Mullins J, 2001. Microorganisms in outdoor air. In: Flannigan B, 27e51. Samson RA, Miller JD (eds), Microorganisms in Home and Indoor Carbone I, Kohn L, 1999. A method for designing primer sets for Work Environments: Diversity, Health Impacts, Investigation and speciation studies in filamentous ascomycetes. Mycologia 91: Control. Taylor & Francis, London, pp. 3e16. 553e559. Nylander JAA, 2004. MrModeltest v2 Program Distributed by the Crous PW, Gams W, Stalpers JA, Robert V, Stegehuis G, 2004. Author. Evolutionary Biology Centre, Uppsala University. MycoBank: an online initiative to launch mycology into the O’Donnell K, Cigelnik E, 1997. Two divergent intragenomic rDNA 21st century. Studies in Mycology 50:19e22. ITS2 types within a monophyletic lineage of the fungus Fusa- Crous PW, Verkley GJM, Groenewald JZ, Samson RA (eds), 2009. rium are nonorthologous. Molecular Phylogenetics and Evolution Fungal Biodiversity. CBS Laboratory Manual Series No. 1. CBS- 7: 103e116. KNAW Fungal Biodiversity Centre, Utrecht, The Netherlands. Obanor F, Erginbas-Orakci G, Tunali B, Nicol JM, Chakraborty S, Deschuyffeleer N, Vermeulen A, Daelman J, Castelein E, 2010. Fusarium culmorum is a single phylogenetic species based Eeckhout M, Devlieghere F, 2015. Modelling of the growth/no on multilocus sequence analysis. Fungal Biology 114: 753e765. growth interface of Wallemia sebi and Eurotium herbariorum as Peterson SW, Bayer EM, Wicklow DT, 2004. Penicillium thiersii, a function of pH, a and ethanol concentration. International w Penicillium angulare and Penicillium decaturense, new species Journal of Food Microbiology 192:77e85. isolated from wood-decay fungi in North America and their Ellis MB, 1971. Dematiaceous Hyphomycetes. CMI, Kew. phylogenetic placement from multilocus DNA sequence Ellis MB, 1976. More Dematiaceous Hyphomycetes. CMI, Kew. analysis. Mycologia 96: 1280e1293. El-Morsy EM, 2000. Fungi isolated from the endorhizosphere of Pitt JI, Hocking AD, 2009. Fungi and Food Spoilage. In: , 3rd ed. halophytic plants from the Red Sea Coast of Egypt. Fungal Di- Springer, New York, U.S.A., pp. 1e519. versity 5:43e54. Rayner RW, 1970. A Mycological Colour Chart. Commonwealth Farris JS, Kallersj€ o€ M, Kluge AG, Bult C, 1995. Testing significance Mycological Institute and British Mycological Society, Surrey, of incongruence. Cladistics 10: 315e319. UK. Farr DF, Bills GF, Chamuris GP, Rossman AY, 1989. Fungi on Plants Riesen T, Sieber T, 1985. Endophytic Fungi in Winter Wheat (Triti- and Plant Products in the United States. The American Phyto- cum aestivum L.). Institute of Microbiology, Swiss Federal In- pathological Society Press, St. Paul (Minnesota), ISBN stitute of Technology, Zurich,€ Switzerland. 0e89054e099e3. Ronquist F, Huelsenbeck JP, 2003. MrBayes 3: Bayesian phyloge- Flannigan B, 2001. Microorganisms in indoor air. In: Flannigan B, netic inference under mixed models. Bioinformatics Applications Samson RA, Miller JD (eds), Microorganisms in Home and Indoor Note 19: 1572e1574. Work Environments: Diversity, Health Impacts, Investigation and Schubert K, Groenewald JZ, Braun U, Dijksterhuis J, Starink M, Control. Taylor & Francis, London, pp. 17e31. Hill CF, Zalar P, de Hoog GS, Crous PW, 2007. Biodiversity in the Geiser DM, Pitt JI, Taylor JW, 1998. Cryptic speciation and re- Cladosporium herbarum complex (Davidiellaceae, Capnodiales), combination in the aflatoxin producing fungus Aspergillus fla- with standardisation of methods for Cladosporium taxonomy vus. Proceedings of the National Academy of Sciences of the United and diagnostics. Studies in Mycology 58: 105e156. States of America 95: 388e393. Scott JB, Chakraborty S, 2006. Multilocus sequence analyses of Guindon S, Dufayard JF, Lefort V, Anisimova M, Hordijk W, Fusarium pseudograminearum reveals a single phylogenetic Gascuel O, 2010. New algorithms and methods to estimate species. Mycological Research 110: 1413e1425. maximum-likelihood phylogenies: assessing the performance Sites JW, Marshall JC, 2003. Delimiting species: a renaissance is- of PhyML 3.0. Systematic Biology 59: 307e321. sue in systematic biology. Trend Ecology and Evolution 18: Guynot ME, Ramos AJ, Sala D, Sanchis V, Marin S, 2002. Combined 462e470. effects of weak acid preservatives, pH and water activity on Stewart JE, Timmer LW, Lawrence CB, Pryor BM, Peever TL, 2014. growth of Eurotium species on a sponge cake. International Discord between morphological and phylogenetic species Journal of Food Microbiology 76:39e46. boundaries: incomplete lineage sorting and recombination Cladosporium lebrasiae 1029

results in fuzzy species boundaries in an asexual fungal and species concepts in fungi. Fungal Genetics and Biology 31: pathogen. BMC Evolutionary Biology 14:38. 21e32. Suhr KI, Nielsen PV, 2004. Effect of weak acid preservatives on Weidenborner€ M, Wieczorek C, Appel S, Kunz B, 2000. Whole growth of bakery product spoilage fungi at different water wheat and white wheat ﬂour-the mycobiota and potential activities and pH values. International Journal of Food Microbiol- mycotoxins. Food Microbiology 17: 103e107. ogy 95:67e78. White TJ, Bruns T, Lee S, Taylor JW, 1990. Ampliﬁcation and direct Swofford DL, 2003. PAUP*. Phylogenetic Analysis Using Parsimony sequencing of fungal ribosomal RNA genes for phylogenetics. (*and Other Methods). Version 4. Sinauer Associates, Sunderland, In: Innis MA, Gelfand DH, Sninsky JJ, White TJ (eds), PCR Pro- Massachusetts. tocols: a guide to methods and applications. Academic Press, New Tancinov a D, Barborakov a1 Z, Maskov a1 Z, Cısarova1 M, York, U.S.A., pp. 315e322. Bojnansk a T, 2012. The occurrence of micromycetes in the Zalar P, de Hoog GS, Schroers HJ, Crous PW, Groenewald JZ, bread samples and their potential ability produces myco- Gunde-Cimerman N, 2007. Phylogeny and ecology of the toxins. Journal of Microbiology, Biotechnology and Food Sciences 1: ubiquitous saprobe Cladosporium sphaerospermum, with de- 813e818. scriptions of seven new species from hypersaline environ- Taylor JW, Jacobson DJ, Kroken S, Kasuga T, Geiser DM, ments. Studies in Mycology 58: 157e183. Hibbett DS, Fisher MC, 2000. Phylogenetic species recognition